Method for modifying amino acid attenuator and use of same in production

Abstract

The present invention discloses a method for modifying an amino acid attenuator, a class of amino acid attenuator mutants, engineered bacteria created on the basis of the amino acid attenuator mutants, and use of the engineered bacteria. The present invention protects a method for relieving the attenuation regulation of an amino acid operon gene, which is modification of the amino acid operon gene by: removing a gene coding for a leader peptide and an anterior reverse complementary palindromic sequence in the terminator stem-loop structure, and maintaining a posterior reverse complementary palindromic sequence in the terminator. The amino acid operon particularly can be histidine operon, tryptophan operon, phenylalanine operon, alanine operon, threonine operon and etc. The present invention can be used for the production of amino acids and derivatives thereof in fermentation by bacteria, providing a novel method for improving the production of amino acids in fermentation.

Claims

1. A modified attenuator nucleic acid sequence encoding a bacterial amino acid biosynthetic enzyme, wherein: the modified attenuator nucleic acid sequence is an attenuator of biosynthesis of L-alanine, wherein the modified attenuator nucleic acid sequence is a DNA molecule represented by nucleotides at positions 294 to n1 of SEQ ID NO: 14, wherein n1 is a natural number greater than or equal to 310 but smaller than or equal to 606; the modified attenuator nucleic acid sequence is an attenuator of biosynthesis of threonine, wherein the modified attenuator nucleic acid sequence is a DNA molecule represented by nucleotides at positions 294 to n1 of SEQ ID NO: 20, wherein n1 is a natural number greater than or equal to 310 but smaller than or equal to 336; the modified attenuator nucleic acid sequence is an attenuator of biosynthesis of valine, wherein the modified attenuator nucleic acid sequence is a DNA molecule represented by nucleotides at positions n1 to n2 of SEQ ID NO: 38, wherein n1 is a natural number greater than or equal to 129 but smaller than or equal to 148, and n2 is a natural number greater than or equal to 155 but smaller than or equal to 215; the modified attenuator nucleic acid sequence is an attenuator of biosynthesis of tryptophan, wherein the modified attenuator nucleic acid sequence is a DNA molecule represented by nucleotides at positions n1 to n2 of SEQ ID NO: 40, wherein n1 is a natural number greater than or equal to 115 but smaller than or equal to 122, and n2 is a natural number greater than or equal to 135 but smaller than or equal to 186; the modified attenuator nucleic acid sequence is an attenuator of biosynthesis of histidine, wherein the modified attenuator nucleic acid sequence is a DNA molecule represented by nucleotides at positions n1 to n2 of SEQ ID NO: 51, wherein n1 is a natural number greater than or equal to 126 but smaller than or equal to 143, and n2 is a natural number greater than or equal to 148 but smaller than or equal to 286; or the modified attenuator nucleic acid sequence is an attenuator of biosynthesis of phenylalanine, wherein the modified attenuator nucleic acid sequence is a DNA molecule represented by nucleotides at positions n1 to n2 of SEQ ID NO: 62, wherein n1 is a natural number greater than or equal to 105 but smaller than or equal to 118, and n2 is a natural number greater than or equal to 123 but smaller than or equal to 176; and wherein the modified attenuator nucleic acid sequence forms an anterior reverse complementary palindromic sequence and a loop sequence in a terminator stem-loop structure, and a preceding sequence thereof, wherein a posterior reverse complementary palindromic sequence in the terminator stem-loop structure remains, so that the remaining sequence is unable to form a stable terminator stem-loop structure.

2. The modified attenuator of claim 1, wherein when the attenuator nucleic acid sequence is an attenuator of biosynthesis of L-alanine, the modified attenuator nucleic acid sequence is represented by nucleotides at positions 294 to n1 of SEQ ID NO: 14, wherein n1 is a natural number greater than or equal to 310 but smaller than or equal to 336.

3. An operon, a recombinant vector, or a recombinant bacterium, comprising the modified attenuator nucleic acid sequence of claim 1.

4. The operon, recombinant vector, or recombinant bacterium of claim 3, wherein the operon, recombinant vector, or recombinant bacterium comprises a target gene that is regulated by a regulator sequence comprising the modified attenuator nucleic acid sequence.

5. The operon, recombinant vector, or recombinant bacterium of claim 4, wherein the target gene is a gene related to amino acid expression.

6. The operon, recombinant vector, or recombinant bacterium of claim 4, wherein the target gene is any one of: (1) a gene coding for alanine dehydrogenase, (2) a gene coding for aspartokinase I-homoserine dehydrogenase complex, a gene coding for homoserine dehydrogenase and a gene coding for threonine synthetase, (3) a gene coding for ATP phosphoribosyltransferase mutated from a gene coding for a wild-type protein to a gene coding for a mutant protein with relieved feedback repression, and (4) a gene coding for a bifunctional enzyme of chorismate mutase-prephenate dehydratase mutated from a gene coding for a wild-type protein to a gene coding for a mutant protein with relieved feedback repression.

7. The operon, recombinant vector, or recombinant bacterium of claim 6, wherein the bacterium is E. coli.

8. A method for improving the capability of a bacterium producing a target protein or a target compound, comprising the step of: including in the bacterium a relevant gene coding for the target protein or a protein coding gene relevant to synthesis of the target compound, wherein the coding gene is regulated by a regulator sequence comprising a modified attenuator nucleic acid sequence according to claim 1.

9. The method of claim 8, wherein, the attenuator is an attenuator of L-alanine, the modified attenuator nucleic acid sequence is represented by nucleotides at positions 294 to n1 of SEQ ID NO: 14, and wherein n1 is a natural number greater than or equal to 310 but smaller than or equal to 336.

10. The method of claim 8, wherein the bacterium is E. coli.

Description

DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows the intensities of GFP expressed under regulations of different attenuator mutants analyzed by the flow cytometer in Example 3.

(2) FIG. 2 shows the yield of L-alanine fermented by the engineered bacteria in a shake flask in Example 4.

BEST EMBODIMENTS OF THE INVENTION

(3) The following examples are intended to facilitate a better understanding of the present invention, but are not to limit the present invention. All the experimental methods in the following examples are conventional methods, unless otherwise specified. All the test materials used in the following examples are available from a conventional shop selling biochemical reagents, unless otherwise specified. All the quantitative tests in the following examples are done in triplicate, the results of which are averaged. The technical means used in the following examples, which are conventional means well known by the skilled in the art, and the conventional apparatuses and reagents commercially available in the market, can find reference in “Molecular Cloning: A Laboratory Manual, Third Edition” (Science Press), “Laboratory Experiments In Microbiology, Fourth Edition” (Higher Education Press) and the instructions from the manufacturers of the corresponding apparatuses and reagents etc., unless otherwise indicated in the examples.

(4) The E. coli K12 W3110 (also referred to as E. coli K12 W3110) is available from the NITE Biological Resource Center, NBRC, in Japan. The plasmid pKOV designated as No. 25769 in a product catalog is available from the Addgene company. The plasmid pACYC184 designated as No. E4152S in a product catalog is available from the NEB company. The pAD123 plasmid can find reference in Gene, 1999. 226(2): 297-305. The full name of ONPG is o-nitrophenyl-β-D-galactopyranoside. Bacillus subtilis W168 designated as Item No. 1A308 is available from the Bacillus Genetic Stock Center in the United States. The E. coli K12 MG1655 designated as No. 700926 is available from the ATCC. The plasmid pKOV designated as No. 25769 in a product catalog is available from the Addgene company. The pGFPuv vector designated as Catalog No. 632312 is available from the Clontech Laboratories, Inc. The E. coli EC135 is recorded in the reference as follows: Zhang et al., Plos Genetics, 2012. 8(9): e1002987. The plasmid pBR322 designated as No. D3050 in a product catalog is available from the TaKaRa company.

(5) ATCC: on the internet at: www.atcc.org.

(6) Each of the primer sequences used in Examples 1-5 is set forth as follows (5′.fwdarw.3′):

(7) TABLE-US-00013 WY569: GCGTCGACATAGAACCCAACCGCCTGCTCA; WY570: AACGATCGACTATCACAGAAGAAACCTGATTACCTCACTA CATA; WY571: TATGTAGTGAGGTAATCAGGTTTCTTCTGTGATAGTCGAT CGTT; WY572: ATTGCGGCCGCCCGAAATAAAATCAGGCAACGT; WY583: CGTTAATGAAATATCGCCAG; WY584: TCGAAATCGGCCATAAAGAC. WY577: CGCGGATCCGAAAGTGTACGAAAGCCAGG; WY578: GCGCTATCAGGCATTTTTCCTATTAACCCCCCAGTTTCGA; WY579: TCGAAACTGGGGGGTTAATAGGAAAAATGCCTGATAGCGC; WY580: ATTGCGGCCGCGTGAAGCGGATCTGGCGATT; WY587: ATGGCTGTATCCGCTCGCTG; WY588: ACACCATCGATCAGCAAGGGC. WY573: CGCGGATCCGGCACGATATTTAAGCTGAC; WY574: CAACCAGCGACTAACCGCAGAACAAACTCCAGATAAGTGC; WY575: GCACTTATCTGGAGTTTGTTCTGCGGTTAGTCGCTGGTTG; WY576: ATTGCGGCCGCGCTGGCAACGCGTCATTTAA; WY585: GTAACACACACACTTCATCT; WY586: GATCCCGGATGCTGATTTAG. WY598: CGCGGATCCATACTGCGATGTGATGGGCC; WY599: AATACCAGCCCTTGTTCGTGCTCACATCCTCAGGCGATAA; WY600: TTATCGCCTGAGGATGTGAGCACGAACAAGGGCTGGTATT; WY601: ATTGCGGCCGCCGTTGCCACTTCAATCCCAC; WY602: GCTATGCCAACAACGATATG; WY603: GGTTAATACGCCGGTTGAGC. WY476: CGCGGATCCGGAACGATTGGTCTGGAAAT; WY477: GGCTTCAATCAGGTCAAGGATATCCTATCCTCAACGAATTA; WY478: TAATTCGTTGAGGATAGGATATCCTTGACCTGATTGAAGCC; WY479: ATTGCGGCCGCCGCGACGGATATTATCAATGAC; WY497: GCGCCAAAATCCAAAGTAGC; WY498: ATGTGCGCGCTGGGAAACAT. WY945: CGCGGATCCTATCTTCGCCGTGACCACTGA; WY946: ACCGAACATATTACAGGCCAGCGATCCTTTCATTGTGTTGTC; WY947: GACAACACAATGAAAGGATCGCTGGCCTGTAATATGTTCGGT; WY948: ATTGCGGCCGCCTCGCGAAGTTCCATCATCCT; WY949: CCTGTAACGAGCGTAACGACT; WY950: TATCTTCGCCGTGACCACTGA. WY914: CCCAAGCTTACAGAGTACACAACATCCATG; WY1630: CCCAAGCTTCATTAGCACCACCATTACCA; WY1629: CCCAAGCTTCAGGTAACGGTGCGGGCTGA; WY1628: CCCAAGCTTCGCGTACAGGAAACACAGAA; WY1627: CCCAAGCTTGTGCGGGCTTTTTTTTTCGA; WY913: CCCAAGCTTTCGACCAAAGGTAACGAGGT; WY1746: CATAGAACCAGAACCAGAACCCAATTGCGCCAGCGGGAAC. WY1752: CAATTGGGTTCTGGTTCTGGTTCTATGACCATGATTACGGAT TCACT; WY1750: CGCGGATCCACGCGAAATACGGGCAGACA.

Example 1. Construction of the E. coli K-12 W3110ΔmetAΔilvAΔlysAΔtdhΔtdcCΔsstT

(8) Chassis engineered bacteria are obtained by sequentially knocking out the metA gene (a gene coding for homoserine transsuccinylase), the ilvA gene (a gene coding for threonine deaminase), the lysA gene (a gene coding for diaminopimelic acid decarboxylase), the tdh gene (a gene coding for threonine dehydratase), the tdcC gene (a gene coding for threonine absortion and transport protein) and the sstT gene (a gene coding for threonine absortion and transport protein) with the E. coli K12 W3110 as the starting bacteria strain, and named as E. coli K-12 W3110ΔmetAΔilvAΔlysAΔtdhΔtdcCΔsstT.

(9) 1. Knockout of the metA Gene

(10) (1) A DNA fragment I-A (a region upstream of the metA gene) is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 W3110 as a template and using a primer pair comprised of WY569 and WY570.

