Three-Dimensional Co-Culture Method for Adipocytes and Macrophages

20180208898 ยท 2018-07-26

    Inventors

    Cpc classification

    International classification

    Abstract

    Provided herein is a three-dimensional co-culture of adipocytes and macrophages, wherein, in a hydrogel scaffold containing adipocytes and macrophages, the adipocytes and the macrophages are co-cultured to form a fat-like tissue, which can be then utilized in the studies and medicine development for treating metastatic diseases associated with adipose tissue.

    Claims

    1. A co-culture method of adipocytes and macrophages, comprising: (a) preparing a mixture including preadipocytes, macrophages and hydrogels; (b) manufacturing hydrogel scaffolds including preadipocytes and macrophages from the mixture using a three-dimensional cell-printing system; and (c) treating the hydrogel scaffolds with a culture fluid so that the preadipocytes and the macrophages included in the hydrogel scaffolds are proliferated and differentiated to form like adipose tissue.

    2. The co-culture method of claim 1, wherein the macrophages in (a) are included at 1.0 to 2.0% (w/v) relative to the preadipocytes.

    3. The co-culture method of claim 1, wherein the hydrogels are alginate hydrogels containing alginates, collagen and gelatin.

    4. The co-culture method of claim 3, wherein the content of the alginate is 2.0 to 4.0% (w/v) relative to the mixture in (a).

    5. An analysis method of metabolic disease related to adipose tissue, comprising: (a) preparing a mixture including preadipocytes, macrophages and hydrogels; (b) manufacturing hydrogel scaffolds including preadipocytes and macrophages from the mixture using a three-dimensional cell-printing system; (c) treating the hydrogel scaffolds with a culture fluid so that the preadipocytes and the macrophages included in the hydrogel scaffolds are proliferated and differentiated to compose like adipose tissue; and (d) determining one or more of gene expression and protein activity in adipocytes.

    6. The analysis method of claim 5, wherein the metabolic disease is type 2 diabetes.

    Description

    DESCRIPTION OF DRAWINGS

    [0013] FIG. 1 represents hydrogel scaffolds manufactured by a three-dimensional cell-printing system.

    [0014] FIG. 2 represents proliferation and cell survival of 3T3-L1 preadipocytes in hydrogel scaffolds, in which (A) shows an fluorescent image where green fluorescence represents living cells, and red fluorescence represents dead cells; (B) is a graph representing a proliferation degree of cells, when forming a structure by mixing 3T3-L1 preadipocytes having a concentration of 1?10.sup.5 cells/ml with alginates having different concentrations from each other; (C) is a fluorescent image representing a proliferation degree of cells, when forming a structure by mixing 3T3-L1 preadipocytes having a concentration of 1?10.sup.5 cells/ml with alginates having different concentrations from each other; (D) is a graph representing cell proliferation, when forming a structure with the different number of 3T3-L1 preadipocytes in 3% (w/v) alginate scaffolds; and (E) is a graph representing 3T3-L1 preadipocyte proliferation depending on a scaffold height, and the results are expressed as average ?standard error (S.E.M) according to repetitive experiments (#P<0.05, ##P<0.01, ###P<0.001, compared to the first day).

    [0015] In FIG. 3, (A) and (B) represent 3T3-L1 preadipogenesis in hydrogels as fluorescent images using BODIPY (boron-dipyrromethene), which compare 3T3-L1 adipocytes differentiated from the hydrogels having a 3% alginate concentration; (C) compares difference in G6PD enzyme activity between 3T3-L1 preadipocytes and 3T3-L1 adipocytes; (D) represents change in representative genes related to adipogenesis and insulin resistance; and (E) represents difference in expression of representative protein related to adipogenesis and insulin resistance, and the results are expressed as average ?standard error (S.E.M) according to repetitive experiments (#P<0.05, ##P<0.01, ###P<0.001, compared to preadipocyte group).

