Catalytic nucleic acid and gold nanoparticles for detection of biomolecules
10036056 ยท 2018-07-31
Assignee
Inventors
Cpc classification
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
International classification
Abstract
The present invention relates to catalytic nucleic acid molecule signal amplification combined with surface plasmon properties of gold nanoparticles to achieve simple and sensitive colorimetric detection of biological targets. The assays of the present invention have about 50 pM sensitivity without the need for purification steps, can detect multiple targets in parallel, and is easily adaptable to new targets. The methods of the present invention are capable of rapid detection of genetic targets for gonorrhea, syphilis, malaria, and hepatitis B infections.
Claims
1. A method of simultaneously detecting a presence or an absence of more than one different nucleic acid targets of interest in a sample, characterized in that the method comprises: (a) mixing the sample suspected of having the more than one different nucleic acid targets with target-specific sets of (i) target-specific un-catalyzed nucleic acid substrates and (ii) target-specific pre-catalytic nucleic acid subunits, each target-specific pre-catalytic nucleic acid subunit including a sensor domain for specifically hybridizing to one of the more than one different nucleic acid targets, and a catalytic domain configured for catalyzing its corresponding target-specific un-catalyzed nucleic acid substrate solely when the corresponding specific target is bound to the sensor domain; (b) contacting the mixture of step (a) with separate target-specific populations of gold nanoparticles (GNPs), the GNPs in each target-specific population functionalized with a linking moiety for assembling with its corresponding target-specific un-catalyzed nucleic acid substrate and molecules of polyethylene glycol; and (c) optically determining for each separate target-specific population of GNPs whether the target-specific GNPs are in an assembled form with the corresponding target specific un-catalyzed nucleic acid substrate or in a substantially dispersed form, wherein in the assembled form the GNPs turn the sample to a first color, and in the substantially dispersed form the GNPs turn the sample to a second color thereby simultaneously detecting the presence or absence of the more than one different nucleic acid targets of interest in the sample.
2. The method of claim 1, characterized in that said method further includes spotting the sample onto thin layer chromatography (TLC) plates for visual detection.
3. The method of claim 2, characterized in that the method further includes storing the TLC plates for later viewing.
4. The method of claim 1, characterized in that the method further comprises a spectroscopic measurement of the UV-visible spectroscopic shift of peak absorbance.
5. The method of claim 1, characterized in that the target specific pre-catalytic nucleic acid subunits and the target-specific un-catalyzed nucleic acid substrate are provided as a lyophilized mixture.
6. The method of claim 1, characterized in that the target specific pre-catalytic nucleic acid subunits, the target-specific un-catalyzed nucleic acid substrate and the GNPs are provided lyophilized.
7. The method of claim 1, characterized in that the linking moiety includes nucleic acid strands that hybridize with a 3 end and a 5 end of the corresponding target specific un-catalyzed nucleic acid substrate for assembling.
8. A kit for detecting a presence or an absence of more than one different nucleic acid targets of interest in a sample, characterized in that the kit comprises: (a) target-specific un-catalyzed nucleic acid substrates and (b) target-specific pre-catalytic nucleic acid subunits, each target-specific pre-catalytic nucleic acid subunit including a sensor domain for specifically hybridizing to one of the more than one different nucleic acid targets, and a catalytic domain configured for catalyzing its corresponding target-specific un-catalyzed nucleic acid substrate solely when the corresponding specific target is bound to the sensor domain; and (c) separate target-specific populations of gold nanoparticles (GNPs), the GNPs in each target-specific population functionalized with a linking moiety for assembling with its corresponding target-specific un-catalyzed nucleic acid substrate and molecules of polyethylene glycol; characterized in that the kit is configured to perform the method of claim 1.
9. The kit of claim 8, characterized in that the GNPs assembled with the target-specific un-catalyzed nucleic acid substrate turn the sample to a first color, and GNPs in a substantially dispersed form turn the sample to a second color.
10. The kit of claim 8, characterized in that the target specific un-catalyzed nucleic acid substrate and the target-specific pre-catalytic nucleic acid subunits are in a lyophilized mixture.
11. The kit of claim 8, characterized in that the GNPs, target specific un-catalyzed nucleic acid substrate and the target specific pre-catalytic nucleic acid subunits are in a lyophilized mixture.
12. The kit of claim 8, wherein the kit further comprises ingredients necessary for optimal activity of the catalytic domain.
13. The kit of claim 8, characterized in that the kit further comprises a thin layer chromatography (TLC) plate.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) Embodiments will now be described, by way of example only, with reference to the drawings, in which:
(2)
(3)
(4)
(5)
DETAILED DESCRIPTION OF THE INVENTION
(6) Definitions
(7) In this specification and in the claims that follow, reference will be made to a number of terms that shall be defined to have the meanings below. All numerical designations, e.g., dimensions and weight, including ranges, are approximations that typically may be varied (+) or () by increments of 0.1, 1.0, or 10.0, as appropriate. All numerical designations may be understood as preceded by the term about.
(8) The singular form a, an, and the includes plural references unless the context clearly dictates otherwise.
(9) The term comprising means any recited elements are necessarily included and other elements may optionally be included. Consisting essentially of means any recited elements are necessarily included, elements that would materially affect the basic and novel characteristics of the listed elements are excluded, and other elements may optionally be included. Consisting of means that all elements other than those listed are excluded. Embodiments defined by each of these terms are within the scope of this invention.