(11) (2) A DNA fragment I-B (a region downstream of the metA gene) is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 W3110 as a template and using a primer pair comprised of WY571 and WY572.

(12) (3) A DNA fragment I-C is obtained by performing a PCR amplification using a mixture of the DNA fragment I-A and the DNA fragment I-B as a template and using a primer pair comprised of WY569 and WY572.

(13) (4) The vector backbone (about 5.6 kb) of the plasmid pKOV, after being subjected to a double enzymatic cleavage using the restriction endonucleases Sal I and Not I, is recovered.

(14) (5) The enzymatically cleaved product of the DNA fragment I-C, after being subjected to a double enzymatic cleavage using the restriction endonucleases Sal I and Not I, is recovered.

(15) (6) A recombinant plasmid I is obtained by linking the vector backbone obtained in step (4) and the enzymatically cleaved product obtained in step (5). According to the sequencing result, a structural description for the recombinant plasmid I is set forth as follows: the following specific DNA molecule is inserted between the enzymatic cleavage sites of Sal I and Not I of the plasmid pKOV: sequentially consisting, from upstream to downstream, of the upstream section shown by the nucleotides at positions 245-751 of SEQ ID No: 1 of the sequence listing and the downstream section shown by the nucleotides at positions 1682-2154 of SEQ ID No: 1 of the sequence listing. The metA gene is shown by SEQ ID No: 1 of the sequence listing, wherein the open reading frame is shown by the nucleotides at positions 752-1681 (coding for the metA protein shown by SEQ ID No: 2 of the sequence listing).

(16) (7) Recombinant bacteria with metA gene knocked out is obtained by introducing the recombinant plasmid I into the E. coli K12 W3110 and named as E. coli K12 W3110ΔmetA.

(17) A method for identyfing the recombinant bacteria with metA gene knocked out is that: a PCR amplification is performed using a primer pair comprised of WY583 and WY584; if an amplification product with 1375 bp is obtained, the recombinant bacteria preliminarily can be determined as a candidate for the target bacteria; and sequencing will be further performed to verify that the open reading frame of the metA gene on the chromosomes of the bacteria has been knocked out.

(18) 2. Knockout of the ilvA Gene

(19) (1) A DNA fragment II-A (a region upstream of the ilvA gene) is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 W3110 as a template and using a primer pair comprised of WY577 and WY578.

(20) (2) A DNA fragment II-B (a region downstream of the ilvA gene) is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 W3110 as a template and using a primer pair comprised of WY579 and WY580.

(21) (3) A DNA fragment II-C is obtained by performing a PCR amplification using a mixture of the DNA fragment II-A and the DNA fragment II-B as a template and using a primer pair comprised of WY577 and WY580.

(22) (4) The vector backbone (about 5.6 kb) of the plasmid pKOV, after being subjected to a double enzymatic cleavage using the restriction endonucleases BamH I and Not I, is recovered.

(23) (5) The enzymatically cleaved product of the DNA fragment II-C, after being subjected to a double enzymatic cleavage using the restriction endonucleases BamH I and Not I, is recovered.

(24) (6) A recombinant plasmid II is obtained by linking the vector backbone obtained in step (4) and the enzymatically cleaved product obtained in step (5). According to the sequencing result, a structural description for the recombinant plasmid II is set forth as follows: the following specific DNA molecule is inserted between the enzymatic cleavage sites of BamH I and Not I of the plasmid pKOV: sequentially consisting, from upstream to downstream, of the upstream section shown by the nucleotides at positions 140-637 of SEQ ID No: 3 of the sequence listing and the downstream section shown by the nucleotides at positions 2183-2712 of SEQ ID No: 3 of the sequence listing. The ilvA gene is shown by SEQ ID No: 3 of the sequence listing, wherein the open reading frame is shown by the nucleotides at positions 638-2182 (coding for the ilvA protein shown by SEQ ID No: 4 of the sequence listing).

(25) (7) Recombinant bacteria with ilvA gene knocked out are obtained by introducing the recombinant plasmid II into the E. coli K12 W3110ΔmetA, and named as E. coli K12 W3110ΔmetAΔilvA.

(26) A method for identyfing the recombinant bacteria with ilvA gene knocked out is that: a PCR amplification is performed using a primer pair comprised of WY587 and WY588; if an amplification product with 1344 bp is obtained, the recombinant bacteria preliminarily can be determined as a candidate for the target bacteria; and sequencing will be further performed to verify that the open reading frame of the ilvA gene on the chromosomes of the bacteria has been knocked out.

(27) 3. Knockout of the lysA Gene

(28) (1) A DNA fragment III-A (a region upstream of the lysA gene) is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 W3110 as a template and using a primer pair comprised of WY573 and WY574.

(29) (2) A DNA fragment III-B (a region downstream of the lysA gene) is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 W3110 as a template and using a primer pair comprised of WY575 and WY576.

(30) (3) A DNA fragment III-C is obtained by performing a PCR amplification using a mixture of the DNA fragment III-A and the DNA fragment III-B as a template and using a primer pair comprised of WY573 and WY576.

(31) (4) The vector backbone (about 5.6 kb) of the plasmid pKOV, after being subjected to a double enzymatic cleavage using the restriction endonucleases BamH I and Not I, is recovered.

(32) (5) The enzymatically cleaved product of the DNA fragment III-C, after being subjected to a double enzymatic cleavage using the restriction endonucleases BamH I and Not I, is recovered.

(33) (6) A recombinant plasmid III is obtained by linking the vector backbone obtained in step (4) and the enzymatically cleaved product obtained in step (5). According to the sequencing result, a structural description for the recombinant plasmid III is set forth as follows: the following specific DNA molecule is inserted between the enzymatic cleavage sites of BamH I and Not I of the plasmid pKOV: sequentially consisting, from upstream to downstream, of the upstream section shown by the nucleotides at positions 132-638 of SEQ ID No: 5 of the sequence listing and the downstream section shown by the nucleotides at positions 1902-2445 of SEQ ID No: 5 of the sequence listing. The lysA gene is shown by SEQ ID No: 5 of the sequence listing, wherein the open reading frame is shown by the nucleotides at positions 639-1901 (coding for the lysA protein shown by SEQ ID No: 6 of the sequence listing).

(34) (7) Recombinant bacteria with lysA gene knocked out are obtained by introducing the recombinant plasmid III into the E. coli K-12 W3110ΔmetAΔilvA, and named as E. coli K-12 W3110ΔmetAΔilvAΔlysA.

(35) A method for identyfing the recombinant bacteria with lysA gene knocked out is that: a PCR amplification is performed using a primer pair comprised of WY585 and WY586; if an amplification product with 1302 bp is obtained, the recombinant bacteria preliminarily can be determined as a candidate for the target bacteria; and sequencing will be further performed to verify that the open reading frame of the lysA gene on the chromosomes of the bacteria has been knocked out.

(36) 4. Knockout of the tdh Gene

(37) (1) A DNA fragment IV-A (a region upstream of the tdh gene) is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 W3110 as a template and using a primer pair comprised of WY598 and WY599.

(38) (2) A DNA fragment IV-B (a region downstream of the tdh gene) is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 W3110 as a template and using a primer pair comprised of WY600 and WY601.

(39) (3) A DNA fragment IV-C is obtained by performing a PCR amplification using a mixture of the DNA fragment IV-A and the DNA fragment IV-B as a template and using a primer pair comprised of WY598 and WY601.

(40) (4) The vector backbone (about 5.6 kb) of the plasmid pKOV, after being subjected to a double enzymatic cleavage using the restriction endonucleases BamH I and Not I, is recovered.

(41) (5) The enzymatically cleaved product of the DNA fragment IV-C, after being subjected to a double enzymatic cleavage using the restriction endonucleases BamH I and Not I, is recovered.

(42) (6) A recombinant plasmid IV is obtained by linking the vector backbone obtained in step (4) and the enzymatically cleaved product obtained in step (5). According to the sequencing result, a structural description for the recombinant plasmid IV is set forth as follows: the following specific DNA molecule is inserted between the enzymatic cleavage sites of BamH I and Not I of the plasmid pKOV: sequentially consisting, from upstream to downstream, of the upstream section shown by the nucleotides at positions 227-752 of SEQ ID No: 7 of the sequence listing and the downstream section shown by the nucleotides at positions 1779-2271 of SEQ ID No: 7 of the sequence listing. The tdh gene is shown by SEQ ID No: 7 of the sequence listing, wherein the open reading frame is shown by the nucleotides at positions 753-1778 (coding for the tdh protein shown by SEQ ID No: 8 of the sequence listing).

(43) (7) Recombinant bacteria with tdh gene knocked out are obtained by introducing the recombinant plasmid IV into the E. coli K-12 W3110ΔmetAΔilvAΔlysA, and named as E. coli K-12 W3110ΔmetAΔilvAΔlysAΔtdh.

(44) A method for identyfing the recombinant bacteria with tdh gene knocked out is that: a PCR amplification is performed using a primer pair comprised of WY602 and WY603; if an amplification product with 1434 bp is obtained, the recombinant bacteria preliminarily can be determined as a candidate for the target bacteria; and sequencing will be further performed to verify that the open reading frame of the tdh gene on the chromosomes of the bacteria has been knocked out.

(45) 5. Knockout of the tdcC Gene

(46) (1) A DNA fragment V-A (a region upstream of the tdcC gene) is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 W3110 as a template and using a primer pair comprised of WY476 and WY477.

(47) (2) A DNA fragment V-B (a region downstream of the tdcC gene) is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 W3110 as a template and using a primer pair comprised of WY478 and WY479.

(48) (3) A DNA fragment V-C is obtained by performing a PCR amplification using a mixture of the DNA fragment V-A and the DNA fragment V-B as a template and using a primer pair comprised of WY476 and WY479.

(49) (4) The vector backbone (about 5.6 kb) of the plasmid pKOV, after being subjected to a double enzymatic cleavage using the restriction endonucleases BamH I and Not I, is recovered.

(50) (5) The enzymatically cleaved product of the DNA fragment V-C, after being subjected to a double enzymatic cleavage using the restriction endonucleases BamH I and Not I, is recovered.

(51) (6) A recombinant plasmid V is obtained by linking the vector backbone obtained in step (4) and the enzymatically cleaved product obtained in step (5). According to the sequencing result, a structural description for the recombinant plasmid V is set forth as follows: the following specific DNA molecule is inserted between the enzymatic cleavage sites of BamH I and Not I of the plasmid pKOV: sequentially consisting, from upstream to downstream, of the upstream section shown by the nucleotides at positions 176-700 of SEQ ID No: 9 of the sequence listing and the downstream section shown by the nucleotides at positions 1853-2388 of SEQ ID No: 9 of the sequence listing. The tdcC gene is shown by SEQ ID No: 9 of the sequence listing, wherein the open reading frame is shown by the nucleotides at positions 701-2032 (coding for the tdcC protein shown by SEQ ID No: 10 of the sequence listing).

(52) (7) Recombinant bacteria with tdcC gene knocked out are obtained by introducing the recombinant plasmid V into the E. coli K-12 W3110ΔmetAΔilvAΔlysAΔtdh, and named as E. coli K-12 W3110ΔmetAΔilvAΔlysAΔtdhΔtdcC.

(53) A method for identyfing the recombinant bacteria with tdcC gene knocked out is that: a PCR amplification is performed using a primer pair comprised of WY497 and WY498; if an amplification product with 1453 bp is obtained, the recombinant bacteria preliminarily can be determined as a candidate for the target bacteria; and sequencing will be further performed to verify that the following section of the tdcC gene on the chromosomes of the bacteria has been knocked out: the nucleotides at positions 701-1852 of SEQ ID No: 9.

(54) 6. Knockout of the sstT Gene

(55) (1) A DNA fragment VI-A (a region upstream of the sstT gene) is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 W3110 as a template and using a primer pair comprised of WY945 and WY946.

(56) (2) A DNA fragment VI-B (a region downstream of the sstT gene) is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 W3110 as a template and using a primer pair comprised of WY947 and WY948.

(57) (3) A DNA fragment VI-C is obtained by performing a PCR amplification using a mixture of the DNA fragment VI-A and the DNA fragment VI-B as a template and using a primer pair comprised of WY945 and WY948.