    [0016] In FIG. 4, (A) represents comparison of macrophage cell proliferation in hydrogel scaffolds having a 3% (w/v) alginate concentration with preadipocytes; (B) is a fluorescent image representing a macrophage survival degree in hydrogel scaffolds having a 3% (w/v) alginate concentration; (C) compares difference in expression of representative protein related to adipogenesis and insulin resistance in co-culture mixed with macrophages having a 10% (w/v) concentration of the number of preadipocytes; (D)-(F) compare difference in an adipogenesis degree, and expression of representative protein related to adipogenesis and insulin resistance in co-culture, when the macrophage concentration was different; and (G)-(I) show fluorescent images for the difference in expression of protein related to adipogenesis and insulin resistance, and an adipogenesis degree, when further subdividing the macrophage concentration.

    [0017] In FIG. 5, (A) represents change in expression of protein related to adipogenesis and insulin resistance in three-dimensional cell co-culture scaffolds; and (B) shows change in insulin resistance in three-dimensional cell co-culture scaffolds through a glucose uptake test.

    BEST MODE

    [0018] Hereinafter, the present invention will be described in detail. Any known contents which may obscure the subject matter may be omitted from the description and the drawings of the present invention. The terms which are not defined separately for the description of the present invention should be interpreted as having the meaning which may be commonly understood by a person with ordinary skill in the art to which the present invention pertains.

    [0019] The present invention relates to a three-dimensional co-culture method of adipocytes and macrophages, and a technique therefor.

    [0020] In the present invention, the co-culture method of adipocytes and macrophages is a three-dimensional co-culture method using adipocytes and macrophages including: preparing a mixture including uniformly mixed preadipocytes, macrophages and hydrogels; manufacturing hydrogel scaffolds including the preadipocytes and the macrophages from the mixture, using a three-dimensional cell-printing system; and treating a culture fluid to proliferate and differentiate the preadipocytes into adipocytes, so that the preadipocytes and the macrophages included in the hydrogel scaffold function similarly to the adipose tissue.

    [0021] In the co-culture method of the present invention, the preadipocytes, the macrophages, and the concentration or cell density of the macrophages included in the hydrogel mixture may be adjusted for survival, differentiation and proliferation of adipocytes, and forming an adipose tissue-like structure. When the macrophages are present in a trace amount or not present, they hardly have the function of adipose tissue, and as the concentration of the macrophages is increased, a differentiation rate of adipocytes is decreased, thereby causing a decrease in expression of a specific gene which is expressed in adipocytes and may form like adipose tissue, a decrease of protein activity, and the like.

    [0022] In the mixture of preadipocytes, macrophages and hydrogels for forming hydrogel scaffolds in the present invention, the content of the preadipocytes is 1?10.sup.5 cells/ml or more, preferably 1?10.sup.5 cells/ml to 1?10.sup.7 cells/ml, more preferably 1?10.sup.6 cells/ml to 1?10.sup.7 cells/ml. When the preadipocytes are included at less than 1?10.sup.5 cells/ml, cell proliferation and survival may not be active, or when included at more than 1?10.sup.7 cells/ml, the cells may fall off to the outside of the scaffolds.

    [0023] In the mixture of preadipocytes, macrophages and hydrogels for forming hydrogel scaffolds in the present invention, the content of the macrophages is 10% or less, 10 to 5.5%, 5.5 to 4.5%, 4.5 to 3.5%, 3.5 to 2.5%, 2.5 to 1.5%, 1.5 to 0.5%, preferably 2.0 to 1.0%, more preferably 1.2 to 0.8% (w/v), relative to the preadipocytes included in the hydrogel scaffolds. For example, when the preadipocytes are included at 1?10.sup.5 cells/ml, for the content of the macrophages of 1.0 to 2.0%, the macrophages may be included by adjusting the number to 1?10.sup.3 cells/ml to 2?10.sup.3 cells/ml or less.

    [0024] According to an exemplary embodiment of the present invention, adipogenesis is smoothly done at the content of the macrophages of 1.0 to 2.0% (w/v), relative to the preadipocytes for producing hydrogel scaffolds, and a similar function to that of actual adipose tissue appears, as in the result of increased insulin resistance.