(10) Catalytic nucleic acid molecule, catalytic nucleic acid, and catalytic nucleic acid sequence are equivalent, and each shall mean a DNA molecule or DNA-containing molecule (also known in the art as a DNAzyme) or an RNA or RNA-containing molecule (also known in the art as a ribozyme) which specifically recognizes a distinct substrate and catalyzes the chemical modification of this substrate. The nucleic acid bases in the DNAzymes and ribozymes can be the bases A, C, G, T and U, as well as derivatives thereof known in the art [PCR Systems, Reagents and Consumables. Perkin Elmer Catalogue 1996-1997. Roche Molecular Systems, Inc., Branchburg, N.J., USA.]. Each catalytic nucleic acid molecule may be divided into pre-catalytic nucleic acid subunits that are not capable of catalyzing the chemical modification of the substrate.
(11) GNP or GNPs refer to gold nanoparticle(s).
(12) GNP-A refers to a GNP functionalized with a linking moiety A, which may be a nucleic acid strand A, as explained bellow. GNP-B refers to a GNP functionalized with a linking moiety B, which may be nucleic acid strand B, as explained bellow. GNP-AB refers to a GNP functionalized with both linking moieties A and B, which may be nucleic acid strand A and nucleic acid strand B, as explained bellow. Accordingly, at least three populations of GNP may exist: GNP-A, GNP-B and GNP-AB. Other linking moieties may also be used.
(13) Reporter substrate, chemical substrate and substrate are equivalent, and each refers to any molecule which is specifically recognized and modified by a catalytic nucleic acid molecule.
(14) Target refers to a biological target, including, nucleic acid sequences (DNA and RNA), peptides, proteins, polysaccharides, fatty acids, toxins, phages, antibodies and so forth. The target of interest to be detected or measured by the instant invention, which comprises a sequence that hybridizes with a target domain, also referred to as sensor domain, of the catalytic nucleic acid molecule when contacted therewith in this method, and that can be either an entire molecule or a portion thereof.
(15) In one embodiment, the present invention relates to a method of detecting a molecular target in a sample. The method may include: (a) contacting the sample with: (i) an un-catalyzed nucleic acid substrate, (ii) a catalytic nucleic acid, the catalytic nucleic acid configured for catalyzing the substrate solely in the presence of the target, and (iii) GNPs, the GNPs, which may be provided in a substantially dispersed form (for the purpose of this document, substantially dispersed includes dispersed), may be functionalized with a linking moiety for assembling with the un-catalyzed nucleic acid substrate; and (b) analyzing the sample to determine whether the GNPs remain substantially dispersed or are assembled with the un-catalyzed nucleic acid substrate, wherein the GNPs being in the substantially dispersed form is indicative that the target is present in the sample.
(16) The GNPs may be functionalized with a nucleic acid strand A and/or a nucleic acid strand B. For example, 5-thiol-modified Agg/A (Strand A) or 3-thiol-modified Agg/B (Strand B) DNA. [34] A linker nucleic acid strand may include a substrate region for a catalytic nucleic acid molecule, and it may be designed to have its 5-end complementary to 3 of Agg/A, and its 3-end to complement 5 of Agg/B. The linker in its un-catalyzed form may then serve to cross-link GNPs through hybridization with strands A and B, forming GNP aggregate or assembled network. When the linker is cleaved, it may no longer serve to cross-link GNPs.
(17)
(18) Close proximity of linked GNPs may cause coupling of their individual localized plasmon fields, leading to the shift in their peak absorbance to a longer wavelength, and solution color changes from red to purple. In addition, the linker strand may also include a substrate sequence that may be cleaved by a catalytic nucleic acid molecule, for example a multicomponent nucleic acid enzyme (MNAzyme), which is one of the reported DNA-responsive DNAzymes. MNAzyme uses Mg2+ as the divalent cation, and has optimal activity at 50 C. Among the three reported DNA-responsive bipartite DNAzymes, the inventors chose to work with the MNAzyme, since it has the highest catalytic rate.[9,24,25,29] In this document, MNAzymes are used as an example, however, it should be understood that other catalytic nucleic acid molecules, including other DNA-responsive DNAzymes, and DNAzymes that respond to metal ions, such as lead and uranyl, or small molecule targets, such as adenosine, FMN and ATP, may be used as well.[46-48]
(19) As illustrated in
(20) The catalytic nucleic acid molecule may be made responsive to any biological target simply by changing the nucleotides of the sensor domains or sensor arms. The sequence of the substrate arms ensures specificity to a particular substrate, so that multiple MNAzyme-substrate pairs may be used in the same assay without cross-reactivity. Aptamers are nucleic acid molecules that bind with high specificity and sensitivity to biological targets. Aptamers may be created basically for any biological target [See U.S. Pat. No. 5,670,637]. The aptamer sequences may be incorporated in the sensor arm to bind any biological target of interest.
