NANOPARTICLES CONTAINING EXTRACELLULAR MATRIX FOR DRUG DELIVERY
20180207107 ยท 2018-07-26
Assignee
Inventors
- Connie Hsia (Dallas, TX)
- Yi Hong (Irving, TX)
- Orson W. Moe (Dallas, TX)
- Kytai Nguyen (Grand Prairie, TX)
Cpc classification
A61K9/0019
HUMAN NECESSITIES
A61K31/713
HUMAN NECESSITIES
A61K9/5176
HUMAN NECESSITIES
A61K38/47
HUMAN NECESSITIES
A61K9/0078
HUMAN NECESSITIES
International classification
A61K31/713
HUMAN NECESSITIES
A61K38/47
HUMAN NECESSITIES
Abstract
Nanoparticles coated with extracellular matrix (ECM) are provided, in some aspects, for the delivery of a therapeutic protein, nucleic acid, or drug. In some embodiments, the nanoparticles are delivered to a subject via inhalation or aerosol delivery. Also provided, in some aspects, are methods for treating acute lung injury comprising administering -Klotho (Klotho) protein or DNA to a subject.
Claims
1. A pharmaceutical composition comprising a plurality of nanoparticles, wherein an exterior surface of the nanoparticles comprises or is at least partially coated with a decellularized extracellular matrix (ECM).
2. The pharmaceutical composition of claim 1, wherein the pharmaceutical composition is formulated for inhalation or aerosol delivery.
3. The pharmaceutical composition of any one of claims 1-2, wherein the extracellular matrix comprises or consists of decellularized lung tissue.
4. The pharmaceutical composition of claim 3, wherein the decellularized lung tissue is decellularized porcine lung tissue.
5. The pharmaceutical composition of any one of claims 1-4, wherein the nanoparticles comprise poly(lactic-co-glycolic) (PLGA), poly(lactic acid) (PLA), poly(glycolic acid) (PGA), gelatin, chitosan, liposome, or a combination thereof.
6. The pharmaceutical composition of claim 5, wherein the nanoparticles are PLGA nanoparticles.
7. The pharmaceutical composition of any one of claims 1-6, wherein the nanoparticles are coated with the extracellular matrix.
8. The pharmaceutical composition of any one of claims 1-7, wherein the nanoparticles are generated via a single or double emulsion method.
9. The pharmaceutical composition of any one of claims 1-8, wherein the extracellular matrix is coated on the nanoparticles layer by layer or via physical adsorption.
10. The pharmaceutical composition of any one of claims 1-9, wherein said nanoparticles comprise a drug.
11. The pharmaceutical composition of claim 10, wherein the pharmaceutical composition is formulated for inhalation or aerosol delivery.
12. The pharmaceutical composition of any one of claims 10-11, wherein the drug is a protein, a small molecule therapeutic, or a nucleic acid.
13. The pharmaceutical composition of claim 12, wherein the drug is an anti-inflammatory agent, an antibiotic, or a chemotherapeutic.
14. The pharmaceutical composition of claim 12, wherein the drug is an -Klotho protein or a nucleic acid encoding -Klotho.
15. The pharmaceutical composition of claim 12, wherein the drug is EPO receptor protein or a nucleic acid encoding EPO receptor.
16. The pharmaceutical composition of any one of claims 1-15, wherein the pharmaceutical composition further comprises an excipient.
17. A method of treating a lung disease in a mammalian subject comprising administering a pharmaceutical preparation of any one of claims 1-15 to the subject via inhalation or aerosol delivery, wherein the nanoparticles contain a drug.
18. The method of claim 17, wherein the subject is a human.
19. The method of any one of claims 17-18, wherein the disease is direct or indirect lung injury, an acute respiratory distress syndrome, a cancer, an infection, an inflammatory disease, a lung inflammatory disease, asthma, chronic obstructive pulmonary disorder, or an inflammatory disease of the lung parenchyma.
20. The method of claim 19, wherein the disease is lung injury and the drug is an Klotho protein or a DNA encoding Klotho.
21. The method of claim 20, wherein the disease is an acute respiratory distress syndrome or results either directly from an injury to the lung, or as a complication secondary to injury to another organ.
22. A method of delivering a drug to a subject, comprising administering a pharmaceutical preparation of any one of claims 1-15 to the subject, wherein the nanoparticles contain a drug.
23. The method of claim 22, wherein the subject is a human.
24. The method of any one of claims 22-23, wherein the pharmaceutical composition is formulated for inhalation, aerosols, lung delivery, nasal delivery, airway instillation, oral administration, mucosal application, or vascular injection into a vein or artery.
25. A method of treating lung injury in a mammalian subject comprising administering a pharmacologically effective or therapeutically effective amount of an Klotho protein or a DNA encoding Klotho to the subject.
26. The method of claim 25, wherein the lung injury is an acute lung injury (ALI) or acute respiratory distress syndrome.
27. The method of claim 25, wherein the subject is a human.
28. The method of any one of claims 25-27, wherein the lung injury results directly from an injury to the lung.
29. The method of any one of claims 25-27, wherein the lung injury results from a complication secondary to injury to another organ.
30. The method of any one of claims 25-28, wherein the Klotho protein or the DNA encoding Klotho is administered via inhalation or aerosol delivery, nasal, or airway instillation, oral administration, mucosal application, or injection into a vein or artery.
31. The method of any one of claims 25-30, wherein the Klotho protein or the DNA encoding Klotho is comprised in a pharmaceutical preparation, wherein the pharmaceutical preparation comprises an excipient.
32. The method of any one of claims 25-31, wherein the Klotho protein or the DNA encoding Klotho is comprised in a nanoparticle.
33. The method of claim 32, wherein an exterior surface of the nanoparticle comprises or is at least partially or coated with a decellularized extracellular matrix (ECM).
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0018] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure. The disclosure may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
[0033] The present disclosure overcomes limitations in the prior art by providing improved nanoparticles that may be used, e.g., for improved drug delivery to the lungs of a subject. The present disclosure is based, in some aspects, on the finding that nanoparticles (e.g., PLGA nanoparticles) that are coated with or comprise ECM exhibit improved pharmacokinetics
II. EXTRACELLULAR MATRIX (ECM)
[0034] A variety of methods may be used to prepare extracellular matrix (ECM). Generally, ECM refers to decellularized tissue, preferably from a mammal such as a pig. The tissue may be lung, small intestinal submucosa (SIS), or from other organs. In some embodiments, the decellularized ECM is obtained from lung tissue from a pig. In some embodiments, the decellularized ECM is obtained from porcine lung. As used herein ECM preferably refers to decellularized ECM.
[0035] In some embodiments, ECM is prepared as follows. Fresh tissue (e.g., lung tissue) may be isolated from adult a mammal (e.g., a pig) and processed into an ECM solution through decellularization and enzymatic digestion using sodium dodecyl sulfate (SDS). Typically, the resulting ECM may thus induce little or no immune response in a subject, and various methods (e.g., DNA residue quantification) may be used to verify the quality of the ECM generated. Decellularized ECM typically contains two major components, collagen and glycosamingoglycan, along with a mixture of proteins, peptides and growth factors. The collagen content may be higher, while the GAG content may be lower, as compared to native tissue. After enzymatic digestion with enzymes, e.g., pepsin, a flowable ECM solution may be obtained. The enzyme treatment can cleave or reduce high molecular weight proteins and may also de-assemble the crosslinking structure, making the ECM more soluble in PBS.
[0036] In some embodiments decellularized ECM may be coated onto nanoparticles (e.g., PLGA nanoparticles) using adsorption. For example, a diluted solution of decellularized ECM was used for coating onto nanoparticles by adsorption. A variety of methods may be used for the decellularization and solublization process used to isolate tissue-derived ECM such as heart (Seif-Naraghi et al., 2013), skin (Wolf M T, et al., 2012.), brain and spin cord (Medberry et al., 2013), meniscus (Wu et al., 2015) and bone (Sawkins et al., 2013). Generally, the method used may try to preserve biological components, especially the water-soluble bioactive molecules while completely removing cellular components that might cause an immunogenic response. In some embodiments, the process is conducted in water, and the ECM may be washed repeatedly to remove SDS residue. The ECM may contain a variety of additional proteins (Sokocevic et al., 2013).
III. NANOPARTICLES
[0037] In some aspects, nanoparticles comprising or coated with ECM are provided that may be used for inhalation or aerosol delivery. In some embodiments, the nanoparticles comprise poly(lactic-co-glycolic acid) (PLGA). PLGA nanoparticles (NPs) may be fabricated, e.g., using a modified double emulsion technique as described, e.g., in (Menon et al., 2012). Additional methods that may be used to generate PLGA-containing nanoparticles include those described in, e.g., (Danhier et al., 2012) and (Menon et al., 2014). In some embodiments the nanoparticles are PLGA nanoparticles. In some embodiments, the nanoparticles are surface-modified or bioconjugated, e.g., to improve targeting capability and delivery of an encapsulated drug.
