<i>Lactobacillus casei </i> for treating obesity and associated metabolic disorders
11490643 · 2022-11-08
Assignee
Inventors
Cpc classification
A23V2002/00
HUMAN NECESSITIES
A23C9/1234
HUMAN NECESSITIES
A61P1/14
HUMAN NECESSITIES
A23V2002/00
HUMAN NECESSITIES
A23L33/30
HUMAN NECESSITIES
A61P1/16
HUMAN NECESSITIES
A23V2200/3204
HUMAN NECESSITIES
A23V2200/3204
HUMAN NECESSITIES
A23L33/135
HUMAN NECESSITIES
International classification
A23L33/135
HUMAN NECESSITIES
A61P1/16
HUMAN NECESSITIES
A23C9/123
HUMAN NECESSITIES
A61P1/14
HUMAN NECESSITIES
Abstract
The strain Lactobacillus casei AH077 (NCIMB12019) produces a polysaccharide and increases energy excretion. The strain acts to block fat absorption and is used in the prevention or treatment of obesity and obesity-related metabolic syndrome.
Claims
1. A method for treating a health condition of a subject, the method comprising administering a formulation to the subject in need thereof, the formulation comprising an ingestible carrier and a therapeutically effective amount of Lactobacillus casei strain AH077 deposited with the National Collection of Industrial, Food and Marine Bacteria (NCIMB) under accession number 42019, wherein the health condition includes obesity, obesity-related metabolic syndrome, non-alcoholic fatty liver disease, or a combination thereof.
2. The method of claim 1, wherein the Lactobacillus casei strain is in the form of viable cells.
3. The method of claim 1, wherein the Lactobacillus casei strain is in the form of non-viable cells.
4. The method of claim 1, wherein the Lactobacillus casei strain is in the form of viable cells and non-viable cells.
5. The method of claim 1, wherein the formulation is in the form of a tablet or a powder.
6. The method of claim 1, wherein the formulation is in the form of a freeze-dried powder.
7. The method of claim 1, wherein the formulation is in the form of a food product.
8. The method of claim 1, wherein the formulation is in the form of a capsule or a sachet.
9. The method of claim 1, wherein the formulation further comprises a prebiotic.
10. The method of claim 1, wherein the formulation further comprises a protein, a peptide, or a combination thereof.
11. The method of claim 1, wherein the Lactobacillus casei strain is present in the formulation in an amount of more than 10.sup.6 cfu.
12. The method of claim 1, wherein the formulation further comprises an adjuvant.
13. The method of claim 1, wherein the formulation further comprises a drug entity or a biological compound.
14. The method of claim 1, wherein the subject is a human.
15. A method for treating a health condition, the method comprising administering a formulation to the subject in need thereof, the formulation comprising a therapeutically effective amount of Lactobacillus casei strain AH077 deposited with the National Collection of Industrial, Food and Marine Bacteria (NCIMB) under accession number 42019 and an ingestible carrier, wherein the ingestible carrier comprises a pharmaceutically acceptable carrier chosen from a capsule, a tablet, or a powder, and wherein the health condition is obesity, obesity-related metabolic syndrome, or non-alcoholic fatty liver disease.
16. The method of claim 15, wherein the Lactobacillus casei strain is in the form of viable cells, non-viable cells, or both.
17. The method of claim 15, wherein the formulation further comprises a prebiotic, a protein, a peptide, or a combination thereof.
18. The method of claim 15, wherein the Lactobacillus casei strain is present in the formulation in an amount of more than 10.sup.6 cfu.
19. The method of claim 15, wherein the formulation further comprises an adjuvant, a drug entity, or a biological compound.
20. The method of claim 15, wherein the subject is a human.
Description
BRIEF DESCRIPTION OF THE FIGURES
(1) The invention will be more clearly understood from the following description of some embodiments thereof, given by way of example only, with reference to the accompanying figures, in which:
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
DETAILED DESCRIPTION OF THE INVENTION
(18) A deposit of Lactobacillus strain AH077 was made at the National Collections of Industrial and Marine Bacteria Limited (NCIMB) Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen, AB21 9YA, Scotland, UK on Aug. 2, 2012 and accorded the accession number NCIMB 42019.
(19) This specification also makes reference by way of comparison to the strain Bifidobacterium longum 35624 which is deposited at the National Collections of Industrial and Marine Bacteria Limited (NCIMB) Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen, AB21 9YA, Scotland, UK on Jan. 13, 1999 under accession number NCIMB 41003.
EXAMPLES
(20) The following examples further describe and demonstrate embodiments within the scope of the invention. The examples are given solely for the purpose of illustration and are not to be construed as limitations of the present invention, as many variations thereof are possible without departing from the spirit and scope of the invention.
(21) We have found that a novel EPS-producing Lactobacillus strain (L. casei AH077) attenuated markers associated with obesity and associated metabolic disorders. L. casei AH077 administration was associated with alteration of gut microbiota, decreased fat storage and decreased hepatic triglyceride and hepatic total cholesterol levels and increased fat excretion. Surprisingly, administration of B. longum NCIMB41003 did not have the same effect.
