Processes for producing ethanol and yeast
10036043 ยท 2018-07-31
Assignee
Inventors
- Katie Shihadeh (Raleigh, NC, US)
- Jeremy Saunders (Raleigh, NC, US)
- Joyce Craig (Pittsboro, NC, US)
- Mark Stevens (Kittrell, NC, US)
- Jennifer Headman (Franklinton, NC, US)
- Bernardo Vidal, JR. (Wake Forest, NC, US)
- John Matthews (Louisburg, NC, US)
- Suzanne Clark (Youngsville, NC)
- Paul Victor Attfield (Sydney, AU)
- Phillip John Livingstone Bell (Sydney, AU)
- Michael Akerman (Wake Forest, NC, US)
Cpc classification
Y02E50/10
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12P7/14
CHEMISTRY; METALLURGY
International classification
C12P7/14
CHEMISTRY; METALLURGY
Abstract
The present invention relates to processes for producing ethanol from starch-containing material by liquefying the starch-containing material at a temperature above the initial gelatinization temperature using an alpha-amylase; saccharifying using a glucoamylase and fermenting using a Saccharomyces cerevisiae yeast strain deposited under Accession No. V14/004037 at National Measurement Institute, Victoria, Australia) or a fermenting organism strain having properties that are about the same as that of the deposited Saccharomyces cerevisiae strain or a derivative of Saccharomyces strain V14/004037 having the defining characteristics of strain V14/004037. The invention also relates to a Saccharomyces yeast strain deposited under the Budapest Treaty and having NMI accession no. V14/004037 or a derivative of strain V14/004037 which exhibits one or more defining characteristics of strain V14/004037. The invention also relates to a process of recovering/extracting oil from an ethanol process of the invention using a Saccharomyces strain of the invention and compositions comprising a Saccharomyces yeast strain of the invention and naturally occurring and/or non-naturally occurring components.
Claims
1. A Saccharomyces yeast strain deposited under the Budapest Treaty and having NMI accession no. V14/004037 (Saccharomyces cerevisiae MBG4851).
2. A composition comprising a Saccharomyces yeast strain of claim 1, and one or more naturally occurring and/or non-naturally occurring components selected from the group consisting of: surfactants, emulsifiers, gums, swelling agents, and antioxidants.
3. A process for producing ethanol from starch-containing material comprising the steps of: i) liquefying the starch-containing material at a temperature above the initial gelatinization temperature using an alpha-amylase; ii) saccharifying using a glucoamylase; and iii) fermenting using the Saccharomyces yeast strain of claim 1.
4. The process of claim 3, wherein 100 to 600 ppm urea is added in saccharification step ii) or fermentation step iii) or added during simultaneous saccharification and fermentation (SSF) of steps ii) and iii).
5. The process of claim 3, wherein a protease is added in saccharification step ii) or fermentation step iii) or added during simultaneous saccharification and fermentation (SSF) of steps ii) and iii).
6. A method of producing ethanol, comprising incubating the yeast strain of claim 1 with a substrate comprising a fermentable sugar under conditions which permit fermentation of the fermentable sugar to produce ethanol.
7. A method of producing distiller's grain, comprising: (a) incubating the yeast strain of claim 1 with a substrate comprising fermentable sugar under conditions which allow fermentation of the fermentable sugar to produce ethanol and distiller's grains; (b) isolating the distiller's grains.
8. A process of recovering/extracting oil from an ethanol fermentation product production process comprising the steps of: i) liquefying starch-containing material at a temperature above the initial gelatinization temperature using an alpha-amylase; ii) saccharifying using a glucoamylase; iii) fermenting using a fermenting organism; iv) recovering the fermentation product to form whole stillage; v) separating the whole stillage into thin stillage and wet cake; vi) optionally concentrating the thin stillage into syrup; wherein oil is recovered/extracted downstream from fermentation step iii) and wherein the fermenting organism is the Saccharomyces yeast strain of claim 5.
Description
BRIEF DESCRIPTION OF THE DRAWING
(1)
(2)
(3)
(4)
(5)
DETAILED DESCRIPTION OF THE INVENTION
(6) Processes of the Invention
(7) In this aspect the present invention relates to producing ethanol from starch-containing material in a process including liquefaction, saccharification and fermentation. Fermentable sugars generated during saccharification are converted to ethanol during fermentation by yeast.
(8) In the first aspect the invention relates to processes for producing ethanol from starch-containing material comprising the steps of:
(9) i) liquefying the starch-containing material at a temperature above the initial gelatinization temperature using an alpha-amylase;
(10) ii) saccharifying using a glucoamylase;
(11) iii) fermenting using a fermenting organism;
(12) wherein the fermenting organism is Saccharomyces cerevisiae MBG4851 (deposited under Accession No. V14/004037 at National Measurement Institute, Victoria, Australia) or a fermenting organism strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or a derivative of Saccharomyces strain V14/004037 having defining characteristics of strain V14/004037
(13) Steps ii) and iii) are carried out either sequentially or simultaneously (SSF). In a preferred embodiment steps ii) and iii) are carried out simultaneously (SSF).
(14) Nitrogens-Source Added During Fermentation
(15) Generally fermenting organisms such as yeast, including Saccharomyces cerevisiae yeast, require an adequate source of nitrogen for propagation and fermentation. Many sources of nitrogen can be used and such sources of nitrogen are well known in the art. According to the invention the nitrogen source may be organic, such as urea, DDGs, wet cake or corn mash, or inorganic, such as ammonia or ammonium hydroxide. In a preferred embodiment the nitrogen source is urea.
(16) In an embodiment of the invention, less than 3,000 ppm, such as less than 2,000 ppm, such as less than 1,000 ppm, such as less than 800 ppm, such as less than 600 ppm, such as less than 500 ppm, such as less than 400 ppm, such as less than 300 ppm, such as less than 200 ppm, such as less than 100 ppm nitrogen source, especially urea, may be added in saccharification and/or fermentation or SSF.
(17) In a preferred embodiment from 100 to 600 ppm nitrogen source, such as urea, may be added in saccharification and/or fermentation or simultaneous saccharification and fermentation (SSF).
(18) In an embodiment of the invention no nitrogen source, such as urea, is added in saccharification and/or fermentation or SSF.
(19) The inventors have surprisingly found that when using the Saccharomyces MBG4851 yeast there is a reduced need for adding a supplementing nitrogen source, such as urea, in fermentation or SSF compared to using the industry standard yeast Ethanol Red (ER). For instance, when the MBG4851 yeast was used in mash liquefied with the addition of 3 g PfuS/g DS, no added urea is required to ferment to dryness. In addition, the MBG4851 yeast provided at least a 1% increase in ethanol yield over Ethanol Red yeast. This is described in the Examples below.
(20) Reduced Lactic Acid Generated
(21) The inventors also found that when using the Saccharomyces MBG4851 yeast in liquefied mash an approximately 15-20% reduction in lactic acid accumulation during fermentation was obtained. This would help reduce a number of problems that ethanol plants experience and would increase the ethanol yield. The working examples below show that fermentations of different alpha-amylase liquefied mashes give lower lactic acid at fermentation finish when using MBG4851 yeast compared to fermentations using the industry standard yeast Ethanol Red (ER).
(22) Reduced Glycerol
(23) The inventors have also surprisingly found that fermentation with MBG4851 yeast resulted in reduced glycerol levels compared to Ethanol Red (ER). For instance, the glycerol level was reduced by at least 10% when comparing MBG4851 to Ethanol Red (ER) after 54 hours fermentation of corn mash liquefied with alpha-amylase when between 0 to 3,000 ppm urea were present in fermentation (See Example 31). Generally the working examples below show that fermentations of mashes prepared with different alpha-amylases give lower glycerol levels at fermentation finish when using MBG4851 yeast compared to fermentations using the industry standard yeast Ethanol Red (ER).
(24) Reduced Acetaldehyde Level
(25) The inventors have surprisingly found that fermentation with MBG4851 yeast results in a reduced acetaldehyde level in fermentation compared to when fermenting with Ethanol Red (ER) at the same conditions. This enables reduction of added chemicals needed to mitigate high acetaldehyde levels. Example 39 below shows that reduced acetaldehyde accumulation is found in mash liquefied using alpha-amylase, glucoamylase and protease when using MBG4851 compared to Ethanol Red (ER). Specifically, Example 39 shows a 52% reduction in the acetaldehyde level when using MBG4851 compared to Ethanol Red (ER).
(26) Increased Oil Yield
(27) The inventors have surprisingly found that fermentation with MBG4851 yeast results in increased oil yield when compared to Ethanol Red (ER). When additionally a protease, such as a metallo protease derived from a strain of the genus Thermoascus, is added to fermentation the yield increases even more. Therefore, in an embodiment of the invention a protease is added in saccharification and/or fermentation or SSF. Example 40 shows that the oil yield during corn mash fermentation was increased by almost 20%. When a protease was added more than 45% increase was observed compared to fermentation using Ethanol Red, i.e., no protease. If a protease was already present approximately 20% more oil could be obtained.
(28) Liquefaction Step i)
(29) According to processes of the invention liquefaction in step i) may be carried out by subjecting starch-containing material at a temperature above the initial gelatinization temperature to an alpha-amylase and optionally a protease, and/or a glucoamylase. Other enzymes such as a pullulanase and phytase may also be present and/or added in liquefaction.
(30) Liquefaction step i) may be carried out for 0.5-5 hours, such as 1-3 hours, such as typically around 2 hours.
(31) The term initial gelatinization temperature means the lowest temperature at which gelatinization of the starch-containing material commences. In general, starch heated in water begins to gelatinize between about 50 C. and 75 C.; the exact temperature of gelatinization depends on the specific starch and can readily be determined by the skilled artisan. Thus, the initial gelatinization temperature may vary according to the plant species, to the particular variety of the plant species as well as with the growth conditions. In the context of this invention the initial gelatinization temperature of a given starch-containing material may be determined as the temperature at which birefringence is lost in 5% of the starch granules using the method described by Gorinstein and Lii, 1992, Starch/Strke 44(12): 461-466.
(32) According to the invention liquefaction is typically carried out at a temperature in the range from 70-100 C. In an embodiment the temperature in liquefaction is between 75-95 C., such as between 75-90 C., preferably between 80-90 C., such as 82-88 C., such as around 85 C.
(33) According to the invention a jet-cooking step may be carried out prior to liquefaction in step i). The jet-cooking may be carried out at a temperature between 110-145 C., preferably 120-140 C., such as 125-135 C., preferably around 130 C. for about 1-15 minutes, preferably for about 3-10 minutes, especially around about 5 minutes.
(34) The pH during liquefaction may be between 4-7, such as between pH 4.5-6.5, such as between pH 5.0-6.5, such as between pH 5.0-6.0, such as between pH 5.2-6.2, such as around 5.2, such as around 5.4, such as around 5.6, such as around 5.8.
(35) In an embodiment, the process of the invention further comprises, prior to the step i), the steps of:
(36) a) reducing the particle size of the starch-containing material, preferably by dry milling;
(37) b) forming a slurry comprising the starch-containing material and water.
(38) The starch-containing starting material, such as whole grains, may be reduced in particle size, e.g., by milling, in order to open up the structure, to increase surface area, and allowing for further processing. Generally there are two types of processes: wet and dry milling. In dry milling whole kernels are milled and used. Wet milling gives a good separation of germ and meal (starch granules and protein). Wet milling is often applied at locations where the starch hydrolysate is used in production of, e.g., syrups. Both dry milling and wet milling are well known in the art of starch processing. According to the present invention dry milling is preferred.
(39) In an embodiment the particle size is reduced to between 0.05 to 3.0 mm, preferably 0.1-0.5 mm, or so that at least 30%, preferably at least 50%, more preferably at least 70%, even more preferably at least 90% of the starch-containing material fit through a sieve with a 0.05 to 3.0 mm screen, preferably 0.1-0.5 mm screen. In another embodiment at least 50%, preferably at least 70%, more preferably at least 80%, especially at least 90% of the starch-containing material fit through a sieve with #6 screen.
(40) The aqueous slurry may contain from 10-55 w/w-% dry solids (DS), preferably 25-45 w/w-% dry solids (DS), more preferably 30-40 w/w-% dry solids (DS) of starch-containing material.
(41) The alpha-amylase, optionally a protease, optionally a glucoamylase may initially be added to the aqueous slurry to initiate liquefaction (thinning). In an embodiment only a portion of the enzymes (e.g., about ) is added to the aqueous slurry, while the rest of the enzymes (e.g., about ) are added during liquefaction step i).
(42) A non-exhaustive list of examples of alpha-amylases can be found below in the Alpha-Amylase Present and/or Added During Liquefaction-section. In an embodiment the alpha-amylase is a bacterial alpha-amylase. Bacterial alpha-amylases are typically thermostable. In a preferred embodiment the alpha-amylase is from the genus Bacillus, such as a strain of Bacillus stearothermophilus, in particular a variant of a Bacillus stearothermophilus alpha-amylase, such as the one shown in SEQ ID NO: 3 in WO 99/019467 or SEQ ID NO: 1 herein.
(43) In an embodiment the alpha-amylase has an improved stability compared to a reference alpha-amylase (Bacillus stearothermophilus alpha-amylase with the mutations I181*+G182*, optionally with a N193F substitution, truncated to around 491 amino acids, i.e., from 480-495 amino acids, (using SEQ ID NO: 1 herein for numbering) determined by incubating the reference alpha-amylase and variants at pH 4.5 and 5.5 and temperatures of 75 C. and 85 C. with 0.12 mM CaCl.sub.2 followed by residual activity determination using the EnzChek substrate (EnzChek Ultra Amylase assay kit, E33651, Molecular Probes). This is described in Example 1.
(44) Examples of suitable Bacillus stearothermophilus alpha-amylase variants can be found below in the Thermostable Alpha-Amylase-section and include one from the following group of Bacillus stearothermophilus alpha-amylase variants with the following mutations:
(45) I181*+G182*+N193F+E129V+K177L+R179E;
(46) I181*+G182*+N193F+V59A+Q89R+E129V+K177L+R179E+H208Y+K220P+N224L+Q254S;
(47) I181*+G182*+N193F+V59A+Q89R+E129V+K177L+R179E+Q254S+M284V;
(48) I181*+G182*+N193F+V59A+E129V+K177L+R179E+Q254S+M284V; and
(49) I181*+G182*+N193F+E129V+K177L+R179E+K220P+N224L+S242Q+Q254S (using SEQ ID NO: 1 for numbering).
(50) Examples of other suitable Bacillus stearothermophilus alpha-amylases having increased thermostability compared to a reference alpha-amylase (Bacillus stearothermophilus alpha-amylase with the mutations I181*+G182*+N193F truncated to 491 amino acids) at pH 4.5 and 5.5, 0.12 mM CaCl.sub.2 can be found in WO 2011/082425 hereby incorporated by reference. (See also Example 1 below)
(51) According to processes of the invention, liquefaction in step i) may be carried out using a combination of alpha-amylase and protease. The protease may be a protease having a thermostability value of more than 20% determined as Relative Activity at 80 C./70 C. determined as described in Example 1 (Relative Activity). Examples of suitable proteases are described below in the section Protease Present and/or Added During Liquefaction.
(52) The protease may be of fungal origin, such as of filamentous fungus origin. Specific examples of suitable fungal proteases are protease variants of metallo protease derived from a strain of the genus Thermoascus, preferably a strain of Thermoascus aurantiacus, especially the strain Thermoascus aurantiacus CGMCC No. 0670 disclosed as the mature part of SEQ ID NO. 2 disclosed in WO 2003/048353 or the mature part of SEQ ID NO: 1 in WO 2010/008841 or SEQ ID NO: 3 herein with the following mutations:
(53) D79L+S87P+A112P+D142L:
(54) D79L+S87P+D142L; or
(55) A27K+D79L+Y82F+S87G+D104P+A112P+A126V+D142L.
(56) More examples of suitable variants of the Thermoascus aurantiacus protease can be found in WO 2011/072191 hereby incorporated by reference (See also Example 2 below).
(57) Suitable proteases also include bacterial proteases. A suitable bacterial protease may be derived from a strain of Pyrococcus, preferably a strain of Pyrococcus furiosus. In a preferred embodiment the protease is the one shown in SEQ ID NO: 1 in U.S. Pat. No. 6,358,726 or SEQ ID NO: 13 herein.
(58) In an embodiment of the invention the alpha-amylase and/or protease, added in the liquefaction step i), is/are further combined with a glucoamylase. Thus, a glucoamylase may also be present and/or added during liquefaction step i). The glucoamylase is preferably thermostable. This means that the glucoamylase has a heat stability at 85 C., pH 5.3, of at least 20%, such as at least 30%, preferably at least 35% determined as described in Example 4 (heat stability). In an embodiment the glucoamylase present and/or added in liquefaction has a relative activity pH optimum at pH 5.0 of at least 90%, preferably at least 95%, preferably at least 97%. In an embodiment the glucoamylase has a pH stability at pH 5.0 of at least at least 80%, at least 85%, at least 90% determined as described in Example 4 (pH stability).
(59) A suitable glucoamylase present and/or added in liquefaction step i) may according to the invention be derived from a strain of the genus Penicillium, especially a strain of Penicillium oxalicum disclosed as SEQ ID NO: 2 in WO 2011/127802 or SEQ ID NOs: 9 or 14 herein. In a preferred embodiment the glucoamylase is a variant of the Penicillium oxalicum glucoamylase shown in SEQ ID NO: 2 in WO 2011/127802 having a K79V substitution (using the mature sequence shown in SEQ ID NO: 14 herein for numbering), such as a variant disclosed in WO 2013/053801. In a preferred embodiment the Penicillium oxalicum glucoamylase has a K79V substitution (using SEQ ID NO: 14 for numbering) and further one of the following:
(60) P11F+T65A+Q327F;
(61) P2N+P4S+P11F+T65A+Q327F (using SEQ ID NO: 14 for numbering).
(62) Examples of other suitable Penicillium oxalicum glucoamylase variants can be found in WO 2013/053801 incorporated by reference (see also Examples 10-16 below, such as the Penicillium oxalicum glucoamylase variants in Table 15).
(63) Further, according to the process of the invention also a pullulanase may be present during liquefaction in combination with an alpha-amylase, a protease and/or a glucoamylase.
(64) Saccharification and Fermentation
(65) A glucoamylase is present and/or added in saccharification step ii) and/or fermentation step iii) or simultaneous saccharification and fermentation (SSF). The glucoamylase added in saccharification step ii) and/or fermentation step iii) or simultaneous saccharification and fermentation (SSF) is typically different from the glucoamylase, optionally added in liquefaction step i). In a preferred embodiment the glucoamylase is added together with a fungal alpha-amylase. Examples of glucoamylases can be found in the Glucoamylases Present and/or Added In Saccharification and/or Fermentation-section below.
(66) When doing sequential saccharification and fermentation, saccharification step ii) may be carried out at conditions well-known in the art. For instance, the saccharification step ii) may last up to from about 24 to about 72 hours. In an embodiment pre-saccharification is done. Pre-saccharification is typically done for 40-90 minutes at a temperature between 30-65 C., typically about 60 C. Pre-saccharification is in an embodiment followed by saccharification during fermentation in simultaneous saccharification and fermentation (SSF). Saccharification is typically carried out at temperatures from 20-75 C., preferably from 40-70 C., typically around 60 C., and at a pH between 4 and 5, normally at about pH 4.5.
(67) Simultaneous saccharification and fermentation (SSF) is widely used in industrial scale fermentation product production processes, especially ethanol production processes. When doing SSF the saccharification step ii) and the fermentation step iii) are carried out simultaneously. There is no holding stage for the saccharification, meaning that a fermenting organism, such as yeast, and enzyme(s), may be added together. However, it is also contemplated to add the fermenting organism and enzyme(s) separately. SSF is according to the invention typically carried out at a temperature from 25 C. to 40 C., such as from 28 C. to 35 C., such as from 30 C. to 34 C., preferably around about 32 C. In an embodiment fermentation is ongoing for 6 to 120 hours, in particular 24 to 96 hours. In an embodiment the pH is between 4-5.
(68) In an embodiment of the invention a cellulolytic composition is present and/or added in saccharification, fermentation or simultaneous saccharification and fermentation (SSF). Examples of such cellulolytic compositions can be found in the Cellulolytic Composition present and/or added during Saccharification and/or Fermentation-section below. The cellulolytic composition is present and/or added together with a glucoamylase, such as one disclosed in the Glucoamylase Present And/Or Added in Saccharification and/or Fermentation-section below.
(69) Starch-Containing Materials
(70) According to the invention any suitable starch-containing starting material may be used. The starting material is generally selected based on the desired fermentation product, here ethanol. Examples of starch-containing starting materials, suitable for use in processes of the present invention, include cereal, tubers or grains. Specifically the starch-containing material may be corn, wheat, barley, rye, milo, sago, cassava, tapioca, sorghum, oat, rice, peas, beans, or sweet potatoes, or mixtures thereof. Contemplated are also waxy and non-waxy types of corn and barley.
(71) In a preferred embodiment the starch-containing starting material is corn.
(72) In a preferred embodiment the starch-containing starting material is wheat.
(73) In a preferred embodiment the starch-containing starting material is barley.
(74) In a preferred embodiment the starch-containing starting material is rye.
(75) In a preferred embodiment the starch-containing starting material is milo.
(76) In a preferred embodiment the starch-containing starting material is sago.
(77) In a preferred embodiment the starch-containing starting material is cassava.
(78) In a preferred embodiment the starch-containing starting material is tapioca.
(79) In a preferred embodiment the starch-containing starting material is sorghum.
(80) In a preferred embodiment the starch-containing starting material is rice,
(81) In a preferred embodiment the starch-containing starting material is peas.
(82) In a preferred embodiment the starch-containing starting material is beans.
(83) In a preferred embodiment the starch-containing starting material is sweet potatoes.
(84) In a preferred embodiment the starch-containing starting material is oats.
(85) Fermentation
(86) Fermentation is carried out in a fermentation medium. The fermentation medium includes the fermentation substrate, that is, the carbohydrate source that is metabolized by the fermenting organism. According to the invention the fermentation medium may comprise nutrients and growth stimulator(s) for the fermenting organism(s). Nutrient and growth stimulators are widely used in the art of fermentation and include nitrogen sources, such as ammonia; urea, vitamins and minerals, or combinations thereof.
(87) Fermenting Organisms
(88) Saccharomyces cerevisiae MBG4851 (deposited under Accession No. V14/004037 at National Measurement Institute, Victoria, Australia) or a fermenting organism strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or defining characteristics of Saccharomyces cerevisiae MBG4851 is used in a process of the invention.
(89) In an embodiment the fermenting organism strain has properties that are about the same as that of Saccharomyces cerevisiae MBG4851 as it provides an increase in ethanol yield compared to Ethanol Red (ER) under the same process conditions.
(90) In an embodiment the fermenting organism strain has properties that are about the same as that of Saccharomyces cerevisiae MBG4851 as it provides an increase in ethanol yield compared to Ethanol Red (ER) under the same conditions where no urea is present and/or added in simultaneous saccharification and fermentation (SSF).
(91) In an embodiment the fermenting organism strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851, as it produces reduced levels of lactic acid compared to Ethanol Red under the same process conditions.
(92) In an embodiment the fermenting organism strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851, as it produces reduced levels of glycerol compared to Ethanol Red under the same process conditions.
(93) In an embodiment the fermenting organism strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851, reduces the level of acetaldehyde in fermentation compared to Ethanol Red under the same process condition.
(94) In an embodiment the fermenting organism strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851, increases the oil yield compared to Ethanol Red under the same process conditions.
(95) In an embodiment the fermenting organism strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851, as it has faster fermentation kinetics compared to Ethanol Red under the same process conditions.
(96) In an embodiment the fermenting organism strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 has one or more, such as all, of the following properties and defining characteristics: increases ethanol yield compared to Ethanol Red under the same process conditions; produces reduced levels of lactic acid compared to Ethanol Red under the same process conditions; produces reduced levels of glycerol compared to Ethanol Red under the same process conditions; reduces the level of acetaldehyde in fermentation compared to Ethanol Red under the same process condition; increases the oil yield compared to Ethanol Red under the same process conditions; has faster fermentation kinetics compared to Ethanol Red under the same process conditions.
(97) In an embodiment of the invention the fermenting organism strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 provides an ethanol yield boost over Ethanol Red (ER) of more than 1.0% at 0 ppm urea and at a Protease Pfu dose of 3 g EP/gDS (added in liquefaction), such as more than 1.5% at 0 ppm urea and at a Pfu dose of 1.5 g EP/gDS, such as more than 4.0% at 0 ppm urea and at a Protease Pfu dose of 0.0385 g EP/gDS when determined using the process set-up and conditions used in Example 19.
(98) In an embodiment of the invention the fermenting organism strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 provides an ethanol yield boost of more than 1.0% at urea levels of 300 ppm, such as more than 3.0% at urea levels of 150 ppm, such as more than 10.0% at urea levels of 0 ppm over Ethanol Red when determined using the process set-up and conditions used in Example 21.
(99) In an embodiment of the invention the fermenting organism strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 provides a reduction in lactic acid in a 54 hours fermentation of more than 50% at urea levels of 0 ppm and at a Protease Pfu dose of 0.0385 g/g DS (added in liquefaction), such as more than 50% at urea levels of 0 ppm and a Protease Pfu dose of 3 g/gDS over Ethanol Red when determined using the process set-up and conditions used in Example 23.
(100) In an embodiment of the invention the fermenting organism strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 provides a reduction in glycerol levels in a 60 hours fermentation of more than 2.0% such as more than 3.0%, such as more than 4.0% over Ethanol Red (ER) when determined using the process set-up and conditions used in Example 34.
(101) In an embodiment of the invention the fermenting organism strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 provides a reduction in the acetaldehyde level, in a 54 hours fermentation, of more than 30%, such as more than 40%, such as more than 50% over Ethanol Red (ER) when determined using the process set-up and conditions used in Example 39.
(102) In an embodiment of the invention the fermenting organism strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or defining characteristics thereof provides an increase in oil yield, after 64 hours fermentation, of more than 10%, such as more than 12%, such as more than 14%, such as more than 16%, such as more than 18%, such as more than 20%, such as between 10-20%, such as between 10-15%, such as between 15-20% over Ethanol Red (ER) when determined using the process set-up and conditions used in Example 40.
(103) Recovery
(104) Subsequent to fermentation, e.g., SSF, the ethanol may be separated from the fermentation medium. The slurry may be distilled to recover/extract the desired fermentation product (i.e., ethanol). Alternatively the desired fermentation product (i.e., ethanol) may be extracted from the fermentation medium by micro or membrane filtration techniques. The fermentation product (i.e., ethanol) may also be recovered by stripping or other method well known in the art.
(105) In an embodiment the invention relates to processes of recovering/extracting oil from an ethanol production process of the invention comprising the steps of: i) liquefying starch-containing material at a temperature above the initial gelatinization temperature using an alpha-amylase; ii) saccharifying using a glucoamylase; iii fermenting using a fermenting organism. iv) recovering the fermentation product to form whole stillage; v) separating the whole stillage into thin stillage and wet cake; vi) optionally concentrating the thin stillage into syrup;
wherein oil is recovered/extracted downstream from fermentation step iii) and wherein the fermenting organism is Saccharomyces cerevisiae MBG4851 (deposited under Accession No. V14/004037 at National Measurement Institute, Victoria, Australia) or a fermenting organism strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or a derivative of Saccharomyces strain V14/004037 having defining characteristics of strain V14/004037.
(106) In a preferred embodiment the oil is recovered/extracted from the thin stillage. In a preferred embodiment the oil is recovered/extracted from the syrup/evaporated centrate.
(107) In an embodiment protease is added in saccharification and/or fermentation or SSF.
(108) In an embodiment the invention concerns processes of recovering/extracting oil from an ethanol production process comprising the steps of:
(109) i) liquefying starch-containing material at a temperature above the initial gelatinization temperature using:
(110) Bacillus stearothermophilus alpha-amylase;
(111) optionally a Pyrococcus furiosus protease;
(112) optionally Penicillium oxalicum glucoamylase;
(113) ii) saccharifying using a glucoamylase;
(114) iii) fermenting using a fermenting organism.
(115) iv) recovering the fermentation product to form whole stillage;
(116) v) separating the whole stillage into thin stillage and wet cake;
(117) vi) optionally concentrating the thin stillage into syrup;
(118) wherein oil is recovered/extracted downstream from fermentation step iii) and wherein the fermenting organism is Saccharomyces cerevisiae MBG4851 (deposited under Accession No. V14/004037 at National Measurement Institute, Victoria, Australia) or a fermenting organism strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or a derivative of Saccharomyces strain V14/004037 having defining characteristics of strain V14/004037.
(119) In an embodiment a protease is added in saccharification and/or fermentation or SSF.
(120) Alpha-Amylase Present and/or Added in Liquefaction
(121) According to the invention an alpha-amylase is present and/or added in liquefaction optionally together with a protease and/or glucoamylase, and/or optional pullulanase.
(122) The alpha-amylase added in liquefaction step i) may be any alpha-amylase. Preferred are bacterial alpha-amylases, which typically are stable at temperature, used during liquefaction.
(123) Bacterial Alpha-Amylase
(124) The term bacterial alpha-amylase means any bacterial alpha-amylase classified under EC 3.2.1.1. A bacterial alpha-amylase used according to the invention may, e.g., be derived from a strain of the genus Bacillus, which is sometimes also referred to as the genus Geobacillus. In an embodiment the Bacillus alpha-amylase is derived from a strain of Bacillus amyloliquefaciens, Bacillus licheniformis, Bacillus stearothermophilus, or Bacillus subtilis, but may also be derived from other Bacillus sp.
(125) Specific examples of bacterial alpha-amylases include the Bacillus stearothermophilus alpha-amylase of SEQ ID NO: 3 in WO 99/19467, the Bacillus amyloliquefaciens alpha-amylase of SEQ ID NO: 5 in WO 99/19467, and the Bacillus licheniformis alpha-amylase of SEQ ID NO: 4 in WO 99/19467 or SEQ ID NO: 21 herein (all sequences are hereby incorporated by reference). In an embodiment the alpha-amylase may be an enzyme having a degree of identity of at least 60%, e.g., at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% to any of the sequences shown in SEQ ID NOS: 3, 4 or 5, respectively, in WO 99/19467.
(126) In an embodiment the alpha-amylase may be an enzyme having a degree of identity of at least 60%, e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% to any of the sequences shown in SEQ ID NO: 3 in WO 99/19467 or SEQ ID NO: 1 herein.
(127) In a preferred embodiment the alpha-amylase is derived from Bacillus stearothermophilus. The Bacillus stearothermophilus alpha-amylase may be a mature wild-type or a mature variant thereof. The mature Bacillus stearothermophilus alpha-amylases may naturally be truncated during recombinant production. For instance, the Bacillus stearothermophilus alpha-amylase may be a truncated so it has around 491 amino acids, e.g., so it lacks a functional starch binding domain (compared to SEQ ID NO: 3 in WO 99/19467) or SEQ ID NO: 1 herein.
(128) The Bacillus alpha-amylase may also be a variant and/or hybrid. Examples of such a variant can be found in any of WO 96/23873, WO 96/23874, WO 97/41213, WO 99/19467, WO 00/60059, and WO 02/10355 (all documents are hereby incorporated by reference). Specific alpha-amylase variants are disclosed in U.S. Pat. Nos. 6,093,562, 6,187,576, 6,297,038, and 7,713,723 (hereby incorporated by reference) and include Bacillus stearothermophilus alpha-amylase (often referred to as BSG alpha-amylase) variants having a deletion of one or two amino acids at positions R179, G180, I181 and/or G182, preferably a double deletion disclosed in WO 96/23873see, e.g., page 20, lines 1-10 (hereby incorporated by reference), preferably corresponding to deletion of positions I181 and G182 compared to the amino acid sequence of Bacillus stearothermophilus alpha-amylase set forth in SEQ ID NO: 3 disclosed in WO 99/19467 or SEQ ID NO: 1 herein or the deletion of amino acids R179 and G180 using SEQ ID NO: 3 in WO 99/19467 or SEQ ID NO: 1 herein for numbering (which reference is hereby incorporated by reference). Even more preferred are Bacillus alpha-amylases, especially Bacillus stearothermophilus alpha-amylases, which have a double deletion corresponding to a deletion of positions 181 and 182 and further comprise a N193F substitution (also denoted I181*+G182*+N193F) compared to the wild-type BSG alpha-amylase amino acid sequence set forth in SEQ ID NO: 3 disclosed in WO 99/19467 or SEQ ID NO: 1 herein. The bacterial alpha-amylase may also have a substitution in a position corresponding to S239 in the Bacillus licheniformis alpha-amylase shown in SEQ ID NO: 4 in WO 99/19467 or SEQ ID NO: 21 herein, or a S242 and/or E188P variant of the Bacillus stearothermophilus alpha-amylase of SEQ ID NO: 3 in WO 99/19467 or SEQ ID NO: 1 herein.
(129) In an embodiment the variant is a S242A, E or Q variant, preferably a S242Q variant, of the Bacillus stearothermophilus alpha-amylase (using SEQ ID NO: 1 herein for numbering).
(130) In an embodiment the variant is a position E188 variant, preferably E188P variant of the Bacillus stearothermophilus alpha-amylase (using SEQ ID NO: 1 herein for numbering).
(131) The bacterial alpha-amylase may in an embodiment be a truncated Bacillus alpha-amylase. Especially the truncation is so that, e.g., the Bacillus stearothermophilus alpha-amylase shown in SEQ ID NO: 3 in WO 99/19467 or SEQ ID NO: 1 herein, is around 491 amino acids long, such as from 480 to 495 amino acids long, or so it lack a functional starch bind domain.
(132) Bacterial Hybrid Alpha-Amylases
(133) The bacterial alpha-amylase may also be a hybrid bacterial alpha-amylase, e.g., an alpha-amylase comprising 445 C-terminal amino acid residues of the Bacillus licheniformis alpha-amylase (shown in SEQ ID NO: 4 of WO 99/19467) and the 37 N-terminal amino acid residues of the alpha-amylase derived from Bacillus amyloliquefaciens (shown in SEQ ID NO: 5 of WO 99/19467). In a preferred embodiment this hybrid has one or more, especially all, of the following substitutions:
(134) G48A+T49I+G107A+H156Y+A181T+N190F+1201F+A209V+Q264S (using the Bacillus licheniformis numbering in SEQ ID NO: 4 of WO 99/19467) or SEQ ID NO: 21 herein. Also preferred are variants having one or more of the following mutations (or corresponding mutations in other Bacillus alpha-amylases): H154Y, A181T, N190F, A209V and Q264S and/or the deletion of two residues between positions 176 and 179, preferably the deletion of E178 and G179 (using SEQ ID NO: 5 of WO 99/19467 for position numbering).
(135) In an embodiment the bacterial alpha-amylase is the mature part of the chimeric alpha-amylase disclosed in Richardson et al. (2002), The Journal of Biological Chemistry, Vol. 277, No 29, Issue 19 July, pp. 267501-26507, referred to as BD5088 or a variant thereof. This alpha-amylase is the same as the one shown in SEQ ID NO: 2 in WO 2007134207. The mature enzyme sequence starts after the initial Met amino acid in position 1.
(136) Thermostable Alpha-Amylase
(137) According to the invention the alpha-amylase may be a thermostable alpha-amylase, such as a thermostable bacterial alpha-amylase, preferably from Bacillus stearothermophilus. In an embodiment the alpha-amylase used according to the invention has a T (min) at pH 4.5, 85 C., 0.12 mM CaCl.sub.2 of at least 10 determined as described in Example 1.
(138) In an embodiment the thermostable alpha-amylase has a T (min) at pH 4.5, 85 C., 0.12 mM CaCl.sub.2, of at least 15.
(139) In an embodiment the thermostable alpha-amylase has a T (min) at pH 4.5, 85 C., 0.12 mM CaCl.sub.2, of as at least 20.
(140) In an embodiment the thermostable alpha-amylase has a T (min) at pH 4.5, 85 C., 0.12 mM CaCl.sub.2, of as at least 25.
(141) In an embodiment the thermostable alpha-amylase has a T (min) at pH 4.5, 85 C., 0.12 mM CaCl.sub.2, of as at least 30.
(142) In an embodiment the thermostable alpha-amylase has a T (min) at pH 4.5, 85 C., 0.12 mM CaCl.sub.2, of as at least 40.
(143) In an embodiment the thermostable alpha-amylase has a T (min) at pH 4.5, 85 C., 0.12 mM CaCl.sub.2, of at least 50.
(144) In an embodiment the thermostable alpha-amylase has a T (min) at pH 4.5, 85 C., 0.12 mM CaCl.sub.2, of at least 60.
(145) In an embodiment the thermostable alpha-amylase has a T (min) at pH 4.5, 85 C., 0.12 mM CaCl.sub.2, between 10-70.
(146) In an embodiment the thermostable alpha-amylase has a T (min) at pH 4.5, 85 C., 0.12 mM CaCl.sub.2, between 15-70.
(147) In an embodiment the thermostable alpha-amylase has a T (min) at pH 4.5, 85 C., 0.12 mM CaCl.sub.2, between 20-70.
(148) In an embodiment the thermostable alpha-amylase has a T (min) at pH 4.5, 85 C., 0.12 mM CaCl.sub.2, between 25-70.
(149) In an embodiment the thermostable alpha-amylase has a T (min) at pH 4.5, 85 C., 0.12 mM CaCl.sub.2, between 30-70.
(150) In an embodiment the thermostable alpha-amylase has a T (min) at pH 4.5, 85 C., 0.12 mM CaCl.sub.2, between 40-70.
(151) In an embodiment the thermostable alpha-amylase has a T (min) at pH 4.5, 85 C., 0.12 mM CaCl.sub.2, between 50-70.
(152) In an embodiment the thermostable alpha-amylase has a T (min) at pH 4.5, 85 C., 0.12 mM CaCl.sub.2, between 60-70.
(153) In an embodiment of the invention the alpha-amylase is an bacterial alpha-amylase, preferably derived from the genus Bacillus, especially a strain of Bacillus stearothermophilus, in particular the Bacillus stearothermophilus as disclosed in WO 99/019467 as SEQ ID NO: 3 (SEQ ID NO: 1 herein) with one or two amino acids deleted at positions R179, G180, I181 and/or G182, in particular with R179 and G180 deleted, or with I181 and G182 deleted, with mutations in below list of mutations.
(154) In preferred embodiments the Bacillus stearothermophilus alpha-amylases have double deletion I181+G182, and optional substitution N193F, further comprising mutations selected from below list:
(155) V59A+Q89R+G112D+E129V+K177L+R179E+K220P+N224L+Q254S;
(156) V59A+Q89R+E129V+K177L+R179E+H208Y+K220P+N224L+Q254S;
(157) V59A+Q89R+E129V+K177L+R179E+K220P+N224L+Q254S+D269E+D281N;
(158) V59A+Q89R+E129V+K177L+R179E+K220P+N224L+Q254S+1270L;
(159) V59A+Q89R+E129V+K177L+R179E+K220P+N224L+Q254S+H274K;
(160) V59A+Q89R+E129V+K177L+R179E+K220P+N224L+Q254S+Y276F;
(161) V59A+E129V+R157Y+K177L+R179E+K220P+N224L+S242Q+Q254S;
(162) V59A+E129V+K177L+R179E+H208Y+K220P+N224L+S242Q+Q254S;
(163) 59A+E129V+K177L+R179E+K220P+N224L+S242Q+Q254S;
(164) V59A+E129V+K177L+R179E+K220P+N224L+S242Q+Q254S+H274K;
(165) V59A+E129V+K177L+R179E+K220P+N224L+S242Q+Q254S+Y276F;
(166) V59A+E129V+K177L+R179E+K220P+N224L+S242Q+Q254S+D281N;
(167) V59A+E129V+K177L+R179E+K220P+N224L+S242Q+Q254S+M284T;
(168) V59A+E129V+K177L+R179E+K220P+N224L+S242Q+Q254S+G416V;
(169) V59A+E129V+K177L+R179E+K220P+N224L+Q254S;
(170) V59A+E129V+K177L+R179E+K220P+N224L+Q254S+M284T;
(171) A91 L+M961+E129V+K177L+R179E+K220P+N224L+S242Q+Q254S;
(172) E129V+K177L+R179E;
(173) E129V+K177L+R179E+K220P+N224L+S242Q+Q254S;
(174) E129V+K177L+R179E+K220P+N224L+S242Q+Q254S+Y276F+L427M;
(175) E129V+K177L+R179E+K220P+N224L+S242Q+Q254S+M284T;
(176) E129V+K177L+R179E+K220P+N224L+5242Q+Q254S+N376*+1377*;
(177) E129V+K177L+R179E+K220P+N224L+Q254S;
(178) E129V+K177L+R179E+K220P+N224L+Q254S+M284T;
(179) E129V+K177L+R179E+S242Q;
(180) E129V+K177L+R179V+K220P+N224L+S242Q+Q254S;
(181) K220P+N224L+S242Q+Q254S;
(182) M284V;
(183) V59A+Q89R+E129V+K177L+R179E+Q254S+M284V.
(184) V59A+E129V+K177L+R179E+Q254S+M284V;
(185) In a preferred embodiment the alpha-amylase is selected from the group of Bacillus stearothermophilus alpha-amylase variants:
(186) I181*+G182*+N193F+E129V+K177L+R179E;
(187) I181*+G182*+N193F+V59A+Q89R+E129V+K177L+R179E+H208Y+K220P+N224L+Q254S;
(188) I181*+G182*+N193F+V59A+Q89R+E129V+K177L+R179E+Q254S+M284V;
(189) I181*+G182*+N193F+V59A+E129V+K177L+R179E+Q254S+M284V; and
(190) I181*+G182*+N193F+E129V+K177L+R179E+K220P+N224L+S242Q+Q254S (using SEQ ID NO: 1 herein for numbering).
(191) It should be understood that when referring to Bacillus stearothermophilus alpha-amylase and variants thereof they are normally produced in truncated form. In particular, the truncation may be so that the Bacillus stearothermophilus alpha-amylase shown in SEQ ID NO: 3 in WO 99/19467 or SEQ ID NO: 1 herein, or variants thereof, are truncated in the C-terminal and are typically around 491 amino acids long, such as from 480-495 amino acids long, or so that it lacks a functional starch binding domain.
(192) In a preferred embodiment the alpha-amylase variant may be an enzyme having a degree of identity of at least 60%, e.g., at least 70%, at least 80%, at least 90%, at least 95%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%, but less than 100% to the sequence shown in SEQ ID NO: 3 in WO 99/19467 or SEQ ID NO: 1 herein.
(193) In an embodiment the bacterial alpha-amylase, e.g., Bacillus alpha-amylase, such as especially Bacillus stearothermophilus alpha-amylase, or variant thereof, is dosed to liquefaction in a concentration between 0.01-10 KNU-A/g DS, e.g., between 0.02 and 5 KNU-A/g DS, such as 0.03 and 3 KNU-A, preferably 0.04 and 2 KNU-A/g DS, such as especially 0.01 and 2 KNU-a/g DS. In an embodiment the bacterial alpha-amylase, e.g., Bacillus alpha-amylase, such as especially Bacillus stearothermophilus alpha-amylases, or variant thereof, is dosed to liquefaction in a concentration of between 0.0001-1 mg EP (Enzyme Protein)/g DS, e.g., 0.0005-0.5 mg EP/g DS, such as 0.001-0.1 mg EP/g DS.
(194) Protease Present and/or Added In Liquefaction
(195) According to the invention a protease is optionally present and/or added in liquefaction together with the alpha-amylase, and an optional glucoamylase, and/or pullulanase.