[0038] In some embodiments, the nanoparticles may comprise poly(lactic acid) (PLA), poly(glycolic acid) (PGA), and/or PLGA. In some embodiments, the nanoparticle may contain natural polymers such as gelatin and chitosan. In some embodiments, the nanoparticle may contain one or more additional agent such as, e.g., a neutral lipid, a neutral phospholipid, a charged lipid, and/or a charged phospholipid. For example, the neutral phospholipid may be a phosphatidylcholine, such as DOPC, egg phosphatidylcholine (EPC), dilauryloylphosphatidylcholine (DLPC), dimyristoylphosphatidylcholine (DMPC), dipalmitoylphosphatidylcholine (DPPC), distearoylphosphatidylcholine (DSPC), 1-myristoyl-2-palmitoyl phosphatidylcholine (MPPC), 1-palmitoyl-2-myristoyl phosphatidylcholine (PMPC), 1-palmitoyl-2-stearoyl phosphatidylcholine (PSPC), 1-stearoyl-2-palmitoyl phosphatidylcholine (SPPC), dimyristyl phosphatidylcholine (DMPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DAPC), 1,2-diarachidoyl-sn-glycero-3-phosphocholine (DBPC), 1,2-dieicosenoyl-sn-glycero-3-phosphocholine (DEPC), palmitoyloeoyl phosphatidylcholine (POPC), lysophosphatidylcholine, or dilinoleoylphosphatidylcholine. In certain embodiments the neutral phospholipid is a phosphatidylethanolamine, such as dioleoylphosphatidylethanolamine (DOPE), distearoylphophatidylethanolamine (DSPE), dimyristoyl phosphatidylethanolamine (DMPE), dipalmitoyl phosphatidylethanolamine (DPPE), palmitoyloeoyl phosphatidylethanolamine (POPE), or lysophosphatidylethanolamine. The charged phospholipid may be positively or negatively charged. The negatively charged phospholipid may be, e.g., a phosphatidylserine (e.g., dimyristoyl phosphatidylserine (DMPS), dipalmitoyl phosphatidylserine (DPPS), or brain phosphatidylserine (BPS)) or a phosphatidylglycerol (e.g., dilauryloylphosphatidylglycerol (DLPG), dimyristoylphosphatidylglycerol (DMPG), dipalmitoylphosphatidylglycerol (DPPG), distearoylphosphatidylglycerol (DSPG), or dioleoylphosphatidylglycerol (DOPG)). In some embodiments, the nanoparticles may further comprise chitosan, gelatin, alginate, cholesterol, PEI (polyethyleneimine), and/or polyethyleneglycol (PEG), for example in combination with PLGA. The phospholipid may be a naturally-occurring phospholipid or a synthetic phospholipid. One or more additional surface modification may be included in the nanoparticles, e.g., as described in Enayati et al., 2012; Fields et al., 2012; Ahmed et al., 2012; or Fontana et al., 2001.
[0039] The size of the nanoparticles may be varied, as desired. In some embodiments, the nanoparticles are about 10-1000 nm, with a more preferred range of about 50-250 nm in diameter.
[0040] In some embodiments, the following method is used to generate PLGA nanoparticles. The emulsion-solvent evaporation method may be used to prepare PLGA nanoparticles. For this procedure, 3% w/v PLGA solution may be prepared in chloroform. The solution may then be added to an aqueous solution of 5% w/v PVA to create an emulsion, and then sonicated. This particle suspension may be stirred (e.g., overnight at room temperature), to allow the solvent to evaporate. Nanoparticles may be recovered by ultracentrifugation at 25,000 rpm for 30 min at 10 C. For drug-loaded nanoparticles, a solution containing the drug (e.g., a therapeutic peptide, protein, small molecule, DNA, cDNA, RNA, RNAi) in water may be emulsified in PLGA solution. If it is desired to include chitosan (or other ingredient) in the nanoparticles, carboxymethyl chitosan (or other ingredient) may be mixed with PVA solution and allowed to be adsorbed onto the surface of the PLGA nanoparticles. If it is desired the nanoparticles may be lyophilized and stored in powder form (e.g., at 20 C.) when not being used. In some embodiments, nanoparticles may be constituted in either DI water, media or saline prior to use.
IV. DRUGS
[0041] In some embodiments, the nanoparticles may contain a drug such as, e.g., a small molecule, a nucleic acid (e.g., a DNA or RNA), or a protein. The protein may be a peptide or a polypeptide. In some embodiments, the nucleic acid encodes a therapeutic protein. The nucleic acid may include a promoter that is operably linked to a sequence for the expression of a therapeutic protein. In some embodiments, the nucleic acid may encode a small inhibitory RNA (siRNA or RNAi), a micro RNA (miRNA), an antisense, a gene therapy, or a therapeutic protein.
[0042] In some embodiments, the drug may be an anti-inflammatory drug, a chemotherapeutic, a tissue protective or a growth promoting substance. For example, in some embodiments the drug may be a therapeutic to treat asthma, chronic obstructive pulmonary disorder (COPD), cancer (e.g., a lung cancer), acute lung injury (ALI), or chronic lung fibrosis.
[0043] In some embodiments, the drug is used to treat a lung injury such as an acute lung injury. For example, in some embodiments, a protein or nucleic acid encoding Klotho, EPO receptor (e.g., human EPO receptor), or other molecules may be included in the nanoparticles. For example, Klotho is described in (Hu et al., 2013; Ravikumar et al., 2016a), and Klotho may have the sequence of Genbank accession number: NM_004795, Gene ID number: 9365.
[0044] Klotho is a single-pass transmembrane protein that functions as an obligate co-receptor for FGF23 and is crucial for mineral metabolism (Hu et al., 2013). The extracellular domain of Klotho is released via cleavage by secretases into blood, urine, and cerebrospinal fluid as endocrine soluble Klotho (Hu et al., 2012; Imura et al., 2004) exerting multiple effects, including anti-oxidation and anti-fibrosis, on distant organs (Hu et al., 2013a; Hu et al., 2013b). Klotho is not normally expressed in the lung, but the lung is highly sensitive to Klotho-mediated protection, and the alveolar capillary bed is constantly exposed to circulating Klotho via perfusion by the entire cardiac output. Hemizygous genetic Klotho haplo-insufficient mice are normal in all organs at baseline except the lung, which exhibits age-exacerbated degenerative changes such as air space enlargement and increased compliance (Suga et al., 2000; Ravikumar et al., 2014). Administered exogenous Klotho may protect the lung and lung cells against acute oxidative damage by increasing endogenous anti-oxidative capacity in vivo and in vitro (Ravikumar et al., 2014).
[0045] Acute kidney injury (AKI) has been associated with a state of transient severe systemic Klotho deficiency in rodents and humans (Hu et al., 2010; Panesso et al., 2014). AKI per se is also a state of heightened oxidative stress (Nath and Norby, 2000). As shown in the below examples, the inventors have investigated the possibility that Klotho deficiency in AKI contributes to acute lung injury (ALI). Without wishing to be bound by any theory, the data presented in the below examples supports the idea that Klotho deficiency may function as a mediator of pulmonary dysfunction in AKI. A rodent renal ischemia-reperfusion model of AKI was used to characterize Klotho deficiency and quantify ALI, and it was observed that Klotho repletion improves ALI in AKI.
V. PHARMACEUTICAL PREPARATIONS
[0046] In some embodiments, the nanoparticles are administered to a mammalian subject (e.g., a human) by inhalation or via an aerosol pharmaceutical composition. Nonetheless, in various embodiments, the pharmaceutical composition may be formulated for parenteral, intravenous, intradermal, intrathecal, intraarterial, intraperitoneal, intranasal, intravaginal, intrarectal, intra-ocular, intramuscular, subcutaneous, mucosal, oral, topical, intra-airway or inhalational administration.
[0047] Nanoparticle compositions as described herein, optionally containing a drug or therapeutic agent, may be dissolved or dispersed in a pharmaceutically acceptable carrier. The phrases pharmaceutical or pharmacologically acceptable refers to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to an animal, such as, for example, a human, as appropriate. The preparation of an pharmaceutical composition that contains at least one nanoparticle (e.g., containing a drug or therapeutic agent) or additional active ingredient will be known to those of skill in the art in light of the present disclosure, as exemplified by Remington: The Science and Practice of Pharmacy, 21.sup.st Ed., Lippincott Williams and Wilkins, 2005, incorporated herein by reference. Moreover, for animal (e.g., human) administration, it will be understood that preparations should typically meet sterility, pyrogenicity, general safety and purity standards as required by FDA Office of Biological Standards.
[0048] As used herein, pharmaceutically acceptable carrier includes any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial agents, antifungal agents), isotonic agents, absorption delaying agents, salts, preservatives, drugs, drug stabilizers, gels, binders, excipients, disintegration agents, lubricants, sweetening agents, flavoring agents, dyes, such like materials and combinations thereof, as would be known to one of ordinary skill in the art (see, for example, Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, pp. 1289-1329, incorporated herein by reference). Except insofar as any conventional carrier is incompatible with the active ingredient, its use in the pharmaceutical compositions is contemplated.