Example 1—Identity of L. casei NCIMB 42019 was Confirmed by BLAST Analysis of the Intergenic Spacer (IGS) Region
(22) Method
(23) 16s-23s intergenic spacer (IGS) sequencing was performed to identify L. casei NCIMB 42019. Briefly, total DNA was isolated from the strains using 100 μl of Extraction Solution and 25 μl of Tissue Preparation solution (Sigma-Aldrich, XNAT2 Kit). The samples were incubated for 5 minutes at room temperature followed by 2 h at 95° C. and then 100 μl of Neutralization Solution (Sigma-Aldrich, XNAT2 kit) was added. DNA solution was quantified using a Nanodrop spectrophotometer and stored at 4° C. PCR was performed using the IGS primers. The primer pairs used for identification of the both strain were IGS R 5′-CTGGTGCCAAGGCATCCA-3′ and IGS L 5′-GCTGGATCACCTCCTTTCT-3′. The cycling conditions were 94° C. for 4 min (1 cycle), 94° C. for 45 sec, 53° C. for 45 sec, 72° C. for 45 sec (28 cycles). The PCR reaction contained 2 μl (100 ng) of DNA, PCR mix (Sigma-Aldrich, Red Taq), 0.025 nM IGS L and R primer (MWG Biotech, Germany). The PCR reactions were performed on an Eppendorf thermocycler. The PCR products were run alongside a molecular weight marker (100 bp Ladder, Roche) on a 2% agarose EtBr stained gel in TAE, to determine the IGS profile. PCR products of Bifidobacterium (single band) were purified using the Promega Wizard PCR purification kit. PCR products of Lactobacillus yield 3 bands. The band present at approx. 280 bp (lowest band) was excised, purified using the GenElute Agarose Spin Column (Sigma-Aldrich) and re-sequenced as above and the PCR product was purified using the Promega Wizard PCR purification kit. The purified PCR products were sequenced at Beckman Coulter Genomics (UK) using the primer sequences (above) for the intergenic spacer region. Sequence data was then searched against the NCBI nucleotide database to determine the identity of the strain by nucleotide homology. The resultant DNA sequence data was subjected to the NCBI standard nucleotide-to-nucleotide homology BLAST search engine (http://www.ncbi.nlm.nih.gov/BLAST/) to identify the nearest match to the sequence.
(24) Results
(25) Identity of L. casei NCIMB 42019 was Confirmed by BLAST Analysis of the Intergenic Spacer (IGS) Region.
(26) TABLE-US-00001 TABLE 1 Blast results of the intergenic spacer (IGS) region of L. casei NCIMB 42019. Closest Match on NCBl Iden- % Sample Accession no BLAST Jul. 12, 2015 tities Match bp NCIMB gb(CP012148.1) Lactobacillus paracasei 272/ 97% 285 42019 strain L9, complete 280 genome gb(CP001084.2) Lactobacillus casei str. Zhang, complete genome
(27) TABLE-US-00002 TABLE 2 Sequence of the intergenic spacer (IGS) region of L. casei NCIMB 42019. IGS Sequence TTGCTGGATCACCTCCTTTCTAAGGAAACAGACTGAA of L. casei AGTCTGACGGAAACCTGCACACACGAAACTTTGTTTA NCIMB 42019 GTTTTGAGGGGATCACCCTCAAGCACCCTAACGGGTG (285 nt) CGACTTTGTTCTTTGAAAACCTGGATATCATTGTATT AATTGTTTTAAATTGCCGAGAACACAGCGTATTTGTA TGAGTTTCTGAAAAAGAAATTCGCATCGCATAACCGC TGACGCAGTCGACAGTATCGGTTAAGTTACAAAGGGC GCACGGTGGATGCCTTTGGCACCAGA
Example 2—EPS Fluffy Pellet Test (Strain Bulkiness)
(28) Method
(29) Each strain was fermented in a broth. The particulate collected after centrifugation was washed and subsequently freeze dried.
(30) The freeze dried powder, adjusted for total cell number (2×10E10), was re-suspended in 10 ml PBS and centrifuged at 4000 rpm/10 mins/4° C.
(31) Results
(32)
(33) B. longum NCIMB 41003 produced a 0.9 cm fluffy pellet while L. casei NCIMB 42019 produced a 1.6 cm fluffy pellet.
(34) Conclusion
(35) B. longum NCIMB 41003 is known to be a high EPS producer. The EPS fluffy pellet test, and the resulting pellet height, confirms that the strains are EPS producers, with some strains producing more than others.
Example 3—Microbial Adhesion to Hexadecane (MATH) Assay
(36) Hydrophobicity is the physical property of a molecule whereby it repels water. Hydrophobic materials are used for oil removal from water, the management of oil spills, and chemical separation processes to remove non-polar substances from polar compounds. Hydrophobicity of a bacterial cell depends on the composition of its cell surface with respect to the proteins, peptides and polysaccharides present. The ability of a probiotic strain to adhere to the intestinal mucosa helps the bacterial cell to establish itself during gastrointestinal transit providing it with a competitive advantage in the intestine. Hydrophobicity of a strain is one factor contributing to adhesive ability. The determination of bacterial adhesion to hexadecane as an indication of the strains ability to adhere to intestinal epithelial cells is a valid qualitative approach (Kiely & Olson, 2000).