(196) Proteases are classified on the basis of their catalytic mechanism into the following groups: Serine proteases (S), Cysteine proteases (C), Aspartic proteases (A), Metallo proteases (M), and Unknown, or as yet unclassified, proteases (U), see Handbook of Proteolytic Enzymes, A. J. Barrett, N. D. Rawlings, J. F. Woessner (eds), Academic Press (1998), in particular the general introduction part.
(197) In a preferred embodiment the thermostable protease used according to the invention is a metallo protease defined as a protease belonging to EC 3.4.24 (metalloendopeptidases); preferably EC 3.4.24.39 (acid metallo proteinases).
(198) To determine whether a given protease is a metallo protease or not, reference is made to the above Handbook of Proteolytic Enzymes and the principles indicated therein. Such determination can be carried out for all types of proteases, be it naturally occurring or wild-type proteases; or genetically engineered or synthetic proteases.
(199) Protease activity can be measured using any suitable assay, in which a substrate is employed, that includes peptide bonds relevant for the specificity of the protease in question. Assay-pH and assay-temperature are likewise to be adapted to the protease in question. Examples of assay-pH-values are pH 6, 7, 8, 9, 10, or 11. Examples of assay-temperatures are 30, 35, 37, 40, 45, 50, 55, 60, 65, 70 or 80 C.
(200) Examples of protease substrates are casein, such as Azurine-Crosslinked Casein (AZCL-casein). Two protease assays are described below in the Materials & Methods-section, of which the so-called AZCL-Casein Assay is the preferred assay.
(201) In an embodiment the thermostable protease has at least 20%, such as at least 30%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 100% of the protease activity of the Protease 196 variant or Protease Pfu determined by the AZCL-casein assay described in the Materials & Methods section.
(202) There are no limitations on the origin of the protease used in a process of the invention as long as it fulfills the thermostability properties defined below.
(203) In one embodiment the protease is of fungal origin.
(204) The protease may be a variant of, e.g., a wild-type protease as long as the protease has the thermostability properties defined herein. In a preferred embodiment the thermostable protease is a variant of a metallo protease as defined above. In an embodiment the thermostable protease used in a process of the invention is of fungal origin, such as a fungal metallo protease, such as a fungal metallo protease derived from a strain of the genus Thermoascus, preferably a strain of Thermoascus aurantiacus, especially Thermoascus aurantiacus CGMCC No. 0670 (classified as EC 3.4.24.39).
(205) In an embodiment the thermostable protease is a variant of the mature part of the metallo protease shown in SEQ ID NO: 2 disclosed in WO 2003/048353 or the mature part of SEQ ID NO: 1 in WO 2010/008841 and shown as SEQ ID NO: 3 herein further with mutations selected from below list: S5*+D79L+S87P+A112P+D142L; D79L+S87P+A112P+T124V+D142L; S5*+N26R+D79L+S87P+A112P+D142L; N26R+T46R+D79L+S87P+A112P+D142L; T46R+D79L+S87P+T116V+D142L; D79L+P81R+S87P+A112P+D142L; A27K+D79L+S87P+A112P+T124V+D142L; D79L+Y82F+S87P+A112P+T124V+D142L; D79L+Y82F+S87P+A112P+T124V+D142L; D79L+S87P+A112P+T124V+A126V+D142L; D79L+S87P+A112P+D142L; D79L+Y82F+S87P+A112P+D142L; S38T+D79L+S87P+A112P+A126V+D142L; D79L+Y82F+S87P+A112P+A126V+D142L; A27K+D79L+S87P+A112P+A126V+D142L; D79L+S87P+N98C+A112P+G135C+D142L; D79L+S87P+A112P+D142L+T141C+M161C; S36P+D79L+S87P+A112P+D142L; A37P+D79L+S87P+A112P+D142L; S49P+D79L+S87P+A112P+D142L; S50P+D79L+S87P+A112P+D142L; D79L+S87P+D104P+A112P+D142L; D79L+Y82F+S87G+A112P+D142L; S70V+D79L+Y82F+S87G+Y97W+A112P+D142L; D79L+Y82F+S87G+Y97W+D104P+A112P+D142L; S70V+D79L+Y82F+S87G+A112P+D142L; D79L+Y82F+S87G+D104P+A112P+D142L; D79L+Y82F+S87G+A112P+A126V+D142L; Y82F+S87G+S70V+D79L+D104P+A112P+D142L; Y82F+S87G+D79L+D104P+A112P+A126V+D142L; A27K+D79L+Y82F+S87G+D104P+A112P+A126V+D142L; A27K+Y82F+S87G+D104P+A112P+A126V+D142L; A27K+D79L+Y82F+D104P+A112P+A126V+D142L; A27K+Y82F+D104P+A112P+A126V+D142L; A27K+D79L+S87P+A112P+D142L; D79L+S87P+D142L.
(206) In an preferred embodiment the thermostable protease is a variant of the metallo protease disclosed as the mature part of SEQ ID NO: 2 disclosed in WO 2003/048353 or the mature part of SEQ ID NO: 1 in WO 2010/008841 or SEQ ID NO: 3 herein with the following mutations:
(207) D79L+S87P+A112P+D142L;
(208) D79L+S87P+D142L; or
(209) A27K+D79L+Y82F+S87G+D104P+A112P+A126V+D142L.
(210) In an embodiment the protease variant has at least 75% identity preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, even more preferably at least 93%, most preferably at least 94%, and even most preferably at least 95%, such as even at least 96%, at least 97%, at least 98%, at least 99%, but less than 100% identity to the mature part of the polypeptide of SEQ ID NO: 2 disclosed in WO 2003/048353 or the mature part of SEQ ID NO: 1 in WO 2010/008841 or SEQ ID NO: 3 herein.
(211) The thermostable protease may also be derived from any bacterium as long as the protease has the thermostability properties defined according to the invention.
(212) In an embodiment the thermostable protease is derived from a strain of the bacterium Pyrococcus, such as a strain of Pyrococcus furiosus (pfu protease).
(213) In an embodiment the protease is one shown as SEQ ID NO: 1 in U.S. Pat. No. 6,358,726-B1 (Takara Shuzo Company), or SEQ ID NO: 13 herein.
(214) In another embodiment the thermostable protease is one disclosed in SEQ ID NO: 13 herein or a protease having at least 80% identity, such as at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID NO: 1 in U.S. Pat. No. 6,358,726-B1 or SEQ ID NO: 13 herein. The Pyroccus furiosus protease can be purchased from Takara Bio, Japan.
(215) The Pyrococcus furiosus protease is a thermostable protease according to the invention. The commercial product Pyrococcus furiosus protease (Pfu S) was found to have a thermostability of 110% (80 C./70 C.) and 103% (90 C./70 C.) at pH 4.5 determined as described in Example 2.
(216) In one embodiment a thermostable protease used in a process of the invention has a thermostability value of more than 20% determined as Relative Activity at 80 C./70 C. determined as described in Example 2.
(217) In an embodiment the protease has a thermostability of more than 30%, more than 40%, more than 50%, more than 60%, more than 70%, more than 80%, more than 90%, more than 100%, such as more than 105%, such as more than 110%, such as more than 115%, such as more than 120% determined as Relative Activity at 80 C./70 C.
(218) In an embodiment protease has a thermostability of between 20 and 50%, such as between 20 and 40%, such as 20 and 30% determined as Relative Activity at 80 C./70 C. In an embodiment the protease has a thermostability between 50 and 115%, such as between 50 and 70%, such as between 50 and 60%, such as between 100 and 120%, such as between 105 and 115% determined as Relative Activity at 80 C./70 C.
(219) In an embodiment the protease has a thermostability value of more than 10% determined as Relative Activity at 85 C./70 C. determined as described in Example 2.
(220) In an embodiment the protease has a thermostability of more than 10%, such as more than 12%, more than 14%, more than 16%, more than 18%, more than 20%, more than 30%, more than 40%, more that 50%, more than 60%, more than 70%, more than 80%, more than 90%, more than 100%, more than 110% determined as Relative Activity at 85 C./70 C.
(221) In an embodiment the protease has a thermostability of between 10 and 50%, such as between 10 and 30%, such as between 10 and 25% determined as Relative Activity at 85 C./70 C.
(222) In an embodiment the protease has more than 20%, more than 30%, more than 40%, more than 50%, more than 60%, more than 70%, more than 80%, more than 90% determined as Remaining Activity at 80 C.; and/or
(223) In an embodiment the protease has more than 20%, more than 30%, more than 40%, more than 50%, more than 60%, more than 70%, more than 80%, more than 90% determined as Remaining Activity at 84 C.
(224) Determination of Relative Activity and Remaining Activity is done as described in Example 2.
(225) In an embodiment the protease may have a themostability for above 90, such as above 100 at 85 C. as determined using the Zein-BCA assay as disclosed in Example 3.
(226) In an embodiment the protease has a themostability above 60%, such as above 90%, such as above 100%, such as above 110% at 85 C. as determined using the Zein-BCA assay.
(227) In an embodiment protease has a themostability between 60-120, such as between 70-120%, such as between 80-120%, such as between 90-120%, such as between 100-120%, such as 110-120% at 85 C. as determined using the Zein-BCA assay.
(228) In an embodiment the thermostable protease has at least 20%, such as at least 30%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 100% of the activity of the JTP196 protease variant or Protease Pfu determined by the AZCL-casein assay.
(229) Glucoamylase Present and/or Added in Liquefaction Step i)
(230) According to the invention a glucoamylase may optionally be present and/or added in liquefaction step i). In a preferred embodiment the glucoamylase is added together with or separately from the alpha-amylase and/or the protease and/or pullulanase.
(231) In an embodiment the glucoamylase has a Relative Activity heat stability at 85 C. of at least 20%, at least 30%, preferably at least 35% determined as described in Example 4 (heat stability).
(232) In an embodiment the glucoamylase has a relative activity pH optimum at pH 5.0 of at least 90%, preferably at least 95%, preferably at least 97%, such as 100% determined as described in Example 4 (pH optimum).
(233) In an embodiment the glucoamylase has a pH stability at pH 5.0 of at least at least 80%, at least 85%, at least 90% determined as described in Example 4 (pH stability).
(234) In an embodiment the glucoamylase, such as a Penicillium oxalicum glucoamylase variant, used in liquefaction has a thermostability determined as DSC Td at pH 4.0 as described in Example 15 of at least 70 C., preferably at least 75 C., such as at least 80 C., such as at least 81 C., such as at least 82 C., such as at least 83 C., such as at least 84 C., such as at least 85 C., such as at least 86 C., such as at least 87%, such as at least 88 C., such as at least 89 C., such as at least 90 C. In an embodiment the glucoamylase, such as a Penicillium oxalicum glucoamylase variant has a thermostability determined as DSC Td at pH 4.0 as described in Example 15 in the range between 70 C. and 95 C., such as between 80 C. and 90 C.
(235) In an embodiment the glucoamylase, such as a Penicillium oxalicum glucoamylase variant, used in liquefaction has a thermostability determined as DSC Td at pH 4.8 as described in Example 15 of at least 70 C., preferably at least 75 C., such as at least 80 C., such as at least 81 C., such as at least 82 C., such as at least 83 C., such as at least 84 C., such as at least 85 C., such as at least 86 C., such as at least 87%, such as at least 88 C., such as at least 89 C., such as at least 90 C., such as at least 91 C. In an embodiment the glucoamylase, such as a Penicillium oxalicum glucoamylase variant has a thermostability determined as DSC Td at pH 4.8 as described in Example 15 in the range between 70 C. and 95 C., such as between 80 C. and 90 C.
(236) In an embodiment the glucoamylase, such as a Penicillium oxalicum glucoamylase variant, used in liquefaction has a residual activity determined as described in Example 16 of at least 100% such as at least 105%, such as at least 110%, such as at least 115%, such as at least 120%, such as at least 125%. In an embodiment the glucoamylase, such as a Penicillium oxalicum glucoamylase variant has a thermostability determined as residual activity as described in Example 16 in the range between 100% and 130%.
(237) In a specific and preferred embodiment the glucoamylase, preferably of fungal origin, preferably a filamentous fungi, is from a strain of the genus Penicillium, especially a strain of Penicillium oxalicum, in particular the Penicillium oxalicum glucoamylase disclosed as SEQ ID NO: 2 in WO 2011/127802 (which is hereby incorporated by reference) and shown in SEQ ID NO: 9 or 14 herein.
(238) In an embodiment the glucoamylase has at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, even more preferably at least 93%, most preferably at least 94%, and even most preferably at least 95%, such as even at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to the mature polypeptide shown in SEQ ID NO: 2 in WO 2011/127802 or SEQ ID NOs: 9 or 14 herein.
(239) In a preferred embodiment the glucoamylase is a variant of the Penicillium oxalicum glucoamylase disclosed as SEQ ID NO: 2 in WO 2011/127802 and shown in SEQ ID NO: 9 and 14 herein, having a K79V substitution (using the mature sequence shown in SEQ ID NO: 14 herein for numbering). The K79V glucoamylase variant has reduced sensitivity to protease degradation relative to the parent as disclosed in WO 2013/036526 (which are hereby incorporated by reference).
(240) In an embodiment the glucoamylase is derived from Penicillium oxalicum.
(241) In an embodiment the glucoamylase is a variant of the Penicillium oxalicum glucoamylase disclosed as SEQ ID NO: 2 in WO 2011/127802 and shown in SEQ ID NO: 9 and 14 herein. In a preferred embodiment the Penicillium oxalicum glucoamylase is the one disclosed as SEQ ID NO: 2 in WO 2011/127802 and shown in SEQ ID NO: 9 and 14 herein having Val (V) in position 79 (using SEQ ID NO: 14 herein for numbering).
(242) Contemplated Penicillium oxalicum glucoamylase variants are disclosed in WO 2013/053801 which is hereby incorporated by reference.
(243) In an embodiment these variants have reduced sensitivity to protease degradation.
(244) In an embodiment these variant have improved thermostability compared to the parent.
(245) More specifically, in an embodiment the glucoamylase has a K79V substitution (using SEQ ID NO: 14 herein for numbering), corresponding to the PE001 variant, and further comprises at least one of the following substitutions or combination of substitutions:
(246) T65A; or
(247) Q327F; or
(248) E501V; or
(249) Y504T; or
(250) Y504*; or
(251) T65A+Q327F; or
(252) T65A+E501V; or
(253) T65A+Y504T; or
(254) T65A+Y504*; or
(255) Q327F+E501V; or
(256) Q327F+Y504T; or
(257) Q327F+Y504*; or
(258) E501V+Y504T; or
(259) E501V+Y504*; or
(260) T65A+Q327F+E501V; or
(261) T65A+Q327F+Y504T; or
(262) T65A+E501V+Y504T; or
(263) Q327F+E501V+Y504T; or
(264) T65A+Q327F+Y504*; or
(265) T65A+E501V+Y504*; or
(266) Q327F+E501V+Y504*; or
(267) T65A+Q327F+E501V+Y504T; or
(268) T65A+Q327F+E501V+Y504*;
(269) E501V+Y504T; or
(270) T65A+K161S; or
(271) T65A+Q405T; or
(272) T65A+Q327W; or
(273) T65A+Q327F; or
(274) T65A+Q327Y; or
(275) P11F+T65A+Q327F; or
(276) R1K+D3W+K5Q+G7V+N8S+T10K+P11S+T65A+Q327F; or
(277) P2N+P4S+P11F+T65A+Q327F; or
(278) P11F+D26C+K33C+T65A+Q327F; or
(279) P2N+P4S+P11F+T65A+Q327W+E501V+Y504T; or
(280) R1E+D3N+P4G+G6R+G7A+N8A+T10D+P11 D+T65A+Q327F; or
(281) P11F+T65A+Q327W; or
(282) P2N+P4S+P11F+T65A+Q327F+E501V+Y504T; or
(283) P11F+T65A+Q327W+E501V+Y504T; or
(284) T65A+Q327F+E501V+Y504T; or
(285) T65A+S105P+Q327W; or
(286) T65A+S105P+Q327F; or
(287) T65A+Q327W+S364P; or
(288) T65A+Q327F+S364P; or
(289) T65A+S103N+Q327F; or
(290) P2N+P4S+P11F+K34Y+T65A+Q327F; or
(291) P2N+P4S+P11F+T65A+Q327F+D445N+V447S; or
(292) P2N+P4S+P11F+T65A+I172V+Q327F; or
(293) P2N+P4S+P11F+T65A+Q327F+N502*; or
(294) P2N+P4S+P11F+T65A+Q327F+N502T+P563S+K571E; or
(295) P2N+P4S+P11F+R31S+K33V+T65A+Q327F+N564D+K571S; or
(296) P2N+P4S+P11F+T65A+Q327F+S377T; or
(297) P2N+P4S+P11F+T65A+V325T+Q327W; or
(298) P2N+P4S+P11F+T65A+Q327F+D445N+V447S+E501V+Y504T; or
(299) P2N+P4S+P11F+T65A+I172V+Q327F+E501V+Y504T; or
(300) P2N+P4S+P11F+T65A+Q327F+S377T+E501V+Y504T; or
(301) P2N+P4S+P11F+D26N+K34Y+T65A+Q327F; or
(302) P2N+P4S+P11F+T65A+Q327F+I375A+E501V+Y504T; or
(303) P2N+P4S+P11F+T65A+K218A+K221D+Q327F+E501V+Y504T; or
(304) P2N+P4S+P11F+T65A+S103N+Q327F+E501V+Y504T; or
(305) P2N+P4S+T10D+T65A+Q327F+E501V+Y504T; or
(306) P2N+P4S+F12Y+T65A+Q327F+E501V+Y504T; or
(307) K5A+P11F+T65A+Q327F+E501V+Y504T; or
(308) P2N+P4S+T10E+E18N+T65A+Q327F+E501V+Y504T; or
(309) P2N+T10E+E18N+T65A+Q327F+E501V+Y504T; or
(310) P2N+P4S+P11F+T65A+Q327F+E501V+Y504T+T568N; or
(311) P2N+P4S+P11F+T65A+Q327F+E501V+Y504T+K524T+G526A; or
(312) P2N+P4S+P11F+K34Y+T65A+Q327F+D445N+V447S+E501V+Y504T; or
(313) P2N+P4S+P11F+R31S+K33V+T65A+Q327F+D445N+V447S+E501V+Y504T; or
(314) P2N+P4S+P11F+D26N+K34Y+T65A+Q327F+E501V+Y504T; or
(315) P2N+P4S+P11F+T65A+F80*+Q327F+E501V+Y504T; or
(316) P2N+P4S+P11F+T65A+K112S+Q327F+E501V+Y504T; or
(317) P2N+P4S+P11F+T65A+Q327F+E501V+Y504T+T516P+K524T+G526A; or
(318) P2N+P4S+P11F+T65A+Q327F+E501V+N502T+Y504*; or
(319) P2N+P4S+P11F+T65A+Q327F+E501V+Y504T; or
(320) P2N+P4S+P11F+T65A+S103N+Q327F+E501V+Y504T; or
(321) K5A+P11F+T65A+Q327F+E501V+Y504T; or
(322) P2N+P4S+P11F+T65A+Q327F+E501V+Y504T+T516P+K524T+G526A; or
(323) P2N+P4S+P11F+T65A+V79A+Q327F+E501V+Y504T; or
(324) P2N+P4S+P11F+T65A+V79G+Q327F+E501V+Y504T; or
(325) P2N+P4S+P11F+T65A+V791+Q327F+E501V+Y504T; or
(326) P2N+P4S+P11F+T65A+V79L+Q327F+E501V+Y504T; or
(327) P2N+P4S+P11F+T65A+V79S+Q327F+E501V+Y504T; or
(328) P2N+P4S+P11F+T65A+L72V+Q327F+E501V+Y504T; or
(329) S255N+Q327F+E501V+Y504T; or
(330) P2N+P4S+P11F+T65A+E74N+V79K+Q327F+E501V+Y504T; or
(331) P2N+P4S+P11F+T65A+G220N+Q327F+E501V+Y504T; or
(332) P2N+P4S+P11F+T65A+Y245N+Q327F+E501V+Y504T; or
(333) P2N+P4S+P11F+T65A+Q253N+Q327F+E501V+Y504T; or
(334) P2N+P4S+P11F+T65A+D279N+Q327F+E501V+Y504T; or
(335) P2N+P4S+P11F+T65A+Q327F+S359N+E501V+Y504T; or
(336) P2N+P4S+P11F+T65A+Q327F+D370N+E501V+Y504T; or
(337) P2N+P4S+P11F+T65A+Q327F+V460S+E501V+Y504T; or
(338) P2N+P4S+P11F+T65A+Q327F+V460T+P468T+E501V+Y504T; or
(339) P2N+P4S+P11F+T65A+Q327F+T463N+E501V+Y504T; or
(340) P2N+P4S+P11F+T65A+Q327F+S465N+E501V+Y504T; or
(341) P2N+P4S+P11F+T65A+Q327F+T477N+E501V+Y504T.
(342) In a preferred embodiment the Penicillium oxalicum glucoamylase variant has a K79V substitution (using SEQ ID NO: 14 herein for numbering), corresponding to the PE001 variant, and further comprises one of the following mutations:
(343) P11F+T65A+Q327F; or
(344) P2N+P4S+P11F+T65A+Q327F; or
(345) P11F+D26C+K33C+T65A+Q327F; or
(346) P2N+P4S+P11F+T65A+Q327W+E501V+Y504T; or
(347) P2N+P4S+P11F+T65A+Q327F+E501V+Y504T; or
(348) P11F+T65A+Q327W+E501V+Y504T.
(349) The glucoamylase may be added in amounts from 0.1-100 micrograms EP/g, such as 0.5-50 micrograms EP/g, such as 1-25 micrograms EP/g, such as 2-12 micrograms EP/g DS.
(350) Pullulanase Present and/or Added in Liquefaction Step i)
(351) Optionally a pullulanase may be present and/or added during liquefaction step i) together with an alpha-amylase, and/or protease and/or glucoamylase. As mentioned above a glucoamylase glucoamylase may also be present and/or added during liquefaction step i).
(352) The pullulanase may be present and/or added in liquefaction step i) and/or saccharification step ii) or simultaneous saccharification and fermentation (SSF).
(353) Pullulanases (E.C. 3.2.1.41, pullulan 6-glucano-hydrolase), are debranching enzymes characterized by their ability to hydrolyze the alpha-1,6-glycosidic bonds in, for example, amylopectin and pullulan.
(354) Contemplated pullulanases according to the present invention include the pullulanases from Bacillus amyloderamificans disclosed in U.S. Pat. No. 4,560,651 (hereby incorporated by reference), the pullulanase disclosed as SEQ ID NO: 2 in WO 01/151620 (hereby incorporated by reference), the Bacillus deramificans disclosed as SEQ ID NO: 4 in WO 01/151620 (hereby incorporated by reference), and the pullulanase from Bacillus acidopullulyticus disclosed as SEQ ID NO: 6 in WO 01/151620 (hereby incorporated by reference) and also described in FEMS Mic. Let. (1994) 115, 97-106.
(355) Additional pullulanases contemplated according to the present invention included the pullulanases from Pyrococcus woesei, specifically from Pyrococcus woesei DSM No. 3773 disclosed in WO92/02614.
(356) In an embodiment the pullulanase is a family GH57 pullulanase. In an embodiment the pullulanase includes an X47 domain as disclosed in U.S. 61/289,040 published as WO 2011/087836 (which are hereby incorporated by reference). More specifically the pullulanase may be derived from a strain of the genus Thermococcus, including Thermococcus litoralis and Thermococcus hydrothermalis, such as the Thermococcus hydrothermalis pullulanase shown in SEQ ID NO: 11 truncated at site X4 right after the X47 domain (i.e., amino acids 1-782 in SEQ ID NOS: 11 and 12 herein). The pullulanase may also be a hybrid of the Thermococcus litoralis and Thermococcus hydrothermalis pullulanases or a T. hydrothermalis/T. litoralis hybrid enzyme with truncation site X4 disclosed in U.S. 61/289,040 published as WO 2011/087836 (which is hereby incorporated by reference) and disclosed in SEQ ID NO: 12 herein.
(357) In another embodiment the pullulanase is one comprising an X46 domain disclosed in WO 2011/076123 (Novozymes).
(358) The pullulanase may according to the invention be added in an effective amount which include the preferred amount of about 0.0001-10 mg enzyme protein per gram DS, preferably 0.0001-0.10 mg enzyme protein per gram DS, more preferably 0.0001-0.010 mg enzyme protein per gram DS. Pullulanase activity may be determined as NPUN. An Assay for determination of NPUN is described in the Materials & Methods-section below.
(359) Suitable commercially available pullulanase products include PROMOZYME D, PROMOZYME D2 (Novozymes A/S, Denmark), OPTIMAX L-300 (DuPont-Danisco, USA), and AMANO 8 (Amano, Japan).
(360) Glucoamylase Present and/or Added in Saccharification and/or Fermentation
(361) The glucoamylase present and/or added in saccharification, fermentation or simultaneous saccharification and fermentation (SSF) may be derived from any suitable source, e.g., derived from a microorganism or a plant. Preferred glucoamylases are of fungal or bacterial origin, selected from the group consisting of Aspergillus glucoamylases, in particular Aspergillus niger G1 or G2 glucoamylase (Boel et al. (1984), EMBO J. 3 (5), p. 1097-1102), or variants thereof, such as those disclosed in WO 92/00381, WO 00/04136 and WO 01/04273 (from Novozymes, Denmark); the A. awamori glucoamylase disclosed in WO 84/02921, Aspergillus oryzae glucoamylase (Agric. Biol. Chem. (1991), 55 (4), p. 941-949), or variants or fragments thereof. Other Aspergillus glucoamylase variants include variants with enhanced thermal stability: G137A and G139A (Chen et al. (1996), Prot. Eng. 9, 499-505); D257E and D293E/Q (Chen et al. (1995), Prot. Eng. 8, 575-582); N182 (Chen et al. (1994), Biochem. J. 301, 275-281); disulphide bonds, A246C (Fierobe et al. (1996), Biochemistry, 35, 8698-8704; and introduction of Pro residues in position A435 and S436 (Li et al. (1997), Protein Eng. 10, 1199-1204.
(362) Other glucoamylases include Athelia rolfsii (previously denoted Corticium rolfsii) glucoamylase (see U.S. Pat. No. 4,727,026 and (Nagasaka et al. (1998) Purification and properties of the raw-starch-degrading glucoamylases from Corticium rolfsii, Appl Microbiol Biotechnol 50:323-330), Talaromyces glucoamylases, in particular derived from Talaromyces emersonii (WO 99/28448), Talaromyces leycettanus (U.S. Pat. No. Re. 32,153), Talaromyces duponti, Talaromyces thermophilus (U.S. Pat. No. 4,587,215). In a preferred embodiment the glucoamylase used during saccharification and/or fermentation is the Talaromyces emersonii glucoamylase disclosed in WO 99/28448.
(363) Bacterial glucoamylases contemplated include glucoamylases from the genus Clostridium, in particular C. thermoamylolyticum (EP 135,138), and C. thermohydrosulfuricum (WO 86/01831).
(364) Contemplated fungal glucoamylases include Trametes cingulate (SEQ ID NO: 20), Pachykytospora papyracea; and Leucopaxillus giganteus all disclosed in WO 2006/069289; or Peniophora rufomarginata disclosed in WO2007/124285; or a mixture thereof. Also hybrid glucoamylase are contemplated according to the invention. Examples include the hybrid glucoamylases disclosed in WO 2005/045018. Specific examples include the hybrid glucoamylase disclosed in Table 1 and 4 of Example 1 (which hybrids are hereby incorporated by reference).
(365) In an embodiment the glucoamylase is derived from a strain of the genus Pycnoporus, in particular a strain of Pycnoporus as described in WO 2011/066576 (SEQ ID NOs 2, 4 or 6), such as SEQ ID NO: 18 herein, or from a strain of the genus Gloeophyllum, such as a strain of Gloeophyllum sepiarium or Gloeophyllum trabeum, in particular a strain of Gloeophyllum as described in WO 2011/068803 (SEQ ID NO: 2, 4, 6, 8, 10, 12, 14 or 16). In a preferred embodiment the glucoamylase is SEQ ID NO: 2 in WO 2011/068803 or SEQ ID NO: 15 herein (i.e. Gloeophyllum sepiarium glucoamylase). In a preferred embodiment the glucoamylase is SEQ ID NO: 17 herein (i.e., Gloeophyllum trabeum glucoamylase discloses as SEQ ID NO: 3 in WO2014/177546). In an embodiment the glucoamylase is derived from a strain of the genus Nigrofomes, in particular a strain of Nigrofomes sp. disclosed in WO 2012/064351 (SEQ ID NO: 2) (all references hereby incorporated by reference).
(366) Contemplated are also glucoamylases which exhibit a high identity to any of the above mentioned glucoamylases, i.e., at least 60%, such as at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or even 100% identity to any one of the mature parts of the enzyme sequences mentioned above, such as any of SEQ ID NOs: 15, 17, 18 or 19 herein, respectively, preferably SEQ ID NO: 15 herein or SEQ ID NO: 17 herein.
(367) Glucoamylases may in an embodiment be added to the saccharification and/or fermentation in an amount of 0.0001-20 AGU/g DS, preferably 0.001-10 AGU/g DS, especially between 0.01-5 AGU/g DS, such as 0.1-2 AGU/g DS.
(368) Glucoamylases may in an embodiment be added to the saccharification and/or fermentation in an amount of 1-1,000 g EP/g DS, preferably 10-500 g/gDS, especially between 25-250 g/g DS.
(369) In an embodiment the glucoamylase is added as a blend further comprising an alpha-amylase. In a preferred embodiment the alpha-amylase is a fungal alpha-amylase, especially an acid fungal alpha-amylase. The alpha-amylase is typically a side activity.
(370) In an embodiment the glucoamylase is a blend comprising Talaromyces emersonii glucoamylase disclosed in WO 99/28448 as SEQ ID NO: 7 and Trametes cingulata glucoamylase disclosed as SEQ ID NO: 2 in WO 06/069289 and SEQ ID NO: 20 herein.
(371) In an embodiment the glucoamylase is a blend_comprising Talaromyces emersonii glucoamylase disclosed in WO 99/28448, Trametes cingulata glucoamylase disclosed as SEQ ID NO: 2 in WO 06/69289 and SEQ ID NO: 20 herein, and Rhizomucor pusillus alpha-amylase with Aspergillus niger glucoamylase linker and SBD disclosed as V039 in Table 5 in WO 2006/069290 or SEQ ID NO: 16 herein.
(372) In an embodiment the glucoamylase is a blend comprising Talaromyces emersonii glucoamylase disclosed in WO99/28448, Trametes cingulata glucoamylase disclosed in WO 06/69289, and Rhizomucor pusillus alpha-amylase with Aspergillus niger glucoamylase linker and SBD disclosed as V039 in Table 5 in WO 2006/069290 or SEQ ID NO: 16 herein.
(373) In an embodiment the glucoamylase is a blend comprising Gloeophyllum sepiarium glucoamylase shown as SEQ ID NO: 2 in WO 2011/068803 and Rhizomucor pusillus with an Aspergillus niger glucoamylase linker and starch-binding domain (SBD), disclosed SEQ ID NO: 3 in WO 2013/006756 with the following substitutions: G128D+D143N.
(374) In an embodiment the alpha-amylase may be derived from a strain of the genus Rhizomucor, preferably a strain the Rhizomucor pusillus, such as the one shown in SEQ ID NO: 3 in WO2013/006756, or the genus Meripilus, preferably a strain of Meripilus giganteus. In a preferred embodiment the alpha-amylase is derived from a Rhizomucor pusillus with an Aspergillus niger glucoamylase linker and starch-binding domain (SBD), disclosed as V039 in Table 5 in WO 2006/069290 or SEQ ID NO: 16 herein.
(375) In an embodiment the Rhizomucor pusillus alpha-amylase or the Rhizomucor pusillus alpha-amylase with an Aspergillus niger glucoamylase linker and starch-binding domain (SBD) has at least one of the following substitutions or combinations of substitutions: D165M; Y141W; Y141R; K136F; K192R; P224A; P224R; S123H+Y141W; G20S+Y141W; A76G+Y141W; G128D+Y141W; G128D+D143N; P219C+Y141W; N142D+D143N; Y141W+K192R; Y141W+D143N; Y141W+N383R; Y141W+P219C+A265C; Y141W+N142D+D143N; Y141W+K192R V410A; G128D+Y141W+D143N; Y141W+D143N+P219C; Y141W+D143N+K192R; G128D+D143N+K192R; Y141W+D143N+K192R+P219C; G128D+Y141W+D143N+K192R; or G128D+Y141W+D143N+K192R+P219C (using SEQ ID NO: 3 in WO 2013/006756 for numbering or SEQ ID NO: 16 herein).
(376) In a preferred embodiment the glucoamylase blend comprises Gloeophyllum sepiarium glucoamylase (e.g., SEQ ID NO: 2 in WO 2011/068803 or SEQ ID NO: 15 herein) and Rhizomucor pusillus alpha-amylase.
(377) In a preferred embodiment the glucoamylase blend comprises Gloeophyllum sepiarium glucoamylase shown as SEQ ID NO: 2 in WO 2011/068803 or SEQ ID NO: 15 herein and Rhizomucor pusillus with an Aspergillus niger glucoamylase linker and starch-binding domain (SBD), disclosed SEQ ID NO: 3 in WO 2013/006756 and SEQ ID NO: 16 herein with the following substitutions: G128D+D143N.
(378) Commercially available compositions comprising glucoamylase include AMG 200L; AMG 300 L; SAN SUPER, SAN EXTRA L, SPIRIZYME PLUS, SPIRIZYME FUEL, SPIRIZYME B4U, SPIRIZYME ULTRA, SPIRIZYME EXCEL, SPIRIZYME ACHIEVE and AMG E (from Novozymes A/S); OPTIDEX 300, GC480, GC417 (from DuPont-Danisco); AMIGASE and AMIGASE PLUS (from DSM); G-ZYME G900, G-ZYME and G990 ZR (from DuPont-Danisco).
(379) Cellulolytic Composition Present and/or Added During Saccharification and/or Fermentation
(380) According to the invention a cellulolytic composition may be present in saccharification, fermentation or simultaneous saccharification and fermentation (SSF).
(381) The cellulolytic composition comprises a beta-glucosidase, a cellobiohydrolase and an endoglucanase.
(382) Examples of suitable cellulolytic composition can be found in WO 2008/151079 and WO 2013/028928 which are incorporated by reference.
(383) In preferred embodiments the cellulolytic composition is derived from a strain of Trichoderma, Humicola, or Chrysosporium.
(384) In an embodiment the cellulolytic composition is derived from a strain of Trichoderma reesei, Humicola insolens and/or Chrysosporium lucknowense.
(385) In an embodiment the cellulolytic composition comprises a beta-glucosidase, preferably one derived from a strain of the genus Aspergillus, such as Aspergillus oryzae, such as the one disclosed in WO 2002/095014 or the fusion protein having beta-glucosidase activity disclosed in WO 2008/057637, or Aspergillus fumigatus, such as one disclosed in WO 2005/047499 or an Aspergillus fumigatus beta-glucosidase variant disclosed in WO 2012/044915 (Novozymes), such as one with the following substitutions: F100D, S283G, N456E, F512Y; or a strain of the genus a strain Penicillium, such as a strain of the Penicillium brasilianum disclosed in WO 2007/019442, or a strain of the genus Trichoderma, such as a strain of Trichoderma reesei.
(386) In an embodiment the cellulolytic composition comprises a GH61 polypeptide having cellulolytic enhancing activity such as one derived from the genus Thermoascus, such as a strain of Thermoascus aurantiacus, such as the one described in WO 2005/074656 as SEQ ID NO: 2; or one derived from the genus Thielavia, such as a strain of Thielavia terrestris, such as the one described in WO 2005/074647 as SEQ ID NO: 7 and SEQ ID NO: 8; or one derived from a strain of Aspergillus, such as a strain of Aspergillus fumigatus, such as the one described in WO 2010/138754 as SEQ ID NO: 1 and SEQ ID NO: 2; or one derived from a strain derived from Penicillium, such as a strain of Penicillium emersonii, such as the one disclosed in WO 2011/041397.
(387) In an embodiment the cellulolytic composition comprises a cellobiohydrolase I (CBH I), such as one derived from a strain of the genus Aspergillus, such as a strain of Aspergillus fumigatus, such as the Cel7a CBHI disclosed in SEQ ID NO: 2 in WO 2011/057140, or a strain of the genus Trichoderma, such as a strain of Trichoderma reesei.
(388) In an embodiment the cellulolytic composition comprises a cellobiohydrolase II (CBH II, such as one derived from a strain of the genus Aspergillus, such as a strain of Aspergillus fumigatus; or a strain of the genus Trichoderma, such as Trichoderma reesei, or a strain of the genus Thielavia, such as a strain of Thielavia terrestris, such as cellobiohydrolase II CEL6A from Thielavia terrestris.
(389) In an embodiment the cellulolytic composition comprises a GH61 polypeptide having cellulolytic enhancing activity and a beta-glucosidase.
(390) In an embodiment the cellulolytic composition comprises a GH61 polypeptide having cellulolytic enhancing activity, a beta-glucosidase, and a CBH I.
(391) In an embodiment the cellulolytic composition comprises a GH61 polypeptide having cellulolytic enhancing activity, a beta-glucosidase, a CBH I, and a CBH II.
(392) In an embodiment the cellulolytic composition is a Trichoderma reesei cellulolytic enzyme composition, further comprising Thermoascus aurantiacus GH61A polypeptide having cellulolytic enhancing activity (SEQ ID NO: 2 in WO 2005/074656), and Aspergillus oryzae beta-glucosidase fusion protein (WO 2008/057637).
(393) In an embodiment the cellulolytic composition is a Trichoderma reesei cellulolytic enzyme composition, further comprising Thermoascus aurantiacus GH61A polypeptide having cellulolytic enhancing activity (SEQ ID NO: 2 in WO 2005/074656) and Aspergillus fumigatus beta-glucosidase (SEQ ID NO: 2 of WO 2005/047499).
(394) In an embodiment the cellulolytic composition is a Trichoderma reesei cellulolytic enzyme composition further comprising Penicillium emersonii GH61A polypeptide having cellulolytic enhancing activity disclosed in WO 2011/041397 and Aspergillus fumigatus beta-glucosidase (SEQ ID NO: 2 of WO 2005/047499) or a variant thereof with the following substitutions F100D, S283G, N456E, F512Y.
(395) In a preferred embodiment the cellulolytic composition comprising one or more of the following components:
(396) (i) an Aspergillus fumigatus cellobiohydrolase I;
(397) (ii) an Aspergillus fumigatus cellobiohydrolase II;
(398) (iii) an Aspergillus fumigatus beta-glucosidase or variant thereof; and
(399) (iv) a Penicillium sp. GH61 polypeptide having cellulolytic enhancing activity; or homologs thereof.
(400) In an preferred embodiment the cellulolytic composition is derived from Trichoderma reesei comprising GH61A polypeptide having cellulolytic enhancing activity derived from a strain of Penicillium emersonii (SEQ ID NO: 2 in WO 2011/041397, Aspergillus fumigatus beta-glucosidase (SEQ ID NO: 2 in WO 2005/047499) variant with the following substitutions: F100D, S283G, N456E, F512Y) disclosed in WO 2012/044915; Aspergillus fumigatus Cel7A CBH1 disclosed as SEQ ID NO: 6 in WO2011/057140 and Aspergillus fumigatus CBH II disclosed as SEQ ID NO: 18 in WO 2011/057140.
(401) In an embodiment the cellulolytic composition is dosed from 0.0001-3 mg EP/g DS, preferably, 0.0005-2 mg EP/g DS, preferably 0.001-1 mg/g DS, more preferably 0.005-0.5 mg EP/g DS, and even more preferably 0.01-0.1 mg EP/g DS.
Examples of Preferred Processes of the Invention
(402) In a preferred embodiment the invention relates processes for producing ethanol from starch-containing material comprising the steps of:
(403) i) liquefying the starch-containing material at a temperature above the initial gelatinization temperature using an alpha-amylase derived from Bacillus stearothermophilus;
(404) ii) saccharifying using a glucoamylase;
(405) iii) fermenting using a fermenting organism;
(406) wherein the fermenting organism is Saccharomyces cerevisiae MBG4851 (deposited under Accession No. V14/004037 at National Measurement Institute, Victoria, Australia) or a strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or a derivative of Saccharomyces strain V14/004037 having defining characteristics of strain V14/004037.
(407) In an embodiment a protease is added in saccharification and/or fermentation or SSF.
(408) In a preferred embodiment the invention relates processes for producing ethanol from starch-containing material comprising the steps of:
(409) i) liquefying the starch-containing material at a temperature above the initial gelatinization temperature using:
(410) an alpha-amylase derived from Bacillus stearothermophilus comprising a double deletion at positions I181+G182, and optionally a N193F substitution; (using SEQ ID NO: 1 for numbering);
(411) ii) saccharifying using a glucoamylase derived from a strain of Gloephyllum, such as Gloephyllum serpiarium or Gloephyllum trabeum;
(412) iii) fermenting using a fermenting organism;
(413) wherein the fermenting organism is Saccharomyces cerevisiae MBG4851 (deposited under Accession No. V14/004037 at National Measurement Institute, Victoria, Australia) or a strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or a derivative of Saccharomyces strain V14/004037 having defining characteristics of strain V14/004037.
(414) In a preferred embodiment the invention relates processes for producing ethanol from starch-containing material comprising the steps of:
(415) i) liquefying the starch-containing material at a temperature above the initial gelatinization temperature using:
(416) an alpha-amylase derived from Bacillus stearothermophilus; a protease having a thermostability value of more than 20% determined as Relative Activity at 80 C./70 C., preferably derived from Pyrococcus furiosus and/or Thermoascus aurantiacus; and optionally a Penicillium oxalicum glucoamylase;
ii) saccharifying using a glucoamylase;
iii) fermenting using a fermenting organism;
wherein the fermenting organism is Saccharomyces cerevisiae MBG4851 (deposited under Accession No. V14/004037 at National Measurement Institute, Victoria, Australia) or a strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or a derivative of Saccharomyces strain V14/004037 having defining characteristics of strain V14/004037.
(417) In a preferred embodiment the invention relates processes for producing ethanol from starch-containing material comprising the steps of:
(418) i) liquefying the starch-containing material at a temperature above the initial gelatinization temperature using:
(419) an alpha-amylase, preferably derived from Bacillus stearothermophilus, comprising a double deletion at positions I181+G182, and optionally a N193F substitution (using SEQ ID NO: 1 for numbering) and having a T (min) at pH 4.5, 85 C., 0.12 mM CaCl.sub.2 of at least 10;
(420) ii) saccharifying using a glucoamylase;
(421) iii) fermenting using a fermenting organism;
(422) wherein the fermenting organism is Saccharomyces cerevisiae MBG4851 (deposited under Accession No. V14/004037 at National Measurement Institute, Victoria, Australia) or a strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or a derivative of Saccharomyces strain V14/004037 having defining characteristics of strain V14/004037.
(423) In a preferred embodiment the invention relates processes for producing ethanol from starch-containing material comprising the steps of:
(424) i) liquefying the starch-containing material at a temperature between 80-90 C.: an alpha-amylase, preferably derived from Bacillus stearothermophilus, having a T (min) at pH 4.5, 85 C., 0.12 mM CaCl.sub.2 of at least 10; a protease, preferably derived from Pyrococcus furiosus and/or Thermoascus aurantiacus, having a thermostability value of more than 20% determined as Relative Activity at 80 C./70 C.; optionally a Penicillium oxalicum glucoamylase
(425) ii) saccharifying using a glucoamylase;
(426) iii) fermenting using a fermenting organism;
(427) wherein the fermenting organism is Saccharomyces cerevisiae MBG4851 (deposited under Accession No. V14/004037 at National Measurement Institute, Victoria, Australia) or a strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or a derivative of Saccharomyces strain V14/004037 having defining characteristics of strain V14/004037.