(21) Referring to
(22) For a given GNP concentration there may be enough linker concentration able to crosslink the GNPs sufficiently to cause visual aggregation. With such a linker/GNP ratio, even if a small proportion of linker strands get cleaved by the MNAzymes, this should have an effect on GNP crosslinking state and color of the solution. Therefore, minimizing the linker concentration may effectively maximize assay sensitivity. Optimization results are presented in
(23) The MNAzyme assay outlined in
(24) If the linker is chosen as the genetic detection target instead of AF-1, the experiment of
(25) The detection methods of the present invention may be used to detect a single target or to detect multiple targets in parallel (
(26) In the first step of the assay, a solution suspected of containing more than one biological targets may be added to a reaction tube containing a mixture of different sets of MNAzymes/linker pairs, each set being specific for a target of interest. For example, if the targets of interest include AF-1, gonorrhea, syphilis, malaria and HBV, then 5 sets of MNAzyme-Linker pairs (MNAzymeAF-1, MNAzymeGon, MNAzymeSyph, MNAzymeMal and MNAzymeHBV) may be used. The mixture and the sample solution may then be incubated at a determined temperature and for a sufficient amount of time. Assuming AF-1 and Gon targets are present in the reaction tube, they activate MNAzymeAF-1 and MNAzymeGon, which in turn degrade LinkerAF-1 and LinkerGon. The other 3 linkers (i.e. LinkerSyph, LinkerMal and LinkerHBV) remain intact. In the second step, the MNAzyme-Linker-target solution is transferred to 5 detection tubes, each containing target-specific GNP pair. Any linkers that remain un-cleaved aggregate the corresponding GNP pairs, turning solution purple. In contrast, Linkers cleaved by target-activated MNAzymes are not able to cross-link associated GNP pairs, and solution remains red. In the example above, only mixtures in AF-1 and Con-specific detection tubes would remain red. Following this protocol all 5 targets were detected simultaneously (
(27) The present invention also provides for a kit for detecting a biological target of interest in a sample. In one embodiment, the kit may include: (a) an un-catalyzed nucleic acid substrate, (b) catalytic nucleic acid capable catalyzing the un-catalyzed substrate solely in the presence of the target, and (c) GNPs functionalized with a linking moiety to assemble with the un-catalyzed nucleic acid substrate. The GNPs may be provided substantially dispersed. The kit may include GNP-A and GNP-B or the kit may include GNP-AB. The kit may also include other ingredients that may be necessary for optimal activation of the catalytic nucleic acid molecule. The kit may also include a TLC. The ingredients (for example the linker, pre-catalytic subunits with or without the populations of GNPs) may be provided as a lyophilized mixture. In aspects of the invention, the kit may also include two or sets of un-catalyzed nucleic acid substrate, catalytic nucleic acid and GNPs that are target specific, that may be used in methods to simultaneously detect more than one target of interest in a sample.
(28) In another embodiment, the present invention provides for lyophilization of assay components. In this form reagents remain functionally stable during storage and transport, making them well suited for POC testing. [40] The ingredients used in the methods of the present invention may conveniently be dehydrated or lyophilized for storage, transportation and extended shelf-life. For example, the catalytic nucleic acid molecules and the linkers may be lyophilized and provided as a freeze-dried mixture that may be added to a sample being tested. The GNPs may also be lyophilized and added to the freeze-dried mixture.
(29) Advantages
(30) DNAzyme-GNP assay of the present invention provides a simple and fast colorimetric scheme for detection of biological targets, including genetic targets of bacterial, viral and fungal origins with high sensitivity without the need for purification and separation steps. Results may be archived when spotted on TLC plates. To the knowledge of the applicants, this is the first report of combining the multi-component DNA-responsive DNAzyme with gold nanoparticle colorimetric platform.
(31) The assay of the present invention may detect multiple genetic sequences in parallel and is easily translatable to new targets.
(32) Color-based readout that does not require any complex equipment, and uses stable and cost-effective reagents make this experimental approach particularly suitable for POC testing. Furthermore, it is difficult to identify specific requirements for analytical sensitivity of a pathogen as this may vary based on the treatment strategy and whether one analyzing a single or co-infection.
(33) Improved sensitivity may be achieved by modifying the nanoparticle size and chemistry, varying the length of MNAzyme/Linker or target sequences,[41] or by combining the fast catalytic rate of MNAzyme and colorimetric plasmonic readout with the sensitive protein-free autocatalytic DNAzyme approach demonstrated by the Willner group. [23, 42] Furthermore, in a complete point-of-care system, extra components may be added that can extract the genetic targets of interest. Such technologies have been developed for isolating targets from blood and stool samples. [43-45]
(34) Freeze-drying of the components used in the methods of the present invention, provides storage, transportation and shelf-life advantages, not seen and not possible in DNAzyme methods of the prior art.
(35) In order to aid in the understanding and preparation of the present invention, the following illustrative, non-limiting examples are provided.
EXAMPLES
(36) Materials
(37) HAuCl4, sodium citrate tribasic, sodium phosphate monobasic, sodium phosphate dibasic, magnesium chloride and potassium chloride were purchased from Sigma-Aldrich. Sodium chloride, Tween-20 and Tris were purchased from BioShop (Burlington, ON, Canada). Hydrochloric acid and nitric acid were purchased from Caledon Laboratories (Georgetown, ON, Canada). Thiolatedmethoxyl polyethylene glycol MW=1000 Da (mPEG-SH.sub.1000) was purchased from Laysan BIO (Arab, Ala.). RPSF reversed phase hydrocarbon impregnated silica gel TLC plates were purchased from Analtech (Newark, Del.). All RNA-containing Linker DNA strands were purchased from Integrated DNA Technologies (IDT) in HPLC-purified lyophilized form. All other DNA sequences were purchased from BioBasic (Markham, ON, Canada) and purified (thiol-functionalized sequences were purified by HPLC and non-functionalized ones by HAP purification) and lyophilized by the company. All lyophilized DNA sequences were re-suspended in UltraPure distilled water (Invitrogen) to 100 M concentration and stored at 20 C. DNA sequences used in the study are outlined in Table 1.