[0049] Nanoparticles described herein may comprise different types of carriers depending on whether it is to be administered in solid, liquid or aerosol form, and whether it need to be sterile for such routes of administration as injection. The present disclosure can be administered intravenously, intradermally, transdermally, intrathecally, intraarterially, intraperitoneally, intranasally, intravaginally, intrarectally, topically, intramuscularly, subcutaneously, mucosally, orally, topically, locally, inhalation (e.g., aerosol inhalation), injection, infusion, continuous infusion, localized perfusion bathing target cells directly, via a catheter, via a lavage, in creams, in lipid compositions (e.g., liposomes), or by other method or any combination of the forgoing as would be known to one of ordinary skill in the art (see, for example, Remington: The Science and Practice of Pharmacy, 21.sup.st Ed., Lippincott Williams and Wilkins, 2005).
[0050] A drug or active ingredient in a nanoparticle may be formulated into a composition in a free base, neutral or salt form. Pharmaceutically acceptable salts, include the acid addition salts, e.g., those formed with the free amino groups of a proteinaceous composition, or which are formed with inorganic acids such as for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric or mandelic acid. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as for example, sodium, potassium, ammonium, calcium or ferric hydroxides; or such organic bases as isopropylamine, trimethylamine, histidine or procaine. Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. The formulations are easily administered in a variety of dosage forms such as formulated for parenteral administrations such as injectable solutions, or aerosols for delivery to the lungs, or formulated for alimentary administrations such as drug release capsules and the like.
[0051] In some embodiments, the nanoparticles or a pharmaceutical composition comprising nanoparticles as described herein may be delivered by eye drops, intranasal sprays, inhalation, and/or other aerosol delivery vehicles. Methods for delivering compositions directly to the lungs via nasal aerosol sprays has been described, e.g., in U.S. Pat. Nos. 5,756,353 and 5,804,212 (each specifically incorporated herein by reference in its entirety). Likewise, the delivery of drugs using intranasal microparticle resins (Takenaga et al., 1998) and lysophosphatidyl-glycerol compounds (U.S. Pat. No. 5,725,871, specifically incorporated herein by reference in its entirety) are also well-known in the pharmaceutical arts. Likewise, transmucosal drug delivery in the form of a polytetrafluoroetheylene support matrix is described in U.S. Pat. No. 5,780,045 (specifically incorporated herein by reference in its entirety).
[0052] The term aerosol refers to a colloidal system of finely divided solid of liquid particles dispersed in a liquefied or pressurized gas propellant. The typical aerosol of the present disclosure for inhalation may contain a suspension of active ingredients in liquid propellant or a mixture of liquid propellant and a suitable solvent. Suitable propellants include hydrocarbons and hydrocarbon ethers. Suitable containers will vary according to the pressure requirements of the propellant. Administration of the aerosol will vary according to subject's age, weight and the severity and response of the symptoms.
VI. EXAMPLES
[0053] The following examples are included to demonstrate preferred embodiments of the disclosure. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the disclosure, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the disclosure.
Example 1Extracellular Matrix Coating Enhances Nanoparticle Uptake and Delays Release by Lung Epithelial Cells
[0054] Materials
[0055] Poly (lactic-co-glycolic acid) (PLGA, 50:50) was purchased from the Lakeshore Biomaterials (Birmingham, Ala.). Sodium dodecyl sulfate (SDS), dichloromethane, 6-coumarin, and polyvinyl alcohol (PVA, MW 31,000-50,000 and 87-89% hydrolyzed) were purchased from Sigma Aldrich (St. Louis, Mo.). Albumin from bovine serum (BSA) and Texas Red conjugated BSA were purchased from Life technology (Carlsbad, Calif.). Type I alveolar epithelial cells (AEC1s) were purchased from Applied Biological Materials Inc. (Richmond, BC, Canada). All other chemicals were purchased from Sigma Aldrich (St. Louis, Mo.).
[0056] Preparation of Porcine Lung ECM Solution (
[0057] The porcine lung ECM solution was obtained by deceullarization and pepsin digestion, as follows. Briefly, the lungs were harvested from adult pigs (weighing 80-100 kg) from a local slaughterhouse, cut into slices (1 mm in thickness) and rinsed using deionized (DI) water. Then the lung slices were processed by decellularization in 1% (w/v) SDS solution under stirring for 3-4 days, until the lung matrix turned white. The SDS solution was refreshed every day. The decellularized matrix was rinsed using large amount of DI water overnight to remove SDS residual, and then freeze-dried for 3 day. The dry decellularized lung matrix further was solubilized at an ECM concentration of 15 mg/mL in 1 mg/mL pepsin/0.01 M HCl solution.
[0058] After 3 days, the decellularized lung matrix was solubilized and filtered to achieve the desired final particle size and concentration. The solution was neutralized using 0.1 M NaOH and 10PBS, and diluted to desirable ECM concentrations using 1PBS for nanoparticle coating.
[0059] Fabrication of Polymeric PLGA Nanoparticles
[0060] PLGA nanoparticles (NPs) were fabricated using a modified double emulsion technique as previously described (Menon et al., 2012). Briefly, 400 L of 1% w/v Texas-Red BSA solution was added drop wise into 3 mL of 1.33% w/v PLGA solution that was dissolved in dichloromethane and then sonicated at 20 W for 1 min. This first emulsion solution was then added drop wise to 12 mL of 5% polyvinyl alcohol (PVA) solution and sonicated at 40 W for 3 min. This double emulsion solution was de-solvated overnight with stirring at room temperature. PLGA NPs were washed and collected using ultracentrifugation at 15,000 rpm for 30 minutes and lyophilization. The supernatant were collected to determine the loading efficiency of Texas-Red BSA. For cellular uptake and cell compatibility assessments, 6-coumarin loaded and unloaded PLGA NPs were fabricated using double-emulsion techniques as previously described (Sung et al., 2007).
[0061] PLGA NPs Coated with Porcine ECM by Adsorption Technique
[0062] PLGA NPs coated with porcine ECM were fabricated using modified adsorption technique (Booth et al., 2002). 10 mg NPs were suspended in 10 ml DI water and then mixed with 40 ml of porcine ECM solution at predetermined concentrations. The mixed solution was rotated on a rotator for 24 h and then the nanoparticles were collected by ultracentrifugation at 15,000 rpm for 30 min. The collected NPs were freeze-dried for further use. As a positive control, PLGA NPs coated with rat tail collagen type I was fabricated by immersing uncoated PLGA NPs in a 0.01% w/v of collagen solution in 0.1 M acetic acid.
[0063] NP Characterization
[0064] Particle size, polydispersity and zeta potential were measured using dynamic light scattering (DLS; ZetaPALS DLS detector, Brookhaven Instruments, Holtsville, N.Y.). Nanoparticle solution were prepared at 1 mg/ml concentration, and added into the transparent cuvette with the fixed amount of de-ionized water for testing. The morphology of the nanoparticles was observed under a transmission electron microscope (TEM; Hitachi H-9500 High resolution Transmission Electron Microscope). Nanoparticle solution was dropped on an oxygen plasma treated and Formvar-coated 200-mesh copper grid (Electron Microscopy Sciences, Hartfield, Pa.). The water was removed using a filter paper and then 10 L of 0.5% of vinyl acetate solution was dropped on the grid at room temperature. The sample was dried in the air overnight for imaging. In vitro stability of nanoparticles was evaluated using dynamic light scattering (DLS) in term of particle size with time. Nanoparticle solutions at 1 mg/ml were prepared using PBS or cell culture medium with 10% fetal bovine serum (FBS; Atlanta Biological, Lawerenceville, Ga.), and were added into transparent cuvette. The cuvette was incubated at 37 C. for 2 d, and then the particle size was measured every 12 h using DLS instrument. Four replicates were used for analysis.
[0065] Protein Release Kinetic Profile
[0066] The stock solution of 1 mg/ml Texas-Red BSA-loaded PLGA NPs was added into a dialysis tubing (100 kDa molecular weight cut-off, Spectrum Laboratories Inc., Rancho Dominguez, Calif.), and then placed into PBS solution with pH 7.4 at 37 C. for 28 days. At pre-determined time points, 1 mL of dialysate was collected and kept in microcentrifuge tubes at 20 C. for future analysis, and 1 mL fresh PBS solution was replenished. The measurement of fluorescent intensity of Texas-Red BSA was performed on an ultraviolet-spectrophotometer (Infinite M-200, Tecan) at 480 nm (excitation) and 615 nm (emission). A Texas-Red BSA standard curve was recorded using series of BSA solutions with known concentrations to determine the concentration of released Texas-Red BSA. Four replicates were used.