(428) In a preferred embodiment the invention relates processes for producing ethanol from starch-containing material comprising the steps of:
(429) i) liquefying the starch-containing material at a temperature above the initial gelatinization temperature using:
(430) an alpha-amylase derived from Bacillus stearothermophilus having a double deletion at positions I181+G182, and optional substitution N193F; and optionally further one of the following set of substitutions: E129V+K177L+R179E; V59A+Q89R+E129V+K177L+R179E+H208Y+K220P+N224L+Q254S: V59A+Q89R+E129V+K177L+R179E+Q254S+M284V; V59A+E129V+K177L+R179E+Q254S+M284V; E129V+K177L+R179E+K220P+N224L+S242Q+Q254S (using SEQ ID NO: 1 herein for numbering);
ii) saccharifying using a glucoamylase, such as one from a strain of Gloephyllum, such as a strain of Gloeophyllum serpiarium;
iii) fermenting using a fermenting organism;
wherein the fermenting organism is Saccharomyces cerevisiae MBG4851 (deposited under Accession No. V14/004037 at National Measurement Institute, Victoria, Australia) or a strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or a derivative of Saccharomyces strain V14/004037 having defining characteristics of strain V14/004037.
(431) In a preferred embodiment the invention relates processes for producing ethanol from starch-containing material comprising the steps of:
(432) i) liquefying the starch-containing material at a temperature above the initial gelatinization temperature using:
(433) an alpha-amylase derived from Bacillus stearothermophilus having a double deletion at positions I181+G182, and optional substitution N193F, and optionally further one of the following set of substitutions: E129V+K177L+R179E; V59A+Q89R+E129V+K177L+R179E+H208Y+K220P+N224L+Q254S: V59A+Q89R+E129V+K177L+R179E+Q254S+M284V; V59A+E129V+K177L+R179E+Q254S+M284V; E129V+K177L+R179E+K220P+N224L+S242Q+Q254S (using SEQ ID NO: 1 herein for numbering). a protease having a thermostability value of more than 20% determined as Relative Activity at 80 C./70 C., preferably derived from Pyrococcus furiosus and/or Thermoascus aurantiacus; and optionally a Penicillium oxalicum glucoamylase shown in SEQ ID NO: 14 having substitutions selected from the group of: K79V; K79V+P11F+T65A+Q327F; or K79V+P2N+P4S+P11F+T65A+Q327F; or K79V+P11F+D26C+K33C+T65A+Q327F; or K79V+P2N+P4S+P11F+T65A+Q327W+E501V+Y504T; or K79V+P2N+P4S+P11F+T65A+Q327F+E501V+Y504T; or K79V+P11F+T65A+Q327W+E501V+Y504T (using SEQ ID NO: 14 for numbering);
ii) saccharifying using a glucoamylase;
iii) fermenting using a fermenting organism;
wherein the fermenting organism is Saccharomyces cerevisiae MBG4851 (deposited under Accession No. V14/004037 at National Measurement Institute, Victoria, Australia) or a strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or a derivative of Saccharomyces strain V14/004037 having defining characteristics of strain V14/004037.
(434) In a preferred embodiment the invention relates processes for producing ethanol from starch-containing material comprising the steps of:
(435) i) liquefying the starch-containing material at a temperature between 80-90 C. using: an alpha-amylase derived from Bacillus stearothermophilus having a double deletion at positions I181+G182, and optional substitution N193F, and further optionally one of the following set of substitutions: E129V+K177L+R179E; V59A+Q89R+E129V+K177L+R179E+H208Y+K220P+N224L+Q254S; V59A+Q89R+E129V+K177L+R179E+Q254S+M284V; V59A+E129V+K177L+R179E+Q254S+M284V; E129V+K177L+R179E+K220P+N224L+S242Q+Q254S (using SEQ ID NO: 1 herein for numbering), a protease having a thermostability value of more than 20% determined as Relative Activity at 80 C./70 C., preferably derived from Pyrococcus furiosus and/or Thermoascus aurantiacus; a Penicillium oxalicum glucoamylase shown in SEQ ID NO: 14 having substitutions selected from the group of: K79V; K79V+P11F+T65A+Q327F; or K79V+P2N+P4S+P11F+T65A+Q327F; or K79V+P11F+D26C+K33C+T65A+Q327F; or K79V+P2N+P4S+P11F+T65A+Q327W+E501V+Y504T; or K79V+P2N+P4S+P11F+T65A+Q327F+E501V+Y504T; or K79V+P11F+T65A+Q327W+E501V+Y504T (using SEQ ID NO: 14 for numbering);
(436) ii) saccharifying using a glucoamylase;
(437) iii) fermenting using a fermenting organism; wherein the fermenting organism is Saccharomyces cerevisiae MBG4851 (deposited under Accession No. V14/004037 at National Measurement Institute, Victoria, Australia) or a strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or a derivative of Saccharomyces strain V14/004037 having defining characteristics of strain V14/004037.
(438) In a preferred embodiment the invention relates processes for producing ethanol from starch-containing material comprising the steps of:
(439) i) liquefying the starch-containing material at a temperature above the initial gelatinization temperature using:
(440) an alpha-amylase derived from Bacillus stearothermophilus having a double deletion at positions I181+G182, and optional substitution N193F; a protease having a thermostability value of more than 20% determined as Relative Activity at 80 C./70 C., preferably derived from Pyrococcus furiosus and/or Thermoascus aurantiacus; and optionally a pullulanase; a Penicillium oxalicum glucoamylase having a K79V substitution (using SEQ ID NO: 14 for numbering);
ii) saccharifying using a glucoamylase;
iii) fermenting using a fermenting organism; wherein the fermenting organism is Saccharomyces cerevisiae MBG4851 (deposited under Accession No. V14/004037 at National Measurement Institute, Victoria, Australia) or a strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or a derivative of Saccharomyces strain V14/004037 having defining characteristics of strain V14/004037.
(441) In a preferred embodiment the invention relates processes for producing ethanol from starch-containing material comprising the steps of: i) liquefying the starch-containing material at a temperature above the initial gelatinization temperature using: an alpha-amylase, preferably derived from Bacillus stearothermophilus, having a T % (min) at pH 4.5, 85 C., 0.12 mM CaCl.sub.2 of at least 10; between 0.5 and 10 micro grams Pyrococcus furiosus protease per g DS; ii) saccharifying using a glucoamylase selected from the group of glucoamylase derived from a strain of Aspergillus, preferably A. niger, A. awamori, or A. oryzae; or a strain of Trichoderma, preferably T. reesei; or a strain of Talaromyces, preferably T. emersonii, or a strain of Pycnoporus, or a strain of Gloeophyllum, such as G. serpiarium or G. trabeum, or a strain of the Nigrofomes; iii) fermenting using a fermenting organism; wherein the fermenting organism is Saccharomyces cerevisiae MBG4851 (deposited under Accession No. V14/004037 at National Measurement Institute, Victoria, Australia) or a strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or a derivative of Saccharomyces strain V14/004037 having defining characteristics of strain V14/004037.
(442) In a preferred embodiment the invention relates processes for producing ethanol from starch-containing material comprising the steps of:
(443) i) liquefying the starch-containing material at a temperature between 80-90 C. using; an alpha-amylase, preferably derived from Bacillus stearothermophilus having a double deletion at positions I181+G182, and optional substitution N193F and having a T (min) at pH 4.5, 85 C., 0.12 mM CaCl.sub.2 of at least 10; between 0.5 and 10 micro grams Pyrococcus furiosus protease per g DS; optionally a pullulanase; a Penicillium oxalicum glucoamylase;
(444) ii) saccharifying using a glucoamylase;
(445) iii) fermenting using a fermenting organism; wherein the fermenting organism is Saccharomyces cerevisiae MBG4851 (deposited under Accession No. V14/004037 at National Measurement Institute, Victoria, Australia) or a strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or a derivative of Saccharomyces strain V14/004037 having defining characteristics of strain V14/004037.
(446) In a preferred embodiment the invention relates processes for producing ethanol from starch-containing material comprising the steps of: i) liquefying the starch-containing material at a temperature a temperature between 80-90 C. using; an alpha-amylase derived from Bacillus stearothermophilus having a double deletion I181+G182 and optional substitution N193F; and optionally further one of the following set of substitutions: E129V+K177L+R179E; V59A+Q89R+E129V+K177L+R179E+H208Y+K220P+N224L+Q254S; V59A+Q89R+E129V+K177L+R179E+Q254S+M284V: V59A+E129V+K177L+R179E+Q254S+M284V E129V+K177L+R179E+K220P+N224L+S242Q+Q254S (using SEQ ID NO: 1 herein for numbering); between 0.5 and 10 micro grams Pyrococcus furiosus protease per g DS; and optionally a pullulanase; a Penicillium oxalicum glucoamylase shown in SEQ ID NO: 14 having substitutions selected from the group of: K79V; K79V+P11F+T65A+Q327F; or K79V+P2N+P4S+P11F+T65A+Q327F; or K79V+P11F+D26C+K33C+T65A+Q327F; or K79V+P2N+P4S+P11F+T65A+Q327W+E501V+Y504T; or K79V+P2N+P4S+P11F+T65A+Q327F+E501V+Y504T; or K79V+P11F+T65A+Q327W+E501V+Y504T (using SEQ ID NO: 14 for numbering); ii) saccharifying using a glucoamylase; iii) fermenting using a fermenting organism;
wherein the fermenting organism is Saccharomyces cerevisiae MBG4851 (deposited under Accession No. V14/004037 at National Measurement Institute, Victoria, Australia) or a strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or a derivative of Saccharomyces strain V14/004037 having defining characteristics of strain V14/004037.
(447) In a preferred embodiment the invention relates processes for producing ethanol from starch-containing material comprising the steps of:
(448) i) liquefying the starch-containing material at a temperature between 80-90 C. using: an alpha-amylase derived from Bacillus stearothermophilus having a double deletion I181+G182 and optional substitution N193F; and further one of the following set of substitutions: E129V+K177L+R179E; V59A+Q89R+E129V+K177L+R179E+H208Y+K220P+N224L+Q254S; V59A+Q89R+E129V+K177L+R179E+Q254S+M284V; V59A+E129V+K177L+R179E+Q254S+M284V E129V+K177L+R179E+K220P+N224L+S242Q+Q254S (using SEQ ID NO: 1 herein for numbering). a protease having a thermostability value of more than 20% determined as Relative Activity at 80 C./70 C., preferably derived from Pyrococcus furiosus and/or Thermoascus aurantiacus; and optionally a pullulanase; a Penicillium oxalicum glucoamylase shown in SEQ ID NO: 14 having substitutions selected from the group of: K79V; K79V+P11F+T65A+Q327F; or K79V+P2N+P4S+P11F+T65A+Q327F; or K79V+P11F+D26C+K33C+T65A+Q327F; or K79V+P2N+P4S+P11F+T65A+Q327W+E501V+Y504T; or K79V+P2N+P4S+P11F+T65A+Q327F+E501V+Y504T; or K79V+P11F+T65A+Q327W+E501V+Y504T (using SEQ ID NO: 14 for numbering);
(449) ii) saccharifying using a glucoamylase selected from the group of glucoamylase derived from a strain of Aspergillus; or a strain of Trichoderma; a strain of Talaromyces, a strain of Pycnoporus; a strain of Gloeophyllum; and a strain of the Nigrofomes;
(450) iii) fermenting using a fermenting organism; wherein the fermenting organism is Saccharomyces cerevisiae MBG4851 (deposited under Accession No. V14/004037 at National Measurement Institute, Victoria, Australia) or a strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or a derivative of Saccharomyces strain V14/004037 having defining characteristics of strain V14/004037.
(451) In a preferred embodiment the invention relates processes for producing ethanol from starch-containing material comprising the steps of: i) liquefying the starch-containing material at a temperature between 80-90 C. at a pH between 5.0 and 6.5 using: an alpha-amylase derived from Bacillus stearothermophilus having a double deletion I181+G182 and optional substitution N193F; and optionally further one of the following set of substitutions: E129V+K177L+R179E; V59A+Q89R+E129V+K177L+R179E+H208Y+K220P+N224L+Q254S; V59A+Q89R+E129V+K177L+R179E+Q254S+M284V; V59A+E129V+K177L+R179E+Q254S+M284V E129V+K177L+R179E+K220P+N224L+S242Q+Q254S (using SEQ ID NO: 1 herein for numbering). a protease derived from Pyrococcus furiosus, preferably the one shown in SEQ ID NO: 13 herein; a Penicillium oxalicum glucoamylase shown in SEQ ID NO: 14 having substitutions selected from the group of: K79V; K79V+P11F+T65A+Q327F; or K79V+P2N+P4S+P11F+T65A+Q327F; or K79V+P11F+D26C+K33C+T65A+Q327F; or K79V+P2N+P4S+P11F+T65A+Q327W+E501V+Y504T; or K79V+P2N+P4S+P11F+T65A+Q327F+E501V+Y504T; or K79V+P11F+T65A+Q327W+E501V+Y504T (using SEQ ID NO: 14 for numbering); ii) saccharifying using a glucoamylase; iii) fermenting using a fermenting organism; wherein the fermenting organism is Saccharomyces cerevisiae MBG4851 (deposited under Accession No. V14/004037 at National Measurement Institute, Victoria, Australia) or a strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or a derivative of Saccharomyces strain V14/004037 having defining characteristics of strain V14/004037.
(452) In a preferred embodiment the process of the invention comprises the steps of: i) liquefying the starch-containing material at a temperature between 80-90 C. at a pH between 5.0 and 6.5 using: an alpha-amylase derived from Bacillus stearothermophilus having a double deletion I181+G182, and optional substitution N193F; and optionally further one of the following set of substitutions: E129V+K177L+R179E; V59A+Q89R+E129V+K177L+R179E+H208Y+K220P+N224L+Q254S; V59A+Q89R+E129V+K177L+R179E+Q254S+M284V; V59A+E129V+K177L+R179E+Q254S+M284V E129V+K177L+R179E+K220P+N224L+S242Q+Q254S (using SEQ ID NO: 1 herein for numbering). a protease derived from Pyrococcus furiosus, preferably the one shown in SEQ ID NO: 13 herein present and/or added in a dosage of 1-5 micro gram protease per gram DS, such as around 1.5 or 3 micro gram protease per gram DS; a Penicillium oxalicum glucoamylase shown in SEQ ID NO: 14 having substitutions selected from the group of: K79V; K79V+P11F+T65A+Q327F; or K79V+P2N+P4S+P11F+T65A+Q327F; or K79V+P11F+D26C+K33C+T65A+Q327F; or K79V+P2N+P4S+P11F+T65A+Q327W+E501V+Y504T; or K79V+P2N+P4S+P11F+T65A+Q327F+E501V+Y504T; or K79V+P11F+T65A+Q327W+E501V+Y504T (using SEQ ID NO: 14 for numbering); ii) saccharifying using a glucoamylase; iii) fermenting using a fermenting organism; wherein the fermenting organism is Saccharomyces cerevisiae MBG4851 (deposited under Accession No. V14/004037 at National Measurement Institute, Victoria, Australia) or a strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or a derivative of Saccharomyces strain V14/004037 having defining characteristics of strain V14/004037.
(453) In a preferred embodiment the invention relates to processes for producing ethanol from starch-containing material comprising the steps of:
(454) i) liquefying the starch-containing material at a temperature above the initial gelatinization temperature using an alpha-amylase derived from Bacillus stearothermophilus;
(455) ii) saccharifying using a glucoamylase;
(456) iii) fermenting using a fermenting organism;
(457) wherein the fermenting organism has one or more, such as all, of the following properties and defining characteristics:
(458) increases ethanol yield compared to Ethanol Red under the same process conditions;
(459) produces reduced levels of lactic acid compared to Ethanol Red under the same process conditions;
(460) produces reduced levels of glycerol compared to Ethanol Red under the same process conditions;
(461) reduces the level of acetaldehyde in fermentation compared to Ethanol Red under the same process condition;
(462) increases the oil yield compared to Ethanol Red under the same process conditions;
(463) has faster fermentation kinetics compared to Ethanol Red under the same process conditions.
(464) In an embodiment the invention relates to processes of recovering/extracting oil from an ethanol production process of the invention comprising the steps of:
(465) In a preferred embodiment the invention relates processes for producing ethanol from starch-containing material comprising the steps of:
(466) i) liquefying the starch-containing material at a temperature a temperature between 80-90 C. using;
(467) an alpha-amylase derived from Bacillus stearothermophilus, optionally having a double deletion I181+G182, and optional substitution N193F, and optionally further one of the following set of substitutions:
(468) E129V+K177L+R179E;
(469) V59A+Q89R+E129V+K177L+R179E+H208Y+K220P+N224L+Q254S;
(470) V59A+Q89R+E129V+K177L+R179E+Q254S+M284V:
(471) V59A+E129V+K177L+R179E+Q254S+M284V
(472) E129V+K177L+R179E+K220P+N224L+S242Q+Q254S (using SEQ ID NO: 1 herein for numbering);
(473) optionally a Pyrococcus furiosus protease; and
(474) optionally a Penicillium oxalicum glucoamylase, optionally having the sequence shown in SEQ ID NO: 14 having substitutions selected from the group of:
(475) K79V;
(476) K79V+P11F+T65A+Q327F; or
(477) K79V+P2N+P4S+P11F+T65A+Q327F; or
(478) K79V+P11F+D26C+K33C+T65A+Q327F; or
(479) K79V+P2N+P4S+P11F+T65A+Q327W+E501V+Y504T; or
(480) K79V+P2N+P4S+P11F+T65A+Q327F+E501V+Y504T; or
(481) K79V+P11F+T65A+Q327W+E501V+Y504T (using SEQ ID NO: 14 for numbering);
(482) ii) saccharifying using a glucoamylase;
(483) iii) fermenting using a fermenting organism;
(484) iv) recovering the fermentation product to form whole stillage;
(485) v) separating the whole stillage into thin stillage and wet cake;
(486) vi) optionally concentrating the thin stillage into syrup;
(487) wherein oil is recovered/extracted downstream from fermentation step iii) and wherein the fermenting organism is Saccharomyces cerevisiae MBG4851 (deposited under Accession No. V14/004037 at National Measurement Institute, Victoria, Australia) or a fermenting organism strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or a derivative of Saccharomyces strain V14/004037 having defining characteristics of strain V14/004037.
(488) In an embodiment the fermenting organism is a non-recombinant Saccharomyces strain, preferably non-recombinant Saccharomyces cerevisiae strain. In a preferred embodiment the fermenting organism is a non-recombinant Saccharomyces strain, preferably non-recombinant Saccharomyces cerevisiae strain produced using the method described and concerned in U.S. Pat. No. 8,257,959-BB.
(489) Use of Strain V14/004037 (Saccharomyces cerevisiae MBG4851) or a Derivative of Strain V14/004037
(490) Strain V14/004037 (Saccharomyces cerevisiae MBG4851) or a derivative of strain V14/004037 may according to the invention be used for increasing the ethanol yield in fermentation.
(491) Strain V14/004037 (Saccharomyces cerevisiae MBG4851) or a derivative of strain V14/004037 may according to the invention be used to produce reduced levels of lactic acid compared to Ethanol Red under the same process conditions.
(492) Strain V14/004037 (Saccharomyces cerevisiae MBG4851) or a derivative of strain V14/004037 may according to the invention be used to produce reduced levels of glycerol compared to Ethanol Red under the same process conditions;
(493) Strain V14/004037 (Saccharomyces cerevisiae MBG4851) or a derivative of strain V14/004037 may according to the invention be used for reducing the level of acetaldehyde in fermentation.
(494) In an embodiment the invention relates to the use of strain V14/004037 (Saccharomyces cerevisiae MBG4851) or a derivative of strain V14/004037 for reducing the level of acetaldehyde in fermentation compared to Ethanol Red under the same process condition.
(495) The liquefied mash to be fermented has been subjected to alpha-amylase and from 0.5-50 micro gram protease per gram DS, such as 1-5 micro gram protease per gram DS, such as around 1.5 or 3 micro gram protease per gram DS.
(496) The protease may be a bacterial protease. The protease may be derived from a strain of the bacterium Pyrococcus, such as a strain of Pyrococcus furiosus (pfu protease), such as or SEQ ID NO: 13 herein. The protease may be the one disclosed in SEQ ID NO: 13 herein or a protease having at least 80% identity, such as at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID NO: 13 herein.
(497) The alpha-amylase used for liquefying may be of bacterial origin, such as from the genus Bacillus, such as a strain of Bacillus stearothermophilus, in particular a variant of a Bacillus stearothermophilus alpha-amylase, such as the one shown in SEQ ID NO: 1 herein. In a preferred embodiment the Bacillus stearothermophilus alpha-amylase variant is selected from the group with the following mutations:
(498) I181*+G182*+N193F+E129V+K177L+R179E;
(499) I181*+G182*+N193F+V59A+Q89R+E129V+K177L+R179E+H208Y+K220P+N224L+Q254S;
(500) I181*+G182*+N193F+V59A+Q89R+E129V+K177L+R179E+Q254S+M284V;
(501) I181*+G182*+N193F+V59A+E129V+K177L+R179E+Q254S+M284V; and
(502) I181*+G182*+N193F+E129V+K177L+R179E+K220P+N224L+S242Q+Q254S (using SEQ ID NO: 1 for numbering).
(503) The liquefied mash, to be fermented, has in an embodiment been subjected to alpha-amylase, glucoamylase and from 0.5-50 micro gram protease per gram DS, such as 1-5 micro gram protease per gram DS such as around 1.5 or 3 micro gram protease per gram DS.
(504) The glucoamylase may be derived from a strain of the genus Penicillium, especially a strain of Penicillium oxalicum disclosed in SEQ ID NOs: 9 or 14 herein.
(505) The glucoamylase may be a variant of the Penicillium oxalicum glucoamylase having a K79V substitution (using the mature sequence shown in SEQ ID NO: 14 for numbering).
(506) In a preferred embodiment the Penicillium oxalicum glucoamylase has a K79V substitution (using SEQ ID NO: 14 for numbering) and further one of the following:
(507) P11F+T65A+Q327F;
(508) P2N+P4S+P11F+T65A+Q327F (using SEQ ID NO: 14 for numbering).
(509) Yeast of the Invention
(510) The invention relates in one embodiment to a strain of Saccharomyces cerevisiae deposited under the Budapest Treaty at the National Measurement Institute (NMI) having deposit accession no. V14/004037.
(511) The majority of the world's fuel ethanol is produced by industrial scale fermentation of starch-based sugars, in substrates such as corn mash. During industrial scale fermentation, the yeast encounter various physiological challenges including variable concentrations of sugars, high concentrations of yeast metabolites such as ethanol, glycerol, organic acids, osmotic stress, as well as potential competition from contaminating microbes such as wild yeasts and bacteria. As a consequence, many Saccharomyces strains are not suitable for use in industrial fermentation. The most widely used commercially available industrial strain of Saccharomyces (i.e. for industrial scale fermentation) is the Saccharomyces cerevisiae strain used, for example, in the product Ethanol Red. This strain is well suited to industrial ethanol production, however improved strains of Saccharomyces cerevisiae are needed.
(512) WO 2011/035392 describes strain NMI V09/024011, which is a strain of Saccharomyces cerevisiae which produces higher levels of ethanol from corn mash than strains of Saccharomyces cerevisiae used in the fuel ethanol industry such as Ethanol Red. However, a limitation of strain NMI V09/024011 is that its fermentation kinetics are slower than those of Ethanol Red. Also, the higher levels of ethanol that V09/024011 produces relative to Ethanol Red were only found when corn mash has been heavily supplemented with exogenous sugar sources such as dextrin. Under such conditions, mash fermentations need to be run for extended periods, beyond what are normally encountered in the industrial process. As such, high concentration sugar supplementation is not necessarily of industrial relevance and may not be encountered at scale. The inventors have now produced strain no. V14/004037 which is capable of producing even higher ethanol yields from endogenously occurring corn sugar consumed under the conditions encountered in industrial scale fermentation, such as those encountered during fermentation of corn mash, than V09/024011 or commercially available industrial Saccharomyces cerevisiae strains used in the ethanol industry. Strain no. V14/004037 also exhibits faster fermentation kinetics than strain no. V09/024011. As described herein, the levels of ethanol produced by strain no. V14/004037 under the conditions encountered during industrial fermentation of corn mash are greater than that of the commercially available industrial yeast strains such as Ethanol Red, and that of strain V09/024011. Thus, strain no. V14/004037 has the necessary characteristics for industrial production of ethanol from substrates such as corn mash.
(513) Strain no. V14/004037 is a non-recombinant Saccharomyces cerevisiae strain developed by breeding which: (a) produces a higher titre of ethanol at 50 hrs fermentation than strains V09/024011 and Ethanol Red, under the same conditions in a corn mash fermentation; (b) produces a higher amount of ethanol than V09/024011 at 20 h, under the same conditions in a corn mash fermentation; (c) produces less glycerol than Ethanol Red and V09/024011 under the same conditions in a corn mash fermentation. (d) leaves less glucose remaining following fermentation than Ethanol Red and V09/024011 under the same conditions in a corn mash fermentation; (e) leaves less maltose remaining following fermentation than Ethanol Red and V09/024011 under the same conditions in a corn mash fermentation.
(514) As used herein, a defining characteristics of strain no. V14/004037 is any one or more of the following characteristics: (a) produces ethanol in an amount in the range from 13.0 to 14.0% w/v at 32 C. in 44 hours in a corn mash fermentation; (b) produces glycerol in an amount in the range from 1.300 to 1.400% w/v at 32 C. in 44 hours in a corn mash fermentation; (c) produces a ratio of % w/v ethanol produced to % w/v glycerol produced following fermentation of corn mash at 32 C. for 50 hours in the range from 9 to 11; (d) produces a ratio of % w/v ethanol produced to % w/v glucose remaining following fermentation of corn mash at 32 C. for 50 hours in the range from 100 to 900, 200 to 850, 300 to 850, 400 to 850; (e) produces a ratio of % w/v ethanol produced to % w/v maltose remaining following fermentation of corn mash at 32 C. for 50 hours in the range from 30 to 50.
(515) Typically, the ethanol produced from fermentation of corn mash is produced from fermentation of sugars that are endogenous to the corn mash. Sugars that are endogenous to the corn mash are sugars that are derived from the corn rather than sugars that are added from an exogenous source.
(516) Strain V14/004037 is also capable of growth in media in which xylose is the sole carbon source. In this regard, strain V14/004037 produces about a 7-fold increase in biomass when grown under the conditions specified in Test T1. As a consequence, strain V14/004037 can be readily distinguished from: (a) naturally occurring strains of Saccharomyces; (b) contaminating strains of Saccharomyces that do not utilize xylose; and (c) other strains used in the ethanol industry that do not have the ethanol producing capabilities of strain V14/004037 and/or do not exhibit about a 7-fold increase in biomass in Test T1.
(517) As current wild type and industrial strains of Saccharomyces are not capable of growth on xylose at the rate at which strain V14/004037 grows on xylose, strain V14/004037 is readily differentiated from current wild type strains of Saccharomyces and strains of Saccharomyces that are used in the ethanol industry prior to the present invention such as Ethanol Red.
(518) The invention also relates to a derivative of Saccharomyces strain V14/004037. As used herein, a derivative of strain V14/004037 is a strain derived from strain V14/004037, including through mutagenesis, recombinant DNA technology, mating, cell fusion, or cytoduction between yeast strains. The strain derived from strain V14/004037 may be a direct progeny (i.e. the product of a mating between strain V14/004037 and another strain or itself), or a distant progeny resulting from an initial mating between V14/004037 and another strain or itself, followed by a large number of subsequent matings.
(519) In one embodiment, a derivative of strain V14/004037 is a hybrid strain produced by culturing a first yeast strain with strain V14/004037 under conditions which permit combining of DNA between the first yeast strain and strain V14/004037.
(520) In one embodiment, a derivative of strain V14/004037 may be prepared by: (a) culturing a first yeast strain with a second yeast strain, wherein the second yeast strain is strain V14/004037 or a derivative of strain V14/004037, under conditions which permit combining of DNA between the first yeast strain and the second yeast strain; and (b) isolating hybrid strains; and (c) optionally repeating steps (a) and (b) using a hybrid strain isolated in step (b) as the first yeast strain and/or the derivative of strain V14/004037.
(521) In one embodiment, the derivative of strain V14/004037 exhibits one or more defining characteristic of strain V14/004037. Derivatives of Saccharomyces which exhibit one or more defining characteristics of strain V14/004037 are produced using strain V14/004037. In this regard, strain V14/004037 forms the basis for preparing other strains having defining characteristics of strain V14/004037. For example, strains of Saccharomyces which exhibit one or more defining characteristics of strain V14/004037 can be derived from strain V14/004037 using methods such as classical mating, cell fusion, or cytoduction between yeast strains, mutagenesis or recombinant DNA technology.
(522) In one embodiment, a derivative of strain V14/004037 which exhibits one or more defining characteristics of strain V14/004037 may be produced by: (a) culturing a first yeast strain with a second yeast strain, wherein the second yeast strain is strain V14/004037 or a derivative of strain V14/004037, under conditions which permit combining of DNA between the first yeast strain and the second yeast strain; (b) screening or selecting for a derivative of strain V14/004037, such as screening or selecting for a derivative with increased ethanol production in corn mash compared to the first strain, and/or screening or selecting for a hybrid which produces less glycerol in corn mash compared to the first strain; (c) optionally repeating steps (a) and (b) with the screened or selected strain as the first yeast strain and/or the second yeast strain, until a derivative of strain V14/004037 is obtained which exhibits one or more defining characteristics of strain V14/004037.
(523) The first yeast strain may be any strain of yeast if the DNA of the strain can be combined with the second yeast strain using methods such as classical mating, cell fusion or cytoduction. Typically, the first yeast strain is a Saccharomyces strain. More typically, the first yeast strain is a Saccharomyces cerevisiae strain. Saccharomyces cerevisiae is as defined by Kurtzman (2003) FEMS Yeast Research vol 4 pp. 233-245. The first yeast strain may have desired properties which are sought to be combined with the defining characteristics of strain V14/004037. The first yeast strain may be, for example, any Saccharomyces cerevisiae strain, such as for example Ethanol Red, V09/024011. It will also be appreciated that the first yeast strain may be strain V14/004037 or a strain which exhibits one or more defining characteristics of strain V14/004037.
(524) The first and second yeast strains are cultured under conditions which permit combining of DNA between the yeast strains. As used herein, combining of DNA between yeast strains refers to combining of all or a part of the genome of the yeast strains. Combining of DNA between yeast strains may be by any method suitable for combining DNA of at least two yeast cells, and may include, for example, mating methods which comprise sporulation of the yeast strains to produce haploid cells and subsequent hybridising of compatible haploid cells; cytoduction; or cell fusion such as protoplast fusion.
(525) In one embodiment, culturing the first yeast strain with the second yeast, under conditions which permit combining of DNA between the first yeast strain and the second yeast strain, comprises: (i) sporulating the first yeast strain and the second yeast strain; (ii) germinating and hybridizing spores produced by the first yeast strain with spores produced by the second yeast strain.
(526) In one embodiment, the method of producing a derivative of strain V14/004037 which exhibits one or more defining characteristics of strain V14/004037, comprises: (a) providing: (i) a first yeast strain; and (ii) a second yeast strain, wherein the second yeast strain is strain V14/004037 or a derivative of strain V14/004037; (b) sporulating the first yeast strain and the second yeast strain; (c) germinating and hybridising the spores of the first yeast strain with germinated spores of the second yeast strain; (d) screening or selecting for a derivative of strain V14/004037, such as screening or selecting for a derivative with increased ethanol production in corn mash compared to the first strain, and/or screening or selecting for a hybrid which produces less glycerol in corn mash compared to the first strain; (e) optionally repeating steps (b) to (d) with the screened or selected strain as the first and/or second yeast strain.
(527) Methods for sporulating, germinating and hybridising yeast strains, and in particular, Saccharomyces strains, are known in the art and are described in, for example, Ausubel, F. M. et al., (1997) Current Protocols in Molecular Biology, Volume 2, pages 13.2.1 to 13.2.5 (John Willey & Sons Inc); Chapter 7, Sporulation and Hybridisation of yeast by R. R. Fowell, in The Yeasts vol 1, A. H. Rose and J. S. Harrison (Eds), 1969, Academic Press.
(528) In one embodiment, the yeast strains may be cultured under conditions which permit cell fusion. Methods for the generation of intraspecific or interspecific hybrids using cell fusion techniques are described in, for example, Spencer et al. (1990) in, Yeast Technology, Spencer J F T and Spencer D M (Eds), Springer Verlag, New York.
(529) In another embodiment, the yeast strains may be cultured under conditions which permit cytoduction. Methods for cytoduction are described in, for example, Inge-Vechymov et al. (1986) Genetika 22: 2625-2636; Johnston (1990) in, Yeast technology, Spencer J F T and Spencer D M (Eds), Springer Verlag, New York.
(530) In one embodiment, screening or selecting for derivatives of strain V14/004037 comprises screening or selecting for a derivative with increased ethanol production in corn mash compared to the first strain, and/or screening or selecting for a hybrid which produces less glycerol in corn mash compared to the first strain.
(531) In another embodiment, the yeast cells may be screened or selected for strains which have one or more of the following characteristics: (a) produces an amount of ethanol that is in the range from an amount higher than that produced by strain Ethanol Red to the amount produced by strain V14/004037, under the same conditions in a corn mash fermentation; (b) produces an amount of glycerol that is in the range from an amount that is less than the amount produced by Ethanol Red to the amount produced by strain V14/004037, under the same conditions in a corn mash fermentation (c) produces a ratio of ethanol to glycerol that is in the range from a ratio higher than the ratio of ethanol to glycerol of Ethanol Red to a ratio that is about the same as the ratio of ethanol to glycerol of strain V14/004037, under the same conditions in a corm mash fermentation. (d) produces a ratio of ethanol to glucose that is in the range from a ratio higher than the ratio of ethanol to glucose of Ethanol Red to a ratio that is about the same as the ratio of ethanol to glucose of strain V14/004037 under the same conditions in a corn mash fermentation; (e) produces a ratio of ethanol to maltose that is in the range from a ratio higher than the ratio of ethanol to maltose of Ethanol Red to a ratio that is about the same as the ratio of ethanol to maltose of strain V14/004037 under the same conditions in a corn mash fermentation.
(532) Methods for determining the amount of ethanol and glycerol produced by a strain are known in the art. For example, methods for testing for determining the amount of ethanol and glycerol produced by a strain during fermentation of corn mash are described in, for example, WO 2011/035392. Once the amount of ethanol and glycerol produced are known, the ratio of ethanol/glycerol can be readily determined. Accordingly, strains can be readily screened for production levels of ethanol and/or glycerol using known methods.
(533) In one embodiment, a derivative of strain V14/004037 which exhibits one or more defining characteristics of strain V14/004037 may be a mutant of strain V14/004037. Methods for producing mutants of Saccharomyces yeast, and specifically mutants of Saccharomyces cerevisiae, are known in the art and described in, for example, Lawrence C. W. (1991) Methods in Enzymology, 194: 273-281.
(534) In another embodiment, a derivative of strain V14/004037 which exhibits one or more defining characteristics of strain V14/004037 may be a recombinant derivative of strain V14/004037. A recombinant derivative of strain V14/004037 is a strain produced by introducing into strain V14/004037 a nucleic acid using recombinant DNA technology. Methods for the introduction of nucleic acid into Saccharomyces yeast cells, and in particular strains of Saccharomyces, are known in the art and are described in, for example, Ausubel, F. M. et al. (1997), Current Protocols in Molecular Biology, Volume 2, pages 13.7.1 to 13.7.7, published by John Wiley & Sons Inc.
(535) The invention also relates to methods for the production of ethanol using the strain described herein. In one form, strain V14/004037 or a derivative strain which exhibits the defining characteristics of strain V14/004037 is incubated with a substrate comprising fermentable sugars under conditions that allow fermentation of the fermentable sugars. The fermentable sugars may be one or more of glucose, galactose, maltose, fructose and sucrose. Typically, the fermentable sugar is glucose. While strain V14/004037 is well suited to fermentation in corn mash, it is envisaged the strain may also be suitable for other fermentation processes. Accordingly, the source of the fermentable sugar in the substrate may be, for example, hydrolysed starch, hydrolysed cellulose, molasses, cane juice, grape juice, fruit juice, glucose, maltodextrins, raw sugar juice, galactose, sucrose, or any other forms of fermentable sugars. In one form, the source of fermentable sugar in the substrate is hydrolysed starch. Typically, the starch is obtained from a substrate such as corn mash. In preparing the substrate, the grain is typically ground and mixed with water and hydrolytic enzyme(s) under conditions which result in hydrolysis of the starch and release of fermentable sugars such as glucose. Typical enzymes for hydrolysis of the starch include a-amylase, amyloglucosidase, pullulanase, b-amylase, glucoamylase, or mixtures thereof. Enzymes suitable for hydrolysis are available from, for example, Novozymes or Genencor Inc. In one form, substrate is provided in the form of corn mash. Corn mash is typically produced by: (a) grinding corn to form a meal; (b) mixing the meal with water; and (c) hydrolyzing the starch in the corn meal. Methods for preparation of corn mash are known in the art and described in, for example, Thomas, K. C. et al., (2001) Journal of Applied Microbiology, volume 90, pages 819-828. Methods for the preparation of other starch-based substrates including sorghum, starch streams and combinations thereof are also known in the art and described in, for example, Kwiatkowski J. R. et al. (2003) Industrial Crops and Products 23: 288-296 and Bothast R. J. and Schlicher M. A. (2005) Applied Microbial Biotechnology 67: 19-25
(536) The fermentation is carried out at a temperature which permits fermentation of the fermentable sugars. Typically, the temperature at which the fermentation is carried out is from 25-34 C.
(537) The fermentation results in an alcoholic mash comprising ethanol and residual sugars in solution, and a particulate portion comprising residual solids including yeast. Ethanol is isolated from the mash using methods know in the art such as distillation or filtration.
(538) Methods for fermentation and distillation are known in the art and are described in, for example, Kwiatkowski J. R. et al. (2003) Industrial Crops and Products 23: 288-296 and Bothast R. J. and Schlicher M. A. (2005) Applied Microbial Biotechnology 67: 19-25
(539) The invention further relates to a method of producing distiller's grain. Distiller's grains may be produced from the residual solids produced in the fermentation using methods known in the art and described in, for example, U.S. Pat. No. 7,572,353. Because Saccharomyces strain V14/004037 reduces the level of residual sugars remaining following fermentation, the distiller's grain which results from fermentation using strain V14/004037 has a lowered glucose content and is therefore more stable and less prone to charring, caramelisation or contamination with unwanted microorganisms.
(540) Furthermore, lower glycerol content in distillers grains is a process advantage because less time is required for drying the distiller's grains. In addition, less glycerol in the distiller's grains results in improved flowability, and further results in distiller's grains which has a higher nutrient content (e.g. higher protein).
(541) As used herein, the singular forms a, an and the include plural reference unless the context clearly indicates otherwise. Thus, for example, a reference to a cell includes a plurality of such cells. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.
(542) As used herein, except where the context requires otherwise due to express language or necessary implication, the word comprise or variations such as comprises or comprising is used in an inclusive sense, i.e. to specify the presence of the stated features but not to preclude the presence or addition of further features in various embodiments of the invention.
(543) Test T1
(544) Step 1: Yeast strains are streaked onto 2% w/v D-glucose 1% bacteriological peptone and 0.5% yeast extract medium solidified with 2% agar using standard microbiological techniques.
(545) Step 2: After incubation for 72 hours at 30 C., yeast cells are taken from plates using a sterile microbiological loop and inoculated to an OD.sub.600 (Optical Density at 600 nm) of between 0.1 and 0.2 units (OD.sub.600 at T.sub.0) in 50 ml of broth containing xylose (5% w/v), Difco Yeast Nitrogen Base w/o amino acids (0.67%), citric acid (0.3%) and trisodium citrate (0.7%) in distilled water in a 250 ml Erlenmeyer flask. An OD.sub.600 of 0.1 unit is equal to approximately 910.sup.5 yeast cells/mL. D-(+)-Xylose, minimum 99% can be obtained from Sigma-Aldrich.
Step 3: Cultures are incubated at 30 deg Celsius with shaking at 220 rpm (10 cm orbital diameter) for 48 hours.
Step 4: After 48 hours incubation, OD.sub.600 of culture is measured (OD.sub.600 at T.sub.48).
Step 5: The fold increase in biomass is determined by the equation:
OD.sub.600 at T.sub.48/OD.sub.600 at T.sub.0.
Composition of the Invention
(546) In this aspect the invention relates to a formulated Saccharomyces yeast composition comprising a yeast strain of the invention and a naturally occurring and/or a nonenaturally occurring component.
(547) As mentioned above a Saccharomyces yeast strain, in particular Saccharomyces cerevisiae yeast strain, of the invention, may according to the invention may be in any viable form, including crumbled, dry, including active dry and instant, compressed, cream (liquid) form etc. In a preferred embodiment the Saccharomyces cerevisiae yeast strain of the invention is dry yeast, such as active dry yeast or instant yeast. In a preferred embodiment the Saccharomyces cerevisiae yeast strain of the invention is crumbled yeast. In a preferred embodiment the Saccharomyces cerevisiae yeast strain is compressed yeast. In an embodiment the Saccharomyces cerevisiae yeast strain of the invention is cream yeast.
(548) In an embodiment the invention relates to a composition comprising a Saccharomyces yeast of the invention, in particular Saccharmyces MBG4851 and one or more of the component selected from the group consisting of: surfactants, emulsifiers, gums, swelling agent, and antioxidants and other processing aids.
(549) Surfactant
(550) According to the invention the composition may comprise a Saccharomyces yeast of the invention, in particular Saccharmyces MBG4851 and any suitable surfactants. In an embodiment the surfactant(s) is/are an anionic surfactant, cationic surfactant, and/or nonionic surfactant.
(551) Emulsifier
(552) According to the invention the composition may comprise a Saccharomyces yeast of the invention, in particular Saccharmyces MBG4851 and any suitable emulsifier. In an embodiment the emulsifier is a fatty-acid ester of sorbitan. In an embodiment the emulsifier is selected from the group of sorbitan monostearate (SMS), citric acid esters of monodiglycerides, polyglycerolester, fatty acid esters of propylene glycol.
(553) In an embodiment the composition of the invention comprises a Saccharomyces yeast of the invention, in particular Saccharmyces MBG4851, and Olindronal SMS, Olindronal SK, or Olindronal SPL including composition concerned in European Patent No. 1,724,336 (hereby incorporated by reference). These products are commercially available from Bussetti, Austria, for active dry yeast.
(554) Gum
(555) According to the invention the composition may comprise a Saccharomyces yeast of the invention, in particular Saccharmyces MBG4851 and any suitable gum. In an embodiment the gum is selected from the group of carob, guar, tragacanth, arabic, xanthan and acacia gum, in particular for cream, compressed and dry yeast.
(556) Swelling Agents
(557) According to the invention the composition may comprise a Saccharomyces yeast of the invention, in particular Saccharmyces MBG4851 and any suitable swelling agent. In an embodiment the swelling agent is methyl cellulose or carboxymethyl cellulose.
(558) Antioxidant
(559) According to the invention the composition may comprise a Saccharomyces yeast of the invention, in particular Saccharmyces MBG4851, and any suitable anti-oxidant. In an embodiment the antioxidant is butylated hydroxyanisol (BHA) and/or butylated hydroxytoluene (BHT), or ascorbic acid (vitamin C), particular for active dry yeast.