(58) (4) The vector backbone (about 5.6 kb) of the plasmid pKOV, after being subjected to a double enzymatic cleavage using the restriction endonucleases BamH I and Not I, is recovered.

(59) (5) The enzymatically cleaved product of the DNA fragment VI-C, after being subjected to a double enzymatic cleavage using the restriction endonucleases BamH I and Not I, is recovered.

(60) (6) A recombinant plasmid VI is obtained by linking the vector backbone obtained in step (4) and the enzymatically cleaved product obtained in step (5). According to the sequencing result, a structural description for the recombinant plasmid VI is set forth as follows: the following specific DNA molecule is inserted between the enzymatic cleavage sites of BamH I and Not I of the plasmid pKOV: sequentially consisting, from upstream to downstream, of the upstream section shown by the nucleotides at positions 14-696 of SEQ ID No: 11 of the sequence listing and the downstream section shown by the nucleotides at positions 1760-2240 of SEQ ID No: 11 of the sequence listing. The sstT gene is shown by SEQ ID No: 11 of the sequence listing, wherein the open reading frame is shown by the nucleotides at positions 701-1945 (coding for the sstT protein shown by SEQ ID No: 12 of the sequence listing).

(61) (7) Recombinant bacteria with sstT gene knocked out are obtained by introducing the recombinant plasmid VI into the E. coli K-12 W3110ΔmetAΔilvAΔlysAΔtdhΔtdcC, and named as E. coli K-12 W3110ΔmetA ΔilvAΔlysAΔtdhΔtdcCΔsstT.

(62) A method for identyfing the recombinant bacteria with sstT gene knocked out is that: a PCR amplification is performed using a primer pair comprised of WY949 and WY950; if an amplification product with 1569 bp is obtained, the recombinant bacteria preliminarily can be determined as a candidate for the target bacteria; and sequencing will be further performed to verify that the following section of the sstT gene on the chromosomes of the bacteria has been knocked out: the nucleotides at positions 697-1759 of SEQ ID No: 11.

Example 2. The Expression of the lacZ Gene Under Regulation of an Attenuator Mutant

(63) I. Construction of the Recombinant Plasmid pACYC184-P.sub.PL

(64) 1. The double-stranded DNA molecule (the promoter P.sub.PL) shown by SEQ ID No: 13 of the sequence listing 13 is synthesized.

(65) 2. A PCR amplification product is obtained by performing a PCR amplification using the double-stranded DNA molecule prepared in step 1 as a template and using a primer pair comprised of WY843 and WY842.

(66) TABLE-US-00014 WY843: TGCTCTAGACAATTCCGACGTCTAAGAAA; WY842: CCCAAGCTTGGTCAGTGCGTCCTGCTGAT.

(67) 3. The enzymatically cleaved product of the PCR amplification product obtained in step 2, after being subjected to a double enzymatic cleavage using the restriction endonucleases Xba I and Hind III, is recovered.

(68) 4. The vector backbone (about 4.1 kb) of the plasmid pACYC184, after being subjected to a double enzymatic cleavage using the restriction endonucleases Xba I and Hind III, is recovered.

(69) 5. A recombinant plasmid pACYC184-P.sub.PL is obtained by linking the enzymatically cleaved product in step 3 and the vector backbone in step 4.

(70) II. Construction of Each of the Recombinant Plasmids

(71) 1. Construction of the Recombinant Plasmid A

(72) (1) A PCR amplification product A1 is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 W3110 as a template and using a primer pair comprised of WY914 and WY1746; a PCR amplification product A2 is obtained by performing a PCR amplification using the double-stranded DNA molecule as a template, which is artificially synthesized and shown by SEQ ID No: 15 of the sequence listing, and using a primer pair comprised of WY1752 and WY1750; a PCR amplification product A3 is obtained by performing a PCR amplification using a mixture of the PCR amplification product A1 and the PCR amplification product A2 as a template and using a primer pair comprised of WY914 and WY1750.

(73) (2) The enzymatically cleaved product of the PCR amplification product A3, after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and BamH I, is recovered.

(74) (3) The vector backbone (about 4.0 kb) of the recombinant plasmid pACYC184-P.sub.PL, after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and BamH I, is recovered.

(75) (4) A recombinant plasmid A is obtained by linking the enzymatically cleaved product in step (2) and the vector backbone in step (3). According to the sequencing result, a structural description for the recombinant plasmid A is set forth as follows: a specific DNA molecule A is inserted between the enzymatic cleavage sites of Xba I and BamH I of the plasmid pACYC184; and the specific DNA molecule A sequentially consists, from upstream to downstream, of the following elements: the promoter P.sub.PL shown by SEQ ID No: 13 of the sequence listing, a recognition sequence for enzymatic cleavage by restriction endonuclease Hind III, the nucleotides at positions 172-606 of SEQ ID No: 14 of the sequence listing, a linker sequence “GGTTCTGGTTCTGGTTCT” (SEQ ID NO: 67), and the lacZ gene shown by SEQ ID No: 15 of the sequence listing (wherein the open reading frame is at positions 1-3075 of SEQ ID No: 15). The recombinant plasmid A is named as pACYC184-P.sub.PL-thrLA-lacZ914.

(76) 2. Construction of the Recombinant Plasmid B

(77) (1) A PCR amplification product B1 is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 W3110 as a template and using a primer pair comprised of WY1630 and WY1746; a PCR amplification product B2 is obtained by performing a PCR amplification using the double-stranded DNA molecule as a template, which is artificially synthesized and shown by SEQ ID No: 15 of the sequence listing, and using a primer pair comprised of WY1752 and WY1750; a PCR amplification product B3 is obtained by performing a PCR amplification using a mixture of the PCR amplification product B1 and the PCR amplification product B2 as a template and using a primer pair comprised of WY1630 and WY1750.

(78) (2) The enzymatically cleaved product of the PCR amplification product B3, after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and BamH I, is recovered.

(79) (3) The vector backbone (about 4.0 kb) of the recombinant plasmid pACYC184-P.sub.PL, after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and BamH I, is recovered.

(80) (4) A recombinant plasmid B is obtained by linking the enzymatically cleaved product in step (2) and the vector backbone in step (3). According to the sequencing result, a structural description for the recombinant plasmid B is set forth as follows: a specific DNA molecule B is inserted between the enzymatic cleavage sites of Xba I and BamH I of the plasmid pACYC184; and the specific DNA molecule B sequentially consists, from upstream to downstream, of the following elements: the promoter P.sub.PL shown by SEQ ID No: 13 of the sequence listing, a recognition sequence for enzymatic cleavage by restriction endonuclease Hind III, the nucleotides at positions 198-606 of SEQ ID No: 14 of the sequence listing, a linker sequence “GGTTCTGGTTCTGGTTCT” (SEQ ID NO: 67), and the lacZ gene shown by SEQ ID No: 15 of the sequence listing. The recombinant plasmid B is named as pACYC184-P.sub.PL-thrLA-lacZ1630.

(81) 3. Construction of the Recombinant Plasmid C

(82) (1) A PCR amplification product C1 is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 W3110 as a template and using a primer pair comprised of WY1629 and WY1746; a PCR amplification product C2 is obtained by performing a PCR amplification using the double-stranded DNA molecule as a template, which is artificially synthesized and shown by SEQ ID No: 15 of the sequence listing, and using a primer pair comprised of WY1752 and WY1750; a PCR amplification product C3 is obtained by performing a PCR amplification using a mixture of the PCR amplification product C1 and the PCR amplification product C2 as a template and using a primer pair comprised of WY1629 and WY1750.

(83) (2) The enzymatically cleaved product of the PCR amplification product C3, after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and BamH I, is recovered.

(84) (3) The vector backbone (about 4.0 kb) of the recombinant plasmid pACYC184-P.sub.PL, after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and BamH I, is recovered.

(85) (4) A recombinant plasmid C is obtained by linking the enzymatically cleaved product in step (2) and the vector backbone in step (3). According to the sequencing result, a structural description for the recombinant plasmid C is set forth as follows: a specific DNA molecule C is inserted between the enzymatic cleavage sites of Xba I and BamH I of the plasmid pACYC184; and the specific DNA molecule C sequentially consists, from upstream to downstream, of the following elements: the promoter P.sub.PL shown by SEQ ID No: 13 of the sequence listing, a recognition sequence for enzymatic cleavage by restriction endonuclease Hind III, the nucleotides at positions 236-606 of SEQ ID No: 14 of the sequence listing, a linker sequence “GGTTCTGGTTCTGGTTCT” (SEQ ID NO: 67), and the lacZ gene shown by SEQ ID No: 15 of the sequence listing. The recombinant plasmid C is named as pACYC184-P.sub.PL-thrLA-lacZ1629.

(86) 4. Construction of the Recombinant Plasmid D

(87) (1) A PCR amplification product D1 is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 W3110 as a template and using a primer pair comprised of WY1628 and WY1746; a PCR amplification product D2 is obtained by performing a PCR amplification using the double-stranded DNA molecule as a template, which is artificially synthesized and shown by SEQ ID No: 15 of the sequence listing, and using a primer pair comprised of WY1752 and WY1750; a PCR amplification product D3 is obtained by performing a PCR amplification using a mixture of the PCR amplification product D1 and the PCR amplification product D2 as a template and using a primer pair comprised of WY1628 and WY1750.

(88) (2) The enzymatically cleaved product of the PCR amplification product D3, after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and BamH I, is recovered.

(89) (3) The vector backbone (about 4.0 kb) of the recombinant plasmid pACYC184-P.sub.PL, after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and BamH I, is recovered.

(90) (4) A recombinant plasmid D is obtained by linking the enzymatically cleaved product in step (2) and the vector backbone in step (3). According to the sequencing result, a structural description for the recombinant plasmid D is set forth as follows: a specific DNA molecule D is inserted between the enzymatic cleavage sites of Xba I and BamH I of the plasmid pACYC184; and the specific DNA molecule D sequentially consists, from upstream to downstream, of the following elements: the promoter P.sub.PL shown by SEQ ID No: 13 of the sequence listing, a recognition sequence for enzymatic cleavage by restriction endonuclease Hind III, the nucleotides at positions 256-606 of SEQ ID No: 14 of the sequence listing, a linker sequence “GGTTCTGGTTCTGGTTCT” (SEQ ID NO: 67), and the lacZ gene shown by SEQ ID No: 15 of the sequence listing. The recombinant plasmid D is named as pACYC184-P.sub.PL-thrLA-lacZ1628.

(91) 5. Construction of the Recombinant Plasmid E

(92) (1) A PCR amplification product E1 is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 W3110 as a template and using a primer pair comprised of WY1627 and WY1746; a PCR amplification product E2 is obtained by performing a PCR amplification using the double-stranded DNA molecule as a template, which is artificially synthesized and shown by SEQ ID No: 15 of the sequence listing, and using a primer pair comprised of WY1752 and WY1750; a PCR amplification product E3 is obtained by performing a PCR amplification using a mixture of the PCR amplification product E1 and the PCR amplification product E2 as a template and using a primer pair comprised of WY1627 and WY1750.

(93) (2) The enzymatically cleaved product of the PCR amplification product E3, after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and BamH I, is recovered.

(94) (3) The vector backbone (about 4.0 kb) of the recombinant plasmid pACYC184-P.sub.PL, after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and BamH I, is recovered.

(95) (4) A recombinant plasmid E is obtained by linking the enzymatically cleaved product in step (2) and the vector backbone in step (3). According to the sequencing result, a structural description for the recombinant plasmid E is set forth as follows: a specific DNA molecule E is inserted between the enzymatic cleavage sites of Xba I and BamH I of the plasmid pACYC184; and the specific DNA molecule E sequentially consists, from upstream to downstream, of the following elements: the promoter P.sub.PL shown by SEQ ID No: 13 of the sequence listing, a recognition sequence for enzymatic cleavage by restriction endonuclease Hind III, the nucleotides at positions 294-606 of SEQ ID No: 14 of the sequence listing, a linker sequence “GGTTCTGGTTCTGGTTCT” (SEQ ID NO: 67), and the lacZ gene shown by SEQ ID No: 15 of the sequence listing. The recombinant plasmid E is named as pACYC184-P.sub.PL-thrLA-lacZ1627.