(38) TABLE-US-00001 TABLE1 ListofDNAsequences NAME SEQID SEQUENCE(5-to-3) NOTES 1.GNP-immobilizedAggsequencesforGNP-AandGNP-B Agg.sub.1/A.sup.a 1 HS-AAAAAAAAAACCTATCGACCATGCT ForallAggsequences Agg.sub.Gon/A.sup.b 2 HS-AAAAAAAAAATAACAATAATCCCTC underlinedregion Agg.sub.Mal/A.sup.c 3 HS-AAAAAAAAAAATGGCCGATGTATGT bindsappropriate Agg.sub.Syph/A.sup.c 4 HS-AAAAAAAAAACGAGTGAGTGCGACG Linkerstrand,10bp Agg.sub.HBV/A.sup.c 5 HS-AAAAAAAAAATTATTGGTGTTACTC poly-Aspaceris Agg.sub.1/B.sup.a 6 GCGCTAGAGTCGTTTAAAAAAAAAA-SH italicized Agg.sub.Gon/B.sup.b 7 ATCCTTATCAATATTAAAAAAAAAA-SH Agg.sub.Mal/B.sup.c 8 AGAGGAAAGTAGGCTAAAAAAAAAA-SH Agg.sub.Syph/B.sup.c 9 GGTGGCTTACAGTCAAAAAAAAAAA-SH Agg.sub.HBV/B.sup.c 10 TGTAGGGCATGTAGTAAAAAAAAAA-SH 2.Linkers Linker.sub.1.sup.d 11 AGCATGGTCGATAGGTAAGGTTTCCTC ForallLinkers,Mz TAAACGACTCTAGCGC bindsandcleaves Linker.sub.Gon.sup.d 12 GAGGGATTATTGTTAT
(betweenimbedded GGAAGAGATGTAATATTGATAAGGAT RNA
) Linker.sub.Mal.sup.e 13 ACATACATCGGCCATTCGCAAACCATA underlinedregion,
AGCCTACTTTCCTCT italicizedregion Linker.sub.Syph.sup.f 14 CGTCGCACTCACTCGTTGTGACACTAT bindsAggstrand
TTGACTGTAAGCCA A,andboldedregion CC bindsAggstrandB. Linker.sub.HBV.sup.g 15 GAGTAACACCAATAATTGCTGGACAGA
TACTACATGCCCTA CA 3.MNAzymesubunitsAandB Mz.sub.1/A.sup.h 16 AGCTGCTGCCCGTGCTGGTGACAACGA ForallMNAzyme(Mz) GAGGAAACCTT sequences,bolded Mz.sub.Gon/A.sup.i 17 TGCCAATATCGGCGGCCGATGACAACG regionbindsthe AATAGTGAGT targetDNAand Mz.sub.Mal/A.sup.i 18 AACTCAATCATGACTACCCGACAACGA italicizedregion TATGGTTTGCG bindsthe Mz.sub.Syph/A.sup.i 19 GTCCATCGGCAAACACGTCAACAACGA appropriateLinker ATAGTGTCACA sequence.Underlined Mz.sub.HBV/A.sup.i 20 CAGGAGGTTGGTGAGTGATTACAACGA regionformshalfof TCTGTCCAGCA thecatalyticcore. Mz.sub.1/B.sup.h 21 TGCCCAGGGAGGCTAGCTCCATTGCCC CATGTGAAGTCA Mz.sub.Gon/B.sup.i 22 CATCTCTTCCAGGCTAGCTACGGTACC TGAAGAATAAGC Mz.sub.Mal/B.sup.i 23 CACGTGTTCTCAGGCTAGCTTCTGTTA TGAACACTTAATTTT Mz.sub.Syph/B.sup.i 24 CAAGATCGCTAGGCTAGCTACTGCAGC ATCCATCAGAGTCT Mz.sub.HBV/B.sup.i 25 AATCCTATACAGGCTAGCTGGAGGTTG GGGACTGCGAATTT 4.Targetsequences AF-1.sup.j 26 CAGTGACTTCACATGGGGCAATGGCAC Foralltarget CAGCACGGGCAGCAGCTGGC sequences,bolded Gon.sup.k 27 TGCTTATTCTTCAGGTACCGTCATCGG regionisboundby CCGCCGATATTGGCAAC theappropriateMz Mal.sup.l 28 AAAATTAAGTGTTCATAACAGACGGGT partA,and AGTCATGATTGAGTTCATTGTGT underlinedregionis Syph.sup.l 29 GGAGACTCTGATGGATGCTGCAGTTGA boundbyMzpartB. CGTGTTTGCCGATGGACAG 30 GCCAAAATTCGCAGTCCCCAACCTCCA HBV.sup.l ATCACTCACCAACCTCCTGTCCTCCAA .sup.asequences adapted from (1). .sup.bsequences adapted from (2). .sup.csequences were randomly generated. .sup.dMNAzyme-cleavable sequences (underlined) adapted from (3). .sup.eMNAzyme-cleavable sequences (underlined) adapted from (4). .sup.fMNAzyme-cleavable sequences (underlined) adapted from (5). .sup.gMNAzyme-cleavable sequences (underlined) adapted from (6). .sup.hMz.sub.1 subunit sequences taken from (3). .sup.iMz.sub.1 catalytic core sequence (underlined) used for all Mz. Linker and target binding sequences adjusted to match corresponding Linker/target sequences. .sup.jsequence taken from (3). ksequence designed to target 16 S ribosomal RNA gene from Neisseria gonorrhoeae (7). .sup.lsequences were chosen based on: Mal: (8), Syph: (9), and HBV: (10). Specifically, the authors indicated the PCR primers that they used for detection of the microorganisms by PCR method. We obtained the microorganisms' genomic DNA from GenBank (Mal: 16S ribosomal RNA not in asexual parasites, GenBank accession M19173; Syph: Treponema pallidum subsp. pallidum str. Nichols chromosome, complete genome, GenBank accession NC_000919, HBV: Hepatitis B virus isolate RS1, complete genome, GenBank accession HQ236014) and identified the specific regions that these PCR primers would amplify. The DINAMelt Web Server Two-state melting was used to identify the 46-54 base pair long regions within these amplicons containing the least amount of secondary structure [Markham, N. R. & Zuker, M. (2005) DINAMelt web server for nucleic acid melting prediction. Nucleic Acids Res., 33, W577-W581; the server can be found at mfold.rna.albany.edu/?q=DINAMelt/Two-state-folding]. These regions were chosen as MNAzyme targets.