(560) As used herein, the singular forms a, an and the include plural reference unless the context clearly indicates otherwise. Thus, for example, a reference to a cell includes a plurality of such cells. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.
(561) As used herein, except where the context requires otherwise due to express language or necessary implication, the word comprise or variations such as comprises or comprising is used in an inclusive sense, i.e. to specify the presence of the stated features but not to preclude the presence or addition of further features in various embodiments of the invention.
(562) Various references are cited herein, the disclosures of which are incorporated by reference in their entireties.
(563) Materials & Methods
(564) Materials:
(565) Alpha-Amylase A (AAA): Bacillus stearothermophilus alpha-amylase with the mutations I181*+G182*+N193F truncated to 491 amino acids (using SEQ ID NO: 1 herein for numbering)
(566) Alpha-Amylase F: Commercial alpha-amylase sold under the trade name Fuelzyme by Verinium, USA.
(567) Alpha-Amylase 369 (AA369): Bacillus stearothermophilus alpha-amylase with the mutations: I181*+G182*+N193F+V59A+Q89R+E129V+K177L+R179E+Q254S+M284V truncated to 491 amino acids (using SEQ ID NO: 1 herein for numbering);
(568) Penicillium oxalicum glucoamylase variant PE498 (PoAMG498): Penicillium oxalicum glucoamylase variant having the following mutations: K79V+P2N+P4S+P11F+T65A+Q327F (using SEQ ID NO: 14 herein for numbering):
(569) Protease Pfu (PFU): Protease derived from Pyrococcus furiosus shown in SEQ ID NO: 13 herein.
(570) Protease X: Metallo protease derived from Thermoascus aurantiacus CGMCC No. 0670 disclosed as amino acids 1-177 in SEQ ID NO: 3 herein and amino acids 1-177 in SEQ ID NO: 2 in WO 2003/048353.
(571) Glucoamylase SA (GSA) comprises a blend comprising Talaromyces emersonii glucoamylase disclosed in WO99/28448 (SEQ ID NO: 19 herein), Trametes cingulata glucoamylase disclosed as SEQ ID NO: 2 in WO 06/69289 and SEQ ID NO: 20 herein, and Rhizomucor pusillus alpha-amylase with Aspergillus niger glucoamylase linker and SBD disclosed as SEQ ID NO: 16 herein with the following substitutions: G128D+D143N (activity ratio AGU:AGU:FAU(F): approx. 30:7:1).
Cellulase VD (CVD): Cellulolytic composition derived from Trichoderma reesei comprising GH61A polypeptide having cellulolytic enhancing activity derived from a strain of Penicillium emersonii (SEQ ID NO: 2 in WO 2011/041397), Aspergillus fumigatus beta-glucosidase variant (SEQ ID NO: 2 in WO 2005/047499 with the following substitutions: F100D, S283G, N456E, F512Y) disclosed in WO 2012/044915; Aspergillus fumigatus Cel7A CBH1 disclosed as SEQ ID NO: 6 in WO2011/057140 and Aspergillus fumigatus CBH II disclosed as SEQ ID NO: 18 in WO 2011/057140.
Yeast:
ETHANOL RED (ER): Saccharomyces cerevisiae yeast available from Fermentis/Lesaffre, USA.
MBG4851: Saccharomyces cerevisiae yeast (non-recombinant) deposited by Microbiogen Pty Ltd, Unit E2, Lane Cove Business Park, 16 Mars Road, Lane Cove, NSW 2066, Australia under the terms of the Budapest Treaty with the National Measurement Institute, Victoria, Australia) and given the following accession number:
(572) TABLE-US-00001 Deposit Accession Number Date of Deposit MBG4851 V14/004037 Feb. 17, 2014
(573) The strain has been deposited under conditions that assure that access to the culture will be available during the pendency of this patent application to one determined by the Commissioner of Patents and Trademarks to be entitled thereto under 37 C.F.R. 1.14 and 35 U.S.C. 122. The deposit represents a substantially pure culture of the deposited strain. The deposit is available as required by foreign patent laws in countries wherein counterparts of the subject application, or its progeny are filed. However, it should be understood that the availability of a deposit does not constitute a license to practice the subject invention in derogation of patent rights granted by governmental action.
(574) The invention described and claimed herein is not to be limited in scope by the specific aspects herein disclosed, since these aspects are intended as illustrations of several aspects of the invention. Any equivalent aspects are intended to be within the scope of this invention.
(575) Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims. In the case of conflict, the present disclosure including definitions will control.
(576) Various references are cited herein, the disclosures of which are incorporated by reference in their entireties.
(577) Methods
(578) Identity:
(579) The relatedness between two amino acid sequences or between two nucleotide sequences is described by the parameter identity.
(580) For purposes of the present invention the degree of identity between two amino acid sequences, as well as the degree of identity between two nucleotide sequences, may be determined by the program align which is a Needleman-Wunsch alignment (i.e. a global alignment). The program is used for alignment of polypeptide, as well as nucleotide sequences. The default scoring matrix BLOSUM50 is used for polypeptide alignments, and the default identity matrix is used for nucleotide alignments. The penalty for the first residue of a gap is 12 for polypeptides and 16 for nucleotides. The penalties for further residues of a gap are 2 for polypeptides, and 4 for nucleotides.
(581) Align is part of the FASTA package version v20u6 (see W. R. Pearson and D. J. Lipman (1988), Improved Tools for Biological Sequence Analysis, PNAS 85:2444-2448, and W. R. Pearson (1990) Rapid and Sensitive Sequence Comparison with FASTP and FASTA, Methods in Enzymology 183:63-98). FASTA protein alignments use the Smith-Waterman algorithm with no limitation on gap size (see Smith-Waterman algorithm, T. F. Smith and M. S. Waterman (1981) J. Mol. Biol. 147:195-197).
(582) Protease Assays
(583) AZCL-Casein Assay
(584) A solution of 0.2% of the blue substrate AZCL-casein is suspended in Borax/NaH.sub.2PO.sub.4 buffer pH9 while stirring. The solution is distributed while stirring to microtiter plate (100 microL to each well), 30 microL enzyme sample is added and the plates are incubated in an Eppendorf Thermomixer for 30 minutes at 45 C. and 600 rpm. Denatured enzyme sample (100 C. boiling for 20 min) is used as a blank. After incubation the reaction is stopped by transferring the microtiter plate onto ice and the coloured solution is separated from the solid by centrifugation at 3000 rpm for 5 minutes at 4 C. 60 microL of supernatant is transferred to a microtiter plate and the absorbance at 595 nm is measured using a BioRad Microplate Reader.
(585) pNA-Assay
(586) 50 microL protease-containing sample is added to a microtiter plate and the assay is started by adding 100 microL 1 mM pNA substrate (5 mg dissolved in 100 microL DMSO and further diluted to 10 mL with Borax/NaH.sub.2PO.sub.4 buffer pH 9.0). The increase in OD.sub.405 at room temperature is monitored as a measure of the protease activity.
(587) Glucoamylase activity (AGU) Glucoamylase activity may be measured in Glucoamylase Units (AGU).
(588) The Novo Glucoamylase Unit (AGU) is defined as the amount of enzyme, which hydrolyzes 1 micromole maltose per minute under the standard conditions 37 C., pH 4.3, substrate: maltose 23.2 mM, buffer: acetate 0.1 M, reaction time 5 minutes.
(589) An autoanalyzer system may be used. Mutarotase is added to the glucose dehydrogenase reagent so that any alpha-D-glucose present is turned into beta-D-glucose. Glucose dehydrogenase reacts specifically with beta-D-glucose in the reaction mentioned above, forming NADH which is determined using a photometer at 340 nm as a measure of the original glucose concentration.
(590) TABLE-US-00002 AMG incubation: Substrate: maltose 23.2 mM Buffer: acetate 0.1M pH: 4.30 0.05 Incubation temperature: 37 C. 1 Reaction time: 5 minutes Enzyme working range: 0.5-4.0 AGU/mL
(591) TABLE-US-00003 Color reaction: GlucDH: 430 U/L Mutarotase: 9 U/L NAD: 0.21 mM Buffer: phosphate 0.12M; 0.15M NaCl pH: 7.60 0.05 Incubation temperature: 37 C. 1 Reaction time: 5 minutes Wavelength: 340 nm
(592) A folder (EB-SM-0131.02/01) describing this analytical method in more detail is available on request from Novozymes A/S, Denmark, which folder is hereby included by reference.
(593) Acid Alpha-Amylase Activity (AFAU)
(594) Acid alpha-amylase activity may be measured in AFAU (Acid Fungal Alpha-amylase Units), which are determined relative to an enzyme standard. 1 AFAU is defined as the amount of enzyme which degrades 5.260 mg starch dry matter per hour under the below mentioned standard conditions.
(595) Acid alpha-amylase, an endo-alpha-amylase (1,4-alpha-D-glucan-glucanohydrolase, E.C. 3.2.1.1) hydrolyzes alpha-1,4-glucosidic bonds in the inner regions of the starch molecule to form dextrins and oligosaccharides with different chain lengths. The intensity of color formed with iodine is directly proportional to the concentration of starch. Amylase activity is determined using reverse colorimetry as a reduction in the concentration of starch under the specified analytical conditions.
(596) ##STR00001##
blue/violet t=23 sec. decoloration
(597) Standard Conditions/Reaction Conditions:
(598) TABLE-US-00004 Substrate: Soluble starch, approx. 0.17 g/L Buffer: Citrate, approx. 0.03M Iodine (I2): 0.03 g/L CaCl2: 1.85 mM pH: 2.50 0.05 Incubation temperature: 40 C. Reaction time: 23 seconds Wavelength: 590 nm Enzyme concentration: 0.025 AFAU/mL Enzyme working range: 0.01-0.04 AFAU/mL
(599) A folder EB-SM-0259.02/01 describing this analytical method in more detail is available upon request to Novozymes A/S, Denmark, which folder is hereby included by reference.
(600) Alpha-Amylase Activity (KNU)
(601) The alpha-amylase activity may be determined using potato starch as substrate. This method is based on the break-down of modified potato starch by the enzyme, and the reaction is followed by mixing samples of the starch/enzyme solution with an iodine solution. Initially, a blackish-blue color is formed, but during the break-down of the starch the blue color gets weaker and gradually turns into a reddish-brown, which is compared to a colored glass standard.
(602) One Kilo Novo alpha amylase Unit (KNU) is defined as the amount of enzyme which, under standard conditions (i.e., at 37 C.+/0.05; 0.0003 M Ca.sup.2+; and pH 5.6) dextrinizes 5260 mg starch dry substance Merck Amylum solubile.
(603) A folder EB-SM-0009.02/01 describing this analytical method in more detail is available upon request to Novozymes A/S, Denmark, which folder is hereby included by reference.
(604) Alpha-Amylase Activity (KNU-A)
(605) Alpha amylase activity is measured in KNU(A) Kilo Novozymes Units (A), relative to an enzyme standard of a declared strength.
(606) Alpha amylase in samples and -glucosidase in the reagent kit hydrolyze the substrate (4,6-ethylidene(G.sub.7)-p-nitrophenyl(G.sub.1)-,D-maltoheptaoside (ethylidene-G.sub.7PNP) to glucose and the yellow-colored p-nitrophenol.
(607) The rate of formation of p-nitrophenol can be observed by Konelab 30. This is an expression of the reaction rate and thereby the enzyme activity.
(608) ##STR00002##
The enzyme is an alpha-amylase with the enzyme classification number EC 3.2.1.1.
(609) TABLE-US-00005 Parameter Reaction conditions Temperature 37 C. pH 7.00 (at 37 C.) Substrate conc. Ethylidene-G.sub.7PNP, R2: 1.86 mM Enzyme conc. (conc. of high/low 1.35-4.07 KNU(A)/L standard in reaction mixture) Reaction time 2 min Interval kinetic measuring time 7/18 sec. Wave length 405 nm Conc. of reagents/chemicals -glucosidase, critical for the analysis R1: 3.39 kU/L
(610) A folder EB-SM-5091.02-D on determining KNU-A activity is available upon request to Novozymes A/S, Denmark, which folder is hereby included by reference.
(611) Alpha-Amylase Activity KNU(S)
(612) BS-amylase in samples and the enzyme alpha-glucosidase in the reagent kit hydrolyze substrate (4,6-ethylidene(G7)-p-nitrophenyl(G1)-alpha-D-maltoheptaoside (ethylidene-G7PNP)) to glucose and the yellow-colored p-nitrophenol.
(613) The rate of formation of p-nitrophenol can be observed by Konelab 30. This is an expression of the reaction rate and thereby the enzyme activity.
(614) Reaction Conditions
(615) TABLE-US-00006 Reaction: pH 7.15 Temperature 37 C. Reaction Time 180 sec Detection Wavelength 405 nm Measuring Time 120 sec
Unit Definition
(616) Bacillus stearothermophilus amylase (BS-amylase) activity is measured in KNU(S), Kilo Novo Units (sterarothermophilus), relative to an enzyme standard of a declared strength.
(617) This analytical method is described in more details in EB-SM-0221.02 (incorporated by reference) available from Novozymes A/S, Denmark, on request.
(618) Determination of FAU(F)
(619) FAU(F) Fungal Alpha-Amylase Units (Fungamyl) is measured relative to an enzyme standard of a declared strength.
(620) TABLE-US-00007 Reaction conditions Temperature 37 C. pH 7.15 Wavelength 405 nm Reaction time 5 min Measuring time 2 min
(621) A folder (EB-SM-0216.02) describing this standard method in more detail is available on request from Novozymes A/S, Denmark, which folder is hereby included by reference.
(622) Determination of Pullulanase Activity (NPUN)
(623) Endo-pullulanase activity in NPUN is measured relative to a Novozymes pullulanase standard. One pullulanase unit (NPUN) is defined as the amount of enzyme that releases 1 micro mol glucose per minute under the standard conditions (0.7% red pullulan (Megazyme), pH 5, 40 C., 20 minutes). The activity is measured in NPUN/ml using red pullulan.
(624) 1 mL diluted sample or standard is incubated at 40 C. for 2 minutes. 0.5 mL 2% red pullulan, 0.5 M KCl, 50 mM citric acid, pH 5 are added and mixed. The tubes are incubated at 40 C. for 20 minutes and stopped by adding 2.5 ml 80% ethanol. The tubes are left standing at room temperature for 10-60 minutes followed by centrifugation 10 minutes at 4000 rpm. OD of the supernatants is then measured at 510 nm and the activity calculated using a standard curve.
(625) The present invention is described in further detail in the following examples which are offered to illustrate the present invention, but not in any way intended to limit the scope of the invention as claimed. All references cited herein are specifically incorporated by reference for that which is described therein.
EXAMPLES
Example 1
(626) Stability of Alpha-Amylase Variants
(627) The stability of a reference alpha-amylase (Bacillus stearothermophilus alpha-amylase with the mutations I181*+G182*+N193F truncated to 491 amino acids (SEQ ID NO: 1 numbering)) and alpha-amylase variants thereof was determined by incubating the reference alpha-amylase and variants at pH 4.5 and 5.5 and temperatures of 75 C. and 85 C. with 0.12 mM CaCl.sub.2 followed by residual activity determination using the EnzChek substrate (EnzChek Ultra Amylase assay kit, E33651, Molecular Probes).
(628) Purified enzyme samples were diluted to working concentrations of 0.5 and 1 or 5 and 10 ppm (micrograms/ml) in enzyme dilution buffer (10 mM acetate, 0.01% Triton X100, 0.12 mM CaCl.sub.2, pH 5.0). Twenty microliters enzyme sample was transferred to 48-well PCR MTP and 180 microliters stability buffer (150 mM acetate, 150 mM MES, 0.01% Triton X100, 0.12 mM CaCl.sub.2, pH 4.5 or 5.5) was added to each well and mixed. The assay was performed using two concentrations of enzyme in duplicates. Before incubation at 75 C. or 85 C., 20 microliters was withdrawn and stored on ice as control samples. Incubation was performed in a PCR machine at 75 C. and 85 C. After incubation samples were diluted to 15 ng/mL in residual activity buffer (100 mM Acetate, 0.01% Triton X100, 0.12 mM CaCl.sub.2, pH 5.5) and 25 microliters diluted enzyme was transferred to black 384-MTP. Residual activity was determined using the EnzChek substrate by adding 25 microliters substrate solution (100 micrograms/ml) to each well. Fluorescence was determined every minute for 15 minutes using excitation filter at 485-P nm and emission filter at 555 nm (fluorescence reader is Polarstar, BMG). The residual activity was normalized to control samples for each setup.
(629) Assuming logarithmic decay half life time (T (min)) was calculated using the equation: T (min)=T(min)*LN(0.5)/LN(% RA/100), where T is assay incubation time in minutes, and % RA is % residual activity determined in assay.
(630) Using this assay setup the half life time was determined for the reference alpha-amylase and variant thereof as shown in Table 1.
(631) TABLE-US-00008 TABLE 1 T (min) T (min) T (min) (pH 4.5, 75 C., (pH 4.5, 85 C., (pH 5.5, 85 C., Mutations 0.12 mM CaCl.sub.2) 0.12 mM CaCl.sub.2) 0.12 mM CaCl.sub.2) Reference Alpha-Amylase A 21 4 111 Reference Alpha-Amylase A with 32 6 301 the substitution V59A Reference Alpha-Amylase A with 28 5 230 the substitution V59E Reference Alpha-Amylase A with 28 5 210 the substitution V59I Reference Alpha-Amylase A with 30 6 250 the substitution V59Q Reference Alpha-Amylase A with 149 22 ND the substitutions V59A + Q89R + G112D + E129V + K177L + R179E + K220P + N224L + Q254S Reference Alpha-Amylase A with >180 28 ND the substitutions V59A + Q89R + E129V + K177L + R179E + H208Y + K220P + N224L + Q254S Reference Alpha-Amylase A with 112 16 ND the substitutions V59A + Q89R + E129V + K177L + R179E + K220P + N224L + Q254S + D269E + D281N Reference Alpha-Amylase A with 168 21 ND the substitutions V59A + Q89R + E129V + K177L + R179E + K220P + N224L + Q254S + I270L Reference Alpha-Amylase A with >180 24 ND the substitutions V59A + Q89R + E129V + K177L + R179E + K220P + N224L + Q254S + H274K Reference Alpha-Amylase A with 91 15 ND the substitutions V59A + Q89R + E129V + K177L + R179E + K220P + N224L + Q254S + Y276F Reference Alpha-Amylase A with 141 41 ND the substitutions V59A + E129V + R157Y + K177L + R179E + K220P + N224L + S242Q + Q254S Reference Alpha-Amylase A with >180 62 ND the substitutions V59A + E129V + K177L + R179E + H208Y + K220P + N224L + S242Q + Q254S Reference Alpha-Amylase A with >180 49 >480 the substitutions V59A + E129V + K177L + R179E + K220P + N224L + S242Q + Q254S Reference Alpha-Amylase A with >180 53 ND the substitutions V59A + E129V + K177L + R179E + K220P + N224L + S242Q + Q254S + H274K Reference Alpha-Amylase A with >180 57 ND the substitutions V59A + E129V + K177L + R179E + K220P + N224L + S242Q + Q254S + Y276F Reference Alpha-Amylase A with >180 37 ND the substitutions V59A + E129V + K177L + R179E + K220P + N224L + S242Q + Q254S + D281N Reference Alpha-Amylase A with >180 51 ND the substitutions V59A + E129V + K177L + R179E + K220P + N224L + S242Q + Q254S + M284T Reference Alpha-Amylase A with >180 45 ND the substitutions V59A + E129V + K177L + R179E + K220P + N224L + S242Q + Q254S + G416V Reference Alpha-Amylase A with 143 21 >480 the substitutions V59A + E129V + K177L + R179E + K220P + N224L + Q254S Reference Alpha-Amylase A with >180 22 ND the substitutions V59A + E129V + K177L + R179E + K220P + N224L + Q254S + M284T Reference Alpha-Amylase A with >180 38 ND the substitutions A91L + M96I + E129V + K177L + R179E + K220P + N224L + S242Q + Q254S Reference Alpha-Amylase A with 57 11 402 the substitutions E129V + K177L + R179E Reference Alpha-Amylase A with 174 44 >480 the substitutions E129V + K177L + R179E + K220P + N224L + S242Q + Q254S Reference Alpha-Amylase A with >180 49 >480 the substitutions E129V + K177L + R179E + K220P + N224L + S242Q + Q254S + Y276F + L427M Reference Alpha-Amylase A with >180 49 >480 the substitutions E129V + K177L + R179E + K220P + N224L + S242Q + Q254S + M284T Reference Alpha-Amylase A with 177 36 >480 the substitutions E129V + K177L + R179E + K220P + N224L + S242Q + Q254S + N376* + I377* Reference Alpha-Amylase A with 94 13 >480 the substitutions E129V + K177L + R179E + K220P + N224L + Q254S Reference Alpha-Amylase A with 129 24 >480 the substitutions E129V + K177L + R179E + K220P + N224L + Q254S + M284T Reference Alpha-Amylase A with 148 30 >480 the substitutions E129V + K177L + R179E + S242Q Reference Alpha-Amylase A with 78 9 >480 the substitutions E129V + K177L + R179V Reference Alpha-Amylase A with 178 31 >480 the substitutions E129V + K177L + R179V + K220P + N224L + S242Q + Q254S Reference Alpha-Amylase A with 66 17 >480 the substitutions K220P + N224L + S242Q + Q254S Reference Alpha-Amylase A with 30 6 159 the substitutions K220P + N224L + Q254S Reference Alpha-Amylase A with 35 7 278 the substitution M284T Reference Alpha-Amylase A with 59 13 ND the substitutions M284V ND not determined
(632) The results demonstrate that the alpha-amylase variants have a significantly greater half-life and stability than the reference alpha-amylase.
Example 2
(633) Preparation of Protease Variants and Test of Thermostability
(634) Strains and Plasmids
(635) E. coli DH12S (available from Gibco BRL) was used for yeast plasmid rescue. pJTP000 is a S. cerevisiae and E. coli shuttle vector under the control of TPI promoter, constructed from pJC039 described in WO 01/92502, in which the Thermoascus aurantiacus M35 protease gene (WO 03048353) has been inserted.
(636) Saccharomyces cerevisiae YNG318 competent cells: MATa Dpep4[cir+] ura3-52, leu2-D2, his 4-539 was used for protease variants expression. It is described in J. Biol. Chem. 272 (15), pp 9720-9727, 1997.
(637) Media and Substrates
(638) 10 Basal solution: Yeast nitrogen base w/o amino acids (DIFCO) 66.8 g/l, succinate 100 g/l, NaOH 60 g/l.
(639) SC-glucose: 20% glucose (i.e., a final concentration of 2%=2 g/100 ml)) 100 ml/l, 5% threonine 4 ml/l, 1% tryptophan 10 ml/l, 20% casamino acids 25 ml/l, 10 basal solution 100 ml/l. The solution is sterilized using a filter of a pore size of 0.20 micrometer. Agar (2%) and H.sub.2O (approx. 761 ml) is autoclaved together, and the separately sterilized SC-glucose solution is added to the agar solution.
YPD: Bacto peptone 20 g/l, yeast extract 10 g/l, 20% glucose 100 ml/l.
YPD+Zn: YPD+0.25 mM ZnSO.sub.4.
PEG/LiAc solution: 40% PEG4000 50 ml, 5 M Lithium Acetate 1 ml.
96 well Zein micro titre plate:
Each well contains 200 microL of 0.05-0.1% of zein (Sigma), 0.25 mM ZnSO.sub.4 and 1% of agar in 20 mM sodium acetate buffer, pH 4.5.
DNA Manipulations
(640) Unless otherwise stated, DNA manipulations and transformations were performed using standard methods of molecular biology as described in Sambrook et al. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor lab. Cold Spring Harbor, N.Y.; Ausubel, F. M. et al. (eds.) Current protocols in Molecular Biology, John Wiley and Sons, 1995; Harwood, C. R. and Cutting, S. M. (Eds.).
(641) Yeast Transformation
(642) Yeast transformation was performed using the lithium acetate method. 0.5 microL of vector (digested by restriction endonucleases) and 1 microL of PCR fragments is mixed. The DNA mixture, 100 microL of YNG318 competent cells, and 10 microL of YEAST MAKER carrier DNA (Clontech) is added to a 12 ml polypropylene tube (Falcon 2059). Add 0.6 ml PEG/LiAc solution and mix gently. Incubate for 30 min at 30 C., and 200 rpm followed by 30 min at 42 C. (heat shock). Transfer to an eppendorf tube and centrifuge for 5 sec. Remove the supernatant and resolve in 3 ml of YPD. Incubate the cell suspension for 45 min at 200 rpm at 30 C. Pour the suspension to SC-glucose plates and incubate 30 C. for 3 days to grow colonies. Yeast total DNA are extracted by Zymoprep Yeast Plasmid Miniprep Kit (ZYMO research).
(643) DNA Sequencing
(644) E. coli transformation for DNA sequencing was carried out by electroporation (BIO-RAD Gene Pulser). DNA Plasmids were prepared by alkaline method (Molecular Cloning, Cold Spring Harbor) or with the Qiagen Plasmid Kit. DNA fragments were recovered from agarose gel by the Qiagen gel extraction Kit. PCR was performed using a PTC-200 DNA Engine. The ABI PRISM 310 Genetic Analyzer was used for determination of all DNA sequences.
(645) Construction of Protease Expression Vector
(646) The Thermoascus M35 protease gene was amplified with the primer pair Prot F (SEQ ID NO: 4) and Prot R (SEQ ID NO: 5). The resulting PCR fragments were introduced into S. cerevisiae YNG318 together with the pJC039 vector (described in WO 2001/92502) digested with restriction enzymes to remove the Humicola insolens cutinase gene.
(647) The Plasmid in yeast clones on SC-glucose plates was recovered to confirm the internal sequence and termed as pJTP001.
(648) Construction of Yeast Library and Site-Directed Variants
(649) Library in yeast and site-directed variants were constructed by SOE PCR method (Splicing by Overlap Extension, see PCR: A practical approach, p. 207-209, Oxford University press, eds. McPherson, Quirke, Taylor), followed by yeast in vivo recombination.
(650) General Primers for Amplification and Sequencing
(651) The primers AM34 (SEQ ID NO: 6) and AM35 (SEQ ID NO:7) were used to make DNA fragments containing any mutated fragments by the SOE method together with degenerated primers (AM34+Reverse primer and AM35+forward primer) or just to amplify a whole protease gene (AM34+AM35).
(652) TABLE-US-00009 PCR reaction system: Conditions: 48.5 microL H.sub.2O 1 94 C. 2 min 2 beads puRe Taq Ready-To-Go PCR 2 94 C. 30 sec (Amersham Biosciences) 3 55 C. 30 sec 0.5 micro L X 2 100 pmole/microL of primers 4 72 C. 90 sec 0.5 microL template DNA 2-4 25 cycles 5 72 C. 10 min
(653) DNA fragments were recovered from agarose gel by the Qiagen gel extraction Kit. The resulting purified fragments were mixed with the vector digest. The mixed solution was introduced into Saccharomyces cerevisiae to construct libraries or site-directed variants by in vivo recombination.
(654) Relative Activity Assay
(655) Yeast clones on SC-glucose were inoculated to a well of a 96-well micro titre plate containing YPD+Zn medium and cultivated at 28 C. for 3 days. The culture supernatants were applied to a 96-well zein micro titer plate and incubated at at least 2 temperatures (ex. 60 C. and 65 C., 70 C. and 75 C., 70 C. and 80 C.) for more than 4 hours or overnight. The turbidity of zein in the plate was measured as A630 and the relative activity (higher/lower temperatures) was determined as an indicator of thermoactivity improvement. The clones with higher relative activity than the parental variant were selected and the sequence was determined.
(656) Remaining Activity Assay
(657) Yeast clones on SC-glucose were inoculated to a well of a 96-well micro titre plate and cultivated at 28 C. for 3 days. Protease activity was measured at 65 C. using azo-casein (Megazyme) after incubating the culture supernatant in 20 mM sodium acetate buffer, pH 4.5, for 10 min at a certain temperature (80 C. or 84 C. with 4 C. as a reference) to determine the remaining activity. The clones with higher remaining activity than the parental variant were selected and the sequence was determined.
(658) Azo-Casein Assay
(659) 20 microL of samples were mixed with 150 microL of substrate solution (4 ml of 12.5% azo-casein in ethanol in 96 ml of 20 mM sodium acetate, pH 4.5, containing 0.01% triton-100 and 0.25 mM ZnSO.sub.4) and incubated for 4 hours or longer.
(660) After adding 20 microL/well of 100% trichloroacetic acid (TCA) solution, the plate was centrifuge and 100 microL of supernatants were pipette out to measure A440.
(661) Expression of Protease Variants in Aspergillus oryzae
(662) The constructs comprising the protease variant genes were used to construct expression vectors for Aspergillus. The Aspergillus expression vectors consist of an expression cassette based on the Aspergillus niger neutral amylase II promoter fused to the Aspergillus nidulans triose phosphate isomerase non translated leader sequence (Pna2/tpi) and the Aspergillus niger amyloglucosidase terminator (Tamg). Also present on the plasmid was the Aspergillus selective marker amdS from Aspergillus nidulans enabling growth on acetamide as sole nitrogen source. The expression plasmids for protease variants were transformed into Aspergillus as described in Lassen et al. (2001), Appl. Environ. Microbiol. 67, 4701-4707. For each of the constructs 10-20 strains were isolated, purified and cultivated in shake flasks.
(663) Purification of Expressed Variants
(664) 1. Adjust pH of the 0.22 m filtered fermentation sample to 4.0. 2. Put the sample on an ice bath with magnetic stirring. Add (NH4)2SO4 in small aliquots (corresponding to approx. 2.0-2.2 M (NH4)2SO4 not taking the volume increase into account when adding the compound). 3. After the final addition of (NH4)2SO4, incubate the sample on the ice bath with gentle magnetic stirring for min. 45 min. 4. Centrifugation: Hitachi himac CR20G High-Speed Refrigerated Centrifuge equipped with R20A2 rotor head, 5 C., 20,000 rpm, 30 min. 5. Dissolve the formed precipitate in 200 ml 50 mM Na-acetate pH 4.0. 6. Filter the sample by vacuum suction using a 0.22 m PES PLUS membrane (IWAKI). 7. Desalt/buffer-exchange the sample to 50 mM Na-acetate pH 4.0 using ultrafiltration (Vivacell 250 from Vivascience equipped with 5 kDa MWCO PES membrane) overnight in a cold room. Dilute the retentate sample to 200 ml using 50 mM Na-acetate pH 4.0. The conductivity of sample is preferably less than 5 mS/cm. 8. Load the sample onto a cation-exchange column equilibrated with 50 mM Na-acetate pH 4.0. Wash unbound sample out of the column using 3 column volumes of binding buffer (50 mM Na-acetate pH 4.0), and elute the sample using a linear gradient, 0-100% elution buffer (50 mM Na-acetate+1 M NaCl pH 4.0) in 10 column volumes. 9. The collected fractions are assayed by an endo-protease assay (cf. below) followed by standard SDS-PAGE (reducing conditions) on selected fractions. Fractions are pooled based on the endo-protease assay and SDS-PAGE.
Endo-Protease Assay 1. Protazyme OL tablet/5 ml 250 mM Na-acetate pH 5.0 is dissolved by magnetic stirring (substrate: endo-protease Protazyme AK tablet from Megazymecat. # PRAK 11/08). 2. With stirring, 250 microL of substrate solution is transferred to a 1.5 ml Eppendorf tube. 3. 25 microL of sample is added to each tube (blank is sample buffer). 4. The tubes are incubated on a Thermomixer with shaking (1000 rpm) at 50 C. for 15 minutes. 5. 250 microL of 1 M NaOH is added to each tube, followed by vortexing. 6. Centrifugation for 3 min. at 16,100G and 25 C. 7. 200 microL of the supernatant is transferred to a MTP, and the absorbance at 590 nm is recorded.
Results
(665) TABLE-US-00010 TABLE 2 Relative activity of protease variants. Numbering of substitution(s) starts from N-terminal of the mature peptide in amino acids 1 to 177 of SEQ ID NO: 3. Relative activity Variant Substitution(s) 65 C./60 C. WT none 31% JTP004 S87P 45% JTP005 A112P 43% JTP008 R2P 71% JTP009 D79K 69% JTP010 D79L 75% JTP011 D79M 73% JTP012 D79L/S87P 86% JTP013 D79L/S87P/A112P 90% JTP014 D79L/S87P/A112P 88% JTP016 A73C 52% JTP019 A126V 69% JTP021 M152R 59%
(666) TABLE-US-00011 TABLE 3 Relative activity of protease variants. Numbering of substitution(s) starts from N-terminal of the mature peptide in amino acids 1 to 177 of SEQ ID NO: 3. Relative activity Substitution(s) and/ 70 C./ 75 C./ 75 C./ Variant or deletion (S) 65 C. 65 C. 70 C. WT none 59% 17% JTP036 D79L/S87P/D142L 73% 73% JTP040 T54R/D79L/S87P 71% JTP042 Q53K/D79L/S87P/I173V 108% JTP043 Q53R/D79L/S87P 80% JTP045 S41R/D79L/S87P 82% JTP046 D79L/S87P/Q158W 96% JTP047 D79L/S87P/S157K 85% JTP048 D79L/S87P/D104R 88% JTP050 D79L/S87P/A112P/D142L 88% JTP051 S41R/D79L/S87P/A112P/D142L 102% JTP052 D79L/S87P/A112P/D142L/S157K 111% JTP053 S41R/D79L/S87P/A112P/D142L/ 113% S157K JTP054 S5/D79L/S87P 92% JTP055 G8/D79L/S87P 95% JTP059 C6R/D79L/S87P 92% JTP061 T46R/D79L/S87P 111% JTP063 S49R/D79L/S87P 94% JTP064 D79L/S87P/N88R 92% JTP068 D79L/S87P/T114P 99% JTP069 D79L/S87P/S115R 103% JTP071 D79L/S87P/T116V 105% JTP072 N26R/D79L/S87P 92% JTP077 A27K/D79L/S87P/A112P/D142L 106% JTP078 A27V/D79L/S87P/A112P/D142L 100% JTP079 A27G/D79L/S87P/A112P/D142L 104%
(667) TABLE-US-00012 TABLE 4 Relative activity of protease variants. Numbering of substitution(s) starts from N-terminal of the mature peptide in amino acids 1 to 177 of SEQ ID NO: 3. Relative activity Remaining Substitution(s) and/ 75 C./ activity Variant or deletion(s) 65 C. 80 C. 84 C. JTP082 S5/D79L/S87P/A112P/D142L 129% 53% JTP083 T46R/D79L/S87P/A112P/D142L 126% JTP088 Y43F/D79L/S87P/A112P/D142L 119% JTP090 D79L/S87P/A112P/T124L/D142L 141% JTP091 D79L/S87P/A112P/T124V/D142L 154% 43% JTP092 S5/N26R/D79L/S87P/A112P/ 60% D142L JTP095 N26R/T46R/D79L/S87P/A112P/ 62% D142L JTP096 T46R/D79L/S87P/T116V/D142L 67% JTP099 D79L/P81R/S87P/A112P/D142L 80% JTP101 A27K/D79L/S87P/A112P/T124V/ 81% D142L JTP116 D79L/Y82F/S87P/A112P/T124V/ 59% D142L JTP117 D79L/Y82F/S87P/A112P/T124V/ 94% D142L JTP127 D79L/S87P/A112P/T124V/A126V/ 53% D142L
(668) TABLE-US-00013 TABLE 5 Relative activity of protease variants. Numbering of substitution(s) starts from N-terminal of the mature peptide in amino acids 1 to 177 of SEQ ID NO: 3. Relative activity 75 C./ 80 C./ 85 C./ Variant Substitutions 70 C. 70 C. 70 C. JTP050 D79L S87P A112P D142L 55% 23% 9% JTP134 D79L Y82F S87P A112P D142L 40% JTP135 S38T D79L S87P A112P A126V 62% D142L JTP136 D79L Y82F S87P A112P A126V 59% D142L JTP137 A27K D79L S87P A112P A126V 54% D142L JTP140 D79L S87P N98C A112P G135C 81% D142L JTP141 D79L S87P A112P D142L T141C 68% M161C JTP143 S36P D79L S87P A112P D142L 69% JTP144 A37P D79L S87P A112P D142L 57% JTP145 S49P D79L S87P A112P D142L 82% 59% JTP146 S50P D79L S87P A112P D142L 83% 63% JTP148 D79L S87P D104P A112P D142L 76% 64% JTP161 D79L Y82F S87G A112P D142L 30% 12% JTP180 S70V D79L Y82F S87G Y97W 52% A112P D142L JTP181 D79L Y82F S87G Y97W D104P 45% A112P D142L JTP187 S70V D79L Y82F S87G A112P 45% D142L JTP188 D79L Y82F S87G D104P A112P 43% D142L JTP189 D79L Y82F S87G A112P A126V 46% D142L JTP193 Y82F S87G S70V D79L D104P 15% A112P D142L JTP194 Y82F S87G D79L D104P A112P 22% A126V D142L JTP196 A27K D79L Y82F S87G D104P 18% A112P A126V D142L Relative activity Variant Substitutions 75 C./70 C. 80 C./70 C. JTP196 A27K D79L Y82F 102% 55% S87G D104P A112P A126V D142L JTP210 A27K Y82F S87G 107% 36% D104P A112P A126V D142L JTP211 A27K D79L Y82F 94% 44% D104P A112P A126V D142L JTP213 A27K Y82F D104P 103% 37% A112P A126V D142L
Example 3
(669) Temperature Profile of Selected Variants Using Purified Enzymes
(670) Selected variants showing good thermo-stability were purified and the purified enzymes were used in a zein-BCA assay as described below. The remaining protease activity was determined at 60 C. after incubation of the enzyme at elevated temperatures as indicated for 60 min.
(671) Zein-BCA Assay:
(672) Zein-BCA assay was performed to detect soluble protein quantification released from zein by variant proteases at various temperatures.
(673) Protocol:
(674) 1) Mix 10 ul of 10 ug/ml enzyme solutions and 100 ul of 0.025% zein solution in a micro titer plate (MTP). 2) Incubate at various temperatures for 60 min. 3) Add 10 ul of 100% trichloroacetic acid (TCA) solution. 4) Centrifuge MTP at 3500 rpm for 5 min. 5) Take out 15 ul to a new MTP containing 100 ul of BCA assay solution (Pierce Cat#:23225, BCA Protein Assay Kit). 6) Incubate for 30 min. at 60 C. 7) Measure A562.
The results are shown in Table 6. All of the tested variants showed an improved thermo-stability as compared to the wt protease.
(675) TABLE-US-00014 TABLE 6 Zein-BCA assay Sample incubated 60 min at indicated temperatures ( C.) (g/ml Bovine serum albumin equivalent peptide released) WT/ 60 70 75 80 85 90 95 Variant C. C. C. C. C. C. C. WT 94 103 107 93 58 38 JTP050 86 101 107 107 104 63 36 JTP077 82 94 104 105 99 56 31 JTP188 71 83 86 93 100 75 53 JTP196 87 99 103 106 117 90 38
Example 4
(676) Characterization of Penicillium oxalicum Glucoamylase
(677) The Penicillium oxalicum glucoamylase is disclosed in SEQ ID NO: 9 herein.
(678) Substrate.
(679) Substrate: 1% soluble starch (Sigma S-9765) in deionized water
(680) Reaction buffer: 0.1 M Acetate buffer at pH 5.3
(681) Glucose concentration determination kit: Wako glucose assay kit (LabAssay glucose, WAKO, Cat#298-65701).
(682) Reaction Condition.
(683) 20 microL soluble starch and 50 microL acetate buffer at pH 5.3 were mixed. 30 microL enzyme solution (50 micro g enzyme protein/ml) was added to a final volume of 100 microL followed by incubation at 37 C. for 15 min.
(684) The glucose concentration was determined by Wako kits.
(685) All the work carried out in parallel.
(686) Temperature Optimum.
(687) To assess the temperature optimum of the Penicillium oxalicum glucoamylase the Reaction condition-assay described above was performed at 20, 30, 40, 50, 60, 70, 80, 85, 90 and 95 C. The results are shown in Table 7.
(688) TABLE-US-00015 TABLE 7 Temperature optimum Temperature ( C.) 20 30 40 50 60 70 80 85 90 95 Relative 63.6 71.7 86.4 99.4 94.6 100.0 92.9 92.5 82.7 82.8 activity (%)
From the results it can be seen that the optimal temperature for Penicillium oxalicum glucoamylase at the given conditions is between 50 C. and 70 C. and the glucoamylase maintains more than 80% activity at 95 C.
Heat Stability.
(689) To assess the heat stability of the Penicillium oxalicum glucoamylase the Reaction condition assay was modified in that the enzyme solution and acetate buffer was preincubated for 15 min at 20, 30, 40, 50, 60, 70, 75, 80, 85, 90 and 95 C. Following the incubation 20 microL of starch was added to the solution and the assay was performed as described above.
(690) The results are shown in Table 8.
(691) TABLE-US-00016 TABLE 8 Heat stability Temperature ( C.) 20 30 40 50 60 70 80 85 90 95 Relative 91.0 92.9 88.1 100.0 96.9 86.0 34.8 36.0 34.2 34.8 activity (%)
(692) From the results it can be seen that Penicillium oxalicum glucoamylase is stable up to 70 C. after preincubation for 15 min in that it maintains more than 80% activity.
(693) pH Optimum.
(694) To assess the pH optimum of the Penicillium oxalicum glucoamylase the Reaction condition assay described above was performed at pH 2.0, 3.0, 3.5, 4.0, 4.5, 5.0, 6.0 7.0, 8.0, 9.0, 10.0 and 11.0. Instead of using the acetate buffer described in the Reaction condition assay the following buffer was used 100 mM Succinic acid, HEPES, CHES, CAPSO, 1 mM CaCl.sub.2, 150 mM KCl, 0.01% Triton X-100, pH adjusted to 2.0, 3.0, 3.5, 4.0, 4.5, 5.0, 6.0 7.0, 8.0, 9.0, 10.0 or 11.0 with HCl or NaOH.
(695) The results are shown in Table 9.
(696) TABLE-US-00017 TABLE 9 pH optimum pH 2.0 3.0 3.5 4.0 4.5 5.0 6.0 7.0 8.0 9.0 10.0 11.0 Relative 71.4 78.6 77.0 91.2 84.2 100.0 55.5 66.7 30.9 17.8 15.9 16.1 activity (%)
(697) From the results it can be seen that Penicillium oxalicum glucoamylase at the given conditions has the highest activity at pH 5.0. The Penicillium oxalicum glucoamylase is active in a broad pH range in the it maintains more than 50% activity from pH 2 to 7.
(698) pH Stability.
(699) To assess the heat stability of the Penicillium oxalicum glucoamylase the Reaction condition assay was modified in that the enzyme solution (50 micro g/mL) was preincubated for 20 hours in buffers with pH 2.0, 3.0, 3.5, 4.0, 4.5, 5.0, 6.0 7.0, 8.0, 9.0, 10.0 and 11.0 using the buffers described under pH optimum. After preincubation, 20 microL soluble starch to a final volume of 100 microL was added to the solution and the assay was performed as described above.
(700) The results are shown in Table 10.
(701) TABLE-US-00018 TABLE 10 pH stability pH 2.0 3.0 3.5 4.0 4.5 5.0 6.0 7.0 8.0 9.0 10.0 11.0 Relative 17.4 98.0 98.0 103.2 100.0 93.4 71.2 90.7 58.7 17.4 17.0 17.2 activity (%)
(702) From the results it can be seen that Penicillium oxalicum glucoamylase, is stable from pH 3 to pH 7 after preincubation for 20 hours and it decreases its activity at pH 8.