(96) 6. Construction of the Recombinant Plasmid F

(97) (1) A PCR amplification product F1 is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 W3110 as a template and using a primer pair comprised of WY913 and WY1746; a PCR amplification product F2 is obtained by performing a PCR amplification using the double-stranded DNA molecule as a template, which is artificially synthesized and shown by SEQ ID No: 15 of the sequence listing, and using a primer pair comprised of WY1752 and WY1750; a PCR amplification product F3 is obtained by performing a PCR amplification using a mixture of the PCR amplification product F1 and the PCR amplification product F2 as a template and using a primer pair comprised of WY913 and WY1750.

(98) (2) The enzymatically cleaved product of the PCR amplification product F3, after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and BamH I, is recovered.

(99) (3) The vector backbone (about 4.0 kb) of the recombinant plasmid pACYC184-P.sub.PL, after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and BamH I, is recovered.

(100) (4) A recombinant plasmid F is obtained by linking the enzymatically cleaved product in step (2) and the vector backbone in step (3). According to the sequencing result, a structural description for the recombinant plasmid F is set forth as follows: a specific DNA molecule F is inserted between the enzymatic cleavage sites of Xba I and BamH I of the plasmid pACYC184; and the specific DNA molecule F sequentially consists, from upstream to downstream, of the following elements: the promoter P.sub.PL shown by SEQ ID No: 13 of the sequence listing, a recognition sequence for enzymatic cleavage by restriction endonuclease Hind III, the nucleotides at positions 310-606 of SEQ ID No: 14 of the sequence listing, a linker sequence “GGTTCTGGTTCTGGTTCT” (SEQ ID NO: 67), and the lacZ gene shown by SEQ ID No: 15 of the sequence listing. The recombinant plasmid F is named as pACYC184-P.sub.PL-thrLA-lacZ913.

(101) III. Construction of Recombinant Bacteria

(102) Recombinant bacteria is obtained by introducing pACYC184-P.sub.PL-thrLA-lacZ914 into E. coli K-12 W3110ΔmetAΔilvAΔlysAΔtdhΔtdcCΔsstT, and named as LAC914.

(103) Recombinant bacteria is obtained by introducing pACYC184-P.sub.PL-thrLA-lacZ1630 into E. coli K-12 W3110ΔmetAΔilvAΔlysAΔtdhΔtdcCΔsstT, and named as LAC1630.

(104) Recombinant bacteria is obtained by introducing pACYC184-P.sub.PL-thrLA-lacZ1629 into E. coli K-12 W3110ΔmetAΔilvAΔlysAΔtdhΔtdcCΔsstT, and named as LAC1629.

(105) Recombinant bacteria is obtained by introducing pACYC184-P.sub.PL-thrLA-lacZ1628 into E. coli K-12 W3110ΔmetAΔilvAΔlysAΔtdhΔtdcCΔsstT, and named as LAC1628.

(106) Recombinant bacteria is obtained by introducing pACYC184-P.sub.PL-thrLA-lacZ1627 into E. coli K-12 W3110ΔmetAΔilvAΔlysAΔtdhΔtdcCΔsstT, and named as LAC1627.

(107) Recombinant bacteria is obtained by introducing pACYC184-P.sub.PL-thrLA-lacZ913 into E. coli K-12 W3110ΔmetAΔilvAΔlysAΔtdhΔtdcCΔsstT, and named as LAC913.

(108) Recombinant bacteria is obtained by introducing the plasmid pACYC184 into E. coli K-12 W3110ΔmetAΔilvAΔlysAΔtdhΔtdcCΔsstT, and named as LAC control.

(109) IV. Determination of the Activity of β-Galactosidase

(110) The test strain is: LAC914, LAC1630, LAC1629, LAC1628, LAC1627 or LAC913.

(111) 1. The test strain is seeded into a liquid LB medium containing 34 mg/L chloramphenicol, followed by shaking culture for 12 h at 37° C., 220 rpm, and a seed solution is obtained.

(112) 2. The seed solution obtained in step 1 is seeded into a liquid 2YT medium containing 34 mg/L chloramphenicol in a seeding amount of 2%, followed by culture for 6 h at 37° C., 220 rpm.

(113) 3. After completion of step 2, 1.5 ml and 1 ml are sampled from the culture system for the determination of the optical density value at OD.sub.600nm and for the detection of the activity of β-galactosidase of a sample to be tested, respectively.

(114) A method for detecting the activity of β-galactosidase:

(115) (1) 1 ml of a sample to be tested is centrifuged at 10000×g for 5 min, and then bacteria precipitates are collected and washed twice with a PBS buffer solution at pH7.2, followed by making a constant volume to 1 ml with a Z-buffer and making the bacteria be fully suspended and placed on ice for use. The Z-buffer is: 40 mM NaH.sub.2PO.sub.4, 60 mM Na.sub.2HPO.sub.4, 10 mM KCl, 1 mM MgSO.sub.4, and 50 mM β-mercaptoethanol, at pH 7.0.

(116) (2) After completion of step (1), 0.05 mL is sampled, into which 0.2 mL of an aqueous solution containing 4 mg/ml ONPG and 0.8 mL of the Z-buffer are added and uniformly mixed, followed by being static at 37° C., and recording the starting time of the reaction. When the system appears light yellow, 1 mL of 1M Na.sub.2CO.sub.3 aqueous solution is added to terminate the reaction, and the termination time of the reaction is recorded. An OD.sub.420nm value is determined by an ultraviolet spectrophotometer.

(117) Above steps are performed in the LAC control, which functions as a blank control for the OD.sub.420nm value determined by an ultraviolet spectrophotometer.

(118) The activity of β-galactosidase (Miller Unit) is calculated as follows:
=1000×OD.sub.420nm/(OD.sub.600nm×t×V);

(119) t, referred to a reaction time (the difference between the termination time and starting time of the reaction, min); V, referred to a loading volume, 0.05 mL.

(120) The activity of β-galactosidase is defined as the amount of the enzyme that is required for decomposing 1 μmol of ONPG by one cell per minute.

(121) Each of the strains is measured for three times, and a mean and a standard deviation are taken.

(122) The results are shown in Table 1. Above steps are performed in different test strains, and the activities of the corresponding β-galactosidases appear significant differences, wherein the enzyme activity of LAC1627 is significantly higher than that of each of the other strains.

(123) TABLE-US-00015 TABLE 1 Test strains Enzyme Activity (Miller Unit) LAC914 47.72 ± 3.33 LAC1630 26.17 ± 2.71 LAC1629 31.20 ± 1.17 LAC1628 16.11 ± 1.67 LAC1627 132.09 ± 4.61  LAC913 22.59 ± 4.23

Example 3. The Expression of the Gfp Gene Under Regulation of an Attenuator Mutant

(124) I. Construction of Recombinant Plasmids

(125) The following six recombinant plasmids are constructed: pACYC184-P.sub.PL-thrLA-gfp914, pACYC184-P.sub.PL-thrLA-gfp1630, pACYC184-P.sub.PL-thrLA-gfp1629, pACYC184-P.sub.PL-thrLA-gfp1628, pACYC184-P.sub.PL-thrLA-gfp1627 and pACYC184-P.sub.PL-thrLA-gfp913.

(126) The pACYC184-P.sub.PL-thrLA-gfp914 only differs from the pACYC184-P.sub.PL-thrLA-lacZ914 in a substitution of a specific DNA molecule X for the lacZ gene shown by SEQ ID No: 15 of the sequence listing.

(127) The pACYC184-P.sub.PL-thrLA-gfp1630 only differs from the pACYC184-P.sub.PL-thrLA-lacZ1630 in a substitution of a specific DNA molecule X for the lacZ gene shown by SEQ ID No: 15 of the sequence listing.

(128) The pACYC184-P.sub.PL-thrLA-gfp1629 only differs from the pACYC184-P.sub.PL-thrLA-lacZ1629 in a substitution of a specific DNA molecule X for the lacZ gene shown by SEQ ID No: 15 of the sequence listing.

(129) The pACYC184-P.sub.PL-thrLA-gfp1628 only differs from the pACYC184-P.sub.PL-thrLA-lacZ1628 in a substitution of a specific DNA molecule X for the lacZ gene shown by SEQ ID No: 15 of the sequence listing.

(130) The pACYC184-P.sub.PL-thrLA-gfp1627 only differs from the pACYC184-P.sub.PL-thrLA-lacZ1627 in a substitution of a specific DNA molecule X for the lacZ gene shown by SEQ ID No: 15 of the sequence listing.

(131) The pACYC184-P.sub.PL-thrLA-gfp913 only differs from the pACYC184-P.sub.PL-thrLA-lacZ913 in a substitution of a specific DNA molecule X for the lacZ gene shown by SEQ ID No: 15 of the sequence listing.

(132) The specific DNA molecule X is: the nucleotide at position 22 from the beginning to the nucleotide at position 10 from the end of the PCR amplification product obtained by performing a PCR amplification using the pAD123 plasmid as a template and using a primer pair comprised of WY1751 and WY1748 (which having the gfp gene shown by SEQ ID No: 16 of the sequence listing).

(133) TABLE-US-00016 WY1751: TTG GGTTCTGGTTCTGGTTCT ATGAGTAAAGGAGAAGAAC TTTTCACT; WY1748: CGCGGATCCCTTGCATGCCTGCAGGAGAT.

(134) II. Construction of Recombinant Bacteria

(135) Recombinant bacteria is obtained by introducing pACYC184-P.sub.PL-thrLA-gfp914 into E. coli K-12 W3110ΔmetAΔilvAΔlysAΔtdhΔtdcCΔsstT, and named as GFP914.

(136) Recombinant bacteria is obtained by introducing pACYC184-P.sub.PL-thrLA-gfp1630 into E. coli K-12 W3110ΔmetAΔilvAΔlysAΔtdhΔtdcCΔsstT, and named as GFP1630.

(137) Recombinant bacteria is obtained by introducing pACYC184-P.sub.PL-thrLA-gfp1629 into E. coli K-12 W3110ΔmetAΔilvAΔlysAΔtdhΔtdcCΔsstT, and named as GFP1629.

(138) Recombinant bacteria is obtained by introducing pACYC184-P.sub.PL-thrLA-gfp1628 into E. coli K-12 W3110ΔmetAΔilvAΔlysAΔtdhΔtdcCΔsstT, and named as GFP1628.

(139) Recombinant bacteria is obtained by introducing pACYC184-P.sub.PL-thrLA-gfp1627 into E. coli K-12 W3110ΔmetAΔilvAΔlysAΔtdhΔtdcCΔsstT, and named as GFP1627.

(140) Recombinant bacteria is obtained by introducing pACYC184-P.sub.PL-thrLA-gfp913 into E. coli K-12 W3110ΔmetAΔilvAΔlysAΔtdhΔtdcCΔsstT, and named as GFP913.

(141) Recombinant bacteria is obtained by introducing the plasmid pACYC184 into E. coli K-12 W3110ΔmetAΔilvAΔlysAΔtdhΔtdcCΔsstT, and named as GFP control.

(142) III. Analysis of the Expression of GFP in Cell Populations by a Flow Cytometer

(143) The test strain is: GFP914, GFP1630, GFP1629, GFP1628, GFP1627, GFP913 or the GFP control (a blank control).

(144) 1. The test strain is seeded into a liquid LB medium containing 34 mg/L chloramphenicol, followed by shaking culture for 2 h at 37° C., 220 rpm, and then centrifugation and collection of the bacteria.

(145) 2. The bacteria obtained in step 1 is suspended with a PBS buffer solution at pH7.2, and a bacterial suspension having an OD.sub.600nm value of 0.5 is obtained.

(146) 3. The bacterial suspension obtained in step 2 is counted by a flow cytometer (FACSCalibur type, BD company of the United States) for 50,000 cells, and the experimental results are analyzed by using the FlowJ software.

(147) The corresponding result of each of the test strains is shown in FIG. 1 and Table 2 (a mean of 50,000 cells). In FIG. 1, GFP1627, GFP913, GFP914, GFP1630, GFP1629, GFP1628 and the GFP control are respectively exhibited, from right to left, in fluorescence distribution curves of flora. The fluorescence level of the GFP1627 is improved by 30-1280 folds over other strains.

(148) TABLE-US-00017 TABLE 2 Mean Fluorescence Intensity GFP914 50.55 GFP1630 39.15 GFP1629 28.45 GFP1628 1.40 GFP1627 1798.40 GFP913 57.95

Example 4. Preparation of Alanine

(149) I. Construction of Recombinant Plasmids

(150) 1. The double-stranded DNA molecule shown by SEQ ID No: 13 of the sequence listing is synthesized.