[0067] Human Blood Clotting Measurement
[0068] The protocol of human whole blood collection was approved by the Institutional Review Board (IRB) of the University of Texas at Arlington. Human whole blood was drawn into anti-coagulant tubes, which contain trisodium citrate, citric acid and dextrose. Nanoparticle solutions were prepared in 0.9% saline and then added into 1.5 mL microcentrifuge tubes. To prepare the human blood clotting solution, 0.85 mL of calcium chloride solution (0.1M) was added into 8.5 mL anti-coagulated blood, and then 50 L of blood were added into the tube containing nanoparticle solution. Blood solutions served as a control. After a pre-determined time point (10, 20, 30, and 60 minutes), 1.5 mL-distilled water were added, and incubated at room temperature for 5 min to terminate the reaction. Then, 200 L of the lysate were collected from each samples and added into 96-well plates. To determine the clotting cascade, the lysate were measured the absorbance at 540 nm using an ultraviolet-spectrometer (Infinite M-200, Tecan) (Lin et al., 2004). Eight replicates were used for analysis.
[0069] Hemolysis Assessment
[0070] Nanoparticle solutions at various concentrations were prepared in 0.9% saline. To prepare a negative control and a positive control, 200 L of anti-coagulated blood were diluted in 10 ml 0.9% saline solution and 10 mL DI water, respectively. 10 L of nanoparticle solution was added into a microcentrifuge tube and then 200 L of blood solution were added. Samples were placed in an orbital shaker and incubated at 37 C. for 2 h. The samples were then centrifuged at 1000 g for 10 min to obtain the supernatant. The supernatant was transferred into a 96-well plate and the absorbance at 545 nm was recorded under an ultraviolet-spectrometer (Liu et al., 2009). Eight replicates were used for analysis.
[0071] NP Cytocompatibility
[0072] Human alveolar type I epithelial cells (AEC1s) were pre-seeded in collagen I cellware 96 well-plates (Corning, N.Y.) at a 5000 cells per well and incubated at 37 C. and 5% CO.sub.2 for 24 h in Prigrow III medium with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin. The medium was then replaced with nanoparticle suspensions in medium at various concentrations (n=4). After 24 h incubation, the medium was removed and the samples were washed using PBS. The samples were treated with 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) reagent (CellTiter 96AQueous One Solution Cell Proliferation Assay, Promega, Madison, Wis.) and incubated for 4 h following the manufacturer's instructions. Absorbance was detected using an ultraviolet-spectrometer (Infinite M200, Tecan) at 490 nm to determine cell viability.
[0073] Cellular Uptake
[0074] The 6-coumarin loaded-nanoparticle suspensions in medium were added into a AEC1s pre-seeded plate (5000 cells per well). After 2 h incubation, the medium was removed and the samples were washed using PBS solution. The cells were lysed with 250 L of 1% Triton X-100 for 30 min at 37 C. Fluorescence intensity was then measured using a spectrophotometer to determine the 6-coumarin loaded nanoparticles taken up by the cells. These measurements were analyzed against an NP standard. The cell lysate sample is quantified for the total cell protein associated with the cell number using Pierce BCA protein assay for normalization with the particle uptake (Fisher Scientific, Hampton, N.H.) following manufacture's protocol. Confocal microscope was used to observe nanoparticle uptake inside the cells.
[0075] Inhalational Delivery and Examination of Lung Tissue in a Rat Model
[0076] The Institutional Animal Care and Use Committee of the University of Texas Southwestern Medical Center approved all procedures. Adult Sprague-Dawley rats (300-400 grams body weight) were anesthetized with an intraperitoneal injection of ketamine (50 mg/kg) and xylazine (5 mg/kg) and suspended by their front teeth on an angled fiberglass stand. The tongue was lifted with forceps and the trachea visualized using an otoscope. A 14 gauge cannula was inserted into the trachea using a guide wire. Nanoparticles were synthesized as described above, loaded with plasmid DNA vector encoding hEPOR and co-expressing GFP. Each nanoparticle preparation (1 mg) was suspended in 0.3 ml of sterile saline, sonicated (Model 300VT ultrasonic homogenizer, Biologics Inc., Manassas, Va.), aerosolized using a pediatric mesh nebulizer (Aeroneb, 4-6 m droplets) and delivered over 3 min into the lungs via a tracheal cannula. Control rats received PLGA nanoparticles loaded with plasmid vector in the same manner. Following intubation the rats were observed to ensure complete recovery from anesthesia. At 4, 8, 14, 21, and 28 days post-treatment, rats were scarified by an overdose of Euthasol (pentobarbital 86 mg/kg and phenytoin 11 mg/kg by intraperitoneal injection). The lungs were inflated in situ via tracheal instillation of 4% paraformaldehyde at 25 cmH.sub.2O of airway pressure and removed intact. The fixed lobes were serially sliced at 3 mm intervals and the slice faces imaged by a biofluorescence imager (IVIS Spectrum, Caliper Life Sciences, Waltham, Mass.). Tissue blocks were embedded in paraffin, and histological sections (4 m thickness) were examined under a fluorescent microscope (Axioscope, Carl Zeiss Microscopy, LLC, Thornwood, N.Y.).
[0077] Statistical Analysis
[0078] All data are meanstandard deviation (SD). Statistical analysis was performed with Statview software using one-way ANOVA with post hoc Fisher's Protected Least Significant Difference test. P<0.05 was considered as significant difference.
[0079] Decellularized Lung ECM and its Characterization
[0080] Fresh lungs were isolated from adult pigs and processed into an ECM solution through decellularization and enzymatic digestion using sodium dodecyl sulfate (SDS) (
TABLE-US-00001 TABLE 1 Mass spectrometry analysis of decellularized lung ECM Accession Protein Full name No. score Collagen alpha-5(IV) XP_004022477 144 Collagen alpha-5(IV) XP_004022478 144 NADH dehydrogenase BAK19372 190 Nuclear factor NF-kappa-B XP_004009716 174 Chromodomain-helicase-DNA-binding XP_003757294 155 protein ATP-binding cassette sub-family G XP_001917470 144 member 4-like Multiple epidermal growth factor-like XP_002924008 143 domains protein NFKB1 protein AAI53233 106 Copper-transporting ATPase XP_596258 115 Cytochrome c oxidase subunit I YP_004935412 165 Neutralized-like protein 4 XP_002718856 136 Sodium/glucose cotransporter 4 ELK06136 97 Acetylcholine receptor ELK17105 135 Retrotransposon gag domain-containing XP_004000841 146 protein 1 Type III secretion translocator protein YP_004651318 156 Glutamate synthase WP_011645127 144 Fatty acid synthase YP_00686574 170 Carbohydrate binding family protein YP_004319456 143 PE-PGRS family protein YP_001850993 141 GA27210, isoform A XP_002137435 137
[0081] Characterization of ECM-Coated PLGA Nanoparticles
[0082] The inventors coated NPs with a low concentration of ECM (100 mg/mL,
[0083] Blood Compatibility
[0084] Lung tissue has abundant vascular supply, and the NPs could penetrate the vascular wall and enter the circulation. The ECM-coated PLGA NPs show good blood compatibility similar to that of uncoated PLGA NPs, verified by the similar blood clot and hemolysis tests (
[0085] Cellular Compatibility
[0086] PLGA is a popular FDA-approved biodegradable polymer. Both the polymer and its degradation products are biocompatible. The inventors previously showed that PLGA NPs are biocompatible with type I alveolar epithelial cells (Menon et al., 2014). No significant difference in cell viability was seen between ECM-coated and uncoated NPs (
[0087] Protein Release
[0088] The ECM coating extended the payload release profile of bovine serum albumin (BSA). Both ECM-coated and uncoated NPs exhibited short-term burst release on day 1 followed by slower sustained release over 28 days. ECM coating reduced burst release from 30% to 20%, and markedly slowed sustained BSA release compared to uncoated NPs (
[0089] Uptake by Lung Epithelial Cells
[0090] ECM coating greatly enhanced NP uptake in human type I alveolar epithelial cells (AEC1's) by up to ten-fold compared to uncoated NPs and collagen-coated NPs (
[0091] In Vivo Evaluation
[0092] The cDNA of human erythropoietin receptor (hEPOR), tagged with green fluorescent protein (GFP), was encapsulated into PLGA NPs. The loaded NPs were nebulized and delivered into rat lung by inhalation. Once released within the cells, the transfected cells co-express hEPOR and GFP (
[0093] The inventors have developed a new approach of enhancing pulmonary cellular uptake and retention of nanoparticles for DNA delivery by inhalation to the lung. PLGA nanoparticles coated with lung-derived porcine ECM demonstrates excellent cytocompatibility and hemocompatibility with markedly enhanced particle uptake and retention by alveolar epithelial cells. Compared to uncoated nanoparticles, ECM-coated nanoparticles exhibit slower intracellular DNA release with a delayed and shorter duration of peak protein expression. These features may be useful in applications that require more precise control of the timing of delayed payload release and the in vivo effects. This methodology has potentially broad biomedical and nanotechnology applications. For example, the timing to peak drug release following administration could be customized by adjusting the ECM concentration used in coating nanoparticles.