    [0025] In the present invention, the hydrogels may allow polymer chains to form a network, using a cell culture medium, a culture fluid, or water as a solvent, in which aqueous polymers and the like may chemically form crosslinks, or be physically bonded to each other, thereby forming three-dimensional hydrogel scaffolds. The hydrogel used in the present invention is not significantly limited, and collagen, chitosan, hyaluronic acid, and gelatin may be used, and it is preferred to include alginates derived from preferably algae. In the case of using algae-based hydrogels, it is preferred that the content of alginate is appropriately adjusted to maintain the hydrogel scaffolds to be undissolved, during a preadipogenesis period and the subsequent course of further experiment, in co-culture of adipocytes and macrophages.

    [0026] In the present invention, the alginate hydrogels refer to hydrogels prepared by including alginates derived from algae. The alginates in the alginate hydrogels are an aqueous polymer electrolyte, and may form crosslinks, using a polyvalent cation salt such as calcium chloride. In the case of the algae-based hydrogels, the alginate content is more than 2.5%, 2 to 4%, 2.5 to 4%, 2.8 to 3.0%, 3 to 4%, 3.5 to 4%, preferably more than 2.5%, equal to or less than 3.0% (w/v), most preferably 3.0% (w/v), relative to a mixture of adipocytes, macrophages and alginate hydrogels for producing hydrogel scaffolds. When the alginate content is insufficient, solubility of the structure is increased, and when the alginate content is high, proliferation and survival rate of cells may be decreased.

    [0027] According to an exemplary embodiment of the present invention, when the content of alginates derived from brown algae is 2.0% (w/v), survival and proliferation of adipocytes are very active, but the form does not last relatively long in co-culture of adipocytes and macrophages in the hydrogel scaffolds, thereby causing difficulty in culture and application of study. Further, when the alginate content is 2.5% (w/v) and 3.0% (w/v), the hydrogel scaffold form was sufficiently maintained until like adipose tissue was formed, and survival and proliferation of adipocytes are also constantly maintained. In addition, when the alginate content is 3.5% (w/v) or more, persistence of a hydrogel scaffold form is excellent, but survival and proliferation of adipocytes may be decreased.

    [0028] In the present invention, the hydrogels may further include gelatin and collagen, and it is preferred that the contents of gelatin and collagen are 5.0 to 10.0% (w/v), respectively, relative to the mixture of preadipocytes, macrophages and hydrogels, but not limited thereto.

    [0029] In the present invention, preadipocytes, macrophages and hydrogels for forming hydrogel scaffolds are uniformly mixed, and then the mixture is processed through a dispenser of a machine for manufacturing hydrogel scaffolds using a three-dimensional cell-printing system.

    [0030] In the present invention, the three-dimensional cell-printing system is used for producing hydrogel scaffolds having a stereostructure. The three-dimensional cell-printing may be performed by a machine equipped with an x-y-z stage, a dispenser, a syringe nozzle, a compression controller and a computer system. In the present invention, the hydrogel scaffolds manufactured by the three-dimensional cell-printing system have a stereostructure, and allow three-dimensional cell culture, which is distinguished from two-dimensional culture such as commonly performed cell culture in a medium. The structure of hydrogel scaffolds may be appropriately formed by the components and concentration included in the mixture, design by a program, and pressure and a speed in cell-plotting. The scaffold pattern and structure of the hydrogel scaffolds for cell co-culture are not limited, but it is preferred that the scaffold pattern is in an orthogonal direction, and the scaffolds are formed by multilayer cell-plotting.

    [0031] According to an exemplary embodiment of the present invention, it is preferred that the scaffold pattern is programmed and designed to be in an orthogonal direction, and cell-plotted scaffolds having a thickness of 0.2 to 0.3 mm are formed, and laminated, thereby manufacturing hydrogel scaffolds having a thickness of around 2.0 to 3.0 mm. The thickness is 0.1 to 3.0 mm, 0.4 to 2.5 mm, 0.8 to 2.5 mm, 0.4 to 2.5 mm, 0.8 to 2.5 mm, 1.2 to 2.5 mm, 1.6 to 2.5 mm, 0.4 to 2.0 mm, 0.8 to 2.0 mm, 1.2 to 2.0 mm, preferably 0.2 to 0.3 mm, more preferably 1.6 to 2.0 mm. When the thickness is further increased, the structure of the cell-plotted scaffold layer positioned at the bottom may collapse in formation of the hydrogel scaffolds. When the structure of the hydrogel scaffolds is not maintained constant, the survival rate, and the proliferation and differentiation degrees of cells may be decreased in co-culture. The hydrogel scaffold may be manufactured to have a tetragonal shape having an area of 10 to 30 cm.sup.2, 15 to 25 cm.sup.2, preferably 20 to 25 cm.sup.2.