(151) 2. A PCR amplification product is obtained by performing a PCR amplification using the double-stranded DNA molecule synthesized in step 1 as a template and using a primer pair comprised of WY843 and WY1760.

(152) 3. The enzymatically cleaved product of the PCR amplification product obtained in step 2, after being subjected to a double enzymatic cleavage using restriction endonucleases Xba I and BamH I, is recovered.

(153) 4. The vector backbone (about 3.8 kb) of the plasmid pACYC184, after being subjected to a double enzymatic cleavage using restriction endonucleases Xba I and BamH I, is recovered.

(154) 5. A recombinant plasmid pACYC184-P.sub.PL2 is obtained by linking the enzymatically cleaved product in step 3 and the vector backbone in step 4.

(155) 6. A PCR amplification product is obtained by performing a PCR amplification using the genome DNA of Bacillus subtilis W168 as a template and using a primer pair comprised of WY1785 and WY1778.

(156) 7. A PCR amplification product is obtained by performing a PCR amplification using the genome DNA of Bacillus subtilis W168 as a template and using a primer pair comprised of WY1786 and WY1778.

(157) 8. The vector backbone (about 4.2 kb) of the recombinant plasmid pACYC184-P.sub.PL2, after being subjected to a double enzymatic cleavage using restriction endonucleases BamH I and Sph I, is recovered.

(158) 9. The enzymatically cleaved product of the PCR amplification product obtained in step 6, after being subjected to a double enzymatic cleavage using restriction endonucleases BamH I and Sph I, is recovered.

(159) 10. A recombinant plasmid is obtained by linking the enzymatically cleaved product in step 9 and the vector backbone in step 8, and named as pACYC184-P.sub.PL-ald.sub.WT. According to the sequencing result, a structural description for the pACYC184-P.sub.PL-ald.sub.WT is set forth as follows: a specific DNA molecule I is inserted between the enzymatic cleavage sites of Xba I and Sph I of the plasmid pACYC184; and the DNA molecule I sequentially consists, from upstream to downstream, of the following elements: the promoter P.sub.PL shown by SEQ ID No: 13 of the sequence listing, a recognition sequence for enzymatic cleavage by restriction endonuclease BamH I, and the double-stranded DNA molecule shown by SEQ ID No: 17 of the sequence listing.

(160) 11. The enzymatically cleaved product of the PCR amplification product obtained in step 7, after being subjected to a double enzymatic cleavage using restriction endonucleases BamH I and Sph I, is recovered.

(161) 12. A recombinant plasmid is obtained by linking the enzymatically cleaved product in step 11 and the vector backbone in step 8, and named as pACYC184-P.sub.PL-ald.sub.5UTRthrA. According to the sequencing result, a structural description for the pACYC184-P.sub.PL-ald.sub.5UTRthrA is set forth as follows: a specific DNA molecule II is inserted between the enzymatic cleavage sites of Xba I and Sph I of the plasmid pACYC184; and the DNA molecule II sequentially consists, from upstream to downstream, of the following elements: the promoter P.sub.PL shown by SEQ ID No: 13 of the sequence listing, a recognition sequence for enzymatic cleavage by restriction endonuclease BamH I, and the double-stranded DNA molecule shown by SEQ ID No: 18 of the sequence listing.

(162) TABLE-US-00018 WY843: TGCTCTAGACAATTCCGACGTCTAAGAAA; WY1760: CGCGGATCCGGTCAGTGCGTCCTGCTGAT; WY1785: CGCGGATCCCACATATACAGGAGGAGACAGA; WY1786: CGCGGATCCGTGCGGGCTTTTTTTTTCGACCAAAGGTAACGA GGTAACAACCATGATCATAGGGGTTCCTAAAGA; WY1778: ACATGCATGCGTCATAATTCGTGAAATGGTCTCT.

(163) II. Construction of Engineered Bacteria for Alanine

(164) Recombinant bacteria is obtained by introducing pACYC184-P.sub.PL-ald.sub.WT into E. coli K12 W3110, and named as E. coli K-12 W3110/pACYC184-P.sub.PL-ald.sub.WT.

(165) Recombinant bacteria is obtained by introducing pACYC184-P.sub.PL-ald.sub.5UTRthrA into E. coli K12 W3110, and named as E. coli K-12 W3110/pACYC184-P.sub.PL-ald.sub.5UTRthrA.

(166) Recombinant bacteria is obtained by introducing pACYC184 plasmid into E. coli K12 W3110, and named as E. coli K-12 W3110/pACYC184.

(167) III. Fermentation of Engineered Bacteria for Alanine in a Shake Flask

(168) The test strain is: E. coli K-12 W3110/pACYC184-P.sub.PL-ald.sub.WT, E. coli K-12 W3110/pACYC184-P.sub.PL-ald.sub.5UTRthrA or E. coli K-12 W3110/pACYC184.

(169) 1. The test strain is streaked onto a solid LB medium plate containing 34 mg/L chloramphenicol, followed by static culture for 12 h at 37° C.

(170) 2. After completion of step 1, a bacterial lawn on the plate is picked and seeded into 3 mL of a liquid LB medium, followed by shaking culture for 12 h at 37° C., 220 rpm, and a seed solution is obtained.

(171) 3. After completion of step 2, the seed solution is seeded into 30 mL of a fermentation medium in a seeding amount of 3%, followed by shaking culture at 37° C., 220 rpm.

(172) The fermentation medium is: glucose 20.0 g/L, yeast powders 2.0 g/L, peptone 4 g/L, ammonium sulfate 6.0 g/L, potassium dihydrogen phosphate 2.0 g/L, magnesium sulfate heptahydrate 1.0 g/L, betaine 1.0 g/L, calcium carbonate 15.0 g/L, microelement mixture 1 mL/L, and water as the remainder.

(173) The microelement mixture is: FeSO.sub.4.7H.sub.2O10 g/L, CaCl.sub.21.35 g/L, ZnSO.sub.4.7H.sub.2O 2.25 g/L, MnSO.sub.4.4H.sub.2O 0.5 g/L, CuSO.sub.4.5H.sub.2O 1 g/L, (NH.sub.4).sub.6Mo.sub.7O.sub.24.4H.sub.2O 0.106 g/L, Na.sub.2B.sub.4O.sub.7.10H.sub.2O 0.23 g/L, CoCl.sub.2.6H.sub.2O 0.48 g/L, 35% HCl 10 mL/L, and water as the remainder.

(174) During the culture, ammoniacal liquor is used to adjust the pH value of the reaction system to make it maintain at 6.8-7.0.

(175) During the culture, sampling is made once every 3-4 h to detect the content of glucose by using a biosensor analyzer SBA-40D. When the content of glucose in the system is less than 5 g/L, glucose is supplemented to make the concentration of glucose in the system up to 10 g/L.

(176) Sampling is made after culture for 12 h and 48 h respectively, followed by centrifugation at 12,000 g for 2 min. The supernatant is taken for detection of the concentration of L-alanine.

(177) After culture for 12 h and 48 h, the concentrations of L-alanine in the fermented supernatants are shown in FIG. 2 and Table 3 (by a mean±standard deviation from repeated tests in triplicate).

(178) TABLE-US-00019 TABLE 3 Concentritions of L-alanine in fermented supernatant (g/L) culture for 12 h culture for 48 h E. coli K-12 2.9 ± 0.1 9.9 ± 0.2 W3110/pACYC184-P.sub.PL-ald.sub.WT E. coli K-12 5.8 ± 0.3 14.0 ± 0.9  W3110/pACYC184-P.sub.PL-ald.sub.5UTRthrA E. coli K-12 W3110/pACYC184 0.4 ± 0.1 0.5 ± 0.1

(179) After culture for 12 h, the concentration of L-alanine prepared by using the engineered bacteria E. coli K-12 W3110/pACYC184-P.sub.PL-ald.sub.5UTRthrA with regulation of the expression of the ald gene by the 5′-untranslated region expressing element as screened by the present invention is improved by 98.6%, compared with that of the control strain E. coli K-12 W3110/pACYC184-P.sub.PL-ald.sub.WT. After culture for 48 h, the concentration of L-alanine prepared by using the engineered bacteria E. coli K-12 W3110/pACYC184-P.sub.PL-ald.sub.5UTRthrA with regulation of the expression of the ald gene by the 5′-untranslated region expressing element as screened by the present invention is improved by 40.8%, compared with that of the control strain E. coli K-12 W3110/pACYC184-P.sub.PL-ald.sub.WT. These demonstrate that using the 5′-untranslated region expressing element provided by the present invention can significantly improve the fermentation yield of alanine.

(180) A method for detecting the content of L-alanine in fermented broth is: HPLC, which is optimized based on the method for detecting amino acids in a reference (Amino Acids & Biotic Resources, 2000, 22, 59-60), and the method is particularly presented as follows (HPLC coupled to pre-column derivatization with 2, 4-dinitrofluorobenzene (FDBN)):

(181) First, 10 μL of the supernatant is taken into a 2 mL centrifuge tube, into which 200 μL of 0.5M NaHCO.sub.3 aqueous solution and 100 μL of 1% (v/v) FDBN-acetonitrile solution are added. Next, the centrifuge tube is placed in a water bath to be heated at a constant temperature of 60° C. for 60 min in the dark, then cooled to the room temperature, into which 700 μL of 0.04 mol/L KH.sub.2PO.sub.4 aqueous solution (pH=7.2±0.05; the pH is adjusted with 40 g/L KOH aqueous solution) is added, and shaken well. After being static for 15 min, filtration is performed and filtrates are collected. The filtrates are for injection, and injection volume is 15 μL.

(182) C18 column (ZORBAX Eclipse XDB-C18, 4.6*150 mm, Agilent, USA) is used as the chromatographic column; column temperature: 40° C.; UV detection wavelength: 360 nm; mobile phase A: 0.04 mol/L KH.sub.2PO.sub.4 aqueous solution (pH=7.2±0.05; the pH is adjusted with 40 g/100 mL KOH aqueous solution), mobile phase B: 55% (v/v) acetonitrile aqueous solution, and total flux of the mobile phases: 1 mL/min.

(183) The process of elution is presented as follows: at the starting time of elution (0 min), the mobile phase A accounts for 86% by volume of the total flux of the mobile phases, and mobile phase B for 14%; the process of elution is divided into 4 stages, and in each stage, parts by volume of the mobile phase A and the mobile phase B accounting for the total flux of the mobile phases appear a linear variation; when the first stage (a total duration of 2 min from the starting time) ends, the mobile phase A accounts for 88% by volume of the total flux of the mobile phases, and mobile phase B for 12%; when the second stage (a total duration of 2 min from the ending time for the first stage) ends, the mobile phase A accounts for 86% by volume of the total flux of the mobile phases, and mobile phase B for 14%; when the third stage (a total duration of 6 min from the ending time for the second stage) ends, the mobile phase A accounts for 70% by volume of the total flux of the mobile phases, and the mobile phase B for 30%; when the fourth stage (a total duration of 10 min from the ending time for the third stage) ends, the mobile phase A accounts for 30% by volume of the total flux of the mobile phases, and mobile phase B for 70%.

(184) A standard curve is depicted by using the commercially available L-alanine as the standard, and the concentration of L-alanine in a sample is calculated.

Example 5. Preparation of Threonine

(185) I. Preparation of thrA Mutant Gene

(186) 1. A PCR amplification product is obtained by performing a PCR amplification using the genome of the E. coli K12 W3110 as a template and using a primer pair comprised of WY914 and WY926.

(187) 2. A PCR amplification product is obtained by performing a PCR amplification using the genome of the E. coli K12 W3110 as a template and using a primer pair comprised of WY925 and WY832.

(188) 3. A PCR amplification product is obtained by performing a PCR amplification using a mixture of the PCR amplification product obtained in step 1 and the PCR amplification product obtained in step 2 as a template and using a primer pair comprised of WY914 and WY832.

(189) After sequencing, the nucleotides between the recognition sites for enzymatic cleavage by restriction endonucleases Hind III and EcoR V of the PCR amplification product obtained in step 3 are shown by positions 172-5132 of SEQ ID No: 20 of the sequence listing. In SEQ ID No: 20 of the sequence listing, the nucleotides at positions 337-2799 code for the ThrA*protein; the nucleotides at positions 2801-3733 code for the ThrB protein; and the nucleotides at positions 3734-5020 code for the ThrC protein. The ThrA*protein (a mutant protein) is shown by SEQ ID No: 21 of the sequence listing. As compared with the ThrA protein (a wild-type protein), the mutant protein only differs in one amino acid residue, that is, the amino acid residue at position 253 is mutated to histidine from glutamic acid. The ThrB protein is shown by SEQ ID No: 22 of the sequence listing. The ThrC protein is shown by SEQ ID No: 23 of the sequence listing.