Example 2Klotho Deficiency in Acute Kidney Injury Contributes to Lung Injury
[0094] Animal Models
[0095] The ischemia reperfusion injury (IRI) model was conducted as previously described (Hu et al., 2010). Briefly, male Sprague-Dawley rats (250-350 g) were housed in a 12-hour light/dark cycle with free access to rodent chow and water. All animal work was conducted following the Guide for the Care and Use of Laboratory Animals by The National Institutes of Health. The Institutional Animal Care and Use Committee at UT Southwestern approved all study protocols. Under anesthesia, renal arteries were clamped with arterial clips (30 minutes) and occlusion was visually verified as blanching of the entire kidney surface. After clips were removed, the kidneys were observed for at least 5 minutes to ensure reperfusion. Sham animals underwent laparotomy of the same duration with manual manipulation of the kidneys but without arterial clamping. At predetermined times after reperfusion, blood was drawn and the kidneys harvested, instantly snap-frozen in liquid nitrogen, and stored at 80 C. for further processing. Plasma and urine chemistry of animals were analyzed using a Vitros Chemistry Analyzer (Ortho-Clinical Diagnosis, Rochester, N.Y.).
[0096] Administration of Klotho-containing conditioned media was performed as previously described (Ravikumar et al., 2014). The animals received intraperitoneal injections of either control (100 l) or Klotho-containing conditioned medium CM (100 l, 60-100 pM, n=8) 6 hours after induction of IRI. Three days after IRI, rats were euthanized by intraperitoneal injection of Euthasol. The left lung was perfused and snap-frozen in liquid nitrogen for the assays described below. The right lung was fixed by intra-tracheal instillation of 4% paraformaldehyde at a constant airway pressure (25 cmH.sub.2O). Tissue blocks from the right caudal lobe were sampled, embedded in paraffin, sectioned (4 m) and stained for histological evaluation.
[0097] Edema Estimation
[0098] Lung tissue (100 mg) was weighed and transferred to a platinum ashing crucible and placed on a hot plate set at 100 C. under a heat lamp for 2 h. The dried sample-containing crucible was weighed to determine the sample dry weight. The crucible was placed overnight in the ash oven set at 600 C., removed and weighed to determine the ash weight. The ash was dissolved in 2 mL of HCl and the Na.sup.+ content measured by flame photometry.
[0099] Cell Culture
[0100] Human lung epithelial cells (A549, American Type Culture Collection, Manassas, Va.) were grown in Dulbecco's Modified Eagle Medium (DMEM)-nutrient mixture FI2 (Life Technologies, Grand Island, N.Y.) with 1% L-glutamnine. An in vitro oxidative stress model using hydrogen peroxide (H.sub.2O.sub.2) and modified from one the inventors employed for in kidney cells (Panesso et al., 2014) was used to study the cytoprotective effects of Klotho.
[0101] Biochemical Assays
[0102] Cell injuryLactate dehydrogenase (LDH) cytotoxicity detection kit (Clontech Laboratories, Mountain View, Calif.) was used to measure release of cytoplasmic LDH into the culture supernatant. LDH generates NADH from lactate, which reacts with diaphorase to generate formazan dye products (absorbance 490 nm).
[0103] Total Antioxidant Capacity
[0104] Both copper- and iron-based assays were performed. Copper reducing equivalents were measured using a calorimetric assay (OxiSelect, Cell BioLabs, San Diego, Calif.). The Trolox antioxidant assay (Sigma-Aldrich, St. Louis, Mo.) is based on formation of a ferryl myoglobin radical from metmyoglobin and hydrogen peroxide, which oxidizes ABTS (2,2-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) to ABTS, a soluble chromogen. Trolox, a water-soluble vitamin E analog, serves as a standard control antioxidant.
[0105] Antioxidant Reporter
[0106] A dual-luciferase assay (Cignal, SA Biosciences, Valencia, Calif.) was used to measure the activity of Nrf-1 and -2 (nuclear factor E2-related factor) transcription factor activation of tandem antioxidant response elements (ARE's) regulating genes that protect cells from oxidative damage. The ARE reporter contains inducible antioxidant responsive firefly luciferase construct and constitutively expressed Renilla luciferase construct. Upon transfection with the ARE reporter, the activities of the firefly and Renilla luciferases quantify transcriptional activities of the antioxidant response pathway.
[0107] Oxidative Damage
[0108] 8-hydroxydeoxyguanosine (8-OHdG) was used as a marker of oxidative DNA injury. DNA was extracted using DNAzol (Life Technologies, Grand Island, N.Y.), precipitated in 100% ethanol, washed with 70% ethanol, suspended in 8 mM NaOH, and the 8-OHdG concentration determined by ELISA (OxiSelect Cell BioLabs, San Diego, Calif.) compared against a 8-OHdG standard curve. Protein Carbonyl was measured by ELISA (OxiSelect Cell BioLabs, Inc. San Diego, Calif.) was used to measure protein oxidation against a known reduced/oxidized BSA standard curve. 8-isoprostane was measured by EIA (Cayman Chemical, Ann Arbor, Mich.) as a marker for lipid oxidation, based on the competitive binding between 8-isoprostane and 8-isoprostane-acetylcholinesterase (AChE) conjugate (8-Isoprostane Tracer) for limited specific binding sites.
[0109] Conditioned Medium and Recombinant Klotho
[0110] Two types of Klotho preparations were used. Conditioned media containing Klotho were prepared as previously described (Ravikumar et al., 2014). Briefly, Chinese hamster ovary (CHO) cells were stably transfected with soluble Klotho or vector. Serum-free media was added 16 hrs post-transfection and after another 16 hrs, media was collected and stored at 80 C. The conditioned medium contained recombinant soluble Klotho along with other secreted proteins from the CHO cells. The control media was obtained from CHO cells transfected with only the expression plasmid.
[0111] The inventors also used purified recombinant Klotho. Human or murine soluble Klotho was cloned into pEF1/Myc-His/A vector (Invitrogen) and transfected into suspension Free Style 293-F cells (Invitrogen). To establish single stable cell line that expressed recombinant protein, cells were selected in 500 g/ml G418 (Gibco). Single clones of stable Klotho-expressing cells were cultured in serum-free medium (SFM) (Invitrogen) with 100 g/ml G418 and 10% Pluronic F-68. The condition media were collected at suspension cell density 30010.sup.4 and centrifuged at 15,000g for 30 mins at 4 C. to remove cell debris. The supernatant was mixed with Ni-NTA resin (Thermo) that was pre-equilibrated with 20 mM phosphate, pH 7.4, 300 mM NaCl. After incubation at 1 hour at room temperature, the Ni-NTA resin was packed into the Econo-column and washed with the above buffer (35 column volume). Bound Klotho was eluted by 50-250 mM imidazole. The highest concentration Klotho protein was eluted at second fraction by 50 mM imidazole. The protein quality was checked by SDS-PAGE and Coomassie blue staining with a BSA standard.
[0112] Quantitatitative PCR of Potential Nrf-1 and -2 Anti-Oxidant Targets
[0113] Total RNA was extracted with RNeasy Mini kit (Qiagen, Germantown, Md.) from A549 cells according to the manufacturer's protocol. Complementary DNA (cDNA) was generated with oligo-dT primers (SuperScript III First Strand Synthesis System, Invitrogen). Primers used for detection of variety of genesare shown in Table 2. Briefly, PCR was performed in an ABI Prism 7000 Sequence Detector (Applied BioSystems, Foster City, Calif.), with one cycle (95 C.10 min) and then 40 cycles (95 C.15 s and 60 C.1 min) in triplicate for each sample. PCR products were verified by gel electrophoresis. The cycle threshold (Ct) values of the target gene transcript levels were analyzed and normalized to Ct of actin. The relative abundance of target gene transcript was represented by the 2.sup.ct versus control group.