Example 5
(703) Thermostability of Protease Pfu.
(704) The thermostability of the Pyrococcus furiosus protease (Pfu S) purchased from Takara Bio Inc, (Japan) was tested using the same methods as in Example 2. It was found that the thermostability (Relative Activity) was 110% at (80 C./70 C.) and 103% (90 C./70 C.) at pH 4.5.
Example 6
(705) Cloning of Penicillium oxalicum Strain Glucoamylase Gene
(706) Preparation of Penicillium oxalicum Strain cDNA.
(707) The cDNA was synthesized by following the instruction of 3 Rapid Amplification of cDNA End System (Invitrogen Corp., Carlsbad, Calif., USA).
(708) Cloning of Penicillium oxalicum Strain Glucoamylase Gene.
(709) The Penicillium oxalicum glucoamylase gene was cloned using the oligonucleotide primer shown below designed to amplify the glucoamylase gene from 5 end.
(710) TABLE-US-00019 (SEQIDNO:22) Senseprimer: 5-ATGCGTCTCACTCTATTATCAGGTG-3
(711) The full length gene was amplified by PCR with Sense primer and AUAP (supplied by 3 Rapid Amplification of cDNA End System) by using Platinum HIFI Taq DNA polymerase (Invitrogen Corp., Carlsbad, Calif., USA). The amplification reaction was composed of 5 l of 10PCR buffer, 2 l of 25 mM MgCl.sub.2, 1 l of 10 mM dNTP, 1 l of 10 uM Sense primer, 1 l of 10 uM AUAP, 2 l of the first strand cDNA, 0.5 l of HIFI Taq, and 37.5 l of deionized water. The PCR program was: 94 C., 3 mins; 10 cycles of 94 C. for 40 secs, 60 C. 40 secs with 1 C. decrease per cycle, 68 C. for 2 min; 25 cycles of 94 C. for 40 secs, 50 C. for 40 secs, 68 C. for 2 min; final extension at 68 C. for 10 mins.
(712) The obtained PCR fragment was cloned into pGEM-T vector (Promega Corporation, Madison, Wis., USA) using a pGEM-T Vector System (Promega Corporation, Madison, Wis., USA) to generate plasmid AMG 1. The glucoamylase gene inserted in the plasmid AMG 1 was sequencing confirmed. E. coli strain TOP10 containing plasmid AMG 1 (designated NN059173), was deposited with the Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH (DSMZ) on Nov. 23, 2009, and assigned accession number as DSM 23123.
Example 7
(713) Expression of Cloned Penicillium oxalicum Glucoamylase
(714) The Penicillium oxalicum glucoamylase gene was re-cloned from the plasmid AMG 1 into an Aspergillus expression vector by PCR using two cloning primer F and primer R shown below, which were designed based on the known sequence and added tags for direct cloning by IN-FUSION strategy.
(715) TABLE-US-00020 PrimerF: (SEQIDNO:23) 5 ACACAACTGGGGATCCACCATGCGTCTCACTCTATTATC PrimerR: (SEQIDNO:24) 5 AGATCTCGAGAAGCTTAAAACTGCCACACGTCGTTGG
(716) A PCR reaction was performed with plasmid AMG 1 in order to amplify the full-length gene. The PCR reaction was composed of 40 g of the plasmid AMG 1 DNA, 1 l of each primer (100 M); 12.5 l of 2 Extensor Hi-Fidelity master mix (Extensor Hi-Fidelity Master Mix, ABgene, United Kingdom), and 9.5 l of PCR-grade water. The PCR reaction was performed using a DYAD PCR machine (Bio-Rad Laboratories, Inc., Hercules, Calif., USA) programmed for 2 minutes at 94 C. followed by a 25 cycles of 94 C. for 15 seconds, 50 C. for 30 seconds, and 72 C. for 1 minute; and then 10 minutes at 72 C.
(717) The reaction products were isolated by 1.0% agarose gel electrophoresis using 1TAE buffer where an approximately 1.9 kb PCR product band was excised from the gel and purified using a GFX PCR DNA and Gel Band Purification Kit (GE Healthcare, United Kingdom) according to manufacturer's instructions. DNA corresponding to the Penicillium oxalicum glucoamylase gene was cloned into an Aspergillus expression vector linearized with BamHI and HindIII, using an IN-FUSION Dry-Down PCR Cloning Kit (BD Biosciences, Palo Alto, Calif., USA) according to the manufacturer's instructions. The linearized vector construction is as described in WO 2005/042735 A1.
(718) A 2 l volume of the ligation mixture was used to transform 25 l of Fusion Blue E. coli cells (included in the IN-FUSION Dry-Down PCR Cloning Kit). After a heat shock at 42 C. for 45 sec, and chilling on ice, 250 l of SOC medium was added, and the cells were incubated at 37 C. at 225 rpm for 90 min before being plated out on LB agar plates containing 50 g of ampicillin per ml, and cultivated overnight at 37 C. Selected colonies were inoculated in 3 ml of LB medium supplemented with 50 g of ampicillin per ml and incubated at 37 C. at 225 rpm overnight. Plasmid DNA from the selected colonies was purified using Mini JETSTAR (Genomed, Germany) according to the manufacturer's instructions. Penicillium oxalicum glucoamylase gene sequence was verified by Sanger sequencing before heterologous expression. One of the plasmids was selected for further expression, and was named XYZ XYZ1471-4.
(719) Protoplasts of Aspergillus niger MBin118 were prepared as described in WO 95/02043. One hundred l of protoplast suspension were mixed with 2.5 g of the XYZ1471-4 plasmid and 250 microliters of 60% PEG 4000 (Applichem) (polyethylene glycol, molecular weight 4,000), 10 mM CaCl.sub.2, and 10 mM Tris-HCl pH 7.5 were added and gently mixed. The mixture was incubated at 37 C. for 30 minutes and the protoplasts were mixed with 6% low melting agarose (Biowhittaker Molecular Applications) in COVE sucrose (Cove, 1996, Biochim. Biophys. Acta 133:51-56) (1M) plates supplemented with 10 mM acetamide and 15 mM CsCl and added as a top layer on COVE sucrose (1M) plates supplemented with 10 mM acetamide and 15 mM CsCl for transformants selection (4 ml topagar per plate). After incubation for 5 days at 37 C. spores of sixteen transformants were picked up and seed on 750 l YP-2% Maltose medium in 96 deepwell MT plates. After 5 days of stationary cultivation at 30 C., 10 l of the culture-broth from each well was analyzed on a SDS-PAGE (Sodium dodecyl sulfate-polyacrylamide gel electrophoresis) gel, Griton XT Precast gel (BioRad, CA, USA) in order to identify the best transformants based on the ability to produce large amount of glucoamylase. A selected transformant was identified on the original transformation plate and was preserved as spores in a 20% glycerol stock and stored frozen (80 C.).
(720) Cultivation.
(721) The selected transformant was inoculated in 100 ml of MLC media and cultivated at 30 C. for 2 days in 500 ml shake flasks on a rotary shaker. 3 ml of the culture broth was inoculated to 100 ml of M410 medium and cultivated at 30 C. for 3 days. The culture broth was centrifugated and the supernatant was filtrated using 0.2 m membrane filters.
(722) Alpha-Cyclodextrin Affinity Gel.
(723) Ten grams of Epoxy-activated Sepharose 6B (GE Healthcare, Chalfont St. Giles, U.K) powder was suspended in and washed with distilled water on a sintered glass filter. The gel was suspended in coupling solution (100 ml of 12.5 mg/ml alpha-cyclodextrin, 0.5 M NaOH) and incubated at room temperature for one day with gentle shaking. The gel was washed with distilled water on a sintered glass filter, suspended in 100 ml of 1 M ethanolamine, pH 10, and incubated at 50 C. for 4 hours for blocking. The gel was then washed several times using 50 mM Tris-HCl, pH 8 and 50 mM NaOAc, pH 4.0 alternatively. The gel was finally packed in a 35-40 ml column using equilibration buffer (50 mM NaOAc, 150 mM NaCl, pH 4.5).
(724) Purification of Glucoamylase from Culture Broth.
(725) Culture broth from fermentation of A. niger MBin118 harboring the glucoamylase gene was filtrated through a 0.22 m PES filter, and applied on a alpha-cyclodextrin affinity gel column previously equilibrated in 50 mM NaOAc, 150 mM NaCl, pH 4.5 buffer. Unbound material was washed off the column with equilibration buffer and the glucoamylase was eluted using the same buffer containing 10 mM beta-cyclodextrin over 3 column volumes.
(726) The glucoamylase activity of the eluent was checked to see, if the glucoamylase had bound to the alpha-cyclodextrin affinity gel. The purified glucoamylase sample was then dialyzed against 20 mM NaOAc, pH 5.0. The purity was finally checked by SDS-PAGE, and only a single band was found.
Example 8
(727) Construction and Expression of a Site-Directed Variant of Penicillium oxalicum Glucoamylase
(728) Two PCR reactions were performed with plasmid XYZ1471-4, described in Example 7, using primers K79V F and K79VR shown below, which were designed to substitute lysine K at position 79 from the mature sequence to valine (V) and primers F-NP003940 and R-NP003940 shown below, which were designed based on the known sequence and added tags for direct cloning by IN-FUSION strategy.
(729) TABLE-US-00021 PrimerK79VF18mer (SEQIDNO:25) GCAGTCTTTCCAATTGAC PrimerK79VR18mer (SEQIDNO:26) AATTGGAAAGACTGCCCG PrimerF-NP003940: (SEQIDNO:27) 5 ACACAACTGGGGATCCACCATGCGTCTCACTCTATTATC PrimerR-NP003940: (SEQIDNO:28) 5 AGATCTCGAGAAGCTTAAAACTGCCACACGTCGTTGG
(730) The PCR was performed using a PTC-200 DNA Engine under the conditions described below.
(731) TABLE-US-00022 PCR reaction system: Conditions: 48.5 micro L H2O 1 94 C. 2 min 2 beads puRe Taq Ready-To-Go PCR 2 94 C. 30 sec Beads (Amersham Biosciences) 3 55 C. 30 sec 0.5 micro L X 2100 pmole/micro L Primers 4 72 C. 90 sec (K79V F + Primer R-NP003940, K79V R + 2-4 25 cycles Primer F-NP003940) 5 72 C. 10 min 0.5 micro L Template DNA
(732) DNA fragments were recovered from agarose gel by the Qiagen gel extraction Kit according to the manufacturer's instruction. The resulting purified two fragments were cloned into an Aspergillus expression vector linearized with BamHI and HindIII, using an IN-FUSION Dry-Down PCR Cloning Kit (BD Biosciences, Palo Alto, Calif., USA) according to the manufacturer's instructions. The linearized vector construction is as described in WO 2005/042735 A1.
(733) The ligation mixture was used to transform E. coli DH5 cells (TOYOBO). Selected colonies were inoculated in 3 ml of LB medium supplemented with 50 g of ampicillin per ml and incubated at 37 C. at 225 rpm overnight. Plasmid DNA from the selected colonies was purified using Qiagen plasmid mini kit (Qiagen) according to the manufacturer's instructions. The sequence of Penicillium oxalicum glucoamylase site-directed variant gene sequence was verified before heterologous expression and one of the plasmids was selected for further expression, and was named pPoPE001.
(734) Protoplasts of Aspergillus niger MBin118 were prepared as described in WO 95/02043. One hundred l of protoplast suspension were mixed with 2.5 g of the pPoPE001 plasmid and 250 microliters of 60% PEG 4000 (Applichem) (polyethylene glycol, molecular weight 4,000), 10 mM CaCl.sub.2, and 10 mM Tris-HCl pH 7.5 were added and gently mixed. The mixture was incubated at 37 C. for 30 minutes and the protoplasts were mixed with 1% agarose L (Nippon Gene) in COVE sucrose (Cove, 1996, Biochim. Biophys. Acta 133:51-56) supplemented with 10 mM acetamide and 15 mM CsCl and added as a top layer on COVE sucrose plates supplemented with 10 mM acetamide and 15 mM CsCl for transformants selection (4 ml topagar per plate). After incubation for 5 days at 37 C. spores of sixteen transformants were picked up and seed on 750 l YP-2% Maltose medium in 96 deepwell MT plates. After 5 days of stationary cultivation at 30 C., 10 l of the culture-broth from each well was analyzed on a SDS-PAGE gel in order to identify the best transformants based on the ability to produce large amount of the glucoamylase.
Example 9
(735) Purification of Site-Directed Po AMG Variant PE001
(736) The selected transformant of the variant and the strain expressing the wild type Penicillium oxalicum glucoamylase described in Example 6 was cultivated in 100 ml of YP-2% maltose medium and the culture was filtrated through a 0.22 m PES filter, and applied on a alpha-cyclodextrin affinity gel column previously equilibrated in 50 mM NaOAc, 150 mM NaCl, pH 4.5 buffer. Unbound materials was washed off the column with equilibration buffer and the glucoamylase was eluted using the same buffer containing 10 mM beta-cyclodextrin over 3 column volumes.
(737) The glucoamylase activity of the eluent was checked to see, if the glucoamylase had bound to the alpha-cyclodextrin affinity gel. The purified glucoamylase samples were then dialyzed against 20 mM NaOAc, pH 5.0.
Example 10
(738) Characterization of PE001 Protease Stability
(739) 40 l enzyme solutions (1 mg/ml) in 50 mM sodium acetate buffer, pH 4.5, were mixed with 1/10 volume of 1 mg/ml protease solutions such as aspergillopepsin I described in Biochem J. 1975 April; 147(1):45-53, or the commercially available product from Sigma and aorsin described in Biochemical journal [0264-6021] Ichishima yr: 2003 vol: 371 iss: Pt 2 pg: 541 and incubated at 4 or 32 C. overnight. As a control experiment, H.sub.2O was added to the sample instead of proteases. The samples were loaded on SDS-PAGE to see if the glucoamylases are cleaved by proteases.
(740) In SDS-PAGE, PE001 only showed one band corresponding to the intact molecule, while the wild type glucoamylase was degraded by proteases and showed a band at lower molecular size at 60 kCa.
(741) TABLE-US-00023 TABLE 11 The result of SDS-PAGE after protease treatment Wild type glucoamylase PE001 Protease aspergillopepsin I aorsin aspergillopepsin I aorsin control Incubation 4 32 4 32 4 32 4 32 4 temperature ( C.) intact 100% 90% 40% 10% 100% 100% 100% 100% 100% glucoamylase (ca. 70 kDa) cleaved N.D. 10% 60% 90% N.D. N.D. N.D N.D. N.D. glucoamylase (ca. 60 kDa) N.D.: not detected.
Example 11
(742) Less Cleavage During Cultivation
(743) Aspergillus transformant of the variant and the wild type Penicillium oxalicum glucoamylase were cultivated in 6-well MT plates containing 4 diluted YP-2% maltose medium supplemented with 10 mM sodium acetate buffer, pH4.5, at 32 C. for 1 week.
(744) The culture supernatants were loaded on SDS-PAGE.
(745) TABLE-US-00024 TABLE 12 The result of SDS-PAGE of the culture supernatants Wild type glucoamylase PE001 intact glucoamylase(ca. 70 kDa) 90% 100% cleaved glucoamylase (ca. 60 kDa) 10% N.D. N.D.: not detected.
(746) The wild type glucoamylase was cleaved by host proteases during fermentation, while the variant yielded only intact molecule.
Example 12
(747) Glucoamylase Activity of Variant Compared to Parent
(748) The glucoamylase activity measures as AGU as described above was checked for the purified enzymes of the wild type Penicillium oxalicum and the variant glucoamylase.
(749) The Glucoamylase Unit (AGU) was defined as the amount of enzyme, which hydrolyzes 1 micromole maltose per minute under the standard conditions (37 C., pH 4.3, substrate: maltose 100 mM, buffer: acetate 0.1 M, reaction time 6 minutes).
(750) TABLE-US-00025 TABLE 13 Relative specific activity AGU/mg Penicillium oxalicum wt 100% Penicillium oxalicum PE001 (SEQ ID NO: 14 + 102% K79V substitution)
Example 13
(751) Purification of Glucoamylase Variants Having Increased Thermostability
(752) The variants showing increased thermostability may be constructed and expressed similar to the procedure described in Example 8. All variants were derived from the PE001. After expression in YPM medium, variants comprising the T65A or Q327F substitution was micropurified as follows:
(753) Mycelium was removed by filtration through a 0.22 m filter. 50 l column material (alpha-cyclodextrin coupled to Mini-Leak divinylsulfone-activated agarose medium according to manufacturer's recommendations) was added to the wells of a filter plate (Whatman, Unifilter 800 l, 25-30 m MBPP). The column material was equilibrated with binding buffer (200 mM sodium acetate pH 4.5) by two times addition of 200 l buffer, vigorous shaking for 10 min (Heidolph, Titramax 101, 1000 rpm) and removal of buffer by vacuum (Whatman, UniVac 3). Subsequently, 400 l culture supernatant and 100 l binding buffer was added and the plate incubated 30 min with vigorous shaking. Unbound material was removed by vacuum and the binding step was repeated. Normally 4 wells were used per variant. Three washing steps were then performed with 200 l buffer of decreasing ionic strength added (50/10/5 mM sodium acetate, pH 4.5), shaking for 15 min and removal of buffer by vacuum. Elution of the bound AMG was achieved by two times addition of 100 l elution buffer (250 mM sodium acetate, 0.1% alpha-cyclodextrin, pH 6.0), shaking for 15 min and collection of eluted material in a microtiter plate by vacuum. Pooled eluates were concentrated and buffer changed to 50 mM sodium acetate pH 4.5 using centrifugal filter units with 10 kDa cut-off (Millipore Microcon Ultracel YM-10). Micropurified samples were stored at 18 C. until testing of thermostability.
Example 14
(754) Protein Thermal Unfolding Analysis (TSA, Thermal Shift Assay).
(755) Protein thermal unfolding of the T65A and Q327F variants, was monitored using Sypro Orange (In-vitrogen, S-6650) and was performed using a real-time PCR instrument (Applied Biosystems; Step-One-Plus).
(756) In a 96-well plate, 25 microliter micropurified sample in 50 mM Acetate pH4.5 at approx. 100 microgram/ml was mixed (5:1) with Sypro Orange (resulting conc.=5; stock solution from supplier=5000). The plate was sealed with an optical PCR seal. The PCR instrument was set at a scan-rate of 76 C. pr. hr, starting at 25 C. and finishing at 96 C.
(757) Protein thermal unfolding of the E501V+Y504T variant, was monitored using Sypro Orange (In-vitrogen, S-6650) and was performed using a real-time PCR instrument (Applied Biosystems; Step-One-Plus).
(758) In a 96-well plate, 15 microliter purified sample in 50 mM Acetate pH4.5 at approx. 50 microgram/ml was mixed (1:1) with Sypro Orange (resulting conc.=5; stock solution from supplier=5000) with or without 200 ppm Acarbose (Sigma A8980). The plate was sealed with an optical PCR seal. The PCR instrument was set at a scan-rate of 76 degrees C. pr. hr, starting at 25 C. and finishing at 96 C.
(759) Fluorescence was monitored every 20 seconds using in-built LED blue light for excitation and ROX-filter (610 nm, emission).
(760) Tm-values were calculated as the maximum value of the first derivative (dF/dK) (ref.: Gregory et al; J Biomol Screen 2009 14: 700.)
(761) TABLE-US-00026 TABLE 14a Sample Tm (Deg. Celsius) +/ 0.4 PO-AMG (PE001) 80.3 Variant Q327F 82.3 Variant T65A 81.9
(762) TABLE-US-00027 TABLE 14b Sample Tm (Deg. Celsius) +/ 0.4 Acarbose: + PO-AMG (PE001) 79.5 86.9 Variant E501V Y504T 79.5 95.2
Example 15
(763) Thermostability Analysis by Differential Scanning Calorimetry (DSC)
(764) Additional site specific variants having substitutions and/or deletions at specific positions were constructed basically as described in Example 8 and purified as described in Example 11.
(765) The thermostability of the purified Po-AMG PE001 derived variants were determined at pH 4.0 or 4.8 (50 mM Sodium Acetate) by Differential Scanning calorimetry (DSC) using a VP-Capillary Differential Scanning calorimeter (MicroCal Inc., Piscataway, N.J., USA). The thermal denaturation temperature, Td ( C.), was taken as the top of the denaturation peak (major endothermic peak) in thermograms (Cp vs. T) obtained after heating enzyme solutions in selected buffers (50 mM Sodium Acetate, pH 4.0 or 4.8) at a constant programmed heating rate of 200 K/hr.
(766) Sample- and reference-solutions (approximately 0.3 ml) were loaded into the calorimeter (reference: buffer without enzyme) from storage conditions at 10 C. and thermally pre-equilibrated for 10 minutes at 20 C. prior to DSC scan from 20 C. to 110 C. Denaturation temperatures were determined with an accuracy of approximately +/1 C.
(767) The isolated variants and the DSC data are disclosed in Table 15 below.
(768) TABLE-US-00028 TABLE 15 Po- DSC Td DSC Td AMG ( C.) @ ( C.) @ name Mutations pH 4.0 pH 4.8 PE001 82.1 83.4 (SEQ ID NO: 14 + K79V) GA167 E501V Y504T 82.1 GA481 T65A K161S 84.1 86.0 GA487 T65A Q405T 83.2 GA490 T65A Q327W 87.3 GA491 T65A Q327F 87.7 GA492 T65A Q327Y 87.3 GA493 P11F T65A Q327F 87.8 88.5 GA497 R1K D3W K5Q G7V N8S T10K P11S 87.8 88.0 T65A Q327F GA498 P2N P4S P11F T65A Q327F 88.3 88.4 GA003 P11F D26C K33C T65A Q327F 83.3 84.0 GA009 P2N P4S P11F T65A Q327W E501V 88.8 Y504T GA002 R1E D3N P4G G6R G7A N8A T10D 87.5 88.2 P11D T65A Q327F GA005 P11F T65A Q327W 87.4 88.0 GA008 P2N P4S P11F T65A Q327F E501V 89.4 90.2 Y504T GA010 P11F T65A Q327W E501V Y504T 89.7 GA507 T65A Q327F E501V Y504T 89.3 GA513 T65A S105P Q327W 87.0 GA514 T65A S105P Q327F 87.4 GA515 T65A Q327W S364P 87.8 GA516 T65A Q327F S364P 88.0 GA517 T65A S103N Q327F 88.9 GA022 P2N P4S P11F K34Y T65A Q327F 89.7 GA023 P2N P4S P11F T65A Q327F D445N 89.9 V447S GA032 P2N P4S P11F T65A I172V Q327F 88.7 GA049 P2N P4S P11F T65A Q327F N502* 88.4 GA055 P2N P4S P11F T65A Q327F N502T 88.0 P563S K571E GA057 P2N P4S P11F R31S K33V T65A 89.5 Q327F N564D K571S GA058 P2N P4S P11F T65A Q327F S377T 88.6 GA064 P2N P4S P11F T65A V325T Q327W 88.0 GA068 P2N P4S P11F T65A Q327F D445N 90.2 V447S E501V Y504T GA069 P2N P4S P11F T65A I172V Q327F 90.2 E501V Y504T GA073 P2N P4S P11F T65A Q327F S377T 90.1 E501V Y504T GA074 P2N P4S P11F D26N K34Y T65A 89.1 Q327F GA076 P2N P4S P11F T65A Q327F I375A 90.2 E501V Y504T GA079 P2N P4S P11F T65A K218A K221D 90.9 Q327F E501V Y504T GA085 P2N P4S P11F T65A S103N Q327F 91.3 E501V Y504T GA086 P2N P4S T10D T65A Q327F E501V 90.4 Y504T GA088 P2N P4S F12Y T65A Q327F E501V 90.4 Y504T GA097 K5A P11F T65A Q327F E501V 90.0 Y504T GA101 P2N P4S T10E E18N T65A Q327F 89.9 E501V Y504T GA102 P2N T10E E18N T65A Q327F E501V 89.8 Y504T GA084 P2N P4S P11F T65A Q327F E501V 90.5 Y504T T568N GA108 P2N P4S P11F T65A Q327F E501V 88.6 Y504T K524T G526A GA126 P2N P4S P11F K34Y T65A Q327F 91.8 D445N V447S E501V Y504T GA129 P2N P4S P11F R31S K33V T65A 91.7 Q327F D445N V447S E501V Y504T GA087 P2N P4S P11F D26N K34Y T65A 89.8 Q327F E501V Y504T GA091 P2N P4S P11F T65A F80* Q327F 89.9 E501V Y504T GA100 P2N P4S P11F T65A K112S Q327F 89.8 E501V Y504T GA107 P2N P4S P11F T65A Q327F E501V 90.3 Y504T T516P K524T G526A GA110 P2N P4S P11F T65A Q327F E501V 90.6 N502T Y504*
Example 16
(769) Thermostability Analysis by Thermo-Stress Test and pNPG Assay
(770) Starting from one of the identified substitution variants from Example 15, identified as GA008, additional variants were tested by a thermo-stress assay in which the supernatant from growth cultures were assayed for glucoamylase (AMG) activity after a heat shock at 83 C. for 5 min.
(771) After the heat-shock the residual activity of the variant was measured as well as in a non-stressed sample.
(772) Description of Po-AMG pNPG Activity Assay:
(773) The Penicillium oxalicum glucoamylase pNPG activity assay is a spectrometric endpoint assay where the samples are split in two and measured thermo-stressed and non-thermo-stressed. The data output is therefore a measurement of residual activity in the stressed samples.
(774) Growth:
(775) A sterile micro titer plate (MTP) was added 200 L rich growth media (FT X-14 without Dowfax) to each well. The strains of interest were inoculated in triplicates directly from frozen stocks to the MTP. Benchmark was inoculated in 20 wells. Non-inoculated wells with media were used as assay blanks. The MTP was placed in a plastic box containing wet tissue to prevent evaporation from the wells during incubation. The plastic box was placed at 34 C. for 4 days.
(776) Assay:
(777) 50 L supernatant was transferred to 50 L 0.5 M NaAc pH 4.8 to obtain correct sample pH.
(778) 50 L dilution was transferred to a PCR plate and thermo-stressed at 83 C. for 5 minutes in a PCR machine. The remaining half of the dilution was kept at RT.
(779) 20 L of both stressed and unstressed samples was transferred to a standard MTP. 20 L pNPG-substrate was added to start the reaction. The plate was incubated at RT for 1 hour.
(780) The reaction was stopped and the colour developed by adding 50 L 0.5M Na.sub.2CO.sub.3. The yellow colour was measured on a plate reader (Molecular Devices) at 405 nm.
(781) Buffers:
(782) 0.5 M NaAc pH 4.8
(783) 0.25 M NaAc pH 4.8
(784) Substrate, 6 mM pNPG:
(785) 15 mg 4-nitrophenyl D-glucopyranoside in 10 mL 0.25 NaAc pH 4.8
(786) Stop/Developing Solution:
(787) 0.5 M Na.sub.2CO.sub.3
(788) Data Treatment:
(789) In Excel the raw Abs405 data from both stressed and unstressed samples were blank subtracted with their respective blanks. The residual activity (% res. act.=(Abs.sub.unstressed(Abs.sub.unstressedAbs.sub.stressed))/Abs.sub.unstressed*100%) was calculated and plotted relative to benchmark, Po-amg0008.
(790) TABLE-US-00029 TABLE 16 Po-AMG name Mutations % residual activity GA008 P2N P4S P11F T65A Q327F 100 E501V Y504T GA085 P2N P4S P11F T65A S103N 127 Q327F E501V Y504T GA097 K5A P11F T65A Q327F 106 E501V Y504T GA107 P2N P4S P11F T65A Q327F 109 E501V Y504T T516P K524T G526A GA130 P2N P4S P11F T65A V79A 111 Q327F E501V Y504T GA131 P2N P4S P11F T65A V79G 112 Q327F E501V Y504T GA132 P2N P4S P11F T65A V79I 101 Q327F E501V Y504T GA133 P2N P4S P11F T65A V79L 102 Q327F E501V Y504T GA134 P2N P4S P11F T65A V79S 104 Q327F E501V Y504T GA150 P2N P4S P11F T65A L72V 101 Q327F E501V Y504T GA155 S255N Q327F E501V Y504T 105
(791) TABLE-US-00030 TABLE 17 Po-AMG name Mutations % residual activity GA008 P2N P4S P11F T65A Q327F 100 E501V Y504T GA179 P2N P4S P11F T65A E74N 108 V79K Q327F E501V Y504T GA180 P2N P4S P11F T65A G220N 108 Q327F E501V Y504T GA181 P2N P4S P11F T65A Y245N 102 Q327F E501V Y504T GA184 P2N P4S P11F T65A Q253N 110 Q327F E501V Y504T GA185 P2N P4S P11F T65A D279N 108 Q327F E501V Y504T GA186 P2N P4S P11F T65A Q327F 108 S359N E501V Y504T GA187 P2N P4S P11F T65A Q327F 102 D370N E501V Y504T GA192 P2N P4S P11F T65A Q327F 102 V460S E501V Y504T GA193 P2N P4S P11F T65A Q327F 102 V460T P468T E501V Y504T GA195 P2N P4S P11F T65A Q327F 103 T463N E501V Y504T GA196 P2N P4S P11F T65A Q327F 106 S465N E501V Y504T GA198 P2N P4S P11F T65A Q327F 106 T477N E501V Y504T
Example 17
(792) Test for Glucoamylase Activity of Thermo-Stable Variants
(793) All of the above described variants disclosed in tables 15, 16, and 17 have been verified for Glucoamylase activity on culture supernatants using the pNPG assay described in Example 16.
Example 18
(794) Improved Ethanol Production in Mashes Produced with Varying Levels of Pfu Protease.
(795) The performance of MBG4851 compared to Ethanol Red was evaluated in liquefacts liquefied with a blend of alpha-amylase (2.1 g EP AA369/gDS), glucoamylase (4.5 g EP PoAMG498/g DS) and increasing levels of Pfu protease (0.0385, 1.5, and 3.0 g EP Pfu/gDS).
(796) Liquefaction
(797) Liquefactions were prepared by combining ground corn, backset and tap water to a target total weight of 160 g at 32.50% Dry Solids (DS); backset was blended at 30% w/w (weight of backset per total weight of mash). Backset and ground corn from Lincolnway Energy, received on Dec. 12, 2012, were used for all liquefactions. Initial slurry pH was 5.0 and therefore, no further adjustment was needed. Next, water and enzymes were added, followed by sealing of all Labomat canisters and starting the 200 ml program: 5 C./min. Ramp, 15 minute Ramp to 80 C., hold for 1 min, Ramp to 85 C. at 1 C./min and holding for 103 min., 40 rpm for 30 seconds to the left and 30 seconds to the right. All canisters of mash were cooled in an ice bath and prepared for fermentation according to the SSF procedure described below. 2.1 g EP AA369/gDS and 4.5 g EP PoAMG498/gDS was added. Three Pfu doses were tested in liquefaction: 0.0385, 1.5, and 3.0 g EP/g DS.
(798) Yeast Strains and Preparation
(799) The two yeast strains tested in this experiment were Ethanol Red (Fermentis) and MBG4851. Yeast were propagated in filter sterilized liquid media (2% w/v D-glucose, 1% peptone, and 0.5% yeast extract). Using a sterile loop under a UV hood, cells from a lawn were transferred into 25 mL of the liquid media in 50 mL sterile centrifuge tubes with a hole drilled in the top and incubated at 150 rpm in a 30 C. air shaker. Tubes were angled at approximately 30 degrees to increase aeration. Cells were harvested at 18 hours by spinning at 3000 rpm for 10 minutes and decanting the supernatant. Cells were washed once in 25 ml of water and the resulting cell pellet was resuspended in 1.5 ml tap water. Total yeast concentration was determined using the YC-100 in duplicate.
(800) Simultaneous Saccharification and Fermentation (SSF)
(801) Penicillin was added to each mash to a final concentration of 3 ppm. The pH after liquefaction was 5.1 and was not adjusted further for SSF. Urea was added to each mash to a final concentration of 500 ppm. Approximately 5 grams of each mash was transferred to test tubes having a 1/64 hole drilled in the top to allow CO.sub.2 release. A blend of Glucoamylase SA and Cellulase VD were dosed to each tube of mash at 110 g EP GSA/gDS and 30 g EP CVD/gDS. Yeast was dosed at 10e6 cells/g mash. Milli-Q water was added to each tube so that a total volume of liquid added (enzyme+MQ water) to each tube would be equally proportionate to the mash weight. Fermentations took place in a 32 C. water bath for 54 hours. Samples were vortexed periodically (in the morning and in the evening) throughout the fermentation.
(802) HPLC Analysis
(803) Fermentation sampling took place after 54 hours of fermentation by sacrificing 3 tubes per treatment. Each tube was processed for HPLC analysis by deactivation with 50 L of 40% v/v H.sub.2SO.sub.4, vortexing, centrifuging at 1460g for 10 minutes, and filtering through a 0.45 m Whatman PP filter. All 54 hour samples were processed without further dilution. Samples were stored at 4 C. prior to and during HPLC analysis.
(804) TABLE-US-00031 TABLE 18 HPLC System HPLC Agilent's 1100/1200 series with Chem station software System Degasser, Quaternary Pump, Auto-Sampler, Column Compartment /w Heater Refractive Index Detector (RI) Column Bio-Rad HPX-87H Ion Exclusion Column 300 mm 7.8 mm part# 125-0140 Bio-Rad guard cartridge Cation H part# 125-0129, Holder part# 125-0131 Method 0.005M H2SO4 mobile phase Flow rate: 0.6 ml/min Column temperature: 65 C. RI detector temperature:00 55 C.
(805) Samples were analyzed for sugars (DP4+, DP3, DP2, glucose, and fructose), organic acids (lactic and acetic), glycerol, and ethanol. Tukey-Kramer analysis was done on the results using JMP software (SAS, Cary N.C.)
(806) Results
(807) Table 2 below shows the titers at 54 hours of fermentation for both yeasts in each of the three prepared mashes. Tukey Kramer analysis indicated that the final ethanol titers in all three mashes were not statistically different for MBG4851. When the fermenting organism was Ethanol Red, however, there was a statistically significant improvement seen with increased Pfu during liquefaction.
(808) TABLE-US-00032 TABLE 19 Ethanol Titers and Tukey Kramer Analysis Pfu Dose (g EP (Enzyme Protein)/g Ethanol Tukey Kramer Strain Ds) Titer (g/L) Analysis Ethanol Red 0.0385 134.705 C Ethanol Red 1.5 137.489 B Ethanol Red 3.0 138.062 B MBG4851 0.0385 139.712 A MBG4851 1.5 139.590 A MBG4851 3.0 139.384 A *Levels not connected by same letter are significantly different
(809) MBG4851 had higher titers of ethanol than Ethanol Red under all conditions tested. Ethanol boost seen when MBG4851 is the fermenting organism, compared to Ethanol Red is seen in Table 20 below. The boost in final ethanol titer seen with MBG4851 decreased as Pfu during liquefaction, and therefore available nitrogen increased in the mashes.
(810) TABLE-US-00033 TABLE 20 Ethanol Boost over Ethanol Red at varying levels of Pfu. Pfu Dose % Boost over Ethanol (g EP/g DS) Red 0.0385 3.7% 1.5 1.5% 3.0 0.96%
(811) When the fermenting organism was MBG4851, Pfu dose did not have a significant effect on ethanol production. When Ethanol Red was the fermenting organism, increasing Pfu dose and therefore available nitrogen increased ethanol by at least 2%.
Example 19
(812) Improved Ethanol Production and Reduced Pfu Requirements in Mashes Produced with Varying Levels of Pfu Protease.
(813) The performance of MBG4851 compared to Ethanol Red was evaluated in liquefacts liquefied with a blend of alpha-amylase (2.1 g EP AA369/gDS), glucoamylase (4.5 g EP PoAMG498/g DS) and increasing levels of Pfu protease (0.0385, 1.5, and 3.0 g EP Pfu/gDS).
(814) The performance of MBG4851 compared to Ethanol Red was compared in liquefacts with increased levels of Pfu protease. This experiment was run with two levels of N, 0 and 500 ppm urea to determine if varying Pfu levels would have an effect with lower levels of added urea.
(815) Liquefaction
(816) Liquefactions were prepared by combining ground corn, backset and tap water to a target total weight of 160 g at 32.50% Dry Solids (DS); backset was blended at 30% w/w (weight of backset per total weight of mash). Backset from Lincolnway Energy, received on Dec. 12, 2012, and ground corn from Aurora were used for all liquefactions. Initial slurry pH was 5.0 and therefore, no further adjustment was needed. Next, water and enzymes were added, followed by sealing of all Labomat canisters and starting the 200 ml program: 5 C./min. Ramp, 15 minute Ramp to 80 C., hold for 1 min, Ramp to 85 C. at 1 C./min and holding for 103 min., 40 rpm for 30 seconds to the left and 30 seconds to the right. All canisters of mash were cooled in an ice bath and prepared for fermentation according to the SSF procedure described below. 2.1 g EP AA369/gDS and 4.5 g EP PoAMG498/g DS was added. Three Pfu doses were tested in liquefaction: 0.0385, 1.5, and 3.0 g EP/g DS.
(817) Yeast Strains and Preparation
(818) The two yeast strains tested in this experiment were Ethanol Red (Fermentis) and MBG4851. Yeast were propagated in filter sterilized liquid media (2% w/v D-glucose, 1% peptone, and 0.5% yeast extract). Using a sterile loop under a UV hood, cells from a lawn were transferred into 25 mL of the liquid media in 50 mL sterile centrifuge tubes with a hole drilled in the top and incubated at 150 rpm in a 30 C. air shaker. Tubes were angled at approximately 30 degrees to increase aeration. Cells were harvested at 18 hours by spinning at 3000 rpm for 10 minutes and decanting the supernatant. Cells were washed once in 25 ml of water and the resulting cell pellet was resuspended in 1.5 ml tap water. Total yeast concentration was determined using the YC-100 in duplicate.
(819) Simultaneous Saccharification and Fermentation (SSF)
(820) Penicillin was added to each mash to a final concentration of 3 ppm. The pH after liquefaction was 5.1 and was not adjusted further for SSF. Urea was added to half of each mash to a final concentration of 0 ppm and to the other half to a final concentration of 500 ppm. Approximately 5 grams of each of the resulting six mashes was transferred to test tubes having a 1/64 hole drilled in the top to allow CO2 release. A blend of Glucoamylase SA (GSA) and Cellulase VD (CVD) were dosed to each tube of mash at 110 g EP GSA/gDS and 30 g EP CVD/gDS. Yeast was dosed at 10e6 cells/g mash. Milli-Q water was added to each tube so that a total volume of liquid added (enzyme+MQ water) to each tube would be equally proportionate to the mash weight. Fermentations took place in a 32 C. water bath for 54 hours. Samples were vortexed periodically (in the morning and in the evening) throughout the fermentation.
(821) HPLC Analysis
(822) Fermentation sampling took place after 54 hours of fermentation by sacrificing 3 tubes per treatment. Each tube was processed for HPLC analysis by deactivation with 50 L of 40% v/v H.sub.2SO.sub.4, vortexing, centrifuging at 1460g for 10 minutes, and filtering through a 0.45 m Whatman PP filter. All 54 hour samples were processed without further dilution. Samples were stored at 4 C. prior to and during HPLC analysis.
(823) TABLE-US-00034 TABLE 21 HPLC System HPLC Agilent's 1100/1200 series with Chem station software System Degasser, Quaternary Pump, Auto-Sampler, Column Compartment /w Heater Refractive Index Detector (RI) Column Bio-Rad HPX-87H Ion Exclusion Column 300 mm 7.8 mm part# 125-0140 Bio-Rad guard cartridge Cation H part# 125-0129, Holder part# 125-0131 Method 0.005M H2SO4 mobile phase Flow rate: 0.6 ml/min Column temperature: 65 C. RI detector temperature: 55 C.
(824) Samples were analyzed for sugars (DP4+, DP3, DP2, glucose, and fructose), organic acids (lactic and acetic), glycerol, and ethanol. Tukey-Kramer analysis was done on the results using JMP software (SAS, Cary N.C.)
(825) Results
(826) 54 hour ethanol titers were analyzed and Table 22 below shows the results.
(827) TABLE-US-00035 TABLE 22 54 hour Ethanol Titers Pfu Dose Ethanol Tukey Kramer Urea Level Strain (g EP/g Ds) Titer (g/L) Analysis* 0 ppm Ethanol Red 0.0385 125.194 F Ethanol Red 1.5 131.858 CD Ethanol Red 3.0 132.379 BCD MBG4851 0.0385 131.262 DE MBG4851 1.5 134.534 A MBG4851 3.0 134.405 A 500 ppm Ethanol Red 0.0385 130.128 E Ethanol Red 1.5 131.208 DE Ethanol Red 3.0 132.531 BC MBG4851 0.0385 134.108 A MBG4851 1.5 133.336 AB MBG4851 3.0 133.962 A *Levels not connected by same letter are significantly different
(828) MBG4851 had higher titers of ethanol than Ethanol Red under all conditions tested. Ethanol boost seen when MBG4851 is the fermenting organism, compared to Ethanol Red is seen in Table 23 below. The boost in final ethanol titer seen with MBG4851 decreased as Pfu during liquefaction, and therefore available nitrogen increased in the mashes.
(829) TABLE-US-00036 TABLE 23 Ethanol Boost over Ethanol Red with varying N and levels of Pfu % Boost over Urea Pfu Dose Ethanol Dose (g EP/g Ds) Red 0 ppm 0.0385 4.85% 1.5 2.03% 3 1.53% 500 ppm 0.0385 3.06% 1.5 1.62% 3 1.08%
(830) When 500 ppm urea was used, MBG4851 once again did not need higher doses of Pfu to reach maximum ethanol. When no urea was added, MBG4851 performance increased with Pfu dose, but maxed out by 1.5 g EP/g DS. Under both levels of nitrogen, higher doses of Pfu increased ethanol production when Ethanol Red was the fermenting organism.
Example 20
(831) Improved Ethanol Production and Reduced Nitrogen Requirements in Backset Free Mashes Produced with Varying Levels of Pfu Protease
(832) The performance of MBG4851 compared to Ethanol Red was evaluated in liquefacts liquefied with a blend of alpha-amylase (2.1 g EP AA369/gDS), glucoamylase (4.5 g EP PoAMG498/g DS) and increasing levels of Pfu protease (0.0385 and 3.0 g EP Pfu/gDS).
(833) Example 19 showed that MBG4851 yeast had a lower nitrogen requirement than did Ethanol Red yeast. When 3 g Pfu/g DS was used in liquefaction, MBG4851 did not need any added urea; however, adding 500 ppm urea increased ethanol yields for ER. When 0.0385 g Pfu/g DS was used in liquefaction, MBG4851 needed somewhere between 0 and 500 ppm of added urea in fermentation. This previous example used plant backset in the liquefactions, which likely contributed some urea (as well as peptides and amino acids). Thus this was not a true urea-free test; if a plant eliminated urea usage, then no urea would be present in backset. The present example tested five different urea levels in fermentation of backset free liquefacts (0, 200, 300, 500, and 1000 ppm).