(190) TABLE-US-00020   WY914: CCCAAGCTTACAGAGTACACAACATCCATG;   WY925:      WY926:      WY832: CCCGATATCGCATTTATTGAGAATTTCTCC.

(191) II. Construction of Recombinant Plasmid Having the thrA Mutant Gene

(192) 1. The vector backbone (about 4.2 kb) of the recombinant plasmid pACYC184-P.sub.PL, after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and EcoR V, is recovered.

(193) 2. The enzymatically cleaved product of the PCR amplification product obtained in 3 of step I, after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and EcoR V, is recovered.

(194) 3. A recombinant plasmid pACYC184-P.sub.PL-thrLA*BC914 is obtained by linking the vector backbone in step 1 and the enzymatically cleaved product in step 2. According to the sequencing result, a structural description for the recombinant plasmid pACYC184-P.sub.PL-thrLA*BC914 is set forth as follows: a specific DNA molecule I is inserted between the enzymatic cleavage sites of Xba I and EcoR V of the plasmid pACYC184; and the specific DNA molecule I sequentially consists, from upstream to downstream, of the following elements: the promoter P.sub.PL shown by SEQ ID No: 13 of the sequence listing, a recognition sequence for enzymatic cleavage by restriction endonuclease Hind III, and a DNA molecule shown by the nucleotides at positions 172-5132 of SEQ ID No: 20 of the sequence listing.

(195) 4. Preparation of recombinant plasmid pACYC184-P.sub.PL-thrLA*BC1630. According to the sequencing result, a structural description for the recombinant plasmid pACYC184-P.sub.PL-thrLA*BC1630 is set forth as follows: a specific DNA molecule II is inserted between the enzymatic cleavage sites of Xba I and EcoR V of the plasmid pACYC184; and the specific DNA molecule II sequentially consists, from upstream to downstream, of the following elements: the promoter P.sub.PL shown by SEQ ID No: 13 of the sequence listing, a recognition sequence for enzymatic cleavage by restriction endonuclease Hind III, and a DNA molecule shown by the nucleotides at positions 198-5132 of SEQ ID No: 20 of the sequence listing.

(196) 5. Preparation of recombinant plasmid pACYC184-P.sub.PL-thrLA*BC1629. According to the sequencing result, a structural description for the recombinant plasmid pACYC184-P.sub.PL-thrLA*BC1629 is set forth as follows: a specific DNA molecule III is inserted between the enzymatic cleavage sites of Xba I and EcoR V of the plasmid pACYC184; and the specific DNA molecule III sequentially consists, from upstream to downstream, of the following elements: the promoter P.sub.PL shown by SEQ ID No: 13 of the sequence listing, a recognition sequence for enzymatic cleavage by restriction endonuclease Hind III, and a DNA molecule shown by the nucleotides at positions 236-5132 of SEQ ID No: 20 of the sequence listing.

(197) 6. Preparation of recombinant plasmid pACYC184-P.sub.PL-thrLA*BC1628. According to the sequencing result, a structural description for the recombinant plasmid pACYC184-P.sub.PL-thrLA*BC1628 is set forth as follows: a specific DNA molecule IV is inserted between the enzymatic cleavage sites of Xba I and EcoR V of the plasmid pACYC184; and the specific DNA molecule IV sequentially consists, from upstream to downstream, of the following elements: the promoter P.sub.PL shown by SEQ ID No: 13 of the sequence listing, a recognition sequence for enzymatic cleavage by restriction endonuclease Hind III, and a DNA molecule shown by the nucleotides at positions 256-5132 of SEQ ID No: 20 of the sequence listing.

(198) 7. Preparation of recombinant plasmid pACYC184-P.sub.PL-thrLA*BC1627. According to the sequencing result, a structural description for the recombinant plasmid pACYC184-P.sub.PL-thrLA*BC1627 is set forth as follows: a specific DNA molecule V is inserted between the enzymatic cleavage sites of Xba I and EcoR V of the plasmid pACYC184; and the specific DNA molecule V sequentially consists, from upstream to downstream, of the following elements: the promoter P.sub.PL shown by SEQ ID No: 13 of the sequence listing, a recognition sequence for enzymatic cleavage by restriction endonuclease Hind III, and a DNA molecule shown by the nucleotides at positions 294-5132 of SEQ ID No: 20 of the sequence listing.

(199) 8. Preparation of recombinant plasmid pACYC184-P.sub.PL-thrLA*BC913. According to the sequencing result, a structural description for the recombinant plasmid pACYC184-P.sub.PL-thrLA*BC913 is set forth as follows: a specific DNA molecule VI is inserted between the enzymatic cleavage sites of Xba I and EcoR V of the plasmid pACYC184; and the specific DNA molecule VI sequentially consists, from upstream to downstream, of the following elements: the promoter P.sub.PL shown by SEQ ID No: 13 of the sequence listing, a recognition sequence for enzymatic cleavage by restriction endonuclease Hind III, and a DNA molecule shown by the nucleotides at positions 310-5132 of SEQ ID No: 20 of the sequence listing.

(200) III. Construction of Recombinant Bacteria

(201) Recombinant bacteria is obtained by introducing pACYC184-P.sub.PL-thrLA*BC914 into E. coli K-12 W3110ΔmetAΔilvAΔlysAΔtdhΔtdcCΔsstT, and named as TA914.

(202) Recombinant bacteria is obtained by introducing pACYC184-P.sub.PL-thrLA*BC1630 into E. coli K-12 W3110ΔmetAΔilvAΔlysAΔtdhΔtdcCΔsstT, and named as TA1630.

(203) Recombinant bacteria is obtained by introducing pACYC184-P.sub.PL-thrLA*BC1629 into E. coli K-12 W3110ΔmetA ΔilvAΔlysAΔtdhΔtdcCΔsstT, and named as TA1629.

(204) Recombinant bacteria is obtained by introducing pACYC184-P.sub.PL-thrLA*BC1628 into E. coli K-12 W3110ΔmetAΔilvAΔlysAΔtdhΔtdcCΔsstT, and named as TA1628.

(205) Recombinant bacteria is obtained by introducing pACYC184-P.sub.PL-thrLA*BC1627 into E. coli K-12 W3110ΔmetA ΔilvAΔlysAΔtdhΔtdcCΔsstT, and named as TA1627.

(206) Recombinant bacteria is obtained by introducing pACYC184-P.sub.PL-thrLA*BC913 into E. coli K-12 W3110ΔmetAΔilvAΔlysAΔtdhΔtdcCΔsstT, and named as TA913.

(207) Recombinant bacteria is obtained by introducing pACYC184 plasmid into E. coli K-12 W3110ΔmetAΔilvAΔlysAΔtdhΔtdcCΔsstT, and named as TA control.

(208) IV. Fermentation Test of Engineered Bacteria for Threonine in a Shake Flask

(209) The test strain is: TA914, TA1630, TA1629, TA1628, TA1627, TA913 or the TA control.

(210) 1. The test strain is streaked onto a solid LB medium plate containing 34 mg/L chloramphenicol, followed by static culture for 12 h at 37° C.

(211) 2. After completion of step 1, a bacterial lawn on the plate is picked and seeded onto a LB medium slant, followed by static culture for 10-12 h at 37° C.

(212) 3. After completion of step 2, a bacterial lawn on the plate is picked and seeded into a liquid LB medium, followed by shaking culture for 12 h at 37° C., 220 rpm.

(213) 4. After completion of step 3, the seed solution is seeded into a fermentation medium in a seeding amount of 3%, followed by shaking culture at 37° C., 220 rpm.

(214) The fermentation medium is: glucose 20.0 g/L, ammonium sulfate 15.0 g/L, potassium dihydrogen phosphate 2.0 g/L, magnesium sulfate heptahydrate 2.0 g/L, yeast powders 2.0 g/L, isoleucine 0.6 g/L, methionine 0.6 g/L, lysinehydrochloride 1.2 g/L, calcium carbonate 15.0 g/L, microelement mixture 5 mL/L, and water as the remainder.

(215) The microelement mixture is: FeSO.sub.4.7H.sub.2O 10 g/L, CaCl.sub.21.35 g/L, ZnSO.sub.4.7H.sub.2O 2.25 g/L, MnSO.sub.4.4H.sub.2O 0.5 g/L, CuSO.sub.4.5H.sub.2O 1 g/L, (NH.sub.4).sub.6Mo.sub.7O.sub.24.4H.sub.2O 0.106 g/L, Na.sub.2B.sub.4O.sub.7-10H.sub.2O 0.23 g/L, CoCl.sub.2.6H.sub.2O 0.48 g/L, 35% HCl 10 mL/L, and water as the remainder.

(216) During the culture, ammoniacal liquor is used to adjust the pH value of the reaction system to make it maintain at 6.8-7.0.

(217) During the culture, sampling is made once every 3-4 h to detect the content of glucose by using a biosensor analyzer SBA-40D. When the content of glucose in the system is less than 5 g/L, glucose is supplemented to make the concentration of glucose in the system up to 10 g/L.

(218) Sampling is made after culture for 24 h, followed by centrifugation at 12,000 g for 2 min. The supernatant is taken for detection of the concentration of threonine.

(219) The results are shown in Table 4 (by a mean±standard deviation from repeated tests in triplicate). TA1627 has the highest capability for producing threonine, and the concentration of threonine in the fermented supernatant is up to 9.52±1.35.

(220) TABLE-US-00021 TABLE 4 Concentritions of threonine in fermented supernatant (g/L) TA913 5.46 ± 0.53 TA914 6.11 ± 0.41 TA1627 9.52 ± 1.35 TA1628 0.57 ± 0.11 TA1629 2.22 ± 0.03 TA1630 3.15 ± 0.35 TA control 0.21 ± 0.07

(221) A method for detecting the concentration of threonine is: HPLC, which is optimized based on the method for detecting amino acids in a reference (Amino Acids & Biotic Resources, 2000, 22, 59-60), and the method is particularly presented as follows (HPLC coupled to pre-column derivatization with 2, 4-dinitrofluorobenzene (FDBN)):

(222) First, 10 μL of the supernatant is taken into a 2 mL centrifuge tube, into which 200 μL of 0.5M NaHCO.sub.3 aqueous solution and 100 μL of 1% (v/v) FDBN-acetonitrile solution are added. Next, the centrifuge tube is placed in a water bath to be heated at a constant temperature of 60° C. for 60 min in the dark, then cooled to the room temperature, into which 700 μL of 0.04 mol/L KH.sub.2PO.sub.4 aqueous solution (pH=7.2±0.05; the pH is adjusted with 40 g/L KOH aqueous solution) is added, and shaken well. After being static for 15 min, filtration is performed and filtrates are collected. The filtrates are for injection, and injection volume is 15 μL.

(223) C18 column (ZORBAX Eclipse XDB-C18, 4.6*150 mm, Agilent, USA) is used as the chromatographic column; column temperature: 40° C.; UV detection wavelength: 360 nm; mobile phase A: 0.04 mol/L KH.sub.2PO.sub.4 aqueous solution (pH=7.2±0.05; the pH is adjusted with 40 g/100 mL KOH aqueous solution), mobile phase B: 55% (v/v) acetonitrile aqueous solution, and total flux of the mobile phases: 1 mL/min.

(224) The process of elution is presented as follows: at the starting time of elution (0 min), the mobile phase A accounts for 86% by volume of the total flux of the mobile phases, and mobile phase B for 14%; the process of elution is divided into 4 stages, and in each stage, parts by volume of the mobile phase A and the mobile phase B accounting for the total flux of the mobile phases appear a linear variation; when the first stage (a total duration of 2 min from the starting time) ends, the mobile phase A accounts for 88% by volume of the total flux of the mobile phases, and mobile phase B for 12%; when the second stage (a total duration of 2 min from the ending time for the first stage) ends, the mobile phase A accounts for 86% by volume of the total flux of the mobile phases, and mobile phase B for 14%; when the third stage (a total duration of 6 min from the ending time for the second stage) ends, the mobile phase A accounts for 70% by volume of the total flux of the mobile phases, and the mobile phase B for 30%; when the fourth stage (a total duration of 10 min from the ending time for the third stage) ends, the mobile phase A accounts for 30% by volume of the total flux of the mobile phases, and mobile phase B for 70%.