    [0032] In the present invention, it is preferred that the number of preadipocytes to be mixed (cell seeded) when manufacturing the hydrogel scaffolds according to cell-plotting is adjusted so that constant proliferation occurs according to the mixture or hydrogel scaffold design.

    [0033] According to an exemplary embodiment of the present invention, when the number of cells to be mixed with hydrogels is large, a proliferation rate is increased with culture time, and the number of cells to be mixed is preferably 1?10.sup.5 cells/ml or more, but not limited thereto. However, when the number of cells is less than 1?10.sup.5 cells/ml, proliferation may not be smoothly done. In the present invention, the hydrogel scaffolds are a place where similar tissue is formed by cell differentiation and proliferation, and interaction between cells in co-culture. When cell culture is done in a general medium such as a flat medium, each cell interacts with each other only in a certain part, a proliferation direction is one-sided, and even in the case that the number of cells is increased by differentiation and proliferation, cells capable of interacting with each other are limited. In addition, various metabolites secreted from cells are accumulated, and an unbalanced concentration gradient is formed. Thus, in the case of two-dimensional in vitro cell culture, interaction between cells may not be induced to be interaction like in vivo, and it is also difficult to form an in vivo-like structure.

    [0034] However, in the case of the hydrogel scaffolds according to the present invention, the adipocytes and macrophages are included in the hydrogel scaffolds having a stereostructure, and thus, each cell may interact with each other in all directions around like the cells in vivo, the proliferation direction is not one-sided, and even in the case that the number of cells is increased by differentiation and proliferation, each cell may constantly interact with each other around. In addition, various metabolites secreted in cells are not accumulated in a certain area, and may be secreted in all directions around like in vivo, thereby preventing a non-uniform concentration gradient. By these characteristics, interaction between cells like that in vivo may be induced in co-culture of adipocytes and macrophages, and accordingly, like adipose tissue having a similar function to that of in vivo adipose tissue may be formed.

    [0035] According to an exemplary embodiment of the present invention, there was a significant difference in gene expression and protein activity in the in vivo adipose tissue between the case of culturing preadipocytes and adipocytes in a general medium, and the case of co-culturing adipocytes and macrophages in hydrogel scaffolds, the like adipose tissue formed by co-culture of adipocytes and macrophages in hydrogel scaffolds represented similar gene expression and protein activity to those of increased adipose differentiation factors and increased insulin resistance in the in vivo adipose tissue in C57BL/6-DIO and C57BL/6Job/ob mice widely known as a model of obesity and diabetes.

    [0036] According to the present invention, after manufacturing hydrogel scaffolds, the cells included in the hydrogel scaffolds are proliferated and differentiated so that the cells form similar tissue by interaction between the cells. The proliferation and differentiation of the cells included in the hydrogel scaffolds occur by treating a culture fluid for proliferation or differentiation in the hydrogel scaffolds to be absorbed therein. The culture fluid absorbed by a porous stereostructure of the hydrogel scaffolds may be uniformly treated in each cell.

    [0037] The preadipocytes and the macrophages included in the hydrogel scaffolds are differentiated and proliferated by culture fluid treatment, and the adipocytes and macrophages have a similar function to that of adipose tissue by interaction between cells.

    [0038] According to the present invention, the adipocytes and the macrophages which are three-dimensionally co-cultured form an adipose tissue-like structure, and it may be recognized from difference in an expression degree of protein related to adipogenesis and insulin resistance in the structure, and a glucose uptake test, whether the like adipose tissue is formed.

    [0039] According to an exemplary embodiment of the present invention, the like adipose tissue formed according to adipocyte and macrophage co-culture in the hydrogel scaffolds has increased expression of marker protein related to adipogenesis such as FABP4, FAS, ACC and PPAR?2, and decreased expression and activity degree of marker protein related to insulin resistance such as AkT phosphorylation and GLUT4. However, when the preadipocytes or adipocytes are cultured alone, respectively in the hydrogel scaffolds, expression of both marker proteins related to adipogenesis and insulin resistance is increased.