(834) Liquefaction
(835) Liquefactions were prepared by combining ground corn and tap water to a target total weight of 160 g at 32.50% Dry Solids (DS). Ground corn from Aurora was used for all liquefactions. pH was adjusted to 5.1 using 40% v/v sulfuric acid and 50% w/w potassium hydroxide. Next enzymes were added, followed by sealing of all Labomat canisters and starting the 200 ml program: 5 C./min. Ramp, 15 minute Ramp to 80 C., hold for 1 min, Ramp to 85 C. at 1 C./min and holding for 103 min., 40 rpm for 30 seconds to the left and 30 seconds to the right. All canisters of mash were cooled in an ice bath and prepared for fermentation according to the SSF procedure described below. 2.1 g EP AA369/g DS and 4.5 g EP DS PoAMG498 was added. Two Pfu doses were tested in liquefaction: 0.0385, and 3.0 g EP/g DS.
(836) Yeast Strains and Preparation
(837) The two yeast strains tested in this experiment were Ethanol Red (Fermentis) and MBG4851. Yeasts were rehydrated by weighing 2.75 g of dried yeast into 50 ml of 32 C. tap water in a 125 mL Erlenmeyer flask. The flasks were then covered with parafilm and allowed to incubate in a 32 C. water bath. After 15 minutes, the flasks were swirled, but no other agitation took place. After a total of 30 minutes, the flasks were removed from the water bath. Total yeast concentration was determined using the YC-100 in duplicate.
(838) Simultaneous Saccharification and Fermentation (SSF)
(839) Penicillin was added to each mash to a final concentration of 3 ppm. The pH after liquefaction was 5.1 and was not adjusted further for SSF. Urea was adjusted to the desired level and water added to maintain a consistent solids level between mashes. Approximately 5 grams of each of the resulting mashes was transferred to test tubes having a 1/64 hole drilled in the top to allow CO.sub.2 release. A blend of Glucoamylase SA (GSA) and Cellulase VD (CVD) were dosed to each tube of mash at 110 g EP GSA/gDS and 30 g EP CVD/gDS. Yeast was dosed at 10e6 cells/g mash. Milli-Q water was added to each tube so that a total volume of liquid added (enzyme+MQ water) to each tube would be equally proportionate to the mash weight. Fermentations took place in a 32 C. water bath for 54 hours. Samples were vortexed periodically (in the morning and in the evening) throughout the fermentation.
(840) HPLC Analysis
(841) Fermentation sampling took place after 54 hours of fermentation by sacrificing 3 tubes per treatment. Each tube was processed for HPLC analysis by deactivation with 50 L of 40% v/v H2SO4, vortexing, centrifuging at 1460g for 10 minutes, and filtering through a 0.45 m Whatman PP filter. All 54 hour samples were processed without further dilution. Samples were stored at 4 C. prior to and during HPLC analysis.
(842) TABLE-US-00037 TABLE 24 HPLC System HPLC Agilent's 1100/1200 series with Chem station software System Degasser, Quaternary Pump, Auto-Sampler, Column Compartment /w Heater Refractive Index Detector (RI) Column Bio-Rad HPX-87H Ion Exclusion Column 300 mm 7.8 mm part# 125-0140 Bio-Rad guard cartridge Cation H part# 125-0129, Holder part# 125-0131 Method 0.005M H2SO4 mobile phase Flow rate: 0.6 ml/min Column temperature: 65 C. RI detector temperature: 55 C.
(843) Samples were analyzed for sugars (DP4+, DP3, DP2, glucose, and fructose), organic acids (lactic and acetic), glycerol, and ethanol. Tukey-Kramer analysis was done on the results using JMP software (SAS, Cary N.C.)
(844) Results
(845) 54 hour Ethanol titers were analyzed and the results and ethanol boosts observed shown in Table 8 below. When the lower level of Pfu was used, added urea increased ethanol titers for both yeasts up to 500 ppm added urea, at which point MBG4851 ethanol titers remained consistent. Ethanol Red titers continued to increase when 1000 ppm urea was added. When the higher level of Pfu was used during liquefaction, added urea had no effect on MBG4851 fermentation. At this level, 0 ppm added urea fermented at the same level as 1000 ppm added urea for this yeast. In the higher Pfu mash, Ethanol Red needed at least 500 ppm urea to ferment to maximum ethanol.
(846) TABLE-US-00038 TABLE 25 Ethanol Titers and Observed Boosts at 54 Hours ER MBG4851 % Boost Urea Ethanol Ethanol (MBG4851 Pfu Dose addition (g/L) (g/L) over ER) 0.0385 g EP/g 0 ppm 93.18321 122.9076 31.9% DS Pfu 200 ppm 112.2505 138.3888 23.3% 300 ppm 120.9298 144.2185 19.3% 500 ppm 133.3747 146.5595 9.9% 1000 ppm 143.4957 146.6301 2.2% 3.0 g EP/g DS 0 ppm 141.0018 147.6714 4.7% Pfu 200 ppm 143.957 147.6526 2.6% 300 ppm 144.8663 148.2786 2.4% 500 ppm 145.5638 148.6821 2.1% 1000 ppm 145.2924 147.5827 1.6%
Example 21
(847) Reduced Nitrogen (Urea) Requirement to Ferment to Maximum Ethanol in Industrially Produced Corn Mash
(848) The performance of MBG4851 compared to Ethanol Red was evaluated in an industrially produced alpha-amylase (Alpha-Amylase A) liquefied corn mash with varying levels of urea supplementation.
(849) Corn Mash
(850) Industrially prepared corn mash was obtained from Lincolnland. Solids on this mash were measured to be 31.5% by 105 C. drying oven.
(851) Yeast Strains and Preparation
(852) The two yeast strains tested in this experiment were Ethanol Red (Fermentis) and MBG4851. Yeasts were rehydrated by weighing 2.75 g of dried yeast into 50 ml of 32 C. tap water in a 125 mL Erlenmeyer flask. The flasks were then covered with parafilm and allowed to incubate in a 36.5 C. water bath. After 15 minutes, the flasks were swirled, but no other agitation took place. After a total of 30 minutes, the flasks were removed from the water bath. Total yeast concentration was determined using the YC-100 in duplicate.
(853) Simultaneous Saccharification and Fermentation (SSF)
(854) Penicillin was added to each mash to a final concentration of 3 ppm. The pH after liquefaction was 5.1 and was not adjusted further for SSF. Urea was adjusted to the desired level and water added to maintain a consistent solids level between mashes. Approximately 5 grams of each of the resulting mashes was transferred to test tubes having a 1/64 hole drilled in the top to allow CO.sub.2 release. A blend of Glucoamylase SA (GSA) and Cellulase VD (CVD) were dosed to each tube of mash at 110 g EP GSA/gDS and 30 g EP CVD/gDS. Yeast was dosed at 10e6 cells/g mash. Milli-Q water was added to each tube so that a total volume of liquid added (enzyme+MQ water) to each tube would be equally proportionate to the mash weight. Fermentations took place in a 32 C. water bath for 54 hours. Samples were vortexed periodically (in the morning and in the evening) throughout the fermentation.
(855) HPLC Analysis
(856) Fermentation sampling took place after 54 hours of fermentation by sacrificing 3 tubes per treatment. Each tube was processed for HPLC analysis by deactivation with 50 L of 40% v/v H.sub.2SO.sub.4, vortexing, centrifuging at 1460g for 10 minutes, and filtering through a 0.45 m Whatman PP filter. All 54 hour samples were processed without further dilution. Samples were stored at 4 C. prior to and during HPLC analysis.
(857) TABLE-US-00039 TABLE 26 HPLC System HPLC Agilent's 1100/1200 series with Chem station software System Degasser, Quaternary Pump, Auto-Sampler, Column Compartment /w Heater Refractive Index Detector (RI) Column Bio-Rad HPX-87H Ion Exclusion Column 300 mm 7.8 mm part# 125-0140 Bio-Rad guard cartridge Cation H part# 125-0129, Holder part# 125-0131 Method 0.005M H.sub.2SO.sub.4 mobile phase Flow rate: 0.6 ml/min Column temperature: 65 C. RI detector temperature: 55 C.
(858) Samples were analyzed for sugars (DP4+, DP3, DP2, glucose, and fructose), organic acids (lactic and acetic), glycerol, and ethanol. Tukey-Kramer analysis was done on the results using JMP software (SAS, Cary N.C.)
(859) Results
(860) 54 hour results are shown in Table 27 below.
(861) TABLE-US-00040 TABLE 27 54 Hour Ethanol Titers Tukey Urea Ethanol Kramer Yeast addition (g/L) Analysis* Ethanol 0 ppm 115.708 G Red 150 ppm 128.891 F 300 ppm 132.487 CD 600 ppm 133.369 BC 1000 ppm 133.556 B 3000 ppm 130.734 E MBG4851 0 ppm 131.791 D 150 ppm 135.03 A 300 ppm 135.218 A 600 ppm 135.032 A 1000 ppm 135.259 A 3000 ppm 133.222 BC *Levels not connected by same letter are significantly different
(862) Both yeasts fermented to the lowest ethanol titer when no urea was added to the fermentations. Another similarity between both yeasts was a decrease in ethanol titer when extremely high levels of urea (3000 ppm) were added to the fermentation. MBG4851 showed that it needed 150 ppm or less of added urea to ferment this corn mash to maximum ethanol. Ethanol Red did not hit its maximum until somewhere between 300 and 600 ppm of urea was added. This means that at least a 2 reduction in urea addition is possible with this yeast.
(863) Table 28 below shows that at each level of nitrogen supplementation, MBG4851 outperforms Ethanol Red by a minimum of 1.25%.
(864) TABLE-US-00041 TABLE 28 Ethanol Boost when MBG4851 was compared to Ethanol Red at each level of nitrogen supplementation. % Boost Urea (MBG4851 addition over ER) 0 ppm 13.90% 150 ppm 4.76% 300 ppm 2.06% 600 ppm 1.25% 1000 ppm 1.28% 3000 ppm 1.90%
Example 22
(865) Lactic Acid Reduction in Fermentations of Mashes Produced with Varying Levels of Pfu Protease.
(866) The lactic acid levels when using MBG4851 compared to Ethanol Red were evaluated in liquefacts liquefied with a blend of alpha-amylase (2.1 g EP AA369/gDS), glucoamylase (4.5 g EP PoAMG498/g DS) and increasing levels of Pfu protease (0.0385, 1.5, and 3.0 g EP Pfu/gDS).
(867) Liquefaction
(868) Experiment 1 liquefactions were prepared by combining ground corn, backset and tap water to a target total weight of 160 g at 32.50% Dry Solids (DS); backset was blended at 30% w/w (weight of backset per total weight of mash). Backset and ground corn from Lincolnway Energy, received on Dec. 12, 2012, were used for all liquefactions. Initial slurry pH was 5.0 and therefore, no further adjustment was needed. Next, water and enzymes were added, followed by sealing of all Labomat canisters and starting the 200 ml program: 5 C./min. Ramp, 15 minute Ramp to 80 C., hold for 1 min, Ramp to 85 C. at 1 C./min and holding for 103 min., 40 rpm for 30 seconds to the left and 30 seconds to the right. All canisters of mash were cooled in an ice bath and prepared for fermentation according to the SSF procedure described below. 2.1 g EP AA369/g DS and 4.5 g EP DS PoAMG498 was added. Three Pfu doses were tested in liquefaction: 0.0385, 1.5, and 3.0 g EP/g DS.
(869) Experiment 2 liquefactions were prepared by combining ground corn, backset and tap water to a target total weight of 160 g at 32.50% Dry Solids (DS); backset was blended at 30% w/w (weight of backset per total weight of mash). Backset from Lincolnway Energy, received on Dec. 12, 2012, and ground corn from Aurora were used for all liquefactions. Initial slurry pH was 5.0 and therefore, no further adjustment was needed. Next, water and enzymes were added, followed by sealing of all Labomat canisters and starting the 200 ml program: 5 C./min. Ramp, 15 minute Ramp to 80 C., hold for 1 min, Ramp to 85 C. at 1 C./min and holding for 103 min., 40 rpm for 30 seconds to the left and 30 seconds to the right. All canisters of mash were cooled in an ice bath and prepared for fermentation according to the SSF procedure described below. Three Pfu doses were tested in liquefaction: 0.0385, 1.5, and 3.0 g EP/g Ds.
(870) Yeast Strains and Preparation
(871) The two yeast strains tested in this experiment were Ethanol Red (Fermentis) and MBG4851. Yeast were propagated in filter sterilized liquid media (2% w/v D-glucose, 1% peptone, and 0.5% yeast extract). Using a sterile loop under a UV hood, cells from a lawn were transferred into 25 mL of the liquid media in 50 mL sterile centrifuge tubes with a hole drilled in the top and incubated at 150 rpm in a 30 C. air shaker. Tubes were angled at approximately 30 degrees to increase aeration. Cells were harvested at 18 hours by spinning at 3000 rpm for 10 minutes and decanting the supernatant. Cells were washed once in 25 ml of water and the resulting cell pellet was resuspended in 1.5 ml tap water. Total yeast concentration was determined using the YC-100 in duplicate.
(872) Simultaneous Saccharification and Fermentation (SSF)
(873) Penicillin was added to each mash to a final concentration of 3 ppm. The pH after liquefaction was 5.1 and was not adjusted further for SSF. In experiment 1, urea was added to each mash to a final concentration of 500 ppm. In experiment 2, half of each mash was adjusted to 500 ppm urea and the other half was adjusted with water to maintain consistent solids. Approximately 5 grams of each mash was transferred to test tubes having a 1/64 hole drilled in the top to allow CO.sub.2 release. A blend of Glucoamylase SA (GSA) and Cellulase VD (CVD) were dosed to each tube of mash at 110 g EP GSA/gDS and 30 g EP CVD/gDS. Yeast was dosed at 10e6 cells/g mash. Milli-Q water was added to each tube so that a total volume of liquid added (enzyme+MQ water) to each tube would be equally proportionate to the mash weight. Fermentations took place in a 32 C. water bath for 54 hours. Samples were vortexed periodically (in the morning and in the evening) throughout the fermentation.
(874) HPLC Analysis
(875) Fermentation sampling took place after 54 hours of fermentation by sacrificing 3 tubes per treatment. Each tube was processed for HPLC analysis by deactivation with 50 L of 40% v/v H.sub.2SO.sub.4, vortexing, centrifuging at 1460g for 10 minutes, and filtering through a 0.45 m Whatman PP filter. All 54 hour samples were processed without further dilution. Samples were stored at 4 C. prior to and during HPLC analysis.
(876) TABLE-US-00042 TABLE 29 HPLC System HPLC Agilent's 1100/1200 series with Chem station software System Degasser, Quaternary Pump, Auto-Sampler, Column Compartment /w Heater Refractive Index Detector (RI) Column Bio-Rad HPX-87H Ion Exclusion Column 300 mm 7.8 mm part# 125-0140 Bio-Rad guard cartridge Cation H part# 125-0129, Holder part# 125-0131 Method 0.005M H2SO4 mobile phase Flow rate: 0.6 ml/min Column temperature: 65 C. RI detector temperature: 55 C.
(877) Samples were analyzed for sugars (DP4+, DP3, DP2, glucose, and fructose), organic acids (lactic and acetic), glycerol, and ethanol.
(878) Results
(879) Table 30 below shows the lactic acid titers and percent reduction at 54 hours of fermentation for both yeasts in experiment 1.
(880) TABLE-US-00043 TABLE 30 54 hour Lactic Acid Results MBG4851 % ER (g/L (g/L Reduction Lactic Lactic with Pfu dose Acid) Acid) MBG4851 0.0385 g EP/g DS Pfu 2.607496 2.174635 16.60% 1.5 g EP/g DS Pfu 2.491174 2.127822 14.59% 3.0 g EP/g DS Pfu 2.521229 2.168343 14.00%
(881) Table 31 below shows the lactic acid titers and percent reduction at 54 hours of fermentation for both yeasts in experiment 2
(882) TABLE-US-00044 TABLE 31 54 Hour Lactic Acid Results MBG4851 % ER (g/L (g/L Reduction Lactic Lactic with Pfu dose Acid) Acid) MBG4851 0 ppm Added Urea 0.0385 g EP/g DS Pfu 2.748912 2.257129 17.89% 1.5 g EP/g DS Pfu 2.597976 2.161818 16.79% 3.0 g EP/g DS Pfu 2.597319 2.146677 17.35% 500 ppm Added Urea 0.0385 g EP/g DS Pfu 2.77946 2.36138 15.04% 1.5 g EP/g DS Pfu 2.653623 2.248402 15.27% 3.0 g EP/g DS Pfu 2.656285 2.260516 14.90%
Example 23
(883) Lactic Acid Reduction in Fermentations of Backset Free Mashes Produced with Varying Levels of Pfu Protease
(884) The lactic acid levels when using MBG4851 compared to Ethanol Red were evaluated in backset free liquefacts liquefied with a blend of alpha-amylase (2.1 g EP AA369/gDS), glucoamylase (4.5 g EP PoAMG498/g DS) and increasing levels of Pfu protease (0.0385 and 3.0 g EP Pfu/gDS).
(885) Liquefaction
(886) Liquefactions were prepared by combining ground corn and tap water to a target total weight of 160 g at 32.50% Dry Solids (DS). Ground corn from Aurora was used for all liquefactions. pH was adjusted to 5.1 using 40% v/v sulfuric acid and 50% w/w potassium hydroxide. Next enzymes were added, followed by sealing of all Labomat canisters and starting the 200 ml program: 5 C./min. Ramp, 15 minute Ramp to 80 C., hold for 1 min, Ramp to 85 C. at 1 C./min and holding for 103 min., 40 rpm for 30 seconds to the left and 30 seconds to the right. All canisters of mash were cooled in an ice bath and prepared for fermentation according to the SSF procedure described below. 2.1 g EP AA369/g DS and 4.5 g EP DS PoAMG498 was added. Two Pfu doses were tested in liquefaction: 0.0385 and 3.0 g EP/g DS.
(887) Yeast Strains and Preparation
(888) The two yeast strains tested in this experiment were Ethanol Red (Fermentis) and MBG4851. Yeasts were rehydrated by weighing 2.75 g of dried yeast into 50 ml of 32 C. tap water in a 125 mL Erlenmeyer flask. The flasks were then covered with parafilm and allowed to incubate in a 32 C. water bath. After 15 minutes, the flasks were swirled, but no other agitation took place. After a total of 30 minutes, the flasks were removed from the water bath. Total yeast concentration was determined using the YC-100 in duplicate.
(889) Simultaneous Saccharification and Fermentation (SSF)
(890) Penicillin was added to each mash to a final concentration of 3 ppm. The pH after liquefaction was 5.1 and was not adjusted further for SSF. Urea was adjusted to the desired level and water added to maintain a consistent solids level between mashes. Approximately 5 grams of each of the resulting mashes was transferred to test tubes having a 1/64 hole drilled in the top to allow CO.sub.2 release. A blend of Glucoamylase SA (GSA) and Cellulase VD (CVD) were dosed to each tube of mash at 110 g EP GSA/gDS and 30 g EP CVD/gDS. Yeast was dosed at 10e6 cells/g mash. Milli-Q water was added to each tube so that a total volume of liquid added (enzyme+MQ water) to each tube would be equally proportionate to the mash weight. Fermentations took place in a 32 C. water bath for 54 hours. Samples were vortexed periodically (in the morning and in the evening) throughout the fermentation.
(891) HPLC Analysis
(892) Fermentation sampling took place after 54 hours of fermentation by sacrificing 3 tubes per treatment. Each tube was processed for HPLC analysis by deactivation with 50 L of 40% v/v H.sub.2SO.sub.4, vortexing, centrifuging at 1460g for 10 minutes, and filtering through a 0.45 m Whatman PP filter. All 54 hour samples were processed without further dilution. Samples were stored at 4 C. prior to and during HPLC analysis.
(893) TABLE-US-00045 TABLE 32 HPLC System HPLC Agilent's 1100/1200 series with Chem station software System Degasser, Quaternary Pump, Auto-Sampler, Column Compartment /w Heater Refractive Index Detector (RI) Column Bio-Rad HPX-87H Ion Exclusion Column 300 mm 7.8 mm part# 125-0140 Bio-Rad guard cartridge Cation H part# 125-0129, Holder part# 125-0131 Method 0.005M H2SO4 mobile phase Flow rate: 0.6 ml/min Column temperature: 65 C. RI detector temperature: 55 C.
(894) Samples were analyzed for sugars (DP4+, DP3, DP2, glucose, and fructose), organic acids (lactic and acetic), glycerol, and ethanol.
(895) Results
(896) Table 33 below shows the lactic acid results for this experiment. A significant reduction was seen in all mashes.
(897) TABLE-US-00046 TABLE 33 54 hour Lactic Acid Results % ER (g/L MBG4851 Reduction Pfu Added Lactic (g/L Lactic with Dose Urea Acid) Acid) MBG4851 0.0385 g 0 ppm 0.739 0.240 67.53% EP/g 200 ppm 0.783 0.311 60.28% DS Pfu 300 ppm 0.820 0.312 61.98% 500 ppm 0.783 0.345 55.98% 1000 ppm 0.909 0.598 34.22% 3.0 g 0 ppm 0.511 0.212 58.39% EP/g 200 ppm 0.527 0.259 50.78% DS Pfu 300 ppm 0.556 0.336 39.48% 500 ppm 0.608 0.370 39.22% 1000 ppm 0.788 0.503 36.12%
Example 24
(898) Lactic Acid Reduction in Fermentations of Corn Mash Produced Industrially with Alpha-Amylase A as the Liquefaction Enzyme
(899) The lactic acid levels when using MBG4851 compared to Ethanol Red were evaluated in an industrially produced alpha-amylase (Alpha-Amylase A) liquefied corn mash with varying levels of urea supplementation.
(900) Corn Mash
(901) Industrially prepared corn mash was obtained from Lincolnland. Solids on this mash were measured to be 31.5% by 105 C. drying oven.
(902) Yeast Strains and Preparation
(903) The two yeast strains tested in this experiment were Ethanol Red (Fermentis) and MBG4851. Yeasts were rehydrated by weighing 2.75 g of dried yeast into 50 ml of 32 C. tap water in a 125 mL Erlenmeyer flask. The flasks were then covered with parafilm and allowed to incubate in a 36.5 C. water bath. After 15 minutes, the flasks were swirled, but no other agitation took place. After a total of 30 minutes, the flasks were removed from the water bath. Total yeast concentration was determined using the YC-100 in duplicate.
(904) Simultaneous Saccharification and Fermentation (SSF)
(905) Penicillin was added to each mash to a final concentration of 3 ppm. The pH after liquefaction was 5.1 and was not adjusted further for SSF. Urea was adjusted to the desired level and water added to maintain a consistent solids level between mashes. Approximately 5 grams of each of the resulting mashes was transferred to test tubes having a 1/64 hole drilled in the top to allow CO.sub.2 release. A blend of Glucoamylase SA (GSA) and Cellulase VD (CVD) were dosed to each tube of mash at 110 g EP GSA/gDS and 30 g EP CVD/gDS. Yeast was dosed at 10e6 cells/g mash. Milli-Q water was added to each tube so that a total volume of liquid added (enzyme+MQ water) to each tube would be equally proportionate to the mash weight. Fermentations took place in a 32 C. water bath for 54 hours. Samples were vortexed periodically (in the morning and in the evening) throughout the fermentation.
(906) HPLC Analysis
(907) Fermentation sampling took place after 54 hours of fermentation by sacrificing 3 tubes per treatment. Each tube was processed for HPLC analysis by deactivation with 50 L of 40% v/v H.sub.2SO.sub.4, vortexing, centrifuging at 1460g for 10 minutes, and filtering through a 0.45 m Whatman PP filter. All 54 hour samples were processed without further dilution. Samples were stored at 4 C. prior to and during HPLC analysis.
(908) TABLE-US-00047 TABLE 34 HPLC System HPLC Agilent's 1100/1200 series with Chem station software System Degasser, Quaternary Pump, Auto-Sampler, Column Compartment /w Heater Refractive Index Detector (RI) Column Bio-Rad HPX-87H Ion Exclusion Column 300 mm 7.8 mm part# 125-0140 Bio-Rad guard cartridge Cation H part# 125-0129, Holder part# 125-0131 Method 0.005M H2SO4 mobile phase Flow rate: 0.6 ml/min Column temperature: 65 C. RI detector temperature: 55 C.
(909) Samples were analyzed for sugars (DP4+, DP3, DP2, glucose, and fructose), organic acids (lactic and acetic), glycerol, and ethanol.
(910) Results
(911) Table 35 below shows the 54 hour lactic acid results.
(912) TABLE-US-00048 TABLE 35 54 Hour Lactic Acid Results ER MBG4851 % (g/L (g/L Reduction Added Lactic Lactic with Urea Acid) Acid) MBG4851 0 ppm 0.794 0.485 38.91% 150 ppm 0.862 0.514 40.41% 300 ppm 0.879 0.545 37.97% 600 ppm 1.022 0.609 40.45% 1000 ppm 1.104 0.703 36.34% 3000 ppm 1.430 0.954 33.26%
Example 25
(913) Lactic Acid Reduction in Fermentations of Corn Mash Produced Industrially with Alpha-Amylase F (Fuelzyme) as the Liquefaction Enzyme
(914) The lactic acid levels when using of MBG4851 compared to Ethanol Red were evaluated in an industrially prepared Alpha-Amylase F (Fuelzyme) liquefied corn mash.
(915) Corn Mash
(916) Industrially prepared corn mash was obtained from Pine Lake. Solids on this mash were measured to be 31.5% by 105 C. drying oven.
(917) Yeast Strains and Preparation
(918) The two yeast strains tested in this experiment were Ethanol Red (Fermentis) and MBG4851. Yeasts were rehydrated by weighing 2.75 g of dried yeast into 50 ml of 36.5 C. tap water in a 125 mL Erlenmeyer flask. The flasks were then covered with parafilm and allowed to incubate in a 36.5 C. water bath. After 15 minutes, the flasks were swirled, but no other agitation took place. After a total of 30 minutes, the flasks were removed from the water bath. Total yeast concentration was determined using the YC-100 in duplicate.
(919) Simultaneous Saccharification and Fermentation (SSF)
(920) Penicillin was added to each mash to a final concentration of 3 ppm. Urea was adjusted to 762 ppm and the pH adjusted to 5.0 using sulfuric acid. Approximately 5 grams of mash was transferred to test tubes having a 1/64 hole drilled in the top to allow CO2 release. A blend of Glucoamylase SA (GSA) and Cellulase VD (CVD) were dosed to each tube of mash at 110 g EP GSA/gDS and 30 g EP CVD/gDS. Yeast was dosed at 10e6 cells/g mash. Milli-Q water was added to each tube so that a total volume of liquid added (enzyme+MQ water) to each tube would be equally proportionate to the mash weight. Fermentations took place in a 32 C. water bath for 52 hours. Samples were vortexed periodically (in the morning and in the evening) throughout the fermentation.
(921) HPLC Analysis
(922) Fermentation sampling took place after 52 hours of fermentation by sacrificing 3 tubes per treatment. Each tube was processed for HPLC analysis by deactivation with 50 L of 40% v/v H.sub.2SO.sub.4, vortexing, centrifuging at 1460g for 10 minutes, and filtering through a 0.45 m Whatman PP filter. All 52 hour samples were processed without further dilution. Samples were stored at 4 C. prior to and during HPLC analysis.
(923) TABLE-US-00049 TABLE 36 HPLC System HPLC Agilent's 1100/1200 series with Chem station software System Degasser, Quaternary Pump, Auto-Sampler, Column Compartment /w Heater Refractive Index Detector (RI) Column Bio-Rad HPX-87H Ion Exclusion Column 300 mm 7.8 mm part# 125-0140 Bio-Rad guard cartridge Cation H part# 125-0129, Holder part# 125-0131 Method 0.005M H2SO4 mobile phase Flow rate: 0.6 ml/min Column temperature: 65 C. RI detector temperature: 55 C.
(924) Samples were analyzed for sugars (DP4+, DP3, DP2, glucose, and fructose), organic acids (lactic and acetic), glycerol, and ethanol.
(925) Results
(926) Table 37 below shows the 52 hour results.
(927) TABLE-US-00050 TABLE 37 52 hour Lactic Acid Results % Reduction with ER MBG4851 MBG4851 0.876282 0.606876 30.74%
Example 26
(928) Lactic Acid Reduction in Fermentations of Corn Mash Produced Industrially with Liquefaction Enzyme Blend
(929) The lactic acid levels when using MBG4851 compared to Ethanol Red were evaluated in industrially prepared corn mash liquefied with a blend of alpha-amylase (2.1 g EP AA369/gDS), glucoamylase (4.5 g EP PoAMG498/g DS) and 0.0385 g EP Pfu/g DS.
(930) Corn Mash
(931) Experiment 1Industrially prepared corn mash was obtained from Flint Hills Shell Rock. Solids on this mash were measured to be 32.8% by 105 C. drying oven.
(932) Experiment 2Industrially prepared corn mash was obtained from One Earth Energy. Solids on this mash were measured to be 33.95% by 105 C. drying oven.
(933) Yeast Strains and Preparation
(934) The two yeast strains tested in these experiments were Ethanol Red (Fermentis) and
(935) MBG4851. Yeast were propagated in filter sterilized liquid media (2% w/v D-glucose, 1% peptone, and 0.5% yeast extract). Using a sterile loop under a UV hood, cells from a lawn were transferred into 25 mL of the liquid media in 50 mL sterile centrifuge tubes with a hole drilled in the top and incubated at 150 rpm in a 30 C. air shaker. Tubes were angled at approximately 30 degrees to increase aeration. Cells were harvested at 18 hours by spinning at 3000 rpm for 10 minutes and decanting the supernatant. Cells were washed once in 25 ml of water and the resulting cell pellet was resuspended in 1.5 ml tap water. Total yeast concentration was determined using the YC-100 in duplicate.
(936) Simultaneous Saccharification and Fermentation (SSF)
(937) Penicillin was added to each mash to a final concentration of 3 ppm. In experiment 1, urea was adjusted to 275 ppm and the pH adjusted to 5.0 using potassium hydroxide. In experiment 2, urea was adjusted to 644 ppm and the pH adjusted to 5.0 using sulfuric acid. Approximately 5 grams of mash was transferred to test tubes having a 1/64 hole drilled in the top to allow CO2 release. A blend of Glucoamylase SA (GSA) and Cellulase VD (CVD) (110 g EP GSA/gDS and 30 g EP CVD/gDS) and Glucoamylase SA alone (110 g EP GSA/gDS) were dosed to each tube of mash. Yeast was dosed at 10e6 cells/g mash. Milli-Q water was added to each tube so that a total volume of liquid added (enzyme+MQ water) to each tube would be equally proportionate to the mash weight. Fermentations took place in a 32 C. water bath for 52 hours. Samples were vortexed periodically (in the morning and in the evening) throughout the fermentation.
(938) HPLC Analysis
(939) Fermentation sampling took place after 54 hours of fermentation by sacrificing 3 tubes per treatment. Each tube was processed for HPLC analysis by deactivation with 50 L of 40% v/v H.sub.2SO.sub.4, vortexing, centrifuging at 1460g for 10 minutes, and filtering through a 0.45 m Whatman PP filter. All 52 hour samples were processed without further dilution. Samples were stored at 4 C. prior to and during HPLC analysis.
(940) TABLE-US-00051 TABLE 38 HPLC System HPLC Agilent's 1100/1200 series with Chem station software System Degasser, Quaternary Pump, Auto-Sampler, Column Compartment /w Heater Refractive Index Detector (RI) Column Bio-Rad HPX-87H Ion Exclusion Column 300 mm 7.8 mm part# 125-0140 Bio-Rad guard cartridge Cation H part# 125-0129, Holder part# 125-0131 Method 0.005M H.sub.2SO.sub.4 mobile phase Flow rate: 0.6 ml/min Column temperature: 65 C. RI detector temperature: 55 C.
(941) Samples were analyzed for sugars (DP4+, DP3, DP2, glucose, and fructose), organic acids (lactic and acetic), glycerol, and ethanol.
(942) Results
(943) Table 39 below shows the results from Experiment 1
(944) TABLE-US-00052 TABLE 39 Shell Rock Lactic Acid Results MBG4851 % ER (g/L (g/L Reduction Lactic Lactic with Glucoamylase Acid) Acid) MBG4851 GSA + CVD 0.9543 0.6984 26.82% GSA 0.9894 0.7439 24.81%
(945) Table 40 below shows the results from Experiment 2
(946) TABLE-US-00053 TABLE 40 One Earth Lactic Acid Results MBG4851 % ER (g/L (g/L Reduction Lactic Lactic with Glucoamylase Acid) Acid) MBG4851 GSA + CVD 1.1601 0.8618 25.71% GSA 1.1548 0.8523 26.20%
Example 27
(947) Reduced Lactic Acid Accumulation During Bioreactor Fermentations of Industrially Produced Alpha-Amylase A Corn Mash.
(948) The lactic acid levels when using of MBG4851 compared to Ethanol Red were evaluated in an industrially prepared Alpha-Amylase A liquefied corn mash.
(949) Corn Mash
(950) Industrially prepared corn mash was obtained from Lincolnland. Solids on this mash were measured to be 32.95% by moisture balance.
(951) Yeast Strains and Propagation
(952) The two yeast strains tested in this experiment were Ethanol Red (Fermentis) and MBG4851.
(953) The target solids percentage in the propagation was 20%, 607 ml of mash was added to 393 ml of water to reach a 1000 ml propagation volume at 20% solids. Lactrol was added at a concentration of 0.024 grams per liter. Urea nitrogen was added at a concentration of 1500 ppm, by adding 3 ml of a 50% urea solution. Glucoamylase dose was calculated to be 0.075 g per 1 L fermenter. As an inoculum, 2.08 grams of dried yeast were weighed out, added to 40 ml of water preheated to 36.5 C., and allowed to rehydrate for 30 minutes with swirling at 15 minutes. Ten ml of this rehydration was then added to the propagation. Propagation time was 8 hours at 33.3 C., at which time 15.2 ml of propagation was transferred to the fermentation vessels as an approximately 1.6% inoculation.
(954) All propagations and fermentations were run in 1 L Sartorius Q+ bioreactors.
(955) Simultaneous Saccharification and Fermentation (SSF)
(956) Lactrol was added to each fermenter at a concentration of 0.024 grams per liter.
(957) Urea was added to 600 ppm total urea. Glucoamylase SA was dosed to each reactor of mash at 110 g EP GSA/gDS. To mimic enzyme addition at the plant scale, 55% of the glucoamylase and 50% of the fermentation urea were dosed at inoculation. After 8 hours of fermentation, the remaining 45% of glucoamylase and 50% of urea were added to the fermenter.
(958) Temperature Profiles
(959) All fermentations started at 32 C. and then started a temperature profile as described below.
(960) TABLE-US-00054 TABLE 41 Temperature Profiles Ferm Time Temp Target F. Temp Target C. 10 92 33.3 18 93 33.9 25 91 32.8 35 89 31.7 45 89 31.7 60 88 31.1
HPLC Analysis
(961) Fermentation sampling took place by sampling 5 grams of mash into 15 ml tubes at 0, 2, 4, 6, 8, 12, 16, 24, 30, 48, 54, and 60 hours of fermentation. Each tube was processed for HPLC analysis by deactivation with 150 L of 40% v/v H.sub.2SO.sub.4, vortexing, centrifuging at 1460g for 10 minutes, and filtering through a 0.45 m Whatman PP filter. Samples were stored at 4 C. prior to and during HPLC analysis.
(962) TABLE-US-00055 TABLE 42 HPLC System HPLC Agilent's 1100/1200 series with Chem station software System Degasser, Quaternary Pump, Auto-Sampler, Column Compartment /w Heater Refractive Index Detector (RI) Column Bio-Rad HPX-87H Ion Exclusion Column 300 mm 7.8 mm part# 125-0140 Bio-Rad guard cartridge Cation H part# 125-0129, Holder part# 125-0131 Method 0.005M H2SO4 mobile phase Flow rate: 0.6 ml/min Column temperature: 65 C. RI detector temperature: 55 C.
(963) Samples were analyzed for sugars (DP4+, DP3, DP2, glucose, and fructose), organic acids (lactic and acetic), glycerol, and ethanol.
(964) Results
(965) Lactic Acid titers are shown across the entire course of the fermentation in
(966) Table 43 shows lactic acid titers in 1 L fermentations, liquefied with Alpha-Amylase A.
(967) TABLE-US-00056 TABLE 43 Lactic Acid Results at 60 Hours of Fermentation MBG4851 ER (g/L Lactic Acid) (g/L Lactic Acid) % Reduction with MBG4851 1.180 0.894 24.25%
Example 28
(968) Reduced Lactic Acid Accumulation During Bioreactor Fermentations of Industrially Produced Corn Mash.
(969) The lactic acid accumulation when using MBG4851 compared to Ethanol Red were evaluated in industrially prepared corn mash liquefied with a blend of alpha-amylase (2.1 g EP AA369/gDS), glucoamylase (4.5 g EP PoAMG498/g DS) and 0.0385 g EP Pfu/g DS.
(970) Corn Mash
(971) Industrially prepared corn mash was obtained from Husker AG. Solids on this mash were measured to be 34.05% by moisture balance.
(972) Yeast Strains and Propagation
(973) The two yeast strains tested in this experiment were Ethanol Red (Fermentis) and MBG4851.
(974) The target solids percentage in the propagation was 20%, 587 ml of mash was added to 413 ml of water to reach a 1000 ml propagation volume at 20% solids. Lactrol was added at a concentration of 0.024 grams per liter. Urea nitrogen was added at a concentration of 1500 ppm, by adding 3 ml of a 50% urea solution. Glucoamylase dose was calculated to be 0.075 g per 1 L fermenter. As an inoculum, 2.08 grams of dried yeast were weighed out, added to 40 ml of water preheated to 36.5 C., and allowed to rehydrate for 30 minutes with swirling at 15 minutes. Ten ml of this rehydration was then added to the propagation. Propagation time was 8 hours at 33.3 C., at which time 15.2 ml of propagation was transferred to the fermentation vessels as an approximately 1.6% inoculation.
(975) All propagations and fermentations were run in 1 L Sartorius Q+ bioreactors.
(976) Simultaneous Saccharification and Fermentation (SSF)
(977) Lactrol was added to each fermenter at a concentration of 0.024 grams per liter.
(978) Urea was added to 600 ppm total urea. Glucoamylase SA was dosed to each reactor at 110 g EP GSA/gDS. To mimic enzyme addition at the plant scale, 30% of the glucoamylase and 50% of the fermentation urea were dosed at inoculation. After 8 hours of fermentation, the remaining 70% of glucoamylase and 50% of urea were added to the fermenter.
(979) Temperature Profiles
(980) All fermentations started at 32 C. and then started a temperature profile as described below.
(981) TABLE-US-00057 TABLE 44 Temperature Profiles Ferm Time Temp Target F. Temp Target C. 10 92 33.3 18 93 33.9 25 91 32.8 35 89 31.7 45 89 31.7 60 88 31.1
HPLC Analysis
(982) Fermentation sampling took place by sampling 5 grams of mash into 15 ml tubes at 0, 2, 4, 6, 8, 12, 16, 24, 30, 48, 54, and 60 hours of fermentation. Each tube was processed for HPLC analysis by deactivation with 150 L of 40% v/v H.sub.2SO.sub.4, vortexing, centrifuging at 1460g for 10 minutes, and filtering through a 0.45 m Whatman PP filter. Samples were stored at 4 C. prior to and during HPLC analysis.
(983) TABLE-US-00058 TABLE 45 HPLC System HPLC Agilent's 1100/1200 series with Chem station software System Degasser, Quaternary Pump, Auto-Sampler, Column Compartment /w Heater Refractive Index Detector (RI) Column Bio-Rad HPX-87H Ion Exclusion Column 300 mm 7.8 mm part# 125-0140 Bio-Rad guard cartridge Cation H part# 125-0129, Holder part# 125-0131 Method 0.005M H.sub.2SO.sub.4 mobile phase Flow rate: 0.6 ml/min Column temperature: 65 C. RI detector temperature: 55 C.
(984) Samples were analyzed for sugars (DP4+, DP3, DP2, glucose, and fructose), organic acids (lactic and acetic), glycerol, and ethanol.
(985) Results
(986) Lactic Acid titers are shown across the entire course of the fermentation in
(987)
(988) TABLE-US-00059 TABLE 46 60 Hour Lactic Acid Results. MBG4851 ER (g/L Lactic Acid) (g/L Lactic Acid) % Reduction with MBG4851 1.226 0.938 23.54%
Example 29
(989) Glycerol Reduction in Fermentations of Mashes Produced with Varying Levels of Pfu Protease.
(990) This example was carried out using the experimental set-up described in Example 22 above.
(991) The glycerol levels when using MBG4851 compared to Ethanol Red were evaluated in liquefacts liquefied with a blend of alpha-amylase (2.1 g EP AA369/gDS), glucoamylase (4.5 g EP PoAMG498/g DS) and increasing levels of Pfu protease (0.0385, 1.5, and 3.0 g EP Pfu/gDS).
(992) Results
(993) The 54 hour glycerol results are shown in Table 47 below for experiment 1 and Table 48 below for experiment 2. MBG4851 had a significant reduction of glycerol even at the highest levels of Pfu supplementation.
(994) TABLE-US-00060 TABLE 47 54 hour Glycerol Results for Experiment 1 Pfu Dose (g EP/g Ds) ER MBG4851 % Decrease 0.0385 14.52546 12.3727325 14.82% 1.5 13.57462 12.3477627 9.04% 3 13.48923 12.3634329 8.35%
(995) TABLE-US-00061 TABLE 48 54 hour glycerol results for Experiment 2 0 ppm Urea 500 ppm Urea Pfu Dose % Pfu Dose % (g EP/g Ds) ER MBG4851 Decrease (g EP/g Ds) ER MBG4851 Decrease 0.0385 13.631 11.800 13.44% 0.0385 13.665 11.346 16.97% 1.5 13.425 11.565 13.85% 1.5 13.543 11.503 15.06% 3 12.921 11.362 12.06% 3 12.902 11.657 9.65%
Example 30
(996) Glycerol Reduction in Fermentations of Backset Free Mashes Produced with Varying Levels of Pfu Protease
(997) This example was carried out using the experimental set-up described in Example 24 above.
(998) The glycerol levels when using MBG4851 compared to Ethanol Red were evaluated in backset free liquefacts liquefied with a blend of alpha-amylase (2.1 g EP AA369/gDS), glucoamylase (4.5 g EP PoAMG498/g DS) and increasing levels of Pfu protease (0.0385 and 3.0 g EP Pfu/gDS).
(999) The 54 hour glycerol results are shown in Table 49 below. MBG4851 had a significant glycerol reduction compared to Ethanol Red regardless of added urea.
(1000) TABLE-US-00062 TABLE 49 54 hour glycerol results Pfu Urea % Dose (ppm) ER MBG4851 Decrease 0.0385 g 0 9.033 7.748 14.23% EP/g 200 9.704 7.961 17.96% DS Pfu 300 10.145 8.103 20.13% 500 10.510 8.362 20.43% 1000 10.343 8.931 13.64% 3.0 g 0 9.784 7.540 22.94% EP/g 200 9.621 7.683 20.14% DS Pfu 300 9.552 7.847 17.85% 500 9.545 7.787 18.42% 1000 9.660 7.983 17.35%
Example 31
(1001) Glycerol Reduction in Fermentations of Corn Mash Produced Industrially with Alpha-Amylase A as the Liquefaction Enzyme
(1002) This example was carried out using the experimental set-up described in Example 23 above.
(1003) The glycerol levels when using MBG4851 compared to Ethanol Red were evaluated in an industrially produced alpha-amylase (Alpha-Amylase A) liquefied corn mash with varying levels of urea supplementation.
(1004) Glycerol results can be found in Table 50 below.