TABLE-US-00002 TABLE2 PrimerpairsusedinPCR-basedsequencing Primersequences(5-3) Transcript Forward Reverse HMOX1 Hemeoxygenase1 tctcttggctggcttcctta(SEQIDNO:1) attgcctggatgtgcttttc(SEQIDNO:2) HMOX2 Hemeoxygenase2 gaaggaagggaccaaggaag(SEQIDNO:3) gtggccagcttaaacagctc(SEQIDNO:4) SOD1 Superoxide ggcaaaggtggaaatgaaga(SEQIDNO:5) gggcctcagactacatccaa(SEQIDNO:6) dismutase GSS Gluthathione gcctcctacatcctcatgga(SEQIDNO:7) aaagatgcccagctctgaaa(SEQIDNO:8) synthase MT1A Methalothionine1A gcaaatgcaaagagtgcaaa(SEQIDNO:9) cagctgcacttctctgatgc(SEQIDNO:10) MT2A Methalothionine1A caacctgtcccgactctagc(SEQIDNO:11) aggagcagcagcttttcttg(SEQIDNO:12) TXNRD1 Thioredoxin agagaggaaggcaggtgtca(SEQIDNO:13) ctggacttcctgcttcttgg(SEQIDNO:14) reductase GRX Glutaredoxin aacggtgcctcgagtcttta(SEQIDNO:15) caattgggtcctgtgacctt(SEQIDNO:16) HYOU1 Hypoxia gccattgtcaaacctggagt(SEQIDNO:17) aacgtagcgtagcctttgga(SEQIDNO:18) up-regulated1 NQO1 NAD(P)H gcttcaaatggcagaaaagc(SEQIDNO:19) agaacccatcgaccatcaag(SEQIDNO:20) dehydrogenase, quinone1 PRDX1 Peroxiredoxin1 tggggtcttaaaggctgatg(SEQIDNO:21) tccccatgtttgtcagtgaa(SEQIDNO:22) PRDX2 Peroxiredoxin2 gtgtccttcgccagatcact(SEQIDNO:23) acgttgggcttaatcgtgtc(SEQIDNO:24) PRDX3 Peroxiredoxin3 gccgttgtcaatggagagtt(SEQIDNO:25) tccactgagactgcgacaac(SEQIDNO:26) PRDX5 Peroxiredoxin5 acggtgcagtgaaggagagt(SEQIDNO:27) aacagctctgccaggttcac(SEQIDNO:28) PRDX6 Peroxiredoxin6 ggatggggatagtgtgatgg(SEQIDNO:29) ctgacatcctctggctcaca(SEQIDNO:30) TXNDC12 Thioredoxindomain cacagagcacttgcggttta(SEQIDNO:31) gcaggctctggctcaaatac(SEQIDNO:32) containing12 TXNDC17 Thioredoxindomain agaggggctgaagcacatta(SEQIDNO:33) caggttggcctgaagacact(SEQIDNO:34) containing17 TXNDC5 Thioredoxindomain tgtggctcctgagttgagtg(SEQIDNO:35) tcaatctgctccatgctacg(SEQIDNO:36) containing5 PXDN Peroxidasin ttgcgactggactcaaacac(SEQIDNO:37) ggcctttcacagttcagctc(SEQIDNO:38)
[0114] Results
[0115] ALI in AKI
[0116] The inventors used an established model of ischemia-reperfusion injury (IRI) (Hu et al., 2010) and confirmed a markedly reduced circulating Klotho level in the animals with AKI (
[0117] Total Antioxidant Capacity:
[0118] Role of Klotho
[0119] The inventors previously found severe acute systemic Klotho deficiency in this AKI model (Hu et al., 2010). The reperfusion phase post renal ischemia is a highly oxidative state (Gao et al., 2014; Kasuno et al., 2014). The inventors have shown Klotho protects against acute hyperoxic stress in the lung (Ravikumar et al., 2014). The above observations in concert highly suggest that the acute Klotho deficiency in AKI contributes to ALI. To take the status of these findings from correlation to causality, the inventors replenished the Klotho deficiency in AKI with exogenous Klotho and queried whether the lung involvement is alleviated.
[0120] Klotho repletion beyond 4 hours post-IRI does not affect the peak plasma creatinine or creatinine clearance but Klotho replacement when given early will alleviated AKI [25]. By administering Klotho 6 hrs after AKI, we did not change the course of AKI (
[0121] Klotho administration reduced the histologic changes, edema, (
[0122] Direct Effect on Pulmonary Epithelia
[0123] The animal experiments above are important proof-of-principle studies showing that Klotho deficiency exacerbates pulmonary injury and put forward promising therapeutic potentials in the horizon. However, the complexities of the intact organism preclude the ability to conclude that Klotho has a direct action on pulmonary epithelia and renders the dissection of cytoprotective mechanism rather difficult. To this end, the inventors used cultured pulmonary epithelial cells, simulated the post-AKI oxidative milieu with hydrogen peroxide (H.sub.2O.sub.2), and examined if Klotho can ameliorate oxidative damage (see below).
[0124] One may question the relevance of the experiment where Klotho is directly added to lung epithelial cells. Can a 130 kD protein leave the pulmonary vasculature readily to access the alveolar cells? The inventors have shown that while Klotho cannot traverse the glomerular capillary, it crosses the peritubular capillary freely to be taken up by the tubule in surprisingly short time (Hu et al., 2015). The inventors tested if this can be achieved in the pulmonary capillaries. Exogenously injected FLAG-tagged Klotho is present inside the capillaries but also clearly detectable in the lung in the interstitial space outside the capillaries in 30 mins after injection (
[0125] Cytoprotection Via Anti-Oxidation
[0126] The inventors dosed H.sub.2O.sub.2 to establish the conditions of moderate oxidative stress and cell damage (
[0127] The inventors have previously shown that heme oxygenase-1 (HOX-1) is increased by Klotho-containing conditioned media in the lung (Ravikumar et al., 2014), and HOX-1 is a downstream effect of the nrf-2 pathway. They next performed a dose-response of purified Klotho on a nrf-2 promoter reporter and showed that purified Klotho activates Nrf-2.
Example 3Solubilized Lung-Derived Extracellular Matrix Mitigates Hyperoxic Lung Injury
[0128] Decellularized extracellular matrix (ECM) contains a complex cocktail of tissue-specific bioactive components that work in concert to promote cellular homeostasis, and has been used as a scaffold for bioengineered organs or as a substrate to promote wound healing. To examine whether lung-derived ECM could mitigate acute lung injury, fresh porcine lung was decellularized and engineered into a clear solution (3 mg/ml). Sprague-Dawley rats (body weight 300 g) received the ECM solution (1.5 mg) or placebo (saline) (n=4 each) via one of two protocols: a) direct tracheal instillation followed by continuous hyperoxia (90% O.sub.2 for 3 days), or b) nebulization through a tracheal cannula followed by intermittent hyperoxia (90% O.sub.2 for 24 h alternating with normoxia [21% O.sub.2] for 24 h) for a total of 6 days. Age-matched untreated control animals were exposed to normoxia. Lung tissue was harvested for histology and assays of apoptosis (caspase-8 activity, nmole/hr/g protein) and oxidative damage to DNA (8-hydroxydeoxyguanosine, 8-OHdG, ng/ml), lipid (8-isoprostane, pg/ml) and protein (carbonyl, mmoles/mg). Results (meanSD) were compared among groups by ANOVA. P<0.05: * vs. placebo; vs. 21% O.sub.2. Results are shown below in Table 3.
TABLE-US-00003 TABLE 3 ECM Results Delivery and Exposure Instillation Nebulization Normoxia Continuous Hyperoxia Intermittent Hyperoxia Treatment None Placebo ECM Placebo ECM 8-OHdG 0.08 0.01 0.15 0.01 0.11 0.01 * 0.14 0.01 0.13 0.01 Caspase-8 8.80 0.57 16.09 0.52 13.80 0.74 * 19.75 0.55 17.33 0.53 * 8-Isoprostane 2.67 0.41 8.58 0.77 6.41 3.14 * 8.21 1.08 7.41 0.22 Carbonyl 2.30 0.12 3.61 0.07 3.36 0.07 * 3.61 0.12 3.28 0.12 *
[0129] As shown above, most oxidative damage markers were more elevated following continuous than intermittent hyperoxia. ECM treatment attenuated hyperoxia-induced damage to DNA (5 and 28%), apoptosis (12 and 14%), lipid (10 and 25%) and protein oxidation (7 and 9%) compared to placebo in the intermittent and continuous hyperoxia groups, respectively. We conclude that targeted delivery of decellularized ECM to the lung modestly alleviated acute oxidant lung damage.
Example 4Alpha-Klotho Protects Zucker Diabetic Fatty Rat Lung Against Hyperoxic Injury
[0130] Systemic delivery of Klotho protein has been observed to protect normal rat lungs from oxidant damage (Am J Physiol Lung Cell Mol Physiol. 307(7):L566-75, 2014). To determine whether targeted delivery of Klotho cDNA mitigates oxidant lung injury in the presence of elevated basal metabolic lipo-oxidative stress in the Zucker Diabetic Fatty (ZDF fa/fa) rats, the inventors delivered nebulized Klotho cDNA (25 g) or empty vector (control) to anesthetized male fa/fa and lean control (+/+) rats (350-400 g body weight) via a tracheal cannula (n=6-9 per group). Two days after inhalation, animals were exposed to hyperoxia (90% O.sub.2) in an environmental chamber for 3 d. Age-matched, untreated control animals were exposed to normoxia (21% O.sub.2). Lung tissue was analyzed for histology and assays of oxidative damage to DNA (8-hydroxydeoxyguanosine, 8-OHdG, ng/ml), lipid (8-isoprostane, pg/ml) and protein (carbonyl, mmoles/mg). Results are shown below in Table 4.