    EXAMPLE

    [0040] Hereinafter, preferred Examples for carrying out the present invention will be described in detail. The present invention is neither limited to the following Examples, nor construed as limited by the Examples.

    Example 1

    [0041] An adipose-like structure was formed by co-culturing adipocytes and macrophages in the following manner:

    [0042] Culture and Preparation of Preadipocytes and Macrophages

    [0043] 3T3-L1 (#CL-173, ATCC) as preadipocytes and RAW264.7 (#TIB-71, ATCC) as macrophages were prepared, and the cells were cultured in an incubator for culture under a condition of 37? C. and 5% CO.sub.2, using a Dulbecco's modified Eagle's medium (Gibco) containing a 1% mixture of 10% fetal bovine serum (Invitrogen, Carsbad, Calif., USA), 100 ?g/ml of penicillin, and 100 ?g/ml of streptomycin (Invitrogen). After culturing, the cells were washed with DPBS (Dulbecco's Phosphate-Buffered Saline, Gibco), 2 ml of 0.2% trypsin-EDTA (ethylenediaminetetraacetic acid) (Invitrogen) was added thereto, and culture was performed in an incubator at 37? C. and 5% CO.sub.2 for 1 minute. Next, cell suspension was centrifuged at 1,500 rpm for 2 minutes, thereby obtaining cell pellets, which were used in the experiment.

    [0044] Preparation of Mixture Including Preadipocytes, Macrophages and Alginate Hydrogels for Manufacturing Hydrogel Scaffolds

    [0045] 500 ul of gelatin (Sigma-Aldrich), 500 ul of collagen (Sigma-Aldrich), 1?10.sup.7 preadipocytes and 1?10.sup.5 macrophages were uniformly mixed, and then the volume was adjusted finally to 9.7 ml with a Dulbecco's modified Eagle's medium. 3 mg of sodium alginate (Sigma-Aldrich) was added to the mixture and rapidly stirred, thereby preparing a mixture for manufacturing 3% alginate hydrogel scaffolds, which were transferred to a dispenser composed of 200-300 ?m sized nozzles for manufacturing three-dimensional scaffolds. For active cell-printing, centrifugation at 1000 rpm for 10 seconds was performed to prepare the manufacture of hydrogel scaffolds.

    [0046] In the same manner as in the above method of preparing the mixture, the amounts of gelatin and collagen were equalized, and the mixture including preadipocytes, macrophages and sodium alginate at different contents from each other was prepared using a Dulbecco's modified Eagle's medium. The content of alginate was adjusted to 2, 2.5, 3.0, 3.5 and 4.0%, respectively, so that the hydrogel scaffolds having different concentrations from each other were manufactured. Further, the seeding density of adipocytes was calculated by a disposable blood counting chamber (hemocytometer-based cell counter, SKC Co. Ltd., Seoul, Korea), so that hydrogel scaffolds including different adipocytes from each other may be manufactured with different number of cells of 1?10.sup.4, 5?10.sup.4, 1?10.sup.5, 4?10.sup.5, 8?10.sup.5 and 1?10.sup.6 cells/ml, respectively. The macrophages were adjusted to 1, 2, 3, 4, 5 and 10% (w/v), respectively, relative to adipocytes and the change in a macrophage concentration in co-culture of the adipocytes and the macrophages was observed.

    [0047] The hydrogel scaffolds manufactured by the dispenser were reacted with 5% aqueous calcium chloride solution which was rapidly prepared in advance. Here, the scaffolds form crosslinks by calcium chloride treatment.