(1005) TABLE-US-00063 TABLE 50 54 hour glycerol results Urea % (ppm) ER MBG4851 Decrease 0 11.721 10.007 14.62% 150 12.182 10.162 16.58% 300 12.115 10.289 15.07% 600 11.855 10.273 13.34% 1000 11.714 10.524 10.16% 3000 13.281 11.569 12.89%
Example 32
(1006) Glycerol Reduction in Fermentations of Corn Mash Produced Industrially with Alpha-Amylase F (Fuelzyme) as the Liquefaction Enzyme
(1007) This example was carried out using the experimental set-up described in Example 25 above.
(1008) The glycerol levels when using of MBG4851 compared to Ethanol Red were evaluated in an industrially prepared Alpha-Amylase F (Fuelzyme) liquefied corn mash.
(1009) 52 hour glycerol results can be found in Table 51 below.
(1010) TABLE-US-00064 TABLE 51 52 hour glycerol results ER MBG4851 % Decrease 10.974 8.518 22.37%
Example 33
(1011) Glycerol Reduction in Fermentations of Corn Mash Produced Industrially with Liquefaction Enzyme Blend
(1012) This example was carried out using the experimental set-up described in Example 26 above.
(1013) The glycerol levels when using MBG4851 compared to Ethanol Red were evaluated in industrially prepared corn mash liquefied with a blend of alpha-amylase (2.1 g EP AA369/gDS), glucoamylase (4.5 g EP PoAMG498/g DS) and 0.0385 g EP Pfu/g DS.
(1014) 54 hour glycerol results can be found in Tables 52 and 53 for Experiments 1 and 2 respectively.
(1015) TABLE-US-00065 TABLE 52 54 Hour Glycerol Results for Experiment 1 Glucoamylase ER MBG4851 % Decrease GSA + CVD 15.4833 13.6878 11.60% GSA 15.6964 13.9262 11.28%
(1016) TABLE-US-00066 TABLE 53 54 Hour Glycerol Results for Experiment 2 GA ER MBG4851 % Decrease GSA + CVD 15.0683 13.3075 11.69% GSA 15.2362 13.4763 11.55%
Example 34
(1017) Glycerol Level During Bioreactor Fermentations of Industrially Produced Alpha-Amylase A Corn Mash.
(1018) This example was carried out using the experimental set-up described in Example 27 above.
(1019) The glycerol levels when using of MBG4851 compared to Ethanol Red were evaluated in an industrially prepared Alpha-Amylase A liquefied corn mash.
(1020) Glycerol accumulation in the mash throughout fermentation can be seen in
(1021)
(1022) TABLE-US-00067 TABLE 54 60 hour Glycerol Values ER MBG4851 % Decrease 14.429 13.799 4.37%
Example 35
(1023) Glycerol Level During Bioreactor Fermentations of Industrially Produced Corn Mash.
(1024) This example was carried out using the experimental set-up described in Example 28 above.
(1025) The glycerol levels when using MBG4851 (V14/004037) compared to Ethanol Red were evaluated in industrially prepared corn mash liquefied with a blend of alpha-amylase (2.1 g EP AA369/gDS), glucoamylase (4.5 g EP PoAMG498/g DS) and 0.0385 g EP Pfu/g DS.
(1026) Glycerol accumulation in the mash throughout fermentation can be seen in
(1027)
(1028) TABLE-US-00068 TABLE 55 60 Hour Glycerol Values ER MBG4851 % Decrease 16.916 15.643 7.53%
Example 36
(1029) Production of Strain V14/004037 (MBG4851)
(1030) Strain V14/004037 was produced using the methods described in WO 2005/121337 and through matings with various strains of Saccharomyces cerevisiae combined with selection for characteristics including low glycerol and high ethanol production.
(1031) Strain V14/004037 was verified to be a Saccharomyces cerevisiae strain by its ability to sporulate and produce progeny when the germinated spores were mated with standard strains of Saccharomyces cerevisiae, including tester strains of Saccharomyces cerevisiae. One such haploid tester strain is W303-1A. Specifically, germinated spores of strain V14/004037 were able to produce hybrid progeny when mated with tester strain W303-1A.
(1032) In more detail, haploid strain W303-1A was obtained from the Yeast Genetic Stock Center at the ATCC, USA (ATCC #208352) Strain V14/004037 was cultured to form haploid Saccharomyces yeast as described in Ausubel, F. M. et al. (1997), Current Protocols in Molecular Biology, Volume 2, pages 13.2.1 to 13.2.5, published by John Wiley & Sons. Subsequently, the spores were germinated on a solid medium such as GYP containing 1% w/v D-glucose, 0.5% yeast extract, 1% w/v bacteriological peptone and 1.5% w/v agar and incubated at 30 C. for three to five days. The isolated germinated spores from strain V14/004037 were then mated together with haploid W303-1A using the method described in, for example, Ausubel, F. M. et al. (1997), Current Protocols in molecular Biology, Volume 2, pages 13.2.1 to 13.2.5, published by John Wiley & Sons. Formation of hybrid zygotes could be observed under a microscope demonstrating that strain V14/004037 is a Saccharomyces cerevisiae strain.
(1033) Strain V14/004037 was deposited on 17 Feb. 2014 at the National Measurement Institute, 1/153 Bertie Street, Port Melbourne, Victoria 3207, Australia under the Budapest Treaty and was designated accession number V14/004037.
Example 37
(1034) Growth of Strain V14/004037 (MBG4851) on Xylose Minimal Media
(1035) Growth of strain V14/004037 on xylose as a sole carbon source was determined using Test T1. Saccharomyces cerevisiae strain V14/004037 was streaked onto 2% w/v D-glucose 1% bacteriological peptone and 0.5% yeast extract medium (GYP) solidified with 2% agar using standard microbiological techniques. After incubation for 72 hours at 30 deg Celsius, yeast cells were taken from plates using a sterile microbiological loop and inoculated to an OD.sub.600 (Optical Density at 600 nm) of between 0.1 and 0.2 units (OD.sub.600 at T0) in 50 ml of broth. An OD.sub.600 of 0.1 unit is equal to approximately 910.sup.5 yeast cells/mL. The broth contained xylose (5% w/v), Difco Yeast Nitrogen Base w/o amino acids (0.67%), citric acid (0.3%) and trisodium citrate (0.7%) in distilled water in a 250 ml Erlenmeyer flask. Citric acid and trisodium citrate were provided as buffering agents that are not able to be used as growth substrates by Saccharomyces. D-(+)-Xylose 99% pure was obtained from Sigma-Aldrich (catalogue number X1500-500G). Cultures were incubated at 30 deg Celsius with shaking at 220 rpm (10 cm orbital diameter) for 48 hours prior to measuring OD.sub.600 (OD.sub.600 at T.sub.48 hrs). The fold increase in biomass was determined by the equation: OD.sub.600 at T.sub.48 hrs divided by OD.sub.600 at T.sub.0.
(1036) Strain V14/004037 was inoculated at an initial OD.sub.600 of 0.149 and increased more than 7-fold in 48 hours. Under the same conditions biomass of Ethanol Red yeast increased less than 2-fold.
Example 38
(1037) Fermentation of Corn Mash
(1038) Corn mash may be obtained from ethanol-producing companies such as described in Devantier et al., Applied Microbiology and Biotechnology 2005, 68:622-629. A method for preparing corn mash is also described in Thomas et al., Journal of Applied Microbiology 2001, 90:819-828.
(1039) Corn mash can also be prepared as follows:
(1040) Depending on the desired corn mash dry matter target, the following ingredients are placed into a glass beaker and the total weight of ingredients plus beaker is recorded.
(1041) TABLE-US-00069 TABLE 56 CORN MASH % dry STILLAGE GROUND matter UREA BACKSET WATER CORN -AMYLASE 30 0.6 g 162 g 231 g 207 g 1.34 ml 31 0.6 g 162 g 224 g 214 g 1.34 ml 32 0.6 g 162 g 217 g 221 g 1.34 ml 33 0.6 g 162 g 210 g 228 g 1.34 ml
(1042) Alpha-amylase may be for example, Liquozyme SC (Novozymes, Bagsvaerd, Denmark). The slurry is continuously stirred at 85 C. for 3.5 hours. The mash is then cooled, and the mass of beaker is weighed and compensated with water to account for evaporation during cooking of mash based on original weight of beaker and ingredients. Mash is cooled to 32 C. and adjusted to pH 5.2.
(1043) Glucoamylase is added. Glucoamylase may be for example Spirizyme Excel (Novozymes) and is dosed at 0.05% of dry corn solids. The mash is mixed, then dispensed in 15 g aliquots into 50 mL plastic screw capped tubes. The mash samples are placed in a static incubator at the desired temperature (typically 32 C.) for 30 min prior to addition of yeast. Yeast is prepared by suspending 0.1 g active dried yeast in 5 mL water at 37 deg C and leaving static for 30 min. After vortex mixing to disperse the yeast evenly, 190 microliters of the suspended yeast is inoculated per 15 g of corn mash prepared as described above.
(1044) The inoculated corn mash is incubated static for 50 hours and assayed by HPLC as described in WO 2011/035392.
(1045) The levels of ethanol, glycerol, glucose and maltose in the fermentation were determined using methods described in WO 2011/035392 following 20 hours (Table 57), 44 hrs (Table 58) and 50 hours (Table 59) of fermentation.
(1046) The results are also plotted graphically in
(1047) All yeasts were active dry yeasts. Ethanol Red is a commercial sample from Fermentis, BP 3029-137 rue Gabriel Peri, F-59703 Marcq-en-Baroeul, Cedex France.
(1048) V09/024011 and V14/004037 (MBG4851) were grown and dried as described in WO 2011/035392 A representative sample of Ethanol Red was deposited on 19 Mar. 2014 under the Budapest Treaty at the National Measurement Institute, 1/153 Bertie Street, Port Melbourne, Victoria 3207 and designated accession no. V14/007039. Values are presented as percent weight per volume (% w/v).
(1049) TABLE-US-00070 TABLE 57 Fermentation of corn mash for 20 hours 31% (DM) CORN MASH Ethanol/ FERMENTATION Glycerol 20 hr Maltose Glucose Glycerol Ethanol Ratio 1. Ethanol Red 3.700 5.208 1.222 7.075 5.8 2. Ethanol Red 3.602 5.144 1.218 7.282 6.0 3. Ethanol Red 3.625 4.796 1.229 7.396 6.0 4. Ethanol Red 3.597 5.025 1.222 7.186 5.9 5. Ethanol Red 3.560 5.191 1.217 7.125 5.9 6. Ethanol Red 3.633 5.104 1.221 7.271 6.0 7. V14/004037 3.304 4.522 1.146 7.726 6.7 8. V14/004037 2.610 5.173 1.165 8.049 6.9 9. V14/004037 3.222 4.451 1.158 7.880 6.8 10. V14/004037 3.234 4.409 1.156 7.924 6.9 11. V14/004037 3.250 4.559 1.151 7.853 6.8 12. V14/004037 3.195 4.326 1.161 7.991 6.9 13. V09/024011 4.276 9.725 1.022 4.667 4.6 14. V09/024011 4.205 9.542 1.039 4.858 4.7 15. V09/024011 4.183 9.714 1.031 4.771 4.6 16. V09/024011 2.445 11.748 1.052 4.958 4.7 17. V09/024011 4.217 9.802 1.023 4.750 4.6 18. V09/024011 4.179 9.551 1.030 4.817 4.7
(1050) As can be seen from Table 57, after 20 hours of fermentation of corn mash, strain V14/004037 produced greater amounts of ethanol than Ethanol Red and strain V09/024011 and less glycerol than Ethanol Red. The ratio of the fermentation products Ethanol to Glycerol was also significantly higher for V14/004037.
(1051) TABLE-US-00071 TABLE 58 Fermentation of corn mash for 44 hours 31% (DM) CORN MASH Ethanol/ FERMENTATION Glycerol 44 hr Maltose Glucose Glycerol Ethanol Ratio 1. Ethanol Red 0.447 1.033 1.588 12.687 8.0 2. Ethanol Red 0.465 1.005 1.577 12.704 8.1 3. Ethanol Red 0.452 0.998 1.594 12.745 8.0 4. Ethanol Red 0.446 1.017 1.577 12.679 8.0 5. Ethanol Red 0.438 1.061 1.562 12.623 8.1 6. Ethanol Red 0.447 1.047 1.574 12.685 8.1 7. V14/004037 0.322 0.401 1.361 13.379 9.8 8. V14/004037 0.324 0.402 1.350 13.377 9.9 9. V14/004037 0.324 0.481 1.354 13.361 9.9 10. V14/004037 0.324 0.355 1.355 13.429 9.9 11. V14/004037 0.329 0.449 1.348 13.313 9.9 12. V14/004037 0.321 0.346 1.354 13.424 9.9 13. V09/024011 0.468 2.647 1.640 11.578 7.1 14. V09/024011 0.466 2.617 1.636 11.637 7.1 15. V09/024011 0.469 2.556 1.644 11.733 7.1 16. V09/024011 0.461 2.456 1.633 11.677 7.2 17. V09/024011 0.472 2.648 1.643 11.613 7.1 18. V09/024011 0.464 2.573 1.639 11.664 7.1
(1052) As can be seen from Table 58, after 44 hours of fermentation of corn mash, strain V14/004037 produced greater amounts of ethanol than Ethanol Red and strain V09/024011, and less glycerol than both Ethanol Red and strain V09/024011.
(1053) TABLE-US-00072 TABLE 59 Fermentation of corn mash for 50 hours 31% (DM) CORN MASH Ethanol/ FERMENTATION Glycerol 50 hr Maltose Glucose Glycerol Ethanol Ratio 1. Ethanol Red 0.456 0.290 1.597 13.116 8.2 2. Ethanol Red 0.457 0.363 1.593 13.108 8.2 3. Ethanol Red 0.467 0.260 1.607 13.145 8.2 4. Ethanol Red 0.472 0.295 1.598 13.135 8.2 5. Ethanol Red 0.450 0.298 1.595 13.133 8.2 6. Ethanol Red 0.459 0.323 1.600 13.158 8.2 7. V14/004037 0.302 0.022 1.359 13.736 10.1 8. V14/004037 0.308 0.017 1.359 13.554 10.0 9. V14/004037 0.305 0.029 1.366 13.640 10.0 10. V14/004037 0.304 0.023 1.361 13.648 10.0 11. V14/004037 0.308 0.030 1.357 13.616 10.0 12. V14/004037 0.303 0.022 1.366 13.651 10.0 13. V09/024011 0.456 1.596 1.671 12.334 7.4 14. V09/024011 0.458 1.469 1.681 12.339 7.3 15. V09/024011 0.459 1.395 1.683 12.472 7.4 16. V09/024011 0.455 1.280 1.674 12.451 7.4 17. V09/024011 0.461 1.389 1.678 12.460 7.4 18. V09/024011 0.453 1.367 1.679 12.453 7.4
(1054)
Example 39
(1055) Reduced Acetaldehyde Accumulation in Mash Produced with Pfu Protease.
(1056) The performance of MBG4851 compared to Ethanol Red (ER) was evaluated in a liquefact liquefied with a blend of alpha-amylase (2.1 g EP AA369/gDS), glucoamylase (4.5 g EP PoAMG498/g DS) and Pfu protease (3.0 g EP Pfu/gDS).
(1057) Liquefaction
(1058) Liquefactions were prepared by combining ground corn, backset and tap water to a target total weight of 185 g at 32.50% Dry Solids (DS); backset was blended at 30% w/w (weight of backset per total weight of mash). Backset from Lincolnway Energy, received on Dec. 12, 2012, and corn ground in house received from GPRE in Central City, Nebr., USA, were used for all liquefactions. Initial slurry pH was 5.0 and therefore, no further adjustment was needed. Next, water and enzymes were added, followed by sealing of all Labomat canisters and starting the 200 ml program: 5 C./min. Ramp, 15 minute Ramp to 80 C., hold for 1 min, Ramp to 85 C. at 1 C./min and holding for 103 min., 40 rpm for 30 seconds to the left and 30 seconds to the right. All canisters of mash were cooled in an ice bath and prepared for fermentation according to the SSF procedure described below. 2.1 g EP AA369/gDS, 4.5 g EP PoAMG498/gDS, and 3.0 g EP Pfu/g DS were added.
(1059) Yeast Strains and Preparation
(1060) The two yeast strains tested in this experiment were Ethanol Red (Fermentis) and MBG4851. Yeasts were rehydrated by weighing 3.52 g of dried yeast into 40 ml of 37 C. tap water in a 125 mL Erlenmeyer flask. The flasks were then covered with parafilm, swirled to mix, and allowed to incubate in a 32 C. water bath. After 15 minutes, the flasks were removed from the water bath and swirled once more to mix.
(1061) Simultaneous Saccharification and Fermentation (SSF)
(1062) The pH after liquefaction was 5.1 and was not adjusted further for SSF. Mash solids were calculated to be 31.6% by moisture balance.
(1063) One 350 ml propagation was set up for each yeast in 500 ml kettles. Mash solids were adjusted to 27%, and 0.024 g/L Lactrol was added for bacterial control. GA dose was calculated to be 0.018 g per 350 ml propagation. Five ml of rehydrated yeast was then added to start the propagation. Propagation time was 8 hours at 33.3 C., at which time 18 ml of propagation was transferred to the fermentation vessels as an approximately 1.8% inoculation.
(1064) Fermentations were set up in 1 L Sartorius Q+ reactors. Each fermentation vessel was set up with 1000 ml of the aforementioned corn mash. Mash was held at 12 C. until approximately one hour before inoculation, at which time it was warmed to 32 C. Lactrol was added to each fermenter at 0.024 g/L to limit bacterial contamination.
(1065) Urea was added to each mash to a final concentration of 200 ppm. Glucoamylase SA was dosed to each reactor of mash at 110 g EP GSA/gDS. To mimic enzyme addition at the plant scale, 30% of the glucoamylase was dosed at inoculation. After 8 hours of fermentation, the remaining 70% of glucoamylase was added to the fermenter. The temperature of both bioreactors started at 32 C. and then followed the following profile to mimic the temperatures experienced in an industrial setting.
(1066) TABLE-US-00073 Ferm Time Temp Target F. Temp Target C. 10 92 33.3 18 93 33.9 25 91 32.8 35 89 31.7 45 89 31.7 60 88 31.1
Sampling and GC Analysis
(1067) Fermentation sampling took place after 54 hours of fermentation.
(1068) Reactors were not sampled during fermentation. At the final time point, three samples were taken from each reactor. 5 ml of mash was sampled into a 15 ml centrifuge tube. After sampling, 150 l of 40% H.sub.2SO.sub.4 was used to stop the fermentation. Samples were vortexed to mix and then centrifuged at 3000 rpm for 5-10 minutes to pellet corn debris. Supernatant was then filtered through 0.45 M filters. All 54 hour samples were processed without further dilution. Samples were stored at 4 C. prior to submission for analysis.
(1069) Acetaldehyde levels were analyzed by Enthalpy Analytical Inc. (Durham, N.C.)
(1070) Results
(1071) The results for the acetaldehyde levels are shown below. In this experiment, the MBG4851 fermentation showed a 52% reduction in acetaldehyde levels compared to Ethanol Red (ER).
(1072) TABLE-US-00074 Acetaldehyde g/ml ER 51.36667 MBG4851 24.56667
Example 40
(1073) Increased Oil Yield in Fermentations Performed with MBG4851.
(1074) Yeast Strains and Preparation
(1075) The two yeast strains tested in this experiment were Ethanol Red (Fermentis) and MBG4851. Yeasts were rehydrated by weighing 5.5 g of dried yeast into 100 ml of 37 C. tap water in a 250 mL Erlenmeyer flask. The flasks were then covered with parafilm, swirled to mix, and allowed to incubate in a 32 C. water bath. After 15 minutes, the flasks were removed from the water bath and swirled once more to mix.
(1076) Simultaneous Saccharification and Fermentation (SSF)
(1077) Industrially produced corn mash liquefied with a blend of alpha-amylase (2.1 g EP AA369/gDS), glucoamylase (4.5 g EP PoAMG498/g DS) and protease (0.0385 g EP Pfu/g DS) was utilized for this experiment. The pH after liquefaction was 5.1 and was not adjusted further for SSF. Mash solids were calculated to be 28.30% by moisture balance. Mash was adjusted to 1000 ppm urea and 3 mg/L penicillin and aliquoted into 25 g samples in 50 mL screw cap centrifuge tubes, with 24 samples total. Glucoamylase SA (GSA) was dosed at 0.6 AGU/gDS in all tubes. In tubes 4-6 and 10-12, Protease X was dosed at 5 g/gDS. In tubes 1-6, 150 L of rehydrated MBG4851 yeast was added. In tubes 7-12, 150 L of rehydrated Ethanol Red yeast was added. Fermentations proceeded in a 32 C. shaking water bath for 64 hours.
(1078) Sampling and Oil Analysis
(1079) Oil Extraction:
(1080) Hexane was added to each sample at a dose of 0.125 mL hexane/1 g starting material. Each tube was covered in Dura-seal to prevent sample leakage, and mixed thoroughly. Tubes were centrifuged at 3,000g for 10 minutes in an Avanti JE Series centrifuge with JS-5.3 rotor. After centrifugation, the oil/hexane layer (supernatant) was removed using a positive displacement pipette, transferred to a pre-weighed 5 mL flip-top tube, and reweighed. The density of the sample was measured using a Rudolph Research Analytical density meter. The density of the supernatant was then calculated using the standard curve equation to find the % oil in the supernatant. From this value the total % oil in the starting material was derived.
(1081) Results
(1082) The results of the oil assays are listed in the following table.
(1083) TABLE-US-00075 % Change Treatment Average % Oil +/ Over Control ER Yeast 0.460% 0.058% ER Yeast + Protease X 0.552% 0.058% 20.02% MBG4851 Yeast 0.549% 0.058% 19.32% MBG4851 Yeast + Protease X 0.673% 0.058% 46.15%
(1084) The invention is further described in the following numbered paragraphs:
(1085) 1. A process for producing ethanol from starch-containing material comprising the steps of:
(1086) i) liquefying the starch-containing material at a temperature above the initial gelatinization temperature using an alpha-amylase;
(1087) ii) saccharifying using a glucoamylase;
(1088) iii) fermenting using a fermenting organism;
(1089) wherein the fermenting organism is Saccharomyces cerevisiae MBG4851 (deposited under Accession No. V14/004037 at National Measurement Institute, Victoria, Australia) or a fermenting organism strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851, or a derivative of Saccharomyces strain V14/004037 having defining characteristics of strain V14/004037.
(1090) 2. The process of paragraph 1, wherein a nitrogen source, preferably urea, is added in saccharification, fermentation, or simultaneous saccharification and fermentation (SSF).
(1091) 3. The process of paragraph 1, wherein less than 3,000 ppm, such as less than 2000 ppm, such as less than 1,000 ppm, such as less than 800 ppm, such as less than 600 ppm, such as less than 500 ppm, such as less than 400 ppm, such as less than 300 ppm such as less than 200 ppm, such as less than 100 ppm nitrogen source, such a no nitrogen source, especially urea, is added in saccharification or fermentation or SSF.
(1092) 4. The process of paragraph 1, wherein from 100 to 600 ppm urea is adding in saccharification or fermentation or SSF.
(1093) 5. The process of any of paragraphs 1-4, wherein a protease is added in saccharification or fermentation or SSF.
(1094) 6. The process of any of paragraphs 1-5, further comprises, prior to the liquefaction step i), the steps of: x) reducing the particle size of the starch-containing material, preferably by dry milling; y) forming a slurry comprising the starch-containing material and water.
(1095) 7. The process of any of paragraphs 1-6, wherein at least 50%, preferably at least 70%, more preferably at least 80%, especially at least 90% of the starch-containing material fit through a sieve with #6 screen.
(1096) 8. The process of any of paragraphs 1-3, wherein the pH in liquefaction is between 4-7, such as between pH 4.5-6.5, such as between pH 5.0-6.5, such as between pH 5.0-6.0, such as between pH 5.2-6.2, such as around 5.2, such as around 5.4, such as around 5.6, such as around 5.8.
(1097) 9. The process of any of paragraphs 1-8, wherein the temperature in liquefaction is in the range from 70-100 C., such as between 75-95 C., such as between 75-90 C., preferably between 80-90 C., such as 82-88 C., such as around 85 C.
(1098) 10. The process of any of paragraphs 1-9, wherein a jet-cooking step is carried out prior to liquefaction in step i).
(1099) 11. The process of paragraph 10, wherein the jet-cooking is carried out at a temperature between 110-145 C., preferably 120-140 C., such as 125-135 C., preferably around 130 C. for about 1-15 minutes, preferably for about 3-10 minutes, especially around about 5 minutes.
(1100) 12. The process of any of paragraphs 1-11, wherein saccharification and fermentation is carried out sequentially or simultaneously (SSF).
(1101) 13. The process of any of paragraphs 1-12, wherein saccharification is carried out at a temperature from 20-75 C., preferably from 40-70 C., such as around 60 C., and at a pH between 4 and 5.
(1102) 14. The process of any of paragraphs 1-13, wherein fermentation or simultaneous saccharification and fermentation (SSF) is carried out carried out at a temperature from 25 C. to 40 C., such as from 28 C. to 35 C., such as from 30 C. to 34 C., preferably around about 32 C. In an embodiment fermentation is ongoing for 6 to 120 hours, in particular 24 to 96 hours.
(1103) 15. The process of any of paragraphs 1-14, wherein the fermentation product is recovered after fermentation, such as by distillation.
(1104) 16. The process of any of paragraphs 1-15, wherein the fermentation product is an alcohol, preferably ethanol, especially fuel ethanol, potable ethanol and/or industrial ethanol.
(1105) 17. The process of any of paragraphs 1-16, wherein the starch-containing starting material is whole grains.
(1106) 18. The process of any of paragraphs 1-17, wherein the starch-containing material is derived from corn, wheat, barley, rye, milo, sago, cassava, manioc, tapioca, sorghum, oats, rice or potatoes.
(1107) 19. The process of any of paragraphs 1-18, wherein the alpha-amylase used or added in liquefaction step i) is of bacterial origin.
(1108) 20. The process of any of paragraphs 1-19, wherein the alpha-amylase is from the genus Bacillus, such as a strain of Bacillus stearothermophilus, in particular a variant of a Bacillus stearothermophilus alpha-amylase, such as the one shown in SEQ ID NO: 3 in WO 99/019467 or SEQ ID NO: 1 herein.
(1109) 21. The process of paragraph 20, wherein the Bacillus stearothermophilus alpha-amylase or variant thereof is truncated, preferably to have from 485-495 amini acuds, such as around 491 amino acids.
(1110) 22. The process of any of paragraphs 20 or 21, wherein the Bacillus stearothermophilus alpha-amylase has a double deletion at positions I181+G182, and optionally a N193F substitution, or deletion of R179+G180 (using SEQ ID NO: 1 for numbering).
(1111) 23. The process of any of paragraphs 20-22, wherein the Bacillus stearothermophilus alpha-amylase has a substitution in position S242, preferably S242Q substitution (using SEQ ID NO: 1 for numbering).
(1112) 24. The process of any of paragraphs 20-23, wherein the Bacillus stearothermophilus alpha-amylase has a substitution in position E188, preferably E188P substitution (using SEQ ID NO: 1 for numbering).
(1113) 25. The process of any of paragraphs 1-24, wherein the alpha-amylase has a T (min) at pH 4.5, 85 C., 0.12 mM CaCl.sub.2) of at least 10, such as at least 15, such as at least 20, such as at least 25, such as at least 30, such as at least 40, such as at least 50, such as at least 60, such as between 10-70, such as between 15-70, such as between 20-70, such as between 25-70, such as between 30-70, such as between 40-70, such as between 50-70, such as between 60-70.
(1114) 26. The process of any of paragraphs 1-25, wherein the alpha-amylase present and/or added in liquefaction step i) is selected from the group of Bacillus stearothermophilus alpha-amylase variants with the following mutations in addition to I181*+G182*, and optionally N193F: V59A+Q89R+G112D+E129V+K177L+R179E+K220P+N224L+Q254S; V59A+Q89R+E129V+K177L+R179E+H208Y+K220P+N224L+Q254S; V59A+Q89R+E129V+K177L+R179E+K220P+N224L+Q254S+D269E+D281N; V59A+Q89R+E129V+K177L+R179E+K220P+N224L+Q254S+1270L; V59A+Q89R+E129V+K177L+R179E+K220P+N224L+Q254S+H274K; V59A+Q89R+E129V+K177L+R179E+K220P+N224L+Q254S+Y276F; V59A+E129V+R157Y+K177L+R179E+K220P+N224L+S242Q+Q254S; V59A+E129V+K177L+R179E+H208Y+K220P+N224L+S242Q+Q254S; 59A+E129V+K177L+R179E+K220P+N224L+S242Q+Q254S; V59A+E129V+K177L+R179E+K220P+N224L+S242Q+Q254S+H274K; V59A+E129V+K177L+R179E+K220P+N224L+S242Q+Q254S+Y276F; V59A+E129V+K177L+R179E+K220P+N224L+S242Q+Q254S+D281N; V59A+E129V+K177L+R179E+K220P+N224L+S242Q+Q254S+M284T; V59A+E129V+K177L+R179E+K220P+N224L+S242Q+Q254S+G416V; V59A+E129V+K177L+R179E+K220P+N224L+Q254S; V59A+E129V+K177L+R179E+K220P+N224L+Q254S+M284T; A91L+M96I+E129V+K177L+R179E+K220P+N224L+S242Q+Q254S; E129V+K177L+R179E; E129V+K177L+R179E+K220P+N224L+S242Q+Q254S; E129V+K177L+R179E+K220P+N224L+S242Q+Q254S+Y276F+L427M; E129V+K177L+R179E+K220P+N224L+S242Q+Q254S+M284T; E129V+K177L+R179E+K220P+N224L+S242Q+Q254S+N376*+1377*; E129V+K177L+R179E+K220P+N224L+Q254S; E129V+K177L+R179E+K220P+N224L+Q254S+M284T; E129V+K177L+R179E+S242Q; E129V+K177L+R179V+K220P+N224L+S242Q+Q254S; K220P+N224L+S242Q+Q254S; M284V; V59A+Q89R+E129V+K177L+R179E+Q254S+M284V. V59A+E129V+K177L+R179E+Q254S+M284V;
(1115) 27. The process of any of paragraphs 1-26, wherein the alpha-amylase present and/or added in liquefaction step i) is selected from the following group of Bacillus stearothermophilus alpha-amylase variants: I181*+G182*+N193F+E129V+K177L+R179E; I181*+G182*+N193F+V59A+Q89R+E129V+K177L+R179E+H208Y+K220P+N224L+Q254S I181*+G182*+N193F+V59A+Q89R+E129V+K177L+R179E+Q254S+M284V; I181*+G182*+N193F+V59A+E129V+K177L+R179E+Q254S+M284V and I181*+G182*+N193F+E129V+K177L+R179E+K220P+N224L+S242Q+Q254S (using SEQ ID NO: 1 herein for numbering).
(1116) 28. The process of any of paragraphs 1-27, wherein a glucoamylase is present and/or added in saccharification and/or fermentation.
(1117) 29. The process of paragraph 28, wherein the glucoamylase present and/or added in saccharification, fermentation or simultaneous saccharification and fermentation (SSF) is of fungal origin, preferably from a strain of Aspergillus, preferably A. niger, A. awamori, or A. oryzae; or a strain of Trichoderma, preferably T. reesei; or a strain of Talaromyces, preferably T. emersonii, or a strain of Pycnoporus, or a strain of Gloeophyllum, such as G. serpiarium or G. trabeum, or a strain of the Nigrofomes.
(1118) 30. The process of any of paragraphs 1-29, wherein the glucoamylase is derived from Talaromyces emersonii, such as the one shown in SEQ ID NO: 19 herein,
(1119) 31. The process of any of paragraphs 1-29, wherein the glucoamylase is selected from the group consisting of:
(1120) (i) a glucoamylase comprising the mature polypeptide of SEQ ID NO: 19 herein;
(1121) (ii) a glucoamylase comprising an amino acid sequence having at least 60%, at least 70%, e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the mature polypeptide of SEQ ID NO: 19 herein.
(1122) 32. The process of any of paragraphs 1-29, wherein the glucoamylase present and/or added in saccharification is derived from Gloeophyllum serpiarium, such as the one shown in SEQ ID NO: 15 herein.
(1123) 33. The process of any of paragraphs 1-29, wherein the glucoamylase present and/or added in saccharification is selected from the group consisting of:
(1124) (i) a glucoamylase comprising the mature polypeptide of SEQ ID NO: 15 herein;
(1125) (ii) a glucoamylase comprising an amino acid sequence having at least 60%, at least 70%, e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the mature polypeptide of SEQ ID NO: 15 herein.
(1126) 34. The process of any of paragraphs 1-29, wherein the glucoamylase present and/or added in saccharification is derived from Gloeophyllum trabeum such as the one shown in SEQ ID NO: 17 herein.
(1127) 35. The process of any of paragraphs 1-29, wherein the glucoamylase present and/or added in saccharification is selected from the group consisting of:
(1128) (i) a glucoamylase comprising the mature polypeptide of SEQ ID NO: 17 herein;
(1129) (ii) a glucoamylase comprising an amino acid sequence having at least 60%, at least 70%, e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the mature polypeptide of SEQ ID NO: 17 herein.
(1130) 36. The process of any of paragraphs 1-29, wherein the glucoamylase is present and/or added in saccharification and/or fermentation in combination with an alpha-amylase.
(1131) 37. The process of paragraph 36, wherein the alpha-amylase is present and/or added in saccharification and/or fermentation is of fungal or bacterial origin.
(1132) 38. The process of paragraph 36 or 37, wherein the alpha-amylase present and/or added in saccharification and/or fermentation is derived from a strain of the genus Rhizomucor, preferably a strain the Rhizomucor pusillus, such as the one shown in SEQ ID NO: 3 in WO 2013/006756, such as a Rhizomucor pusillus alpha-amylase hybrid having an Aspergillus niger linker and starch-bonding domain, such as the one shown in SEQ ID NO: 16 herein.
(1133) 39. The process of any of paragraphs 36-38, wherein the alpha-amylase present and/or added in saccharification and/or fermentation is selected from the group consisting of:
(1134) (i) an alpha-amylase comprising the mature polypeptide of SEQ ID NO: 16 herein;
(1135) (ii) an alpha-amylase comprising an amino acid sequence having at least 60%, at least 70%, e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the mature polypeptide of SEQ ID NO: 16 herein.
(1136) 40. The process of any of paragraphs 36-39, wherein the alpha-amylase is a variant of the alpha-amylase shown in SEQ ID NO: 16 having at least one of the following substitutions or combinations of substitutions: D165M; Y141W; Y141R; K136F; K192R; P224A; P224R; S123H+Y141W; G20S+Y141W; A76G+Y141W; G128D+Y141W; G128D+D143N; P219C+Y141W; N142D+D143N; Y141W+K192R; Y141W+D143N; Y141W+N383R; Y141W+P219C+A265C; Y141W+N142D+D143N; Y141W+K192R V410A; G128D+Y141W+D143N; Y141W+D143N+P219C; Y141W+D143N+K192R; G128D+D143N+K192R; Y141W+D143N+K192R+P219C; G128D+Y141W+D143N+K192R; or G128D+Y141W+D143N+K192R+P219C (using SEQ ID NO: 16 for numbering).
(1137) 41. The process of any of paragraphs 36-40, wherein the alpha-amylase is derived from a Rhizomucor pusillus with an Aspergillus niger glucoamylase linker and starch-binding domain (SBD), preferably disclosed as SEQ ID NO: 16 herein, preferably having one or more of the following substitutions: G128D, D143N, preferably G128D+D143N (using SEQ ID NO: 16 for numering).
(1138) 42. The process of any of paragraphs 36-41, wherein the alpha-amylase variant has at least 75% identity preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, even more preferably at least 93%, most preferably at least 94%, and even most preferably at least 95%, such as even at least 96%, at least 97%, at least 98%, at least 99%, but less than 100% identity to the mature part of the polypeptide of SEQ ID NO: 16 herein.
(1139) 43. The process of any of paragraphs 1-42, wherein liquefaction step i) is carried out using: an alpha-amylase; a protease having a thermostability value of more than 20% determined as Relative Activity at 80 C./70 C.; and optionally a glucoamylase.
(1140) 44. The process of 43, wherein the protease with a thermostability value of more than 25% determined as Relative Activity at 80 C./70 C.
(1141) 45. The process of paragraphs 43-44, wherein the protease has a thermostability of more than 30%, more than 40%, more than 50%, more than 60%, more than 70%, more than 80%, more than 90%, more than 100%, such as more than 105%, such as more than 110%, such as more than 115%, such as more than 120% determined as Relative Activity at 80 C./70 C.
(1142) 46. The process of any of paragraphs 43-45, wherein the protease has a thermostability of between 20 and 50%, such as between 20 and 40%, such as 20 and 30% determined as Relative Activity at 80 C./70 C.
(1143) 47. The process of any of paragraphs 43-46, wherein the protease has a thermostability between 50 and 115%, such as between 50 and 70%, such as between 50 and 60%, such as between 100 and 120%, such as between 105 and 115% determined as Relative Activity at 80 C./70 C.
(1144) 48. The process of any of paragraphs 43-47, wherein the protease has a thermostability of more than 10%, such as more than 12%, more than 14%, more than 16%, more than 18%, more than 20%, more than 30%, more than 40%, more that 50%, more than 60%, more than 70%, more than 80%, more than 90%, more than 100%, more than 110% determined as Relative Activity at 85 C./70 C.
(1145) 49. The process of any of paragraphs 43-48, wherein the protease has thermostability of between 10 and 50%, such as between 10 and 30%, such as between 10 and 25% determined as Relative Activity at 85 C./70 C.
(1146) 50. The process of any of paragraphs 43-49, wherein the protease has a themostability above 60%, such as above 90%, such as above 100%, such as above 110% at 85 C. as determined using the Zein-BCA assay.
(1147) 51. The process of any of paragraphs 43-50, wherein the protease has a themostability between 60-120, such as between 70-120%, such as between 80-120%, such as between 90-120%, such as between 100-120%, such as 110-120% at 85 C. as determined using the Zein-BCA assay.
(1148) 52. The process of any of paragraphs 43-51, wherein the protease is of fungal origin.
(1149) 53. The process of any of paragraphs 43-52, wherein the protease is a variant of the metallo protease derived from a strain of the genus Thermoascus, preferably a strain of Thermoascus aurantiacus, especially Thermoascus aurantiacus CGMCC No. 0670.
(1150) 54. The process of any of paragraphs 43-53, wherein the protease is a variant of the metallo protease disclosed as the mature part of SEQ ID NO: 2 disclosed in WO 2003/048353 or the mature part of SEQ ID NO: 1 in WO 2010/008841 or SEQ ID NO: 3 herein mutations selected from the group of: S5*+D79L+S87P+A112P+D142L; D79L+S87P+A112P+T124V+D142L; S5*+N26R+D79L+S87P+A112P+D142L; N26R+T46R+D79L+S87P+A112P+D142L; T46R+D79L+S87P+T116V+D142L; D79L+P81R+S87P+A112P+D142L; A27K+D79L+S87P+A112P+T124V+D142L; D79L+Y82F+S87P+A112P+T124V+D142L; D79L+Y82F+S87P+A112P+T124V+D142L; D79L+S87P+A112P+T124V+A126V+D142L; D79L+S87P+A112P+D142L; D79L+Y82F+S87P+A112P+D142L; S38T+D79L+S87P+A112P+A126V+D142L; D79L+Y82F+S87P+A112P+A126V+D142L; A27K+D79L+S87P+A112P+A126V+D142L; D79L+S87P+N98C+A112P+G135C+D142L; D79L+S87P+A112P+D142L+T141C+M161C; S36P+D79L+S87P+A112P+D142L; A37P+D79L+S87P+A112P+D142L; S49P+D79L+S87P+A112P+D142L; S50P+D79L+S87P+A112P+D142L; D79L+S87P+D104P+A112P+D142L; D79L+Y82F+S87G+A112P+D142L; S70V+D79L+Y82F+S87G+Y97W+A112P+D142L; D79L+Y82F+S87G+Y97W+D104P+A112P+D142L; S70V+D79L+Y82F+S87G+A112P+D142L; D79L+Y82F+S87G+D104P+A112P+D142L; D79L+Y82F+S87G+A112P+A126V+D142L; Y82F+S87G+S70V+D79L+D104P+A112P+D142L; Y82F+S87G+D79L+D104P+A112P+A126V+D142L; A27K+D79L+Y82F+S87G+D104P+A112P+A126V+D142L; A27K+Y82F+S87G+D104P+A112P+A126V+D142L; A27K+D79L+Y82F+D104P+A112P+A126V+D142L; A27K+Y82F+D104P+A112P+A126V+D142L; A27K+D79L+S87P+A112P+D142L; and D79L+S87P+D142L.
(1151) 55. The process of any of paragraphs 43-54, wherein the protease is a variant of the metallo protease disclosed as the mature part of SEQ ID NO: 2 disclosed in WO 2003/048353 or the mature part of SEQ ID NO: 1 in WO 2010/008841 or SEQ ID NO: 3 herein with the following mutations:
(1152) D79L+S87P+A112P+D142L:
(1153) D79L+S87P+D142L; or
(1154) A27K+D79L+Y82F+S87G+D104P+A112P+A126V+D142L.
(1155) 56. The process of any of paragraphs 43-55, wherein the protease variant has at least 75% identity preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, even more preferably at least 93%, most preferably at least 94%, and even most preferably at least 95%, such as even at least 96%, at least 97%, at least 98%, at least 99%, but less than 100% identity to the mature part of the polypeptide of SEQ ID NO: 2 disclosed in WO 2003/048353 or the mature part of SEQ ID NO: 1 in WO 2010/008841 or SEQ ID NO: 3 herein.
(1156) 57. The process of any of paragraphs 43-56, wherein the protease variant of the Thermoascus aurantiacus protease shown in SEQ ID NO: 3 herein is one of the following: D79L S87P D142L D79L S87P A112P D142L D79L Y82F S87P A112P D142L S38T D79L S87P A112P A126V D142L D79L Y82F S87P A112P A126V D142L A27K D79L S87P A112P A126V D142L S49P D79L S87P A112P D142L S50P D79L S87P A112P D142L D79L S87P D104P A112P D142L D79L Y82F S87G A112P D142L 570V D79L Y82F S87G Y97W A112P D142L D79L Y82F S87G Y97W D104P A112P D142L 570V D79L Y82F S87G A112P D142L D79L Y82F S87G D104P A112P D142L D79L Y82F S87G A112P A126V D142L Y82F S87G S70V D79L D104P A112P D142L Y82F S87G D79L D104P A112P A126V D142L A27K D79L Y82F S87G D104P A112P A126V D142L
(1157) 58. The process of any of paragraphs 43-57, wherein the protease is of bacterial origin.
(1158) 59. The process of any of paragraphs 43-58, wherein the protease is derived from a strain of Pyrococcus, preferably a strain of Pyrococcus furiosus.
(1159) 60. The process of any of paragraphs 1-41, wherein the protease is the one shown in SEQ ID NO: 1 in U.S. Pat. No. 6,358,726, or SEQ ID NO: 13 herein.
(1160) 61. The process of any of paragraphs 43-60, wherein the protease is one having at least 80%, such as at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to in SEQ ID NO: 1 in U.S. Pat. No. 6,358,726 or SEQ ID NO: 13 herein.
(1161) 62. The process of any of paragraph 43-61, wherein 0.5-100 micro gram Pyrococcus furiosus protease per gram DS, such as 1-50 micro gram Pyrococcus furiosus protease per gram DS, such as 1-10 micro gram Pyrococcus furiosus protease per gram DS, such as 1.5-5 micro gram Pyrococcus furiosus protease per gram DS, such as around or more than 1.5 micro gram Pyrococcus furiosus protease per gram DS are present and/or added in liquefaction step i).