(37) Method
(38) The ability of L. casei NCIMB 42019 and an EPS low Lactobacillus strain to adhere to hexadecane as a measure of their hydrophobicity was determined using the microbial adhesion to hexadecane (MATH) test. Adhesion to hexadecane was measured according to the method of Rosenberg et al, 1980 with some modifications (Crow and Gopal, 1995; Bellon-Fontaine et al, 1996). Bacteria were harvested in the stationary phase by centrifugation at 5000 g for 15 min, washed twice with PBS, and resuspended in 0.1 mol/1 KNO.sub.3 (pH 6.2) to an OD.sub.600 of 0.8. The absorbance of the cell suspension was measured at 600 nm (A0). 2 ml of hexadecane (Sigma Aldrich) was added to 2 ml of cell suspension. After 10 min pre-incubation at room temperature, the two-phase system was mixed by vortexing for 2 mins. The aqueous phase was removed after 20 min of incubation at room temperature, and its absorbance at 600 nm (A1) was measured. The % of bacterial adhesion to hexadecane was calculated as (1−A1/A0)×100, where A0 and A1 are the absorbance before and after extraction with the solvents, respectively. Experiments were done in triplicate with cells coming from independent cultures.
(39) Results
(40)
(41) Conclusion
(42) L. casei NCIMB 42019 (65.6%) showed a higher affinity for hexadecane, indicating that it had greater hydrophobicity, in comparison to an EPS low Lactobacillus strain (50.2%).
Example 4—Fat Binding Capacity
(43) The ability of L. casei NCIMB 42019 and a low EPS producing strain to bind fat in vitro was investigated.
(44) Method
(45) 5×10.sup.10 cells of L. casei NCIMB 42019 and 5×10.sup.10 cells of EPS low Lactobacillus strain were mixed with 10 ml of PBS. 10 ml of olive oil was then added. The mixture was vortexed thoroughly and incubated at 37° C. with shaking. After 2 hr incubation the mixture was centrifuged at 675 g for 10 mins. The unbound layers of fat (top layer), as an indication of the fat binding capacity of the strains, were compared visually. A commercially available fat-binder (XLS Medical) containing the active ingredient Litramine™ was included (2 g sachet+10 ml PBS+10 ml olive oil). A control containing 10 ml PBS and 10 ml olive oil only was also included.
(46) Results
(47)
(48) Conclusion
(49) In comparison to the EPS low Lactobacillus strain and the commercially available XLS Medical fat-binder L. casei NCIMB 42019 demonstrates an increased capacity to bind to fat in vitro.
Example 5—PBMC Anti-Inflammatory Profiles
(50) The anti-inflammatory profile of L. casei NCIMB 42019 and B. longum NCIMB 41003 were examined by assessing the induction of the anti-inflammatory cytokine IL-10 and the pro-inflammatory cytokine TNF-α in the peripheral blood mononuclear cell (PBMC) cytokine induction assay.
(51) Method
(52) Peripheral Blood Mononuclear Cell (PBMC) Cytokine Induction Assay
(53) Blood was obtained from three healthy volunteers under approval of the Clinical Research Ethics Committee of the Cork Teaching Hospitals. Subjects were all and had abstained from probiotic, antibiotic or anti-inflammatory medication usage for one month or longer prior to blood donation. PBMCs were extracted from whole blood by density gradient separation using histopaque (Sigma-Aldrich), a hydrophilic polysaccharide that separates layers of blood, with a ‘buffy/coat’ forming under a layer of plasma which contains the PBMCs. For each strain, 100 mg of freeze-dried powder was weighed out and re-suspended in sterile Dulbecos PBS (Sigma-Aldrich). The bacterial cells were washed twice by centrifugation (4000 rpm/10 min/4° C./Brake 0) and re-suspended in sterile PBS. Direct microscopic counts were performed and the cell preparations were diluted to the appropriate concentrations to give a ratio of 100:1; 50:1; 25:1 total bacteria:PBMC cells. Technical replicates were performed in triplicate. PBMCs were then incubated at a concentration of 2×10.sup.5 cells/ml for 48 h at 37° C. (in the presence of penicillin and streptomycin (Sigma-Aldrich)) with control media, or with increasing concentrations of the bacterial strains: 1×10.sup.6 cells/ml (25:1 Bacterial:PBMC), 1×10.sup.7 cells/ml (50:1 Bacteria:PBMC) and 2×10.sup.7 cells/mL (100:1 Bacteria:PBMC). Supernatants were assayed for the anti-inflammatory cytokine IL-10 and the pro-inflammatory cytokine TNF-α which were measured using the MesoScale Discovery (MSD) multiplex platform tissue culture kits (Meso Scale Diagnostics, Maryland, USA). B. longum NCIMB 41003, which has previously been shown to have anti-inflammatory activity (Groeger et al., 2013) was used as a positive control to validate the accuracy of the assay.
(54) Results
(55)
(56)
(57)
(58)
(59) Conclusion
(60) L. casei NCIMB 42019 and B. longum NCIMB 41003, which are EPS-rich, induce similar anti-inflammatory immune profiles in a PBMC cytokine induction assay. The low-EPS producing strain produces a very different immune profile.