    [0048] Manufacture of Hydrogel Scaffolds Using Three-Dimensional Cell-Printing System

    [0049] The manufacture of hydrogel scaffolds using a three-dimensional (3D) cell-printing system employs a machine equipped with an x-y-z stage, a dispenser, a syringe nozzle, a compression controller, and a computer system (3D Bio-Scaffold Plotting system, PROTek). The dispenser was a storage tank for holding hydrogels, and the computer system adjusted pressure, a feeding speed, a strand size, and a scaffold shape. The cell-plotting system speed, and the pressure were adjusted to 150 mm/s and 650 kPa, respectively. As constant pressure is applied to the dispenser, cell-plotted scaffolds as a three-dimensional scaffold form of a mixture of adipocytes, macrophages and hydrogels were manufactured by plotting on the x-y-z stage layer-by-layer. The manufactured scaffold pattern was designed to be in an orthogonal direction, and the cell-plotted scaffolds in a tetragonal (5?5 cm) shape were laminated to the thicknesses of 0.4, 0.8, 1.2, 1.6 and 2 mm, respectively, thereby manufacturing hydrogel scaffolds including preadipocytes and macrophages.

    [0050] For the manufactured hydrogel scaffolds, proliferation and stabilization of cells were derived in 100 ?g/ml of penicillin, 100 ?g/ml of streptomycin (Invitrogen), and a Dulbecco's modified Eagle's medium containing 10% fetal bovine serum for 1 day, and thereafter, differentiation was derived by replacing the medium with dexamethasone, isobutylmethylxanthine, and an insulin-treated Dulbecco's modified Eagle's medium containing 10% fetal bovine serum. After 2 or 3 days of differentiation derivation, the medium was replaced with an insulin-treated Dulbecco's modified Eagle's medium containing 10% fetal bovine serum, and after 2 days of insulin treatment, culture was performed for the purpose of the experiment from day 1 to day 20 in the Dulbecco's modified Eagle's medium containing 10% fetal bovine serum, and analysis for cell survival, proliferation and differentiation was performed. The culture medium was replaced once every two days at most.

    [0051] Cell Survival and Proliferation Analysis

    [0052] The cell survival in the hydrogel scaffolds was confirmed using a Live/Dead cell analysis kit (Live/Dead cell assay kit, invitrogen), and a fluorescence microscope (TE2000-U, Nikon). The hydrogel scaffolds were washed with PBS, and stained with calcein and EthD-1 (ethidium homodimer) for 15 minutes in PBS. After staining, the hydrogel scaffolds were washed twice, and green fluorescence (living cells, 495-515 nm) and red fluorescence (dead cells, 495-635 nm) were observed with the fluorescence microscope. For the cell proliferation, a cell counting kit (Cell Counting Kit-8 (CCK-8), Dojindo Laboratories) was used. The hydrogel scaffolds were treated with a 1 ml of medium containing 100 ?l of CCK-8 in a 24-well plate, and cultured at 37? C. for 4 hours, and then absorbance at 450 nm was measured with a micro-plate spectrophotometer (BIORAD Inc.).

    [0053] 3T3-LI cell proliferation and survival were most active when alginate was at 2%, but when alginate was at 2%, the hydrogel scaffold structure was deformed or collapsed after about 2 weeks, so that the form was not maintained. When alginate was at 2.5%, cell proliferation and survival were active, but the hydrogel scaffold structure was deformed or collapsed likewise after 3 weeks, so that the form was not maintained. When alginate was at 3%, cell proliferation and survival were active, and the hydrogel scaffold structure was maintained even for a long period of 4 weeks or longer. When alginate was at 3.5% or more, the hydrogel scaffold structure was maintained for a long period, but cell proliferation and survival were decreased to the extent of being visually confirmed (B and C in FIG. 2).

    [0054] When the number of 3T3-L1 cells is less than 1?10.sup.5 cells/ml, proliferation did not smoothly occur (D in FIG. 2). Further, when the height of the hydrogel scaffold was 2.0 mm, the proliferation rate was the highest, and when the height was more than 3.0 mm, the substructure of the hydrogel scaffolds was deformed or collapsed between 2-3 weeks, so that the form was not maintained.

    [0055] Adipocyte and Macrophage Differentiation in Manufactured Scaffolds

    [0056] The hydrogel scaffolds were differentiated for 3 days using a differentiation derivation medium containing 20 ?g/ml of insulin, 0.5 mM isobutylmethylxanthine, and 1 ?M dexamethasone, and then allowed to stand for 2 days with the medium replaced with a medium containing 20 ?g/ml of insulin, and thereafter, the cells were cultured for 1 day in a general medium (maintained medium).