TABLE-US-00004 TABLE 4 Alpha-Klotho Results Exposure 21% O.sub.2 90% O.sub.2 Treatment None Plasmid vector Klotho cDNA Genotype +/+ fa/fa +/+ fa/fa +/+ fa/fa 8-OHdG 0.08 0.01 0.11 0.01* 0.19 0.01 0.23 0.01* 0.12 0.01 0.15 0.01*5 8-Isoprostane 2.50 0.20 3.05 0.13* 7.71 0.42 10.10 1.17* 4.08 0.45 4.90 0.49* Carbonyl 2.29 0.16 2.53 0.08* 3.59 0.07 3.85 0.07* 2.98 0.19 3.18 0.12* Results (mean SD) were compared among groups by ANOVA. P < 0.0001: *vs. fa/fa with same O.sub.2 exposure and treatment; vs. normoxia in the same genotype; vs. vector in the same genotype and O.sub.2 exposure.
[0131] Regardless of O.sub.2 exposure or treatment, DNA damage, lipid and protein oxidation markers were modestly but significantly elevated (21-37%, 20-39% and 7-11% respectively) in fa/fa animals compared to lean controls indicating heightened oxidative stress. Inhalation of Klotho cDNA significantly attenuated hyperoxia-induced oxidative damage to DNA (36%), lipid (50%) and protein (17%) and preserved alveolar morphology to a similar extent in both genotypes. The targeted upregulation of Klotho expression in the lung was observed to protect against acute oxidant lung damage in both fa/fa and +/+ animals, supporting the use of this therapeutic approach for the treatment of lung injury.
[0132] All of the methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this disclosure have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the disclosure. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the disclosure as defined by the appended claims.
REFERENCES
[0133] The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference. [0134] U.S. Pat. No. 5,725,871 [0135] U.S. Pat. No. 5,756,353 [0136] U.S. Pat. No. 5,780,045 [0137] U.S. Pat. No. 5,804,212 [0138] Ahmad et al., International journal of antimicrobial agents, 26, (4), 298-303, 2005. [0139] Ahmad et al., Reduction in burst release after coating poly(D,L-lactide-co-glycolide) (PLGA) microparticles with a drug-free PLGA layer, Pharm Dev Technol. 2012 January-February; 17(1):66-72. doi: 10.3109/10837450.2010.513989. Epub 2010 Sep. 20. [0140] Azarmi, S.; Roa, W. H.; Lobenberg, R. Advanced drug delivery reviews, 60, (8), 863-75, 2008. [0141] Bader et al., European journal of cardio-thoracic surgery: official journal of the European Association for Cardio-thoracic Surgery, 14, (3), 279-84, 1998. [0142] Badylak et al., Acta biomaterialia, 5, (1), 1-13, 2009. [0143] Badylak, S. F. Biomaterials, 28, (25), 3587-93, 2007 [0144] Barker et al., The demonstration of alphaKlotho deficiency in human chronic kidney disease with a novel synthetic antibody. Nephrol Dial Transplant, 30(2):223-233, 2015. [0145] Basu and Wheeler, Effects of ischemic acute kidney injury on lung water balance: nephrogenic pulmonary edema? Pulm Med, 414253, 2011. [0146] Benders, K. E.; van Weeren, P. R.; Badylak, S. F.; Saris, D. B.; Dhert, W. J.; Malda, J. Trends in biotechnology, 31, (3), 169-76, 2013. [0147] Blank V., Small Maf proteins in mammalian gene control: mere dimerization partners or dynamic transcriptional regulators? J Mol Biol, 376(4):913-925, 2008. [0148] Bloch et al., Klotho is a substrate for alpha-, beta- and gamma-secretase. FEBS Lett, 583(19):3221-3224, 2009. [0149] Booth et al., The Journal of heart valve disease 11, (4), 457-62, 2002. [0150] Brown and Badylak, Translational research: the journal of laboratory and clinical medicine, 163, (4), 268-85, 2014. [0151] Chase and Wheeler, Disorders of the Pediatric Chest. In: Wheeler D S, Wong H R, Shanley T P, eds. Pediatric Critical Care Medicine: Basic Science and Clinical Evidence. 1 ed. Springer-Verlag New York, LLC.: New York; 2007. [0152] Chen et al., Insulin stimulates the cleavage and release of the extracellular domain of Klotho by ADAM10 and ADAM17. Proc Natl Acad Sci USA, 104(50):19796-19801, 2007. [0153] Chertow et al., Prognostic stratification in critically ill patients with acute renal failure requiring dialysis. Arch Intern Med, 155(14): 1505-1511, 1995. [0154] Cullinan et al., Nrf2 is a direct PERK substrate and effector of PERK-dependent cell survival. Mol Cell Biol, 23(20):7198-7209, 2003. [0155] Danhier et al., Journal of Controlled Release, Volume 161, Issue 2, 20: Pages 505-522, 2012. [0156] Daum et al., [Diffusion capacity of the lung in patients with uremia]. Cas Lek Cesk, 104(47):1285-1290, 1965. [0157] Doi et al., Lung injury following acute kidney injury: kidney-lung crosstalk. Clin Exp Nephrol, 15(4):464-470, 2011. [0158] Dvorak and Feng, The vesiculo-vacuolar organelle (VVO). A new endothelial cell permeability organelle. J Histochem Cytochem, 49(4):419-432, 2001. [0159] Enayati et al., Modification of the release characteristics of estradiol encapsulated in PLGA particles via surface coating, Ther Deliv., 3(2):209-26, February 2012. [0160] Faubel S. Pulmonary complications after acute kidney injury. Adv Chronic Kidney Dis, 15(3):284-296, 2008. [0161] Faulk et al., Journal of cellular physiology, 229, (8), 984-9, 2014. [0162] Feng et al., Ultrastructural studies define soluble macromolecular, particulate, and cellular transendothelial cell pathways in venules, lymphatic vessels, and tumor-associated microvessels in man and animals. Microsc Res Tech, 57(5):289-326, 2002. [0163] Fields et al., Surface modified poly( amino ester)-containing nanoparticles for plasmid DNA delivery, J Control Release. 2012 Nov. 28; 164(1):41-8. doi: 10.1016/j.jconrel. 2012.09.020. Epub 2012 Oct. 5. [0164] Foldbjerg et al., Chemico-biological interactions, 204, (1), 28-38, 2013. [0165] Fontana et al., Amoxicillin-loaded polyethylcyanoacrylate nanoparticles: influence of PEG coating on the particle size, drug release rate and phagocytic uptake, Biomaterials., 22(21):2857-65, November 2001. [0166] Gao et al., TRPM2 mediates ischemic kidney injury and oxidant stress through RAC1, Journal of Clinical Investigation, 124(11), 4989-5001, 2014. [0167] Hadinoto et al., International journal of pharmaceutics, 333, (1-2), 187-98, 2007. [0168] Hassoun et al., Kidney ischemia-reperfusion injury induces caspase-dependent pulmonary apoptosis. Am J Physiol Renal Physiol, 297(1):F125-137, 2009. [0169] Horiguchi et al., Journal of controlled release: official journal of the Controlled Release Society, 187, 167-74, 2014. [0170] Hsieh and Papaconstantinou, The effect of aging on p38 signaling pathway activity in the mouse liver and in response to ROS generated by 3-nitropropionic acid. Mech Ageing Dev, 123(11):1423-1435, 2002. [0171] Hu and Moe, Klotho as a potential biomarker and therapy for acute kidney injury. Nat Rev Nephrol, 8(7):423-429, 2012. [0172] Hu et al., Klotho deficiency is an early biomarker of renal ischemia-reperfusion injury and its replacement is protective. Kidney Int, 78(12):1240-1251, 2010. [0173] Hu et al., Klotho: a novel phosphaturic substance acting as an autocrine enzyme in the renal proximal tubule. FASEB J, 24(9):3438-3450, 2010. [0174] Hu et al., Klotho deficiency causes vascular calcification in chronic kidney disease. J Am Soc Nephrol, 22(1):124-136, 2011. [0175] Hu et al., Secreted klotho and chronic kidney disease. Adv ExpMed Biol, 728:126-157, 2012. [0176] Hu et al., Fibroblast growth factor 23 and Klotho: physiology and pathophysiology of an endocrine network of mineral metabolism. Annu Rev Physiol, 75:503-533, 2013a. [0177] Hu et al., Renal and extrarenal actions of Klotho. Semin Nephrol 33(2):118-129, 2013b. [0178] Hu et al., The erythropoietin receptor is a downstream effector of Klotho-induced cytoprotection. Kidney Int, 84(3):468-481, 2013c. [0179] Hu et al., Renal production, uptake, and handling of circulating alpha-Klotho. J Am Soc Nephrol. In Press, May 14, 2015. [0180] Ikushima et al., Anti-apoptotic and anti-senescence effects of Klotho on vascular endothelial cells. Biochem Biophys Res Commun, 339(3):827-832, 