Example 6—Effect of Administration of L. casei NCIMB 42019, an EPS Low Lactobacillus Strain, and B. longum NCIMB 41003 on Metabolic Outcomes in the Diet-Induced Obesity (DIO) Mouse Model
(61) Method
(62) Animals
(63) 7 week old male C57BL/6JRccHsd mice (Harlan Laboratories, Netherlands) (72 mice, n=12 per group), randomized based on body weight, were maintained in a controlled environment with 22±3° C. temperature, 50±20% humidity, a light/dark cycle of 12 h each and 15-20 fresh air changes per hour. Mice were housed group wise (4 mice per cage) and autoclaved corncob was used as bedding material. Mice were received at 5 weeks of age and were quarantined for one week followed by acclimatization for one week prior to commencement of study. From Day 0 mice were fed, ad libitum, and mice in each cage were provided with 50 ml of plain sterile drinking water (groups 1 and 2; Table 1) or drinking water containing freeze-dried probiotic (1×10.sup.9 cfu/dose/day) via polycarbonate bottles fitted with stainless steel sipper tubes (groups 3, 4, 5 and 6; Table 1). Treatment continued for 16 weeks.
(64) Experimental Design
(65) Day 0 onwards, group 1 was fed with low fat diet (LFD) D12450 (10% kcal % fat, gamma irradiated; Research Diets Inc, USA) and the other five groups (groups 2 to 6) were fed with high fat diet (HFD) D12451 (45% kcal % fat, gamma irradiated; Research Diets Inc) for a period of 16 weeks. HFD feeding induced insulin resistance and obesity in animals which was characterized by increase in body weight and fasting blood glucose values. Group 1 and 2 were provided with plain sterile drinking water while groups 3, 4, 5 and 6 were provided with drinking water containing 1×10.sup.9 cfu/dose/day of the appropriate probiotic (Table 1). General health observation was performed on a daily basis at the same time of the day. This included alertness, hair texture, cage movement and presence of any discharge from nose, eyes, mouth and ears. Pre-measured feed was kept in each cage and the left over feed was measured and recorded on every third day to access the amount of food consumed by the mice. Water consumption of the animals was measured on a daily basis starting from the first dosing day. Mice in each cage (n=4) were provided with 50 mL of water daily. The remaining water in each cage was measured every 24 h.
(66) Weights and Tissue Sampling
(67) Body weights were recorded individually for all animals at receipt, day of randomization, prior to treatment, and once in three days thereafter. The percent change in bodyweight was calculated according to the formula (TT−TC)/TC*100 where TT is the test day treated and TC is the test day control. Mice were subjected to Echo Magnetic Resonance Imaging (MRI) using an Echo MRI (EchoMRI-700™) on day −1 and 28, 56, 84 and 112 to assess body fat and lean mass composition. The animal was placed in a plastic holder without sedation or anaesthesia. Fat is measured as the mass of all the fat molecules in the body. Lean is a muscle tissue mass equivalent of all the body parts containing water. Contribution to “free water” comes mostly from the bladder. Total water includes both the free water and the water contained in lean mass, which is the entire water content of the body. Plastic holders were sanitized between animals from different groups to avoid cross-contamination. Aseptic technique was followed while handling animals from different groups. At the end of week 16, the animals were sacrificed by CO.sub.2 asphyxiation. Liver, skeletal muscle, visceral fat (epididymal, renal and mesenteric), subcutaneous fat, spleen, caecum, brown adipose fat, brain and intestine were collected, weighed and stored at −80° C. for future biochemical and genetic analysis.
(68) Metabolic Markers
(69) Blood samples were collected at morning 9 am by the tail nipping method on day 0, 30, 60, 90 and 112 for random blood glucose measurements (total 5 samplings were done), starting/including the first dosing day. Blood glucose analysis was done by Johnson and Johnson glucometer (One touch Ultra 2). Aseptic technique was followed while handling animals from different groups. At the end of 16 weeks, mice were fasted for 6 h and blood was collected by the tail nipping method (non-anesthetic mode of blood collection) for blood glucose estimation. Blood was collected by retro-orbital puncture method under light isoflurane anesthesia and plasma was separated which was used for estimating total cholesterol (TC), triglycerides (TG), high-density lipoprotein (HDL) cholesterol, low-density lipoprotein (LDL) cholesterol and non-esterified fatty acids (NEFA) by fully automated random access clinical chemistry analyzer (EM-360, Erba Mannheim, Germany). Plasma VLDL levels were obtained by the calculation method: (VLDL=Triglycerides (mg/dl)/5). For hepatic TC and TG estimation, liver was homogenized in isopropanol (1 ml/50 mg tissue) and incubated at 4° C. for 1 h. The samples were centrifuged at 4° C. for 5 min at 2,500 rpm. Cholesterol and triglyceride concentrations in the supernatants were measured by a fully automated random access clinical chemistry analyzer (EM-360, Erba Mannheim).