    [0057] After culture, adipose particles of adipocytes aged with BODIPY (boron-dipyrromethene) (BODIPY 493/503, Invitrogen) were stained. After staining, they were washed twice with PBS, and as a result of observing the stained adipose particles with a fluorescence microscope, it was confirmed that the stained adipose particles were evenly distributed (A and B in FIG. 3).

    [0058] After culture, G6PD enzyme activity in the hydrogel scaffolds was measured with a G6PD analysis kit (Glucose 6 Phosphate Dehydrogenase Assay Kit, abcam), thereby confirming the G6PD enzyme activity which is activated in differentiated adipocytes (C in FIG. 3).

    [0059] In addition, RNA was separated from cells in the hydrogel scaffolds using trizol (Tri-reagent) (TRIzol, Invitrogen), 2 ?g of RNA was reverse-transcribed, and then a gene expression degree and protein activity were confirmed by Real-Time PCR of mRNA, and Western blot assay, respectively. AccuPower RT PreMix (Bioneer Inc., Korea) was used for the reverse transcription, Primer 3 software (http://bioinfo.ut.ee/primer3/) was used for all primer designs, and the 5- to 3-sequences thereof are represented in Table 1.

    [0060] As a result of confirming the gene expression degree and protein activity, it was recognized that PPAR?2, CEBP/? FABP4, FAS, G3PD and GLUT4 which are adipogenesis process-related transcription factors and adipocyte-related markers were significantly increased (D and E in FIG. 3).

    TABLE-US-00001 TABLE1 Gene Forward Reverse PPAR?2 ccctggcaaagcatttgtat gaaactggcacccttgaaaa G3PD agagatgctcgccacagaat aaagggtctctggggtctgt FABP4 catcagcgtaaatggggatt tcgactttccatcccacttc GLUT4 ctccttctatttgccgtcct ctgttttgcccctcagtcatt c FAS acatggtagctgccctcaag gcgcagtaccgtagaaggac 18S cggttctattttgttggt agtcggcatcgtttatggtc rRNA

    [0061] Confirmation of Adipose Tissue-Like Structure Formation by Co-Culture with Macrophages

    [0062] First, 3T3-L1 survival, proliferation and differentiation potency depending on the concentration of macrophage in co-culture were confirmed. The expression of FABP4, GLUT4 and PPAR? was decreased by about 10% in co-culture with macrophages. Further, as the macrophage concentration is increased, it was confirmed that the expression of FABP4 and GLUT4, and the G6PD activity degree were decreased, and when adipocytes and macrophages were co-cultured, it was confirmed that at a macrophage concentration of 2%, FABP4 was increased, but GLUT4 was decreased, and at the macrophage concentration of 3%, the FABP4 activity was rapidly decreased, and the differentiation of preadipocytes to adipocytes was rapidly decreased (G to I in FIG. 4).

    [0063] In the three-dimensional single culture and differentiation of preadipocytes, the expression of ACC, FAS and FABP4 related to obesity was increased, and the phosphorylation of AKT and the expression of GLUTA4 related to insulin resistance were increased (A in FIG. 5); there is no difference in the expression of ACC, FAS and FABP4 related to obesity between the three-dimensionally co-cultured and differentiated scaffolds of preadipocytes and macrophages, and the three-dimensionally single-cultured and differentiated scaffolds, thereby confirming that differentiation into adipocytes was smoothly performed (A in FIG. 5); and the phosphorylation of AKT and the expression of GLUT4 related to insulin resistance were decreased, thereby confirming at the protein level that insulin resistance is derived by microphage co-culture. These results are significantly different from the generally known results that the insulin resistance was not increased by an increase of the lipogenesis-related factors such as ACC, FAS and FABP4, phosphorylation of AKT related to insulin resistance, and an increase of the factors such as GLUT4 together, in the two-dimensional single-culture and differentiation of preadipocytes. As the results of the glucose uptake test using a glucose uptake evaluation test kit (abcam, UK) (B in FIG. 5) also, it was confirmed that the adipocytes in the scaffolds co-cultured with macrophages had increased insulin resistance due to a significant decrease, despite supply of insulin at a high concentration (1 ?g/ml) as compared with the scaffolds with single-cultured adipocytes,