Instrumentation:
(39) Spectroscopic measurements were performed using a SHIMADZU UV-Visible spectrophotometer UV-1601PC (Kyoto, Japan). DLS measurements were performed on MALVERN Nano-ZS Zetasizer (Worcestershire, UK). Freeze drying was performed in LABCONCO (Kansas City, Mo.) LYPH-LOCK 6 Freeze Dry System. TLC spots were photographed with Canon PowerShot S95 camera.
(40) Experimental Details:
(41) Preparation of 13 nm Gold Nanoparticles (GNPs):
(42) 1 mL of 25 nM HAuCl.sub.4 was added to 98 mL of nanopure water in 250 mL flask prewashed with 100 mL of aqua regia (3 parts hydrochloric acid, 1 part nitric acid)(11). After bringing solution to a rapid boil, stirring was initiated on a benchtop stir plate, and 1 mL of 33 mg/mL of sodium citrate tribasic was added. The mixture was incubated for 10 min under boiling and stirring conditions (at which point solution color turned red), and then cooled to room temperature. DLS measurement was used to verify nanoparticles size and monodispersity (only particles with polydispersity index <0.1 were used). Tween-20 was then added to a final concentration of 0.01% v/v and GNPs were concentrated by 1 centrifugation at 12,000 g for 30 minutes. GNP concentration was measured by UV-vis spectroscopy by using absorbance at =520 nm (assuming extinction coefficient of 2.3310.sup.8 M.sup.1 cm.sup.1 and GNP diameter of 13 nm), then adjusted to 100 nM using nanopure water with 0.01% v/v Tween-20. The extinction coefficient for gold was calculated using the formula from (12). There was a small error in the published version; the corrected formula is as follows:
Extinction coefficient=10.sup.(1.0643*LOG [3/2*3.141592654*(diameter)^3]+4.0935)
(43) Adsorbing Thiolated AggDNA onto GNPs
(44) We followed a protocol described previously by Mirkin group (13) with a few modifications. 60 L of 100 nM 13 nm GNPs (final concentration 10 nM) were mixed with 60 L of 32 M of one of thiol-functionalized Agg strands (final concentration 3.2 M, or 320 Agg/GNP) in 600 L of 10 mM phosphate buffer (PB, pH 7.2) with 0.01% v/v Tween-20. Solution was incubated at room temperature for 20 minutes. 3.43 M NaCl solution in 10 mM PB with 0.01% v/v Tween-20 was then added to the reaction mixture in 10 steps according to the schedule of Table 2 to reach final concentration of 0.88M NaCl. Between each addition step and after the last addition step the mixture was incubated for 20 minutes at room temperature. Salt is required to block the negative charges on DNA molecules to allow high density loading of DNA on GNP surface; slow aging process is used to prevent salt-induced aggregation of GNPs. Next, 30 L of 2 mM mPEG-SH.sub.1000 were added (10,000 mPEG-SH.sub.1000 molecules per GNP), and reaction mixture was incubated for 30 min at 60 C. mPEG-SH.sub.1000 adsorption step was included to block any DNA-free areas on GNP surface, thus improving the stability of DNA-functionalized GNPs against aggregation in salts during the MNAzyme 50 C. cleavage step (see below), centrifugation, and storage. Finally, DNA-functionalized GNPs were purified by 3 centrifugation at 16,000 g for 30 min, resuspended in nanopure water with 0.01% v/v Tween-20 at 11 nM concentration, and stored at 4 C.
(45) TABLE-US-00002 TABLE 2 Salt addition schedule for loading thiolated AggDNA onto 13 nm GNPs Reaction* Volume of Final Volume Salt Mix** [NaCl] STEP (L) Added (L) (M) 1 600.00 18.02 0.10 2 618.02 18.56 0.20 3 636.58 19.12 0.29 4 655.69 19.69 0.38 5 675.38 20.28 0.47 6 695.67 20.89 0.56 7 716.56 21.52 0.64 8 738.07 22.16 0.72 9 760.24 22.83 0.80 10 783.07 23.52 0.88 *Initial reaction volume contains 10 nM of 13 nm GNPs and 3.2 M of Agg DNA in 10 mM PB with 0.01% v/v Tween-20. **Salt Mix contains 3.43M NaCl in 10 mM PB with 0.01% v/v Tween-20.