(70) Gene Expression Analysis
(71) The expression of genes involved in the regulation and enzymatic pathways of fatty acid metabolism and inflammation were analysed. Total RNA was prepared from liver samples using RNeasy Mini Kit (QIAgen, Germany). cDNA was prepared by reverse transcription of 1 μg total RNA using Reverse Transcription System Kit (QIAgen). cDNA from each group was pooled and was screened for each pooled cDNA sample using the Mouse Fatty Acid Metabolism RT.sup.2 Profiler PCR Array (QIAgen) according to manufacturer's instructions. Data analysis was performed using the QIAgen RT.sup.2 Profiler PCR Array accompanying online software. Data is presented as change in fold regulation of low-fat diet control versus high-fat diet control and change in fold regulation of probiotics versus high-fat diet control. A cut-off of below 2-fold regulation was considered as no change.
(72) Energy Excretion Estimation
(73) Two faecal pellets were collected from each mouse at Weeks 6, 10 and 15 and analyzed for their gross calorific value by bomb calorimetry. For bomb calorimetry analysis, the samples were weighed and oven-dried at 60° C. for 48 h. The energy content of the faeces was assessed with a Parr 6100 calorimeter using an 1109 semi-micro bomb (Parr Instruments & Co., Moline, Ill., USA). The calorimeter energy equivalent factor was determined using benzoic acid standards and each sample (100 mg) was analysed in triplicate. Cumulative energy excretion of probiotic fed mice over the course of the study was estimated as a percentage relative to energy excreted by mice from the high-fat diet control group.
(74) Fat Excretion Estimation
(75) Two faecal pellets were collected from each mouse at Weeks 0, 6, 10 and 14 and stored at −80° C. until further analysis. Faecal fat content was determined according to a modified method of Folch et al (Folch et al., 1957, Kraus, 2015). Faecal samples were weighed in 15 ml conical polypropylene tubes (Sarstedt) and deionized water (10× v/w) was added. Samples were vortexed for 60 seconds at high speed at soaked overnight at room temperature. To extract lipids 4× volume of chloroform and methanol mixture (2:1, v:v) to deionised water was added and vortexed for 60 seconds at high speed. The mixture was then centrifuged at 2000 g for 10 min. The bottom lipophilic layer from the extraction was collected by insertion of a 22G 1½ hypodermic needle (BD) through the tube wall and drained into pre-weighed tubes. The collected lipophilic layer was allowed to dry overnight. Total fat content was weighed using an analytical laboratory balance (Sartorius). Cumulative fat excretion of probiotic fed mice over the course of the study was estimated as a percentage relative to fat excreted by mice from the high-fat diet control group.
(76) Statistical Analysis
(77) Statistical analysis was performed using unpaired t-test for differences between two groups. One-way analysis of variance (ANOVA), followed by Tukey's multiple comparison test was used when more than two groups were assessed. Data were analyzed using GraphPad Prism version 5.00 for Windows (GraphPad Software). The results were considered statistically significant when p<0.05.
(78) TABLE-US-00003 TABLE 5 Experimental groups and associated diet and treatment regimens. LFD = Low fat diet control; HFD = high-fat diet control. Number of mice/ Diet Groups group regimen Treatment regimen Group 1 (LFD control) 12 10% Plain sterile drinking fat kcal water, daily Group 2 (HFD control) 12 45% Plain sterile drinking fat kcal water, daily Group 3 (HFD + L. casei 12 45% 1 × 10.sup.9 cfu/dose/day in NCIMB 42019) fat kcal drinking water, daily Group 4 (HFD + EPS 12 45% 1 × 10.sup.9 cfu/dose/day in low Lactobacillus strain) fat kcal drinking water, daily Group 6 (HFD + 12 45% 1 × 10.sup.9 cfu/dose/day in B. longum fat kcal drinking water, daily NCIMB 41003)
Results
(79)
(80)
(81)
(82)
(83)
(84)
(85)
(86)
(87)
(88) TABLE-US-00004 TABLE 6 Expression profiles for genes involved in the regulation and enzymatic pathways of fatty acid metabolism and inflammation. L. casei NCIMB 42019 down-regulates genes associated with cholesterol metabolism and transport, adipokine signalling, β-oxidation and oxidative phosphorylation in a strain-specific manner. L. casei NCIMB 42019 up-regulates the anti-inflammatory cytokine Il-10 and down-regulates pro-inflammatory cytokine TNFα, independent of diet, in a strain-specific manner. HFD versus HFD versus LFD versus NCIMB 42019 low EPS Lac HFD (Fold (ΔFold (ΔFold Gene Function Gene Symbol Gene Info Regulation) Regulation) Regulation) CHOLESTEROL Cyp2e1 Cytochrome P450, family 2, subfamily e, polypeptide 1 +5.063 −2.5663 NC METABOLISM/ Cyp7a1 Cytochrome P450, family 7, subfamily a, polypeptide 1 +4.1989 −3.4928 NC TRANSPORT Abcg1 ATP-binding cassette, sub-family G (WHITE), member 1 NC −4.1894 NC Srebf2 sterol regulatory element binding transcription factor 2 NC −2.9725 NC Abca1 ATP-binding cassette, sub-family A (ABC1), member 1; NC −2.5967 NC CERP, cholesterol efflux regulatory protein Nr1h4 nuclear receptor subfamily 1, group H, member 4; bile acid NC −2.4079 NC receptor ADIPOKINE Scl2a4 Solute carrier family 2 (facilitated glucose transporter), −2.0279 −8.3109 NC SIGNALLING member 4; GLUT4 Serpine1 Serine (or cysteine) peptidase inhibitor, clade E, member 1 −2.9282 −8.3074 NC Adipor1 Adiponectin receptor 1 NC −2.9511 NC Slc2a1 Solute carrier family 2 (facilitated glucose transporter), NC −2.8817 NC member 1; GLUT1 Tnf Fas (TNF receptor superfamily member 6) NC −2.8524 NC Akt1 Thymoma viral proto-oncogene 1 NC −2.2818 NC OTHER LIPID Slc27a5 Solute carrier family 27 (fatty acid transporter), member 5 NC −2.9246 NC METABOLISM TRANSPORT β-OXIDATION Fabp1 Fatty acid-binding protein 1 NC −3.3444 NC Akt1 Thymoma viral proto-oncogene 1 NC −2.2818 NC OXIDATIVE Ndufb6 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6 NC −2.7981 NC PHOSPHORYLATION INFLAMMATORY IL10 Interleukin 10 NC +2.6867 NC RESPONSE Tnf Fas (TNF receptor superfamily member 6) NC −2.8524 NC Expression profiles for genes involved in the regulation and enzymatic pathways of fatty acid metabolism and inflammation in the liver. NC = No change (i.e. below cut-off of 2-fold regulation). + = Upregulation; − = down regulation.