(225) A standard curve is depicted by using the commercially available L-threonine as the standard (available from Sigma, designated as Item No. 8917), and the concentration of threonine in a sample is calculated.

Example 6. Construction of E. coli K-12 W3110ΔmetAΔlysAΔtdhΔtdcC

(226) Chassis engineered bacteria is obtained by sequentially knocking out the metA gene (a gene coding for homoserine transsuccinylase), the lysA gene (a gene coding for diaminopimelic acid decarboxylase), the tdh gene (a gene coding for threonine dehydratase) and the tdcC gene (a gene coding for threonine absortion and transport protein), with the E. coli K12 W3110 as the starting bacteria strain, and named as E. coli K-12 W3110ΔmetAΔlysAΔtdhΔtdcC.

(227) 1. Knockout of the metA Gene

(228) (1) A DNA fragment I-A (a region upstream of the metA gene) is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 W3110 as a template and using a primer pair comprised of WY569 and WY570.

(229) (2) A DNA fragment I-B (a region downstream of the metA gene) is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 W3110 as a template and using a primer pair comprised of WY571 and WY572.

(230) (3) A DNA fragment I-C is obtained by performing a PCR amplification using a mixture of the DNA fragment I-A and the DNA fragment I-B as a template and using a primer pair comprised of WY569 and WY572.

(231) (4) The vector backbone (about 5.6 kb) of the plasmid pKOV, after being subjected to a double enzymatic cleavage using the restriction endonucleases Sal I and Not I, is recovered.

(232) (5) The enzymatically cleaved product of the DNA fragment I-C, after being subjected to a double enzymatic cleavage using the restriction endonucleases Sal I and Not I, is recovered.

(233) (6) A recombinant plasmid I is obtained by linking the vector backbone obtained in step (4) and the enzymatically cleaved product obtained in step (5). According to the sequencing result, a structural description for the recombinant plasmid I is set forth as follows: the following specific DNA molecule is inserted between the enzymatic cleavage sites of Sal I and Not I of the plasmid pKOV: sequentially consisting, from upstream to downstream, of the upstream section shown by the nucleotides at positions 245-751 of SEQ ID No: 1 of the sequence listing and the downstream section shown by the nucleotides at positions 1682-2154 of SEQ ID No: 1 of the sequence listing. The metA gene is shown by SEQ ID No: 1 of the sequence listing, wherein the open reading frame is shown by the nucleotides at positions 752-1681 (coding for the metA protein shown by SEQ ID No: 2 of the sequence listing).

(234) (7) Recombinant bacteria with metA gene knocked out are obtained by introducing the recombinant plasmid I into the E. coli K12 W3110 and named as E. coli K12 W3110ΔmetA.

(235) A method for identyfing the recombinant bacteria with metA gene knocked out is that: a PCR amplification is performed using a primer pair comprised of WY583 and WY584; if an amplification product with 1375 bp is obtained, the recombinant bacteria preliminarily can be determined as a candidate for the target bacteria; and sequencing will be further performed to verify that the open reading frame of the metA gene on the chromosomes of the bacteria has been knocked out.

(236) 2. Knockout of the lysA Gene

(237) (1) A DNA fragment III-A (a region upstream of the lysA gene) is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 W3110 as a template and using a primer pair comprised of WY573 and WY574.

(238) (2) A DNA fragment III-B (a region downstream of the lysA gene) is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 W3110 as a template and using a primer pair comprised of WY575 and WY576.

(239) (3) A DNA fragment III-C is obtained by performing a PCR amplification using a mixture of the DNA fragment III-A and the DNA fragment III-B as a template and using a primer pair comprised of WY573 and WY576.

(240) (4) The vector backbone (about 5.6 kb) of the plasmid pKOV, after being subjected to a double enzymatic cleavage using the restriction endonucleases BamH I and Not I, is recovered.

(241) (5) The enzymatically cleaved product of the DNA fragment III-C, after being subjected to a double enzymatic cleavage using the restriction endonucleases BamH I and Not I, is recovered.

(242) (6) A recombinant plasmid III is obtained by linking the vector backbone obtained in step (4) and the enzymatically cleaved product obtained in step (5). According to the sequencing result, a structural description for the recombinant plasmid III is set forth as follows: the following specific DNA molecule is inserted between the enzymatic cleavage sites of BamH I and Not I of the plasmid pKOV: sequentially consisting, from upstream to downstream, of the upstream section shown by the nucleotides at positions 132-638 of SEQ ID No: 5 of the sequence listing and the downstream section shown by the nucleotides at positions 1902-2445 of SEQ ID No: 5 of the sequence listing. The lysA gene is shown by SEQ ID No: 5 of the sequence listing, wherein the open reading frame is shown by the nucleotides at positions 639-1901 (coding for the lysA protein shown by SEQ ID No: 6 of the sequence listing).

(243) (7) Recombinant bacteria with lysA gene knocked out are obtained by introducing the recombinant plasmid III into the E. coli K-12 W3110ΔmetA, and named as E. coli K-12 W3110ΔmetAΔlysA.

(244) A method for identyfing the recombinant bacteria with lysA gene knocked out is that: a PCR amplification is performed using a primer pair comprised of WY585 and WY586; if an amplification product with 1302 bp is obtained, the recombinant bacteria preliminarily can be determined as a candidate for the target bacteria; and sequencing will be further performed to verify that the open reading frame of the lysA gene on the chromosomes of the bacteria has been knocked out.

(245) 3. Knockout of the Tdh Gene

(246) (1) A DNA fragment IV-A (a region upstream of the tdh gene) is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 W3110 as a template and using a primer pair comprised of WY598 and WY599.

(247) (2) A DNA fragment IV-B (a region downstream of the tdh gene) is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 W3110 as a template and using a primer pair comprised of WY600 and WY601.

(248) (3) A DNA fragment IV-C is obtained by performing a PCR amplification using a mixture of the DNA fragment IV-A and the DNA fragment IV-B as a template and using a primer pair comprised of WY598 and WY601.

(249) (4) The vector backbone (about 5.6 kb) of the plasmid pKOV, after being subjected to a double enzymatic cleavage using the restriction endonucleases BamH I and Not I, is recovered.

(250) (5) The enzymatically cleaved product of the DNA fragment IV-C, after being subjected to a double enzymatic cleavage using the restriction endonucleases BamH I and Not I, is recovered.

(251) (6) A recombinant plasmid IV is obtained by linking the vector backbone obtained in step (4) and the enzymatically cleaved product obtained in step (5). According to the sequencing result, a structural description for the recombinant plasmid IV is set forth as follows: the following specific DNA molecule is inserted between the enzymatic cleavage sites of BamH I and Not I of the plasmid pKOV: sequentially consisting, from upstream to downstream, of the upstream section shown by the nucleotides at positions 227-752 of SEQ ID No: 7 of the sequence listing and the downstream section shown by the nucleotides at positions 1779-2271 of SEQ ID No: 7 of the sequence listing. The tdh gene is shown by SEQ ID No: 7 of the sequence listing, wherein the open reading frame is shown by the nucleotides at positions 753-1778 (coding for the tdh protein shown by SEQ ID No: 8 of the sequence listing).

(252) (7) Recombinant bacteria with tdh gene knocked out are obtained by introducing the recombinant plasmid IV into the E. coli K-12 W3110ΔmetAΔlysA, and named as E. coli K-12 W3110ΔmetAΔlysAΔtdh.

(253) A method for identyfing the recombinant bacteria with tdh gene knocked out is that: a PCR amplification is performed using a primer pair comprised of WY602 and WY603; if an amplification product with 1434 bp is obtained, the recombinant bacteria preliminarily can be determined as a candidate for the target bacteria; and sequencing will be further performed to verify that the open reading frame of the tdh gene on the chromosomes of the bacteria has been knocked out.

(254) 4. Knockout of the tdcC Gene

(255) (1) A DNA fragment V-A (a region upstream of the tdcC gene) is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 W3110 as a template and using a primer pair comprised of WY476 and WY477.

(256) (2) A DNA fragment V-B (a region downstream of the tdcC gene) is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 W3110 as a template and using a primer pair comprised of WY478 and WY479.

(257) (3) A DNA fragment V-C is obtained by performing a PCR amplification using a mixture of the DNA fragment V-A and the DNA fragment V-B as a template and using a primer pair comprised of WY476 and WY479.

(258) (4) The vector backbone (about 5.6 kb) of the plasmid pKOV, after being subjected to a double enzymatic cleavage using the restriction endonucleases BamH I and Not I, is recovered.

(259) (5) The enzymatically cleaved product of the DNA fragment V-C, after being subjected to a double enzymatic cleavage using the restriction endonucleases BamH I and Not I, is recovered.

(260) (6) A recombinant plasmid V is obtained by linking the vector backbone obtained in step (4) and the enzymatically cleaved product obtained in step (5). According to the sequencing result, a structural description for the recombinant plasmid V is set forth as follows: the following specific DNA molecule is inserted between the enzymatic cleavage sites of BamH I and Not I of the plasmid pKOV: sequentially consisting, from upstream to downstream, of the upstream section shown by the nucleotides at positions 176-700 of SEQ ID No: 9 of the sequence listing and the downstream section shown by the nucleotides at positions 1853-2388 of SEQ ID No: 9 of the sequence listing. The tdcC gene is shown by SEQ ID No: 9 of the sequence listing, wherein the open reading frame is shown by the nucleotides at positions 701-2032 (coding for the tdcC protein shown by SEQ ID No: 10 of the sequence listing).

(261) (7) Recombinant bacteria with tdcC gene knocked out are obtained by introducing the recombinant plasmid V into the E. coli K-12 W3110ΔmetAΔlysAΔtdh, and named as E. coli K-12 W3110ΔmetAΔlysAΔtdhΔtdcC.

(262) A method for identyfing the recombinant bacteria with tdcC gene knocked out is that: a PCR amplification is performed using a primer pair comprised of WY497 and WY498; if an amplification product with 1453 bp is obtained, the recombinant bacteria preliminarily can be determined as a candidate for the target bacteria; and sequencing will be further performed to verify that the following section of the tdcC gene on the chromosomes of the bacteria has been knocked out: the nucleotides at positions 701-1852 of SEQ ID No: 9.

(263) Each of the primer sequences used in the examples is set forth as follows (5′.fwdarw.3′):

(264) TABLE-US-00022 WY569: GCGTCGACATAGAACCCAACCGCCTGCTCA; WY570: AACGATCGACTATCACAGAAGAAACCTGATTACCTCACT ACATA; WY571: TATGTAGTGAGGTAATCAGGTTTCTTCTGTGATAGTCGA TCGTT; WY572: ATTGCGGCCGCCCGAAATAAAATCAGGCAACGT; WY583: CGTTAATGAAATATCGCCAG; WY584: TCGAAATCGGCCATAAAGAC. WY573: CGCGGATCCGGCACGATATTTAAGCTGAC; WY574: CAACCAGCGACTAACCGCAGAACAAACTCCAGATAAGTGC; WY575: GCACTTATCTGGAGTTTGTTCTGCGGTTAGTCGCTGGTTG; WY576: ATTGCGGCCGCGCTGGCAACGCGTCATTTAA; WY585: GTAACACACACACTTCATCT; WY586: GATCCCGGATGCTGATTTAG. WY598: CGCGGATCCATACTGCGATGTGATGGGCC; WY599: AATACCAGCCCTTGTTCGTGCTCACATCCTCAGGCGATAA; WY600: TTATCGCCTGAGGATGTGAGCACGAACAAGGGCTGGTATT; WY601: ATTGCGGCCGCCGTTGCCACTTCAATCCCAC; WY602: GCTATGCCAACAACGATATG; WY603: GGTTAATACGCCGGTTGAGC. WY476: CGCGGATCCGGAACGATTGGTCTGGAAAT; WY477: GGCTTCAATCAGGTCAAGGATATCCTATCCTCAACGAATTA; WY478: TAATTCGTTGAGGATAGGATATCCTTGACCTGATTGAAGCC; WY479: ATTGCGGCCGCCGCGACGGATATTATCAATGAC; WY497: GCGCCAAAATCCAAAGTAGC; WY498: ATGTGCGCGCTGGGAAACAT.