Optimizing Linker.sub.1 Concentration (
(46) Twelve 0.6 mL tubes were set up, each containing 2 L of nanopure water, 2 L of 10 MNAzyme buffer (0.1 M Tris-HCl, 0.5 M KCl, pH 8.3), 2 L of 200 mM MgCl.sub.2, and 2 L of 2 M [Mz.sub.1/A+Mz.sub.1/B] solution. In addition, each tube contained 2 L of one of 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 nM of Linker.sub.1. The 12.sup.th tube was included as negative control and contained 2 L of nanopure water instead of Linker.sub.1. The tubes were incubated at 50 C. for 1 hour to mimic MNAzyme cleaving step. To each tube 5 L of 11 nM GNP.sub.1-A (13 nm GNPs functionalized with Agg.sub.1/A DNA) and 5 L of 11 nM GNP.sub.1-B (13 nm GNPs functionalized with Agg.sub.1/B DNA) were added. The samples (20 L final volume) were incubated at 50 C. for 20 minutes, then cooled to room temperature for 5 minutes to allow GNPs to be cross-linked by Linker.sub.1. 3 L of the mixture were then spotted on TLC plates to visualize the degree of aggregation. Remaining mixture was used to measure the location of the surface plasmon resonance (SPR) absorbance peak. This experiment was performed in triplicate.
(47) Referring to
(48) Determining MNAzyme Colorimetric Assay Sensitivity for Detection of AF-1 Genetic Target (
(49) Eight 0.6 mL tubes were set up, each containing 2 L of 10 MNAzyme buffer, 2 L of 150 mM MgCl.sub.2, 2 L of 2 M [Mz.sub.1/A+Mz.sub.1/B] solution, and 2 L of 400 nM Linker.sub.1. In addition, each tube contained 2 L of one of 100, 250, 500, 1000, 2500, 5000, or 10000 M of AF-1. The 8.sup.th tube was included as negative control and contained 2 L of nanopure water instead of AF-1. The samples were incubated for 1 hour at 50 C. to allow AF-1-activated MNAzymes to cleave Linker.sub.1. To each tube 5 L of 11 nM GNP.sub.1-A and 5 L of 11 nM GNP.sub.1-B were then added (20 L final volume), and the samples were incubated at 50 C. for 20 minutes followed by cooling to room temperature for 5 minutes. 3 L of the mixture were then spotted on TLC plates to visualize the degree of aggregation. Remaining mixture was used to measure the location of the SPR absorbance peak. This experiment was performed in triplicate.
(50) Detecting Multiple DNA Targets in Parallel (
(51) MNAzyme mix was made by mixing 100 L of each of the following: 2 M [Mz.sub.1/A+Mz.sub.1/B], 2 M [Mz.sub.Gon/A+Mz.sub.Gon/B], 2 M [Mz.sub.Mal/A+Mz.sub.Mal/B], 2 M [Mz.sub.Syph/A+Mz.sub.Syph/B], and 2 M [Mz.sub.HBV/A+Mz.sub.HBV/B] solutions. Linker mix was made by mixing 100 L of each of: 2 M Linker.sub.1, 2 M Linker.sub.Gon, 2 M Linker.sub.Mal, 2 M Linker.sub.Syph, and 2 M Linker.sub.HBV. To detect all 5 target sequences in parallel, two solutions were set up in 0.6 mL tubes, each containing 10 L of 10 MNAzyme buffer, 10 L of 400 mM MgCl.sub.2, 10 L of MNAzme mix, 40 L of Linker mix, and 20 L of nanopure water. To the first reaction solution, 2 L each of 1 M AF-1, 1 M Gon, 1 M.sub.Mal, 1 M Syph, and 1 M HBV targets were added. In contrast, 10 L of nanopure water were added to the second solution, which was used as a negative control solution. In addition, 5 detection mixes were set up in 0.6 mL tubes in duplicate, each containing one of the following GNP pairs: (i) [5 L of 11 nM GNP.sub.1-A and 5 L of 11 nM GNP.sub.1-B], or (ii) [5 L of 11 nM GNP.sub.Mal-A and 5 L of 11 nMGNP.sub.Mal-B], or (iii) [5 L of 11 nM GNP.sub.Gon-A and 5 L of 11 nM GNP.sub.Gon-B], or (iv) [5 L of 11 nM GNP.sub.Syph-A and 5 L of 11 nM GNP.sub.Syph-B], or (v) [5 L of 11 nM GNP.sub.HBV-A and 5 L of 11 nM GNP.sub.HBV-B]. The reaction and control solutions were incubated for 1 hour at 50 C. to allow activated MNAzymes to cleave their corresponding linkers. 10 L from reaction solution were then transferred to the 5 tubes of the first detection mix set, and 10 L from control solution to the 2.sup.nd 5 detection mix tubes. All samples were incubated for 20 minutes at 50 C., then for 5 minutes at room temperature to allow GNP aggregate formation. 3 L from each tube were spotted on TLC plates for color readout.
(52) The scheme for detecting 3 (AF-1, Mal, and HBV) out of 5 possible targets in parallel included lyophilization of the components. Reaction solution was premade by mixing 6 L of 10 MNAzyme buffer, 6 L of 400 mM MgCl.sub.2, 6 L of MNAzyme mix, 24 L of Linker mix, and 12 L of nanopure water in 1.5 mL tube. In addition, 5 GNP-containing detection mix tubes were set up as described above. All of the samples were frozen at 80 C. for 30 minutes, freeze-dried overnight, and stored at room temperature. On the day of the experiment, lyophilized reaction solution was resuspended in 54 L of nanopure water, and 1.2 L of 2 M AF-1, 1.2 L of 2 M Mal, 1.2 L of 2 M HBV targets and 2.4 MI of nanopure water were added. The reaction solution was then incubated for 1 hour at 50 C. Next, 10 L of the solution was transferred to each lyophilized detection mix, and the detection tubes were incubated for 20 minutes at 50 C. and cooled to room temperature for 5 minutes. 3 L from each tube were spotted on TLC plates for readout.