(89) Surprisingly, the EPS producing B. longum NICMB 41003 strain did not have any significant effect in this model.
(90) Conclusion
(91) L. casei NCIMB 42019 administration led to a significant reduction in fat mass by week sixteen. This was accompanied by a statistically significant reduction in subcutaneous fat, brown adipose tissue and epididymal fat for L. casei NCIMB 42019. L. casei NCIMB 42019 administration led to a significant reduction in hepatic total cholesterol and triglyceride levels when compared to the HFD control group. L. casei NCIMB 42019 alters metabolic pathways altered in a strain-specific manner. Despite no significant difference in cumulative food intake over the course of the study, we observed an increase in % energy excretion for L. casei NCIMB 42019, which was accompanied with an increase in % fat excretion, suggesting that the administration of the fat-binding, hydrophobic L. casei NCIMB 42019 strain may reduce the amount of fat extracted from ingested food which could be responsible for the improvements in metabolic outcomes observed in this DIO mouse model.
Example 6—Transit of L. casei NCIMB 42019 Through the Gastro-Intestinal Tract In Vivo
(92) Method
(93) The ability of L. casei NCIMB 42019 to transit in vivo was demonstrated in mice assessed in seven-week old male C57BL/J6 mice over a period of 60 days (n=5). L. casei NCIMB 42019 was delivered in drinking water at a daily concentration of 1×10.sup.9 CFU/4 ml dose. Faecal samples were collected at 0, 3, 10, 28 and 60 days and L. casei NCIMB 42019 was recovered by plating onto MRS+rifampicin (50 ug/ml; Sigma-Aldrich).
(94) Result
(95)
(96) Conclusion
(97) L. casei NCIMB 42019 transits to high numbers in vivo.
(98) Prebiotics
(99) The introduction of probiotic organisms is accomplished by the ingestion of the microorganism in a suitable carrier. It would be advantageous to provide a medium that would promote the growth of these probiotic strains in the large bowel. The addition of one or more oligosaccharides, polysaccharides, or other prebiotics enhances the growth of lactic acid bacteria in the gastrointestinal tract. Prebiotics refers to any non-viable food component that is specifically fermented in the colon by indigenous bacteria thought to be of positive value, e.g. bifidobacteria, lactobacilli. Types of prebiotics may include those that contain fructose, xylose, soya, galactose, glucose and mannose. The combined administration of a probiotic strain with one or more prebiotic compounds may enhance the growth of the administered probiotic in vivo resulting in a more pronounced health benefit, and is termed synbiotic.
(100) Other Active Ingredients
(101) It will be appreciated that the probiotic strains may be administered prophylactically or as a method of treatment either on its own or with other probiotic and/or prebiotic materials as described above. In addition, the bacteria may be used as part of a prophylactic or treatment regime using other active materials such as those used for treating inflammation or other disorders especially those with an immunological involvement. Such combinations may be administered in a single formulation or as separate formulations administered at the same or different times and using the same or different routes of administration.
(102) Formulations
(103) One or more of the strains of the invention may be administered to animals (including humans) in an orally ingestible form in a conventional preparation such as capsules, microcapsules, tablets, granules, powder, troches, pills, suppositories, suspensions and syrups. Suitable formulations may be prepared by methods commonly employed using conventional organic and inorganic additives. The amount of active ingredient in the medical composition may be at a level that will exercise the desired therapeutic effect.
(104) The formulation may also include a bacterial component, a drug entity or a biological compound.
(105) In addition, a vaccine comprising one or more of the strains of the invention may be prepared using any suitable known method and may include a pharmaceutically acceptable carrier or adjuvant.
(106) The strains of the invention may be formulated to facilitate controlled release such as a delayed release of the strain. For example, the formulation may be adapted to release the strain at a particular location in the gastrointestinal tract such as the small intestine or in the colon. To achieve such a controlled release the strain may be formulated in a capsule which has a coating which is adapted to release the strain at a particular location. A range of coatings are available to facilitate such controlled release. One such family of coatings are those available under the Trade Mark Eudragit.