2006. [0181] Imura et al., Secreted Klotho protein in sera and CSF: implication for post-translational cleavage in release of Klotho protein from cell membrane. FEBS Lett, 565(1-3):143-147, 2004. [0182] Ingenito et al., Journal of tissue engineering and regenerative medicine, 4, (4), 259-72, 2010. [0183] Itoh et al., An Nrf2/small Maf heterodimer mediates the induction of phase II detoxifying enzyme genes through antioxidant response elements. Biochem Biophys Res Commun, 236(2):313-322, 1997. [0184] Jones et al., International journal of pharmaceutics, 236, (1-2), 65-79, 2002. [0185] Jones et al., The Journal of pharmacy and pharmacology, 54, (8), 1065-72, 2002. [0186] Karacan et al., Pulmonary function in uremic patients on long-term hemodialysis. Ren Fail, 26(3):273-278, 2004. [0187] Kasuno et al., Renal redoxd ysregulation in AKI:application for oxidative stress marker of AKI, American Journal of Physiology. Renal Physiology, 307(12), F1342-F1351, 2014. [0188] Kelleher and Vacanti, Journal of the Royal Society, Interface/the Royal Society, 7 Suppl 6, S717-29, 2010. [0189] Kelly K J. Distant effects of experimental renal ischemia/reperfusion injury. J Am Soc Nephrol, 14(6):1549-1558, 2003. [0190] Klein et al., Interleukin-6 mediates lung injury following ischemic acute kidney injury or bilateral nephrectomy. Kidney Int, 74(7):901-909, 2008. [0191] Kramer et al., Renal ischemia/reperfusion leads to macrophage-mediated increase in pulmonary vascular permeability. Kidney Int, 55(6):2362-2367, 1999. [0192] Ku et al., Journal of nanoscience and nanotechnology, 8, (6), 2971-8, 2008. [0193] Kumar et al., Cell transplantation, 20, (5), 609-18, 2011. [0194] Kuro-o et al., Mutation of the mouse klotho gene leads to a syndrome resembling ageing. Nature, 390(6655):45-51, 1997. [0195] Kuro-o M., Klotho as a regulator of oxidative stress and senescence. Biol Chem, 389(3):233-241, 2008. [0196] Kurosu et al., Suppression of aging in mice by the hormone Klotho. Science, 309(5742):1829-1833, 2005. [0197] Levy et al., The effect of acute renal failure on mortality. A cohort analysis. JAMA, 275(19):1489-1494, 1996. [0198] Levy, L A, Severe hypophosphatemia as a complication of the treatment of hypothermia. Arch Intern Med, 140(1):128-129, 1980. [0199] Lin et al., Tissue engineering 10, (7-8), 1046-53, 2004. [0200] Lin et al., Tissue engineering. Part A, 16, (5), 1515-26, 2010. [0201] Lindberg et al., The kidney is the principal organ mediating klotho effects. J Am Soc Nephrol, 25(10):2169-2175, 2014. [0202] Liu et al., Biomaterials 30, (23-24), 3865-73, 2009. [0203] Matsumura et al., Identification of the human klotho gene and its two transcripts encoding membrane and secreted klotho protein. Biochem Biophys Res Commun, 242(3):626-630, 1998. [0204] Medberry et al., Biomaterials., 34(4):1033-40, 2013. [0205] Menon et al., Journal of biomedical materials research. Part A, 100, (8), 1998-2005, 2012. [0206] Menon et al., Polymeric nanoparticles for pulmonary protein and DNA delivery. Acta Biomaterialia, 10:2643-2652, PMCID: PMC4008694, 2014. [0207] Motohashi et al., Integration and diversity of the regulatory network composed of Maf and CNC families of transcription factors. Gene, 294(1-2): 1-12, 2002. [0208] Murray and Lopez, Lancet, 349, (9064), 1498-504, 1997. [0209] Nath and Norby, Reactive oxygen species and acute renal failure. Am J Med, 109(8):665-678, 2000. [0210] Osburn et al., Increased colonic inflammatory injury and formation of aberrant crypt foci in Nrf2-deficient mice upon dextran sulfate treatment. Int J Cancer, 121(9): 1883-1891, 2007. [0211] Paladino et al., Acute kidney injury and lung dysfunction: a paradigm for remote organ effects of kidney disease? Microvasc Res, 77(1):8-12, 2009. [0212] Pandey et al., The Journal of antimicrobial chemotherapy, 52, (6), 981-6, 2003. [0213] Panesso et al., Klotho has dual protective effects on cisplatin-induced acute kidney injury. Kidney Int, 85(4):855-870, 2014. [0214] Rabb et al., Acute renal failure leads to dysregulation of lung salt and water channels. Kidney Int, 63(2):600-606, 2003. [0215] Rabe et al., Global Initiative for Chronic Obstructive Lung, D. American journal of respiratory and critical care medicine, 176, (6), 532-55, 2007. [0216] Rakugi et al., Anti-oxidative effect of Klotho on endothelial cells through cAMP activation. Endocrine, 31(1):82-87, 2007. [0217] Ravikumar et al., Alpha-klotho protects against oxidative damage in pulmonary epithelia. p. In revision, 2013. [0218] Ravikumar et al., alpha-Klotho protects against oxidative damage in pulmonary epithelia. Am J Physiol Lung Cell Mol Physiol, 307(7):L566-575, 2014. [0219] Ravikumar P, J F Ye, M Shi, L Li, M Taniguchi, J Zhang, M Kuro-o, MC Hu, O W Moe, CCW Hsia. Alpha-Klotho deficiency in acute kidney injury contributes to lung damage. J Appl Physiol (1985) 120:72-732, 2016a. [0220] Ravikumar et al., Nanoparticle facilitated inhalational delivery of erythropoietin receptor cDNA protects against hyperoxic lung injury, Nanomedicine 12(3):811-21, 2016b. [0221] Rees et al. The importance of particle size in responses to inhaled bronchodilators. Eur J Respir Dis, 63(Suppl): 73-78, 1982. [0222] Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, pp. 1289-1329, 1990. [0223] Remington: The Science and Practice of Pharmacy, 21.sup.st Ed., Lippincott Williams and Wilkins, 2005. [0224] Rubenfeld et al., Incidence and outcomes of acute lung injury. New Engl J Med., 353:1685-93, 2005. [0225] Sawkins et al., Acta Biomater., 9(8):7865-73, 2013. [0226] Seeley, E J, Updates in the management of acute lung injury: a focus on the overlap between AKI and ARDS. Adv Chronic Kidney Dis, 20(1):14-20, 2013. [0227] Seif-Naraghi et al., Sci Transl Med., 5(173):173ra25, 2013. [0228] Sharma et al., The Journal of antimicrobial chemotherapy, 54, (4), 761-6, 2004. [0229] Sokocevic et al. Biomaterials., 34:3256-69, 2013. [0230] Suga et al., Disruption of the klotho gene causes pulmonary emphysema in mice. Defect in maintenance of pulmonary integrity during postnatal life. Am J Respir Cell Mol Biol, 22(1):26-33, 2000. [0231] Sung et al., Trends in biotechnology 25, (12), 563-70, 2007. [0232] Syedain et al., Tissue engineering. Part A, 19, (5-6), 759-69, 2013. [0233] Tahara et al., International journal of pharmaceutics, 382, (1-2), 198-204, 2009. [0234] Takenaga et al., 1998. [0235] Tanito et al., Upregulation of thioredoxin system via Nrf2-antioxidant responsive element pathway in adaptive-retinal neuroprotection in vivo and in vitro. Free Radic Biol Med, 42(12):1838-1850, 2007. [0236] Thimmulappa et al., Nrf2-dependent protection from LPS induced inflammatory response and mortality by CDDO-Imidazolide. Biochem Biophys Res Commun, 351(4):883-889, 2006. [0237] Tsushima et al., Internal medicine, 48, (9), 621-30, 2009. [0238] Volpato et al., Biomaterials, 34, (21), 4945-55, 2013. [0239] Wolf et al., Biomaterials, 33(29):7028-38, 2012. [0240] Wu J et al. Acta Biomater., 16:49-59, 2015. [0241] Yamamoto et al., Journal of controlled release: official journal of the Controlled Release Society, 102, (2), 373-81, 2005. [0242] Yamamoto et al., Regulation of oxidative stress by the anti-aging hormone klotho. J Biol Chem, 280(45):38029-38034, 2005. [0243] Yap and Lee, Acute kidney injury and extrarenal organ dysfunction: new concepts and experimental evidence. Anesthesiology, 116(5):1139-1148, 2012. [0244] Zeldich et al., The neuroprotective effect of Klotho is mediated via regulation of members of the redox system. J Biol Chem, 289(35):24700-24715, 2014. [0245] Zanen et al. The optimal particle size for beta-2-adrenergic aerosols in mild asthmatics. Int J Pharm, 107:211-217, 1994. [0246] Zanen et al. Optimal particle size for b2-agonist and anticholinergic aerosols in patients with severe airflow obstruction. Thorax, 51: 977980, 1996.