(53) As many changes can be made to the embodiments described above without departing from the scope of the invention, it is intended that all material contained herein be interpreted as illustrative of the invention and not in a limiting sense.
(54) The documents referenced within the preceding description are as follows:
REFERENCES
(55) All documents referred to in this document, are incorporated herein by reference.
(56) Documents Referred to in the Description [1] S. Binder, A. M. Levitt, J. J. Sacks, J. M. Hughes, Science 1999, 284, 1311-1313. [2] T. S. Hauck, S. Gin, Y. Gao, W. C. W. Chan, Adv. Drug Delivery Rev. 2010, 62, 438-448. [3] J. Weile, C. Knabbe, Anal. Bioanal. Chem. 2009, 394, 731-742. [4] M. J. Espy, J. R. Uhl, L. M. Sloan, S. P. Buckwalter, M. F. Jones, E. A. Vetter, J. D. C. Yao, N. L. Wengenack, J. E. Rosenblatt, F. R. Cockerill III, T. F. Smith, Clin. Microbiol. Rev. 2006, 19, 165-256. [5] S. Gin, E. A. Sykes, T. L. Jennings, W. C. W. Chan, ACS Nano 2011, 5, 1580-1587. [6] K. Schlosser, Y. Li, ChemBioChem 2010, 11, 866-879. [7] S. W. Santoro, G. F. Joyce, Proc. Natl. Acad. Sci. U.S.A. 1997, 94, 4262-4266. [8] R. R. Breaker, G. F. Joyce, Chemistry & biology 1994, 1, 223-229. [9] E. Mokany, S. M. Bone, P. E. Young, T. B. Doan, A. V. Todd, J. Am. Chem. Soc. 2010, 132, 1051-1059. [10] W. Zhao, J. C. F. Lam, W. Chiuman, M. A. Brook, Y. Li, Small 2008, 4, 810-816. [11] J. Liu, Y. Lu, J. Am. Chem. Soc. 2004, 126, 12298-12305. [12] J. Liu, Y. Lu, J. Am. Chem. Soc. 2003, 125, 6642-6643. [13] J. Liu, Y. Lu, Org. Biomol. Chem. 2006, 4, 3435-3441. [14] D. Mazumdar, J. Liu, G. Lu, J. Zhou, Y. Lu, Chem. Commun. 2010, 46, 1416. [15] X. Miao, L. Ling, X. Shuai, Chem. Commun. 2011, 47, 4192. [16] H. Wei, B. Li, J. Li, S. Dong, E. Wang, Nanotechnology 2008, 19, 095501. [17] J. H. Lee, Z. Wang, J. Liu, Y. Lu, J. Am. Chem. Soc. 2008, 130, 14217-14226. [18] Z. Wang, J. H. Lee, Y. Lu, Adv. Mater. 2008, 20, 3263-3267. [19] J. Li, Y. Lu, J. Am. Chem. Soc. 2000, 122, 10466-10467. [20] J. Liu, Y. Lu, Anal. Chem. 2004, 76, 1627-1632. [21] J. Liu, Y. Lu, J Fluoresc 2004, 14, 343-354. [22] D. Wang, B. Lai, D. Sen, J. Mol. Biol. 2002, 318, 33-43. [23] F. Wang, J. Elbaz, R. Orbach, N. Magen, I. Willner, J. Am. Chem. Soc. 2011, 133, 17149-17151. [24] F. Wang, J. Elbaz, C. Teller, I. Willner, Angew. Chem. Int. Ed. 2010, 50, 295-299. [25] Y. V. Gerasimova, E. Cornett, D. M. Kolpashchikov, ChemBioChem 2010, 11, 811-817. [26] S. Sando, A. Narita, T. Sasaki, Y. Aoyama, Org. Biomol. Chem. 2005, 3, 1002-1007. [27] S. Sando, T. Sasaki, K. Kanatani, Y. Aoyama, J. Am. Chem. Soc. 2003, 125, 15720-15721. [28] J. Kosman, B. Juskowiak, Anal. Chim. Acta 2011, 707, 7-17. [29] D. M. Kolpashchikov, ChemBioChem 2007, 8, 2039-2042. [30] M. Quinten, U. Kreibig, D. Schnauer, L. Genzel, Surf. Sci. 1985, 156, 741-750. [31] R. Elghanian, J. J. Storhoff, R. C. Mucic, R. L. Letsinger, C. A. Mirkin, Science 1997, 277, 1078-1081. [32] C. D. Medley, J. E. Smith, Z. Tang, Y. Wu, S. Bamrungsap, W. Tan, Anal. Chem. 2008, 80, 1067-1072. [33] K. Sato, K. Hosokawa, M. Maeda, Nucleic Acids Res. 2005, 33, 1, e4. [34] S. J. Hurst, A. K. R. Lytton-Jean, C. A. Mirkin, Anal. Chem. 2006, 78, 8313-8318. [35] J. J. Storhoff, R. Elghanian, R. C. Mucic, C. A. Mirkin, R. L. Letsinger, J. Am. Chem. Soc. 1998, 120, 1959-1964. [36] R. Rossau, L. Heyndrickx, H. Van Heuverswyn, Nucleic Acids Res. 1988, 16, 6227. [37] J. Burstain, E. Grimprel, S. Lukehart, M. Norgard, J. Radolf, J. Clin. Microbiol. 