(107) All documents cited herein are, in relevant part, incorporated herein by reference.
(108) The invention is not limited to the embodiments hereinbefore described, which may be varied in detail.
REFERENCES
(109) ADAMS, E. L., RICE, P. J., GRAVES, B., ENSLEY, H. E., YU, H., BROWN, G. D., GORDON, S., MONTEIRO, M. A., PAPP-SZABO, E., LOWMAN, D. W., POWER, T. D., WEMPE, M. F. & WILLIAMS, D. L. 2008. Differential high-affinity interaction of dectin-1 with natural or synthetic glucans is dependent upon primary structure and is influenced by polymer chain length and side-chain branching. J Pharmacol Exp Ther, 325, 115-23. ARONSSON, L., HUANG, Y., PARINI, P., KORACH-ANDRE, M., HAKANSSON, J., GUSTAFSSON, J. A., PETTERSSON, S., ARULAMPALAM, V. & RAFTER, J. 2010. Decreased fat storage by Lactobacillus paracasei is associated with increased levels of angiopoietin-like 4 protein (ANGPTL4). PLoS One, 5. BACKHED, F., DING, H., WANG, T., HOOPER, L. V., KOH, G. Y., NAGY, A., SEMENKOVICH, C. F. & GORDON, J. I. 2004. The gut microbiota as an environmental factor that regulates fat storage. Proc Natl Acad Sci USA, 101, 15718-23. BACKHED, F., MANCHESTER, J. K., SEMENKOVICH, C. F. & GORDON, J. I. 2007. Mechanisms underlying the resistance to diet-induced obesity in germ-free mice. Proc Natl Acad Sci USA, 104, 979-84. BLAND, E. J., KESHAVARZ, T. & BUCKE, C. 2004. The influence of small oligosaccharides on the immune system. Carbohydr Res, 339, 1673-8. CANI, P. D., AMAR, J., IGLESIAS, M. A., POGGI, M., KNAUF, C., BASTELICA, D., NEYRINCK, A. M., FAVA, F., TUOHY, K. M., CHABO, C., WAGET, A., DELMEE, E., COUSIN, B., SULPICE, T., CHAMONTIN, B., FERRIERES, J., TANTI, J. F., GIBSON, G. R., CASTEILLA, L., DELZENNE, N. M., ALESSI, M. C. & BURCELIN, R. 2007. Metabolic endotoxemia initiates obesity and insulin resistance. Diabetes, 56, 1761-72. CANI, P. D., BIBILONI, R., KNAUF, C., WAGET, A., NEYRINCK, A. M., DELZENNE, N. M. & BURCELIN, R. 2008a. Changes in gut microbiota control metabolic endotoxemia-induced inflammation in high-fat diet-induced obesity and diabetes in mice. Diabetes, 57, 1470-81. CANI, P. D., DELZENNE, N. M., AMAR, J. & BURCELIN, R. 2008b. Role of gut microflora in the development of obesity and insulin resistance following high-fat diet feeding. Pathol Biol (Paris), 56, 305-9. FANNING, S., HALL, L. J., CRONIN, M., ZOMER, A., MACSHARRY, J., GOULDING, D., MOTHERWAY, M. O., SHANAHAN, F., NALLY, K., DOUGAN, G. & VAN SINDEREN, D. 2012. Bifidobacterial surface-exopolysaccharide facilitates commensal-host interaction through immune modulation and pathogen protection. Proc Natl Acad Sci USA, 109, 2108-13. FOLCH, J., LEES, M. & SLOANE STANLEY, G. H. 1957. A simple method for the isolation and purification of total lipides from animal tissues. J Biol Chem, 226, 497-509. GUH, D. P., ZHANG, W., BANSBACK, N., AMARSI, Z., BIRMINGHAM, C. L. & ANIS, A. H. 2009. The incidence of co-morbidities related to obesity and overweight: a systematic review and meta-analysis. BMC Public Health, 9, 88. GUPTA, S., RICHARD, L. & FORSYTHE, A. 2015. The humanistic and economic burden associated with increasing body mass index in the EUS. Diabetes Metab Syndr Obes, 8, 327-38. HIDALGO-CANTABRANA, C., LÓPEZ, P., GUEIMONDE, M., DE LOS REYES-GAVILÁN, C., SUÁREZ, A., MARGOLLES, A. & RUAS-MADIEDO, P. 2012. Immune Modulation Capability of Exopolysaccharides Synthesised by Lactic Acid Bacteria and Bifidobacteria. Probiotics and Antimicrobial Proteins, 4, 227-237. HIDALGO-CANTABRANA, C., NIKOLIC, M., LOPEZ, P., SUAREZ, A., MILJKOVIC, M., KOJIC, M., MARGOLLES, A., GOLIC, N. & RUAS-MADIEDO, P. 2014. Exopolysaccharide-producing Bifidobacterium animalis subsp. lactis strains and