(1162) 63. The process of any of paragraphs 43-62, wherein 2-100 micro gram Pyrococcus furiosus protease per gram DS, such as 2.5-50 micro gram Pyrococcus furiosus protease per gram DS, such as 2.5-10 micro gram Pyrococcus furiosus protease per gram DS, such as 2.5-5 micro gram Pyrococcus furiosus protease gram DS, especially around 3 micro gram Pyrococcus furiosus protease per gram DS are present and/or added in liquefaction step i).
(1163) 64. The process of any of paragraphs 43-63, wherein a glucoamylase is present and/or added during liquefaction step i).
(1164) 65. The process of any of paragraphs 43-64, wherein the glucoamylase present and/or added in liquefaction has a heat stability at 85 C., pH 5.3, of at least 20%, such as at least 30%, preferably at least 35%.
(1165) 66. The process of any of paragraphs 43-65, wherein the glucoamylase present and/or added in liquefaction has a relative activity pH optimum at pH 5.0 of at least 90%, preferably at least 95%, preferably at least 97%.
(1166) 67. The process of any of paragraphs 43-66, wherein the glucoamylase present and/or added in liquefaction has a pH stability at pH 5.0 of at least at least 80%, at least 85%, at least 90%.
(1167) 68. The process of any of paragraphs 43-67, wherein the glucoamylase present and/or added in liquefaction step i) is derived from a strain of the genus Penicillium, especially a strain of Penicillium oxalicum disclosed as SEQ ID NO: 2 in WO 2011/127802 or SEQ ID NOs: 9 or 14 herein.
(1168) 69. The process of paragraph 43-68, wherein the glucoamylase has at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, even more preferably at least 93%, most preferably at least 94%, and even most preferably at least 95%, such as even at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to the mature polypeptide shown in SEQ ID NO: 2 in WO 2011/127802 or SEQ ID NOs: 9 or 14 herein.
(1169) 70. The process of any of paragraphs 43-69, wherein the glucoamylase is a variant of the Penicillium oxalicum glucoamylase shown in SEQ ID NO: 2 in WO 2011/127802 having a K79V substitution (using the mature sequence shown in SEQ ID NO: 14 herein for numbering), such as a variant disclosed in WO 2013/053801.
(1170) 71. The process of any of paragraph 43-70, wherein the Penicillium oxalicum glucoamylase has a K79V substitution (using SEQ ID NO: 14 for numbering) and further one of the following:
(1171) T65A; or
(1172) Q327F; or
(1173) E501V; or
(1174) Y504T; or
(1175) Y504*; or
(1176) T65A+Q327F; or
(1177) T65A+E501V; or
(1178) T65A+Y504T; or
(1179) T65A+Y504*; or
(1180) Q327F+E501V; or
(1181) Q327F+Y504T; or
(1182) Q327F+Y504*; or
(1183) E501V+Y504T; or
(1184) E501V+Y504*; or
(1185) T65A+Q327F+E501V; or
(1186) T65A+Q327F+Y504T; or
(1187) T65A+E501V+Y504T; or
(1188) Q327F+E501V+Y504T; or
(1189) T65A+Q327F+Y504*; or
(1190) T65A+E501V+Y504*; or
(1191) Q327F+E501V+Y504*; or
(1192) T65A+Q327F+E501V+Y504T; or
(1193) T65A+Q327F+E501V+Y504*;
(1194) E501V+Y504T; or
(1195) T65A+K161S; or
(1196) T65A+Q405T; or
(1197) T65A+Q327W; or
(1198) T65A+Q327F; or
(1199) T65A+Q327Y; or
(1200) P11F+T65A+Q327F; or
(1201) R1K+D3W+K5Q+G7V+N8S+T10K+P11S+T65A+Q327F; or
(1202) P2N+P4S+P11F+T65A+Q327F; or
(1203) P11F+D26C+K33C+T65A+Q327F; or
(1204) P2N+P4S+P11F+T65A+Q327W+E501V+Y504T; or
(1205) R1E+D3N+P4G+G6R+G7A+N8A+T10D+P11D+T65A+Q327F; or
(1206) P11F+T65A+Q327W; or
(1207) P2N+P4S+P11F+T65A+Q327F+E501V+Y504T; or
(1208) P11F+T65A+Q327W+E501V+Y504T; or
(1209) T65A+Q327F+E501V+Y504T; or
(1210) T65A+S105P+Q327W; or
(1211) T65A+S105P+Q327F; or
(1212) T65A+Q327W+S364P; or
(1213) T65A+Q327F+S364P; or
(1214) T65A+S103N+Q327F; or
(1215) P2N+P4S+P11F+K34Y+T65A+Q327F; or
(1216) P2N+P4S+P11F+T65A+Q327F+D445N+V447S; or
(1217) P2N+P4S+P11F+T65A+I172V+Q327F; or
(1218) P2N+P4S+P11F+T65A+Q327F+N502*; or
(1219) P2N+P4S+P11F+T65A+Q327F+N502T+P563S+K571E; or
(1220) P2N+P4S+P11F+R31S+K33V+T65A+Q327F+N564D+K571S; or
(1221) P2N+P4S+P11F+T65A+Q327F+S377T; or
(1222) P2N+P4S+P11F+T65A+V325T+Q327W; or
(1223) P2N+P4S+P11F+T65A+Q327F+D445N+V447S+E501V+Y504T; or
(1224) P2N+P4S+P11F+T65A+I172V+Q327F+E501V+Y504T; or
(1225) P2N+P4S+P11F+T65A+Q327F+S377T+E501V+Y504T; or
(1226) P2N+P4S+P11F+D26N+K34Y+T65A+Q327F; or
(1227) P2N+P4S+P11F+T65A+Q327F+I375A+E501V+Y504T; or
(1228) P2N+P4S+P11F+T65A+K218A+K221D+Q327F+E501V+Y504T; or
(1229) P2N+P4S+P11F+T65A+S103N+Q327F+E501V+Y504T; or
(1230) P2N+P4S+T10D+T65A+Q327F+E501V+Y504T; or
(1231) P2N+P4S+F12Y+T65A+Q327F+E501V+Y504T; or
(1232) K5A+P11F+T65A+Q327F+E501V+Y504T; or
(1233) P2N+P4S+T10E+E18N+T65A+Q327F+E501V+Y504T; or
(1234) P2N+T10E+E18N+T65A+Q327F+E501V+Y504T; or
(1235) P2N+P4S+P11F+T65A+Q327F+E501V+Y504T+T568N; or
(1236) P2N+P4S+P11F+T65A+Q327F+E501V+Y504T+K524T+G526A; or
(1237) P2N+P4S+P11F+K34Y+T65A+Q327F+D445N+V447S+E501V+Y504T; or
(1238) P2N+P4S+P11F+R31S+K33V+T65A+Q327F+D445N+V447S+E501V+Y504T; or
(1239) P2N+P4S+P11F+D26N+K34Y+T65A+Q327F+E501V+Y504T; or
(1240) P2N+P4S+P11F+T65A+F80*+Q327F+E501V+Y504T; or
(1241) P2N+P4S+P11F+T65A+K112S+Q327F+E501V+Y504T; or
(1242) P2N+P4S+P11F+T65A+Q327F+E501V+Y504T+T516P+K524T+G526A; or
(1243) P2N+P4S+P11F+T65A+Q327F+E501V+N502T+Y504*; or
(1244) P2N+P4S+P11F+T65A+Q327F+E501V+Y504T; or
(1245) P2N+P4S+P11F+T65A+S103N+Q327F+E501V+Y504T; or
(1246) K5A+P11F+T65A+Q327F+E501V+Y504T; or
(1247) P2N+P4S+P11F+T65A+Q327F+E501V+Y504T+T516P+K524T+G526A; or
(1248) P2N+P4S+P11F+T65A+K79A+Q327F+E501V+Y504T; or
(1249) P2N+P4S+P11F+T65A+K79G+Q327F+E501V+Y504T; or
(1250) P2N+P4S+P11F+T65A+K791+Q327F+E501V+Y504T; or
(1251) P2N+P4S+P11F+T65A+K79L+Q327F+E501V+Y504T; or
(1252) P2N+P4S+P11F+T65A+K79S+Q327F+E501V+Y504T; or
(1253) P2N+P4S+P11F+T65A+L72V+Q327F+E501V+Y504T; or
(1254) S255N+Q327F+E501V+Y504T; or
(1255) P2N+P4S+P11F+T65A+E74N+V79K+Q327F+E501V+Y504T; or
(1256) P2N+P4S+P11F+T65A+G220N+Q327F+E501V+Y504T; or
(1257) P2N+P4S+P11F+T65A+Y245N+Q327F+E501V+Y504T; or
(1258) P2N+P4S+P11F+T65A+Q253N+Q327F+E501V+Y504T; or
(1259) P2N+P4S+P11F+T65A+D279N+Q327F+E501V+Y504T; or
(1260) P2N+P4S+P11F+T65A+Q327F+S359N+E501V+Y504T; or
(1261) P2N+P4S+P11F+T65A+Q327F+D370N+E501V+Y504T; or
(1262) P2N+P4S+P11F+T65A+Q327F+V460S+E501V+Y504T; or
(1263) P2N+P4S+P11F+T65A+Q327F+V460T+P468T+E501V+Y504T; or
(1264) P2N+P4S+P11F+T65A+Q327F+T463N+E501V+Y504T; or
(1265) P2N+P4S+P11F+T65A+Q327F+S465N+E501V+Y504T; or
(1266) P2N+P4S+P11F+T65A+Q327F+T477N+E501V+Y504T.
(1267) 72. The process of any of paragraphs 43-71, wherein the glucoamylase present and/or added in liquefaction is the Penicillium oxalicum glucoamylase has a K79V substitution (using SEQ ID NO: 14 herein for numbering) and further one of the following: P11F+T65A+Q327F; P2N+P4S+P11F+T65A+Q327F (using SEQ ID NO: 14 herein for numbering).
(1268) 73. The process of any of paragraphs 43-72, wherein the glucoamylase variant has at least 75% identity preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, even more preferably at least 93%, most preferably at least 94%, and even most preferably at least 95%, such as even at least 96%, at least 97%, at least 98%, at least 99%, but less than 100% identity to the mature part of the polypeptide of SEQ ID NO: 14 herein.
(1269) 74. The process of any of paragraphs 1-73, further wherein a pullulanase is present during liquefaction and/or saccharification.
(1270) 75. The process of any of paragraphs 1-74, comprising the steps of:
(1271) i) liquefying the starch-containing material at a temperature above the initial gelatinization temperature using an alpha-amylase derived from Bacillus stearothermophilus;
(1272) ii) saccharifying using a glucoamylase;
(1273) iii) fermenting using a fermenting organism;
(1274) wherein the fermenting organism is Saccharomyces cerevisiae MBG4851 (deposited under Accession No. V14/004037 at National Measurement Institute, Victoria, Australia) or a strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or a derivative of Saccharomyces strain V14/004037 having the defining characteristics of strain V14/004037.
(1275) 76. The process of any of paragraphs 1-74, comprising the steps of:
(1276) i) liquefying the starch-containing material at a temperature above the initial gelatinization temperature using:
(1277) an alpha-amylase derived from Bacillus stearothermophilus comprising a double deletion at positions I181+G182, and optionally a N193F substitution; (using SEQ ID NO: 1 herein for numbering);
ii) saccharifying using a glucoamylase derived from a strain of Gloephyllum, such as Gloephyllum serpiarium or Gloephyllum trabeum.
iii) fermenting using a fermenting organism;
wherein the fermenting organism is Saccharomyces cerevisiae MBG4851 (deposited under Accession No. V14/004037 at National Measurement Institute, Victoria, Australia) or a strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or a derivative of Saccharomyces strain V14/004037 having the defining characteristics of strain V14/004037.
(1278) 77. The process of any of paragraphs 1-76, comprising the steps of:
(1279) i) liquefying the starch-containing material at a temperature above the initial gelatinization temperature using:
(1280) an alpha-amylase derived from Bacillus stearothermophilus; a protease having a thermostability value of more than 20% determined as Relative Activity at 80 C./70 C., preferably derived from Pyrococcus furiosus and/or Thermoascus aurantiacus; and optionally a Penicillium oxalicum glucoamylase;
ii) saccharifying using a glucoamylase;
iii) fermenting using a fermenting organism;
wherein the fermenting organism is Saccharomyces cerevisiae MBG4851 (deposited under Accession No. V14/004037 at National Measurement Institute, Victoria, Australia) or a strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or a derivative of Saccharomyces strain V14/004037 having the defining characteristics of strain V14/004037.
(1281) 78. A process of paragraphs 1-77, comprising the steps of:
(1282) i) liquefying the starch-containing material at a temperature above the initial gelatinization temperature using:
(1283) an alpha-amylase, preferably derived from Bacillus stearothermophilus, comprising a double deletion at positions I181+G182, and optionally a N193F substitution (using SEQ ID NO: 1 for numbering) and having a T (min) at pH 4.5, 85 C., 0.12 mM CaCl.sub.2 of at least 10;
ii) saccharifying using a glucoamylase;
iii) fermenting using a fermenting organism;
wherein the fermenting organism is Saccharomyces cerevisiae MBG4851 (deposited under Accession No. V14/004037 at National Measurement Institute, Victoria, Australia) or a strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or a derivative of Saccharomyces strain V14/004037 having the defining characteristics of strain V14/004037.
(1284) 79. A process of paragraphs 1-78, comprising the steps of: i) liquefying the starch-containing material at a temperature between 80-90 C.: an alpha-amylase, preferably derived from Bacillus stearothermophilus, having a T % (min) at pH 4.5, 85 C., 0.12 mM CaCl.sub.2 of at least 10; a protease, preferably derived from Pyrococcus furiosus and/or Thermoascus aurantiacus, having a thermostability value of more than 20% determined as Relative Activity at 80 C./70 C.; optionally a Penicillium oxalicum glucoamylase ii) saccharifying using a glucoamylase; iii) fermenting using a fermenting organism;
wherein the fermenting organism is Saccharomyces cerevisiae MBG4851 (deposited under Accession No. V14/004037 at National Measurement Institute, Victoria, Australia) or a strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or a derivative of Saccharomyces strain V14/004037 having the defining characteristics of strain V14/004037.
(1285) 80. A process of paragraphs 1-79, comprising the steps of:
(1286) i) liquefying the starch-containing material at a temperature above the initial gelatinization temperature using:
(1287) an alpha-amylase derived from Bacillus stearothermophilus having a double deletion at positions I181+G182, and optional substitution N193F; and optionally further one of the following set of substitutions: E129V+K177L+R179E; V59A+Q89R+E129V+K177L+R179E+H208Y+K220P+N224L+Q254S; V59A+Q89R+E129V+K177L+R179E+Q254S+M284V; V59A+E129V+K177L+R179E+Q254S+M284V; E129V+K177L+R179E+K220P+N224L+S242Q+Q254S (using SEQ ID NO: 1 herein for numbering);
ii) saccharifying using a glucoamylase, such as one from a strain of Gloephyllum, such as a strain of Gloephyllum serpiarium;
iii) fermenting using a fermenting organism;
wherein the fermenting organism is Saccharomyces cerevisiae MBG4851 (deposited under Accession No. V14/004037 at National Measurement Institute, Victoria, Australia) or a strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or a derivative of Saccharomyces strain V14/004037 having the defining characteristics of strain V14/004037.
(1288) 81. A process of paragraphs 1-80, comprising the steps of:
(1289) i) liquefying the starch-containing material at a temperature above the initial gelatinization temperature using:
(1290) an alpha-amylase derived from Bacillus stearothermophilus having a double deletion at positions I181+G182, and optional substitution N193F, and optionally further one of the following set of substitutions: E129V+K177L+R179E; V59A+Q89R+E129V+K177L+R179E+H208Y+K220P+N224L+Q254S; V59A+Q89R+E129V+K177L+R179E+Q254S+M284V; V59A+E129V+K177L+R179E+Q254S+M284V; E129V+K177L+R179E+K220P+N224L+S242Q+Q254S (using SEQ ID NO: 1 herein for numbering). a protease having a thermostability value of more than 20% determined as Relative Activity at 80 C./70 C., preferably derived from Pyrococcus furiosus and/or Thermoascus aurantiacus; and optionally a Penicillium oxalicum glucoamylase shown in SEQ ID NO: 14 having substitutions selected from the group of: K79V; K79V+P11F+T65A+Q327F; or K79V+P2N+P4S+P11F+T65A+Q327F; or K79V+P11F+D26C+K33C+T65A+Q327F; or K79V+P2N+P4S+P11F+T65A+Q327W+E501V+Y504T; or K79V+P2N+P4S+P11F+T65A+Q327F+E501V+Y504T; or K79V+P11F+T65A+Q327W+E501V+Y504T (using SEQ ID NO: 14 for numbering);
ii) saccharifying using a glucoamylase;
iii) fermenting using a fermenting organism;
wherein the fermenting organism is Saccharomyces cerevisiae MBG4851 (deposited under Accession No. V14/004037 at National Measurement Institute, Victoria, Australia) or a strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or a derivative of Saccharomyces strain V14/004037 having the defining characteristics of strain V14/004037.
(1291) 82. A process of paragraphs 1-81, comprising the steps of:
(1292) i) liquefying the starch-containing material at a temperature between 80-90 C. using:
(1293) an alpha-amylase derived from Bacillus stearothermophilus having a double deletion at positions I181+G182, and optional substitution N193F, and further optionally one of the following set of substitutions: E129V+K177L+R179E; V59A+Q89R+E129V+K177L+R179E+H208Y+K220P+N224L+Q254S; V59A+Q89R+E129V+K177L+R179E+Q254S+M284V; V59A+E129V+K177L+R179E+Q254S+M284V; E129V+K177L+R179E+K220P+N224L+S242Q+Q254S (using SEQ ID NO: 1 herein for numbering), a protease having a thermostability value of more than 20% determined as Relative Activity at 80 C./70 C., preferably derived from Pyrococcus furiosus and/or Thermoascus aurantiacus; a Penicillium oxalicum glucoamylase shown in SEQ ID NO: 14 having substitutions selected from the group of: K79V; K79V+P11F+T65A+Q327F; or K79V+P2N+P4S+P11F+T65A+Q327F; or K79V+P11F+D26C+K33C+T65A+Q327F; or K79V+P2N+P4S+P11F+T65A+Q327W+E501V+Y504T; or K79V+P2N+P4S+P11F+T65A+Q327F+E501V+Y504T; or K79V+P11F+T65A+Q327W+E501V+Y504T (using SEQ ID NO: 14 for numbering);
ii) saccharifying using a glucoamylase;
iii) fermenting using a fermenting organism; wherein the fermenting organism is Saccharomyces cerevisiae MBG4851 (deposited under Accession No. V14/004037 at National Measurement Institute, Victoria, Australia) or a strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or a derivative of Saccharomyces strain V14/004037 having the defining characteristics of strain V14/004037.
(1294) 83. The process of any of paragraphs 1-82, comprising the steps of:
(1295) i) liquefying the starch-containing material at a temperature above the initial gelatinization temperature using:
(1296) an alpha-amylase derived from Bacillus stearothermophilus having a double deletion at positions I181+G182, and optional substitution N193F (using SEQ ID NO: 1 herein for numbering); a protease having a thermostability value of more than 20% determined as Relative Activity at 80 C./70 C., preferably derived from Pyrococcus furiosus and/or Thermoascus aurantiacus; and optionally a pullulanase; a Penicillium oxalicum glucoamylase having a K79V substitution (using SEQ ID NO: 14 herein for numbering);
ii) saccharifying using a glucoamylase;
iii) fermenting using a fermenting organism; wherein the fermenting organism is Saccharomyces cerevisiae MBG4851 (deposited under Accession No. V14/004037 at National Measurement Institute, Victoria, Australia) or a strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or a derivative of Saccharomyces strain V14/004037 having the defining characteristics of strain V14/004037.
(1297) 84. A process of paragraphs 1-63, comprising the steps of:
(1298) i) liquefying the starch-containing material at a temperature above the initial gelatinization temperature using:
(1299) an alpha-amylase, preferably derived from Bacillus stearothermophilus, having a T % (min) at pH 4.5, 85 C., 0.12 mM CaCl.sub.2 of at least 10; between 0.5 and 10 micro grams Pyrococcus furiosus protease per g DS;
ii) saccharifying using a glucoamylase selected from the group of glucoamylase derived from a strain of Aspergillus, preferably A. niger, A. awamori, or A. oryzae; or a strain of Trichoderma, preferably T. reesei; or a strain of Talaromyces, preferably T. emersonii, or a strain of Pycnoporus, or a strain of Gloephyllum, such as G. serpiarium or G. trabeum, or a strain of the Nigrofomes;
iii) fermenting using a fermenting organism; wherein the fermenting organism is Saccharomyces cerevisiae MBG4851 (deposited under Accession No. V14/004037 at National Measurement Institute, Victoria, Australia) or a strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or a derivative of Saccharomyces strain V14/004037 having the defining characteristics of strain V14/004037.
(1300) 85. A process of paragraphs 1-84, comprising the steps of:
(1301) i) liquefying the starch-containing material at a temperature between 80-90 C. using;
(1302) an alpha-amylase, preferably derived from Bacillus stearothermophilus having a double deletion at positions I181+G182, and optional substitution N193F and having a T % (min) at pH 4.5, 85 C., 0.12 mM CaCl.sub.2 of at least 10; between 0.5 and 10 micro grams Pyrococcus furiosus protease per g DS; optionally a pullulanase; a Penicillium oxalicum glucoamylase;
ii) saccharifying using a glucoamylase;
iii) fermenting using a fermenting organism; wherein the fermenting organism is Saccharomyces cerevisiae MBG4851 (deposited under Accession No. V14/004037 at National Measurement Institute, Victoria, Australia) or a strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or a derivative of Saccharomyces strain V14/004037 having the defining characteristics of strain V14/004037.
(1303) 86. A process of paragraphs 1-85, comprising the steps of:
(1304) i) liquefying the starch-containing material at a temperature a temperature between 80-90 C. using;
(1305) an alpha-amylase derived from Bacillus stearothermophilus having a double deletion I181+G182 and optional substitution N193F; and optionally further one of the following set of substitutions: E129V+K177L+R179E; V59A+Q89R+E129V+K177L+R179E+H208Y+K220P+N224L+Q254S; V59A+Q89R+E129V+K177L+R179E+Q254S+M284V: V59A+E129V+K177L+R179E+Q254S+M284V E129V+K177L+R179E+K220P+N224L+S242Q+Q254S (using SEQ ID NO: 1 herein for numbering); between 0.5 and 10 micro grams Pyrococcus furiosus protease per g DS; and optionally a pullulanase; a Penicillium oxalicum glucoamylase shown in SEQ ID NO: 14 having substitutions selected from the group of: K79V; K79V+P11F+T65A+Q327F; or K79V+P2N+P4S+P11F+T65A+Q327F; or K79V+P11F+D26C+K33C+T65A+Q327F; or K79V+P2N+P4S+P11F+T65A+Q327W+E501V+Y504T; or K79V+P2N+P4S+P11F+T65A+Q327F+E501V+Y504T; or K79V+P11F+T65A+Q327W+E501V+Y504T (using SEQ ID NO: 14 for numbering);
ii) saccharifying using a glucoamylase;
iii) fermenting using a fermenting organism;
wherein the fermenting organism is Saccharomyces cerevisiae MBG4851 (deposited under Accession No. V14/004037 at National Measurement Institute, Victoria, Australia) or a strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or a derivative of Saccharomyces strain V14/004037 having the defining characteristics of strain V14/004037.
(1306) 87. A process of paragraphs 1-86, comprising the steps of:
(1307) i) liquefying the starch-containing material at a temperature between 80-90 C. using:
(1308) an alpha-amylase derived from Bacillus stearothermophilus having a double deletion I181+G182 and optional substitution N193F; and further one of the following set of substitutions: E129V+K177L+R179E; V59A+Q89R+E129V+K177L+R179E+H208Y+K220P+N224L+Q254S; V59A+Q89R+E129V+K177L+R179E+Q254S+M284V; V59A+E129V+K177L+R179E+Q254S+M284V; E129V+K177L+R179E+K220P+N224L+S242Q+Q254S (using SEQ ID NO: 1 herein for numbering). a protease having a thermostability value of more than 20% determined as Relative Activity at 80 C./70 C., preferably derived from Pyrococcus furiosus and/or Thermoascus aurantiacus; and optionally a pullulanase; a Penicillium oxalicum glucoamylase shown in SEQ ID NO: 14 having substitutions selected from the group of: K79V; K79V+P11F+T65A+Q327F; or K79V+P2N+P4S+P11F+T65A+Q327F; or K79V+P11F+D26C+K33C+T65A+Q327F; or K79V+P2N+P4S+P11F+T65A+Q327W+E501V+Y504T; or K79V+P2N+P4S+P11F+T65A+Q327F+E501V+Y504T; or K79V+P11F+T65A+Q327W+E501V+Y504T (using SEQ ID NO: 14 for numbering);
ii) saccharifying using a glucoamylase selected from the group of glucoamylase derived from a strain of Aspergillus; or a strain of Trichoderma; a strain of Talaromyces, a strain of Pycnoporus; a strain of Gloephyllum; and a strain of the Nigrofomes;
iii) fermenting using a fermenting organism; wherein the fermenting organism is Saccharomyces cerevisiae MBG4851 (deposited under Accession No. V14/004037 at National Measurement Institute, Victoria, Australia) or a strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or a derivative of Saccharomyces strain V14/004037 having the defining characteristics of strain V14/004037.
(1309) 88. A process of any of paragraphs 1-87, comprising the steps of:
(1310) i) liquefying the starch-containing material at a temperature between 80-90 C. at a pH between 5.0 and 6.5 using:
(1311) an alpha-amylase derived from Bacillus stearothermophilus having a double deletion I181+G182 and optional substitution N193F; and optionally further one of the following set of substitutions: E129V+K177L+R179E; V59A+Q89R+E129V+K177L+R179E+H208Y+K220P+N224L+Q254S; V59A+Q89R+E129V+K177L+R179E+Q254S+M284V; V59A+E129V+K177L+R179E+Q254S+M284V; E129V+K177L+R179E+K220P+N224L+S242Q+Q254S (using SEQ ID NO: 1 herein for numbering); a protease derived from Pyrococcus furiosus, preferably the one shown in SEQ ID NO: 13 herein; a Penicillium oxalicum glucoamylase shown in SEQ ID NO: 14 having substitutions selected from the group of: K79V; K79V+P11F+T65A+Q327F; or K79V+P2N+P4S+P11F+T65A+Q327F; or K79V+P11F+D26C+K33C+T65A+Q327F; or K79V+P2N+P4S+P11F+T65A+Q327W+E501V+Y504T; or K79V+P2N+P4S+P11F+T65A+Q327F+E501V+Y504T; or K79V+P11F+T65A+Q327W+E501V+Y504T (using SEQ ID NO: 14 for numbering);
ii) saccharifying using a glucoamylase;
iii) fermenting using a fermenting organism; wherein the fermenting organism is Saccharomyces cerevisiae MBG4851 (deposited under Accession No. V14/004037 at National Measurement Institute, Victoria, Australia) or a strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or a derivative of Saccharomyces strain V14/004037 having the defining characteristics of strain V14/004037.
(1312) 89. The process of any of paragraphs 1-88, wherein a cellulolytic composition is present in saccharification, fermentation or simultaneous saccharification and fermentation (SSF).
(1313) 90. The process of any of paragraphs 1-89, wherein the fermentin organism strain has properties that are about the same as that of Saccharomyces cerevisiae MBG4851, or a derivative of Saccharomyces strain V14/004037 having the defining characteristics of strain V14/004037, as it provides an increase in ethanol yield compared to Ethanol Red under the same process conditions.
(1314) 91. The process of any of paragraphs 1-90, wherein the fermenting organism strain has properties that are about the same as that of Saccharomyces cerevisiae MBG4851, or a derivative of Saccharomyces strain V14/004037 having the defining characteristics of strain V14/004037, as it provides an increase in ethanol yield compared to Ethanol Red (ER) under the same conditions where no urea is present and/or added in simultaneous saccharification and fermentation (SSF).
(1315) 92. The process of any of paragraphs 1-91, wherein the fermenting organism strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or a derivative of Saccharomyces strain V14/004037 having the defining characteristics of strain V14/004037, as it produces reduced levels of lactic acid compared to Ethanol Red under the same process conditions.
(1316) 93. The process of any of paragraphs 1-92, wherein the fermenting organism strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or a derivative of Saccharomyces strain V14/004037 having the defining characteristics of strain V14/004037, as it produces reduced levels of glycerol compared to Ethanol Red under the same process conditions.
(1317) 94. The process of any of paragraphs 1-93, wherein the fermenting organism strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or a derivative of Saccharomyces strain V14/004037 having the defining characteristics of strain V14/004037, as it has faster fermentation kinetics compared to Ethanol Red under the same process conditions.
(1318) 95. The process of any of paragraphs 1-94, wherein the fermenting organism strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or a derivative of Saccharomyces strain V14/004037 having the defining characteristics of strain V14/004037, as it reduces the level of acetaldehyde in fermentation compared to Ethanol Red under the same process condition.
(1319) 96. The process of any of paragraphs 1-95, wherein the fermenting organism strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or a derivative of Saccharomyces strain V14/004037 having the defining characteristics of strain V14/004037, as it increases the oil recovery level compared to Ethanol Red under the same process conditions
(1320) 97. The process of any of paragraphs 1-96, wherein the fermenting organism strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851, or a derivative of Saccharomyces strain V14/004037 having defining characteristics of strain V14/004037, has one or more, such as all, of the following properties and defining characteristics: increases ethanol yield compared to Ethanol Red under the same process conditions; produces reduced levels of lactic acid compared to Ethanol Red under the same process conditions; produces reduced levels of glycerol compared to Ethanol Red under the same process conditions; reduces the level of acetaldehyde in fermentation compared to Ethanol Red under the same process condition; increases the oil recovery level compared to Ethanol Red under the same process conditions; has faster fermentation kinetics compared to Ethanol Red under the same process conditions.
(1321) 98. The process of any of paragraphs 1-97, wherein the fermenting organism is a non-recombinant Saccharomyces strain, preferably non-recombinant Saccharomyces cerevisiae strain.
(1322) 99. The process of any of paragraphs 1-98, wherein the fermenting organism strain is a non-recombinant Saccharomyces strain preferably non-recombinant Saccharomyces cerevisiae strain produced using the method described and concerned in U.S. Pat. No. 8,257,959-BB.
(1323) 100. The process of any of paragraphs 1-99, wherein the wherein the fermenting organism strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851, or a derivative of Saccharomyces strain V14/004037 having defining characteristics of strain V14/004037, provides an ethanol yield boost over Ethanol Red (ER) of more than 1.0% at 0 ppm urea and at a Pfu dose of 3 g EP/gDS, such as more than 1.5% at 0 ppm urea and at a Protease Pfu dose of 1.5 g EP/gDS, such as more than 4.0% at 0 ppm urea and at a Protease Pfu dose of 0.0385 g EP/gDS when determined using the process set-up and conditions used in Example 19.
(1324) 101. The process of any of paragraphs 1-100, wherein the fermenting organism strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851, or a derivative of Saccharomyces strain V14/004037 having defining characteristics of strain V14/004037, provides an ethanol yield boost of more than 1.0% at urea levels of 300 ppm, such as more than 3.0% at urea levels of 150 ppm, such as more than 10.0% at urea levels of 0 ppm over Ethanol Red (ER) when determined using the process set-up and conditions used in Example 21.
(1325) 102. The process of any of paragraphs 1-101, wherein the fermenting organism strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851, or a derivative of Saccharomyces strain V14/004037 having defining characteristics of strain V14/004037, provides a reduction in lactic acid in a 54 hours fermentation of more than 50% at urea levels of 0 ppm and at a Protease Pfu dose of 0.0385 g/g DS, such as more than 50% at urea levels of 0 ppm and a Pfu dose of 3 g/gDS over Ethanol Red (ER) when determined using the process set-up and conditions used in Example 23.
(1326) 103. The process of any of paragraphs 1-102, wherein the fermenting organism strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851, or a derivative of Saccharomyces strain V14/004037 having the defining characteristics of strain V14/004037, provides a reduction in glycerol levels in a 60 hours fermentation of more than 2.0% such as more than 3.0%, such as more than 4.0% over Ethanol Red (ER) when determined using the process set-up and conditions used in Example 34.
(1327) 104. The process of any of paragraphs 1-103, wherein the fermenting organism strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851, or a derivative of Saccharomyces strain V14/004037 having the defining characteristics of strain V14/004037, provides a reduction in the acetaldehyde level, in a 54 hours fermentation, of more than 30%, such as more than 40%, such as more than 50% over Ethanol Red (ER) when determined using the process set-up and conditions used in Example 39.
(1328) 105. A process for producing ethanol from starch-containing material comprising the steps of:
(1329) i) liquefying the starch-containing material at a temperature above the initial gelatinization temperature using an alpha-amylase derived from Bacillus stearothermophilus;
(1330) ii) saccharifying using a glucoamylase;
(1331) iii) fermenting using a fermenting organism;
(1332) wherein the fermenting organism has one or more, such as all, of the following properties and defining characteristics:
(1333) increases ethanol yield compared to Ethanol Red (ER) under the same process conditions; produces reduced levels of lactic acid compared to Ethanol Red under the same process conditions; produces reduced levels of glycerol compared to Ethanol Red under the same process conditions; reduces the level of acetaldehyde in fermentation compared to Ethanol Red under the same process condition; increases the oil recovery level compared to Ethanol Red under the same process conditions; has faster fermentation kinetics compared to Ethanol Red under the same process conditions.
(1334) 106. The process of paragraph 103, wherein the fermenting organism is a Saccharomyces cerevisiae yeast.
(1335) 107. The process of paragraphs 105 or 106, wherein the fermenting organism is a non-recombinant Saccharomyces cerevisiae yeast.
(1336) 108. A process of any of paragraphs 1-107, comprising the steps of:
(1337) i) liquefying the starch-containing material at a temperature between 80-90 C. at a pH between 5.0 and 6.5 using:
(1338) an alpha-amylase derived from Bacillus stearothermophilus having a double deletion I181+G182 and optional substitution N193F; and optionally further one of the following set of substitutions: E129V+K177L+R179E; V59A+Q89R+E129V+K177L+R179E+H208Y+K220P+N224L+Q254S; V59A+Q89R+E129V+K177L+R179E+Q254S+M284V; V59A+E129V+K177L+R179E+Q254S+M284V; E129V+K177L+R179E+K220P+N224L+S242Q+Q254S (using SEQ ID NO: 1 herein for numbering). a protease derived from Pyrococcus furiosus, preferably the one shown in SEQ ID NO: 13 herein present and/or added in a dosage of 1-5 micro gram protease per gram DS, such as around 1.5 or 3 micro gram protease per gram DS; a Penicillium oxalicum glucoamylase shown in SEQ ID NO: 14 having substitutions selected from the group of: K79V; K79V+P11F+T65A+Q327F; or K79V+P2N+P4S+P11F+T65A+Q327F; or K79V+P11F+D26C+K33C+T65A+Q327F; or K79V+P2N+P4S+P11F+T65A+Q327W+E501V+Y504T; or K79V+P2N+P4S+P11F+T65A+Q327F+E501V+Y504T; or K79V+P11F+T65A+Q327W+E501V+Y504T (using SEQ ID NO: 14 for numbering);
ii) saccharifying using a glucoamylase;
iii) fermenting using a fermenting organism; wherein the fermenting organism is Saccharomyces cerevisiae MBG4851 (deposited under Accession No. V14/004037 at National Measurement Institute, Victoria, Australia) or a strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or a derivative of Saccharomyces strain V14/004037 having the defining characteristics of strain V14/004037.
(1339) 109. The process of any of paragraphs 105-108, wherein the fermenting organism is Saccharomyces cerevisiae MBG4851 (deposited under Accession No. V14/004037 at National Measurement Institute, Victoria, Australia), or the fermenting organism strain has properties that are about the same as that of Saccharomyces cerevisiae MBG4851, or a derivative of Saccharomyces strain V14/004037 having the defining characteristics of strain V14/004037.
(1340) 110. A process of recovering oil from a fermentation product production process comprising the steps of:
(1341) i) liquefying starch-containing material at a temperature above the initial gelatinization temperature using an alpha-amylase;
(1342) ii) saccharifying using a glucoamylase;
(1343) iii fermenting using a fermenting organism.
(1344) iv) recovering the fermentation product to form whole stillage;
(1345) v) separating the whole stillage into thin stillage and wet cake;
(1346) vi) optionally concentrating the thin stillage into syrup;
(1347) wherein oil is recovered/extracted downstream from fermentation step iii) and wherein the fermenting organism is Saccharomyces cerevisiae MBG4851 (deposited under Accession No. V14/004037 at National Measurement Institute, Victoria, Australia) or a fermenting organism strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or a derivative of Saccharomyces strain V14/004037 having defining characteristics of strain V14/004037.
(1348) 111. The process of claim 110, wherein a protease is present or added in saccharification and/or fermentation or simultaneous saccharification and fermentation (SSF).
(1349) 112. A Saccharomyces yeast strain deposited under the Budapest Treaty and having NMI accession no. V14/004037 (Saccharomyces cerevisiae MBG4851) or a strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or a derivative of strain V14/004037 which exhibits one or more defining characteristics of strain V14/004037.
(1350) 113. The strain of paragraph 112, wherein the strain is strain V14/004037 (MBG4851).
(1351) 114. A method of producing a derivative of strain V14/004037 which exhibits the defining characteristics of strain V14/004037, comprising: (a) providing: (i) a first yeast strain; and (ii) a second yeast strain, wherein the second yeast strain is strain V14/004037 or a derivative of strain V14/004037; (b) culturing the first yeast strain and the second yeast strain under conditions which permit combining of DNA between the first and second yeast strains; (c) screening or selecting for a derivative of strain V14/004037.
(1352) 115. The method of paragraph 114, wherein step (c) comprises screening or selecting for a hybrid strain which exhibits one or more defining characteristic of strain V14/004037.
(1353) 116. The method of paragraph 114, comprising the further step of: (d) repeating steps (b) and (c) with the screened or selected strain from step (c) as the first and/or second strain, until a derivative is obtained which exhibits the defining characteristics of strain V14/004037.
(1354) 117. The method of paragraph 114 or 115, wherein the culturing step (b) comprises: (i) sporulating the first yeast strain and the second yeast strain; (ii) hybridizing germinated spores produced by the first yeast strain with germinated spores produced by the second yeast strain.
(1355) 118. A Saccharomyces strain produced by the method of paragraph 114.
(1356) 119. A method of producing ethanol, comprising incubating a strain of paragraph 112 or 118 with a substrate comprising a fermentable sugar under conditions which permit fermentation of the fermentable sugar to produce ethanol.
(1357) 120. Use of a strain of paragraph 112 or 118 in the production of ethanol.
(1358) 121. A method of producing distiller's grain, comprising:
(1359) (a) incubating a Saccharomyces strain of paragraphs 112 or 118 with a substrate comprising fermentable sugar under conditions which allow fermentation of the fermentable sugar to produce ethanol and distiller's grains; (b) isolating the distiller's grains.
(1360) 122. Distiller's grain produced by the method of paragraph 121.
(1361) 123. Use of a strain of paragraph 112 or 118 in the production of distiller's grains.
(1362) 124. Use of strain V14/004037 (Saccharomyces cerevisiae MBG4851) in the production of a Saccharomyces strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or which exhibits one or more defining characteristics of strain V14/004037.
(1363) 125. Use of strain V14/004037 (Saccharomyces cerevisiae MBG4851) or a strain having properties that are about the same as that of Saccharomyces cerevisiae MBG4851 or a derivative of strain V14/004037 in a process according to any of paragraphs 1-111.
(1364) 126. Use of strain V14/004037 (Saccharomyces cerevisiae MBG4851) or a derivative of strain V14/004037 for reducing the level of acetaldehyde in fermentation compared to Ethanol Red under the same process condition.
(1365) 127. The use according to paragraph 126, wherein the mash in fermention has been subjected to alpha-amylase and from 0.5-50 micro gram protease per gram DS, such as 1-5 micro gram protease per gram DS such as around 1.5 or 3 micro gram protease per gram DS.
(1366) 128. The use according to paragraph 127, wherein the protease is a bacterial protease.
(1367) 129. The use according to claims 127-128, wherein the protease is derived from a strain of the bacterium Pyrococcus, such as a strain of Pyrococcus furiosus (pfu protease), such as or SEQ ID NO: 13 herein.
(1368) 130. The use according to paragraph 129, wherein the protease is the one disclosed in SEQ ID NO: 13 herein or a protease having at least 80% identity, such as at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID NO: 13 herein.
(1369) 131. The use according to paragraphs 125-128, wherein the alpha-amylase is of bacterial origin, such as from the genus Bacillus, such as a strain of Bacillus stearothermophilus, in particular a variant of a Bacillus stearothermophilus alpha-amylase, such as the one shown in SEQ ID NO: 1 herein.
(1370) 132. The use according to paragraph 130, wherein the Bacillus stearothermophilus alpha-amylase variant is selected from the group with the following mutations: I181*+G182*+N193F+E129V+K177L+R179E; I181*+G182*+N193F+V59A+Q89R+E129V+K177L+R179E+H208Y+K220P+N224L+Q254S; I181*+G182*+N193F+V59A+Q89R+E129V+K177L+R179E+Q254S+M284V; I181*+G182*+N193F+V59A+E129V+K177L+R179E+Q254S+M284V; and I181*+G182*+N193F+E129V+K177L+R179E+K220P+N224L+S242Q+Q254S (using SEQ ID NO: 1 for numbering).
(1371) 133. Th use according to any of paragraphs 125-132, where the mash to be fermented has been subjected to alpha-amylase, glucoamylase and from 0.5-50 micro gram protease per gram DS, such as 1-5 micro gram protease per gram DS such as around 1.5 or 3 micro gram protease per gram DS.
(1372) 134. The use according to paragraph 133, wherein the glucoamylase is derived from a strain of the genus Penicillium, especially a strain of Penicillium oxalicum disclosed in SEQ ID NOs: 9 or 14 herein.
(1373) 135. The use according to 134, wherein the glucoamylase is a variant of the Penicillium oxalicum glucoamylase having a K79V substitution (using the mature sequence shown in SEQ ID NO: 14 for numbering).
(1374) 136. The use according to paragraph 135, wherein the Penicillium oxalicum glucoamylase has a K79V substitution (using SEQ ID NO: 14 for numbering) and further one of the following: P11F+T65A+Q327F; P2N+P4S+P11F+T65A+Q327F (using SEQ ID NO: 14 for numbering).
(1375) 137. Use of strain V14/004037 (Saccharomyces cerevisiae MBG4851) or a derivative of strain V14/004037 for increasing oil recovery/extraction in an ethanol production process compared to Ethanol Red under the same process condition.
(1376) 138. A composition comprising a Saccharomyces yeast strain of any of paragraphs 112 or 118 and one or more naturally occurring and/or non-naturally occurring components.
(1377) 139. The composition of paragraph 138, wherein the components are selected from the group consisting of: surfactants, emulsifiers, gums, swelling agents, and antioxidants.
(1378) 140. The composition of paragraphs 138-139, wherein the Saccharomyces yeast strain is Saccharomyces MBG4851.
(1379) 141. The composition of paragraphs 138-140, wherein the Saccharomyces yeast strain is in a viable form, in particular in dry, cream or compressed form.