1991, 29, 62-69. [38] A. R. Bharti, K. P. Patra, R. Chuquiyauri, M. Kosek, R. H. Gilman, A. Llanos-Cuentas, J. M. Vinetz, Am. J. Trop. Med. Hyg. 2007, 77, 444-446. [39] D. Paraskevis, A. Beloukas, C. Haida, A. Katsoulidou, Z. Moschidis, H. Hatzitheodorou, A. Varaklioti, V. Sypsa, A. Hatzakis, Virol. J. 2010, 7, 57. [40] W. Abdelwahed, G. Degobert, S. Stainmesse, H. Fessi, Adv. Drug Delivery Rev. 2006, 58, 1688-1713. [41] Y. Gao, W. L. Stanford, W. C. W. Chan, Small 2011, 7, 137-146. [42] S. Shimron, F. Wang, R. Orbach, I. Willner, Anal. Chem. 2012, 84, 1042-1048. [43] S. R. Jangam, D. H. Yamada, S. M. McFall, D. M. Kelso, J. Clin. Microbiol. 2009, 47, 2363-2368. [44] A. V. Govindarajan, S. Ramachandran, G. D. Vigil, P. Yager, K. F. Boehringer, Lab Chip 2012, 12, 174-181. [45] A. G. Freifeld, K. A. Simonsen, C. S. Booth, X. Zhao, S. E. Whitney, T. Karre, P. C. Iwen, H. J. Viljoen, The Journal of Molecular Diagnostics 2012, 14, 274-279. [46] Liu, J.; Lu, Y. J. Fluoresc. 2004, 14, 343-354. [47] Wang, D.; Lai, B.; Sen, D. J. Mol. Biol. 2002, 318, 33-43. [48] Lee, J. H.; Wang, Z.; Liu, J.; Lu, Y. J. Am. Chem. Soc. 2008, 130, 14217-14226.
(57) Documents Referred to in the Examples (1) Elghanian, R. Selective Colorimetric Detection of Polynucleotides Based on the Distance-Dependent Optical Properties of Gold Nanoparticles. Science 1997, 277, 1078-1081. (2) Jin, R.; Wu, G.; Li, Z.; Mirkin, C. A.; Schatz, G. C. What Controls the Melting Properties of DNA-Linked Gold Nanoparticle Assemblies? J. Am. Chem. Soc. 2003, 125, 1643-1654. (3) Mokany, E.; Bone, S. M.; Young, P. E.; Doan, T. B.; Todd, A. V. MNAzymes, a Versatile New Class of Nucleic Acid Enzymes That Can Function as Biosensors and Molecular Switches. J. Am. Chem. Soc. 2010, 132, 1051-1059. (4) Zhao, W.; Lam, J. C. F.; Chiuman, W.; Brook, M. A.; Li, Y. Enzymatic Cleavage of Nucleic Acids on Gold Nanoparticles: A Generic Platform for Facile Colorimetric Biosensors. Small 2008, 4, 810-816. (5) Liu, J.; Lu, Y. Design of asymmetric DNAzymes for dynamic control of nanoparticle aggregation states in response to chemical stimuli. Org. Biomol. Chem. 2006, 4, 3435. (6) Wang, F.; Elbaz, J.; Teller, C.; Willner, I. Amplified Detection of DNA through an Autocatalytic and Catabolic DNAzyme-Mediated Process. Angewandte Chemie International Edition 2010, 50, 295-299. (7) Rossau, R.; Heyndrickx, L.; Van Heuverswyn, H. Nucleotide sequence of a 16S ribosomal RNA gene from Neisseria gonorrhoeae. Nucleic Acids Res 1988, 16, 6227. (8) R-Bharti, A.; Patra, K. P.; Chuquiyauri, R.; Kosek, M.; Gilman, R. H.; Llanos-Cuentas, A.; Vinetz, J. M. Short report: Polymerase chain reaction detection of Plasmodium vivax and Plasmodium falciparum DNA from stored serum samples: Implications for retrospective diagnosis of malaria. American Journal of Tropical Medicine and Hygiene 2007, 77, 444-446. (9) Burstain, J.; Grimprel, E.; Lukehart, S.; Norgard, M.; Radolf, J. Sensitive Detection of Treponema-Pallidum by Using the Polymerase Chain-Reaction. J Clin Microbiol 1991, 29, 62-69. (10) Paraskevis, D.; Beloukas, A.; Haida, C.; Katsoulidou, A.; Moschidis, Z.; Hatzitheodorou, H.; Varaklioti, A.; Sypsa, V.; Hatzakis, A. Development of a new ultra sensitive real-time PCR assay (ultra sensitive RTQ-PCR) for the quantification of HBV-DNA. Virology journal 2010, 7, 57. (11) Perrault, S. D.; Walkey, C.; Jennings, T.; Fischer, H. C.; Chan, W. C. W. Mediating Tumor Targeting Efficiency of Nanoparticles Through Design. Nano Lett. 2009, 9, 1909-1915. (12) Perrault, S. D.; Chan, W. C. W. Synthesis and Surface Modification of Highly Monodispersed, Spherical Gold Nanoparticles of 50-200 nm. J. Am. Chem. Soc. 2009, 131, 17042. (13) Hurst, S. J.; Lytton-Jean, A. K. R.; Mirkin, C. A. Maximizing DNA Loading on a Range of Gold Nanoparticle Sizes. Anal. Chem. 2006, 78, 8313-8318.