their polymers elicit different responses on immune cells from blood and gut associated lymphoid tissue. Anaerobe, 26, 24-30. JONES, S. E., PAYNICH, M. L., KEARNS, D. B. & KNIGHT, K. L. 2014. Protection from intestinal inflammation by bacterial exopolysaccharides. J Immunol, 192, 4813-20. KAHN, S. E., HULL, R. L. & UTZSCHNEIDER, K. M. 2006. Mechanisms linking obesity to insulin resistance and type 2 diabetes. Nature, 444, 840-6. KANKAINEN, M., PAULIN, L., TYNKKYNEN, S., VON OSSOWSKI, I., REUNANEN, J., PARTANEN, P., SATOKARI, R., VESTERLUND, S., HENDRICKX, A. P., LEBEER, S., DE KEERSMAECKER, S. C., VANDERLEYDEN, J., HAMALAINEN, T., LAUKKANEN, S., SALOVUORI, N., RITARI, J., ALATALO, E., KORPELA, R., MATTILA-SANDHOLM, T., LASSIG, A., HATAKKA, K., KINNUNEN, K. T., KARJALAINEN, H., SAXELIN, M., LAAKSO, K., SURAKKA, A., PALVA, A., SALUSJARVI, T., AUVINEN, P. & DE VOS, W. M. 2009. Comparative genomic analysis of Lactobacillus rhamnosus GG reveals pili containing a human-mucus binding protein. Proc Natl Acad Sci USA, 106, 17193-8. KOTZAMPASSI, K., GIAMARELLOS-BOURBOULIS, E. J. & STAVROU, G. 2014. Obesity as a consequence of gut bacteria and diet interactions. ISRN Obes, 2014, 651895. KRAUS, D., YANG, Q. AND KAHN, B. B. 2015. Lipid Extraction from Mouse Feces. Bio-protocol, 5, e1375. LEE, H. Y., PARK, J. H., SEOK, S. H., BAEK, M. W., KIM, D. J., LEE, K. E., PAEK, K. S., LEE, Y. & PARK, J. H. 2006. Human originated bacteria, Lactobacillus rhamnosus PL60, produce conjugated linoleic acid and show anti-obesity effects in diet-induced obese mice. Biochim Biophys Acta, 1761, 736-44. NAITO, E., YOSHIDA, Y., MAKINO, K., KOUNOSHI, Y., KUNIHIRO, S., TAKAHASHI, R., MATSUZAKI, T., MIYAZAKI, K. & ISHIKAWA, F. 2011. Beneficial effect of oral administration of Lactobacillus casei strain Shirota on insulin resistance in diet-induced obesity mice. J Appl Microbiol, 110, 650-7. RIDAURA, V. K., FAITH, J. J., REY, F. E., CHENG, J., DUNCAN, A. E., KAU, A. L., GRIFFIN, N. W., LOMBARD, V., HENRISSAT, B., BAIN, J. R., MUEHLBAUER, M. J., ILKAYEVA, O., SEMENKOVICH, C. F., FUNAI, K., HAYASHI, D. K., LYLE, B. J., MARTINI, M. C., URSELL, L. K., CLEMENTE, J. C., VAN TREUREN, W., WALTERS, W. A., KNIGHT, R., NEWGARD, C. B., HEATH, A. C. & GORDON, J. I. 2013. Gut microbiota from twins discordant for obesity modulate metabolism in mice. Science, 341, 1241214. TURNBAUGH, P. J., HAMADY, M., YATSUNENKO, T., CANTAREL, B. L., DUNCAN, A., LEY, R. E., SOGIN, M. L., JONES, W. J., ROE, B. A., AFFOURTIT, J. P., EGHOLM, M., HENRISSAT, B., HEATH, A. C., KNIGHT, R. & GORDON, J. I. 2009. A core gut microbiome in obese and lean twins. Nature, 457, 480-4. TURNBAUGH, P. J., LEY, R. E., MAHOWALD, M. A., MAGRINI, V., MARDIS, E. R. & GORDON, J. I. 2006. An obesity-associated gut microbiome with increased capacity for energy harvest. Nature, 444, 1027-31. VINDEROLA, G., PERDIGON, G., DUARTE, J., FARNWORTH, E. & MATAR, C. 2006. Effects of the oral administration of the exopolysaccharide produced by Lactobacillus kefiranofaciens on the gut mucosal immunity. Cytokine, 36, 254-60. VOLMAN, J. J., RAMAKERS, J. D. & PLAT, J. 2008. Dietary modulation of immune function by beta-glucans. Physiol Behav, 94, 276-84. VRIEZE, A., VAN NOOD, E., HOLLEMAN, F., SALOJARVI, J., KOOTTE, R. S., BARTELSMAN, J. F., DALLINGA-THIE, G. M., ACKERMANS, M. T., SERLIE, M. J., OOZEER, R., DERRIEN, M., DRUESNE, A., VAN HYLCKAMA VLIEG, J. E., BLOKS, V. W., GROEN, A. K., HEILIG, H. G., ZOETENDAL, E. G., STROES, E. S., DE VOS, W. M., HOEKSTRA, J. B. & NIEUWDORP, M. 2012. Transfer of intestinal microbiota from lean donors increases insulin sensitivity in individuals with metabolic syndrome. Gastroenterology, 143, 913-6.e7.