Example 7. Preparation of Isoleucine

(265) I. Preparation of a Threonine Operon Having the thrA Mutant Gene

(266) 1. A PCR amplification product is obtained by performing a PCR amplification using the genome of the E. coli K12 W3110 as a template and using a primer pair comprised of WY914 and WY926.

(267) TABLE-US-00023   WY914: CCCAAGCTTACAGAGTACACAACATCCATG;   WY926:   

(268) 2. A PCR amplification product is obtained by performing a PCR amplification using the genome of the E. coli K12 W3110 as a template and using a primer pair comprised of WY925 and WY832.

(269) TABLE-US-00024   WY925:      WY832: CCCGATATCGCATTTATTGAGAATTTCTCC.

(270) 3. A PCR amplification product is obtained by performing a PCR amplification using a mixture of the PCR amplification product obtained in step 1 and the PCR amplification product obtained in step 2 as a template and using a primer pair comprised of WY914 and WY832.

(271) After sequencing, the nucleotides between the recognition sites for enzymatic cleavage by Hind III and EcoR V of the PCR amplification product obtained in step 3 are shown by SEQ ID NOs: 172-5132 of SEQ ID No: 20 of the sequence listing. In SEQ ID No: 20 of the sequence listing, the nucleotides at positions 337-2799 code for the ThrA*protein; the nucleotides at positions 2801-3733 code for the ThrB protein; and the nucleotides at positions 3734-5020 code for the ThrC protein. The ThrA*protein (a mutant protein) is shown by SEQ ID No: 21 of the sequence listing. As compared with the ThrA protein (a wild-type protein), the mutant protein only differs in one amino acid residue, that is, the amino acid residue at position 253 is mutated to histidine from glutamic acid. The ThrB protein is shown by SEQ ID No: 22 of the sequence listing. The ThrC protein is shown by SEQ ID No: 23 of the sequence listing.

(272) II. Construction of the Recombinant Plasmid pACYC184-P.sub.PL

(273) 1. The double-stranded DNA molecule (the promoter P.sub.PL) shown by SEQ ID No: 13 of the sequence listing is synthesized.

(274) 2. A PCR amplification product is obtained by performing a PCR amplification using the double-stranded DNA molecule prepared in step 1 as a template and using a primer pair comprised of WY843 and WY842.

(275) TABLE-US-00025 WY843: TGCTCTAGACAATTCCGACGTCTAAGAAA; WY842: CCCAAGCTTGGTCAGTGCGTCCTGCTGAT.

(276) 3. The enzymatically cleaved product of the PCR amplification product obtained in step 2, after being subjected to a double enzymatic cleavage using the restriction endonucleases Xba I and Hind III, is recovered.

(277) 4. The vector backbone (about 4.1 kb) of the plasmid pACYC184, after being subjected to a double enzymatic cleavage using the restriction endonucleases Xba I and Hind III, is recovered.

(278) 5. A recombinant plasmid pACYC184-P.sub.PL is obtained by linking the enzymatically cleaved product in step 3 and the vector backbone in step 4.

(279) III. Construction of a Recombinant Plasmid Having a Threonine Operon Comprising the thrA Mutant Gene

(280) 1. The vector backbone (about 4.2 kb) of the recombinant plasmid pACYC184-P.sub.PL, after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and EcoR V, is recovered.

(281) 2. The enzymatically cleaved product of the PCR amplification product obtained in 3 of step I, after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and EcoR V, is recovered.

(282) 3. A recombinant plasmid pACYC184-P.sub.PL-thrLA*BC914 is obtained by linking the vector backbone in step 1 and the enzymatically cleaved product in step 2. According to the sequencing result, a structural description for the recombinant plasmid pACYC184-P.sub.PL-thrLA*BC914 is set forth as follows: a specific DNA molecule is inserted between the enzymatic cleavage sites of Xba I and EcoR V of the plasmid pACYC184; and the specific DNA molecule sequentially consists, from upstream to downstream, of the following elements: the promoter P.sub.PL shown by SEQ ID No: 13 of the sequence listing, a recognition sequence for enzymatic cleavage by restriction endonuclease Hind III, and the DNA molecule shown by the nucleotides at positions 172-5132 of SEQ ID No: 20 of the sequence listing.

(283) IV. Construction of an Integrated Plasmid of Threonine Operon at the lysA Site

(284) 1. A PCR amplification product (the upstream homology arm integrated at the lysA site) is obtained by performing a PCR amplification using the genome of the E. coli K12 W3110 as a template and using a primer pair comprised of WY970 and WY971.

(285) TABLE-US-00026 WY970: AACTGCAGGGCACGATATTTAAGCTGAC; WY971: GAAGATCTAACAAACTCCAGATAAGTGC.

(286) 2. The enzymatically cleaved product of the PCR amplification product obtained in step 1, after being subjected to a double enzymatic cleavage using the restriction endonucleases Pst I and Bgl II, is recovered.

(287) 3. The vector backbone of the plasmid pKOV, after being subjected to a double enzymatic cleavage using the restriction endonucleases Pst I and Bgl II, is recovered.

(288) 4. A recombinant plasmid pKOV-Up.sub.lysA is obtained by linking the enzymatically cleaved product in step 2 and the vector backbone in step 3.

(289) 5. A PCR amplification product (the downstream homology arm integrated at the lysA gene site) is obtained by performing a PCR amplification using the genome of the E. coli K12 W3110 as a template, and using a primer pair comprised of WY974 and WY975.

(290) TABLE-US-00027 WY974: CGCGGATCCCTGCGGTTAGTCGCTGGTTG; WY975: CTAGTCTAGAGCTGGCAACGCGTCATTTAA.

(291) 6. The enzymatically cleaved product of the PCR amplification product obtained in step 5, after being subjected to a double enzymatic cleavage using the restriction endonucleases BamH I and Xba I, is recovered.

(292) 7. The vector backbone of the recombinant plasmid pKOV-Up.sub.lysA, after being subjected to a double enzymatic cleavage using the restriction endonucleases BamH I and Xba I, is recovered.

(293) 8. A recombinant plasmid pKOV-UP.sub.lysA-Down.sub.lysA is obtained by linking the enzymatically cleaved product in step 6 and the vector backbone in step 7.

(294) 9. A PCR amplification product (a P.sub.PL-thrA*BC fragment) is obtained by performing a PCR amplification using the recombinant plasmid pACYC184-P.sub.PL-thrLA*BC914 as a template and using a primer pair comprised of WY978 and WY979.

(295) TABLE-US-00028 WY978: GAAGATCTCAATTCCGACGTCTAAGAAA; WY979: CGCGGATCCGCATTTATTGAGAATTTCTCC.

(296) 10. The enzymatically cleaved product of the PCR amplification product obtained in step 9, after being subjected to a double enzymatic cleavage using the restriction endonucleases Bgl II and BamH I, is recovered.

(297) 11. The vector backbone of the recombinant plasmid pKOV-UP.sub.lysA-Down.sub.lysA, after being subjected to a double enzymatic cleavage using the restriction endonucleases Bgl II and BamH I, is recovered.

(298) 12. A recombinant plasmid pKOV-UP.sub.lysA-P.sub.PL-thrA*BC-Down.sub.lysA is obtained by linking the enzymatically cleaved product in step 10 and the vector backbone in step 11.

(299) According to the sequencing result, a structural description for the recombinant plasmid pKOV-UP.sub.lysA-P.sub.PL-thrA*BC-Down.sub.lysA is set forth as follows: a specific DNA molecule is inserted between the enzymatic cleavage sites of Pst I and Xba I of the plasmid pKOV; and the specific DNA molecule sequentially consists, from upstream to downstream, of the following elements: the upstream homology arm integrated at the lysA gene site shown by the nucleotides at positions 132-638 of SEQ ID No: 5 of the sequence listing, a recognition sequence for enzymatic cleavage by restriction endonuclease Bgl II, the promoter P.sub.PL shown by SEQ ID No: 13 of the sequence listing, a recognition sequence for enzymatic cleavage by restriction endonuclease Hind III, the DNA molecule shown by the nucleotides at positions 172-5132 of SEQ ID No: 20 of the sequence listing, a recognition sequence for enzymatic cleavage by restriction endonuclease BamH I, and the downstream homology arm integrated at the lysA gene site shown by the nucleotides at positions 1902-2445 of SEQ ID No: 5 of the sequence listing.

(300) V. Construction of Engineered Bacteria Integrated with a Threonine Operon

(301) Recombinant bacteria integrated with said specific DNA molecule in 3 of step III at the lysA gene site are obtained by introducing the recombinant plasmid pKOV-UP.sub.lysA-P.sub.PL-thrA*BC-Down.sub.lysA into the E. coli K-12 W3110ΔmetAΔlysAΔtdhΔtdcC, and named as recombinant bacteria E. coli W3110ΔmetAΔtdhΔtdcCΔlysA::P.sub.PL-thrA*BC, referred to as recombinant bacteria EC272 for short.

(302) A method for identifying the recombinant bacteria integrated with said specific DNA molecule in 3 of step III at the lysA gene site is that: a PCR identification is performed by using the primers WY585 and WY586; if an amplification product with 6443 bp is obtained, the recombinant bacteria preliminarily can be determined as a candidate for the target bacteria; and sequencing will be further performed for verification.

(303) VI. Construction of EC272sstT::ilvA*-ilvC

(304) 1. Site-Directed Mutagenesis of the ilvA Gene

(305) A PCR amplification product A1 is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 MG1655 as a template and using a primer pair comprised of WY4027 and WY4028; a PCR amplification product A2 is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 MG1655 as a template and using a primer pair comprised of WY4029 and WY4030; a PCR amplification product A3 is obtained by performing a PCR amplification using a mixture of the PCR amplification product A1 and the PCR amplification product A2 as a template and using a primer pair comprised of WY4027 and WY4030.

(306) TABLE-US-00029   WY4027:    WY4028: CAGCGTGTTGGCGAAGCGCAGAAACGCGC; WY4029: GCGCGTTTCTGCGCTTCGCCAACACGCTG; WY4030: CTATATGACAGGAAATTTATTGCGGGCATTCTGGAAGATT TTGC.

(307) In the primers, the box denotes the RBS, and the undulating underline denotes a portion of sections of the promoter P.sub.trc. The primers WY4028 and WY4029 introduce 4 point mutations: the nucleotide at position 1339 in the open reading frame of the ilvA gene is mutated to T from C, and the nucleotide at position 1341 is mutated to T from G, and the base at position 1351 is mutated to G from C, and the base at position 1352 is mutated to C from T. The ilvA gene after being introduced with the above 4 point mutations is named as ilvA*gene.

(308) 2. A PCR amplification product B1 is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 MG1655 as a template and using a primer pair comprised of WY4025 and WY4026;

(309) TABLE-US-00030 WY4025: CGCGGATCCgtgctgacctcaaacctgt; WY4026: CTCGGTTACATTATACGAGCCGGATGATTAATTGTCAACGAT CCTTTCATTGTGTTGTC.

(310) 3. A PCR amplification product C1 is obtained by performing a PCR amplification using a mixture of the PCR amplification product A3 obtained in step 1 and the PCR amplification product B1 obtained in step 2 as a template and using a primer pair comprised of WY4025 and WY4030.

(311) 4. A PCR amplification product B2 is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 MG1655 as a template and using a primer pair comprised of WY4031 and WY4032.

(312) TABLE-US-00031 WY4031: GCAAAATCTTCCAGAATGCCCCGCAATAAATTTCCTGTCATATAG; WY4032: ACCGAACATATTACAGGCCAGCAAGGCCTTCTCCAGGAGAA.

(313) 5. A PCR amplification product B3 is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 MG1655 as a template and using a primer pair comprised of WY4033 and WY4034.

(314) TABLE-US-00032 WY4033: TTCTCCTGGAGAAGGCCTTGctggcctgtaatatgttcggt; WY4034: ATTGCGGCCGCCTCGCGAAGTTCCATCATCCT.

(315) 6. A PCR amplification product C2 is obtained by performing a PCR amplification using a mixture of the PCR amplification product B2 obtained in step 4 and the PCR amplification product B3 obtained in step 5 as a template and using a primer pair comprised of WY4031 and WY4034.

(316) 7. A PCR amplification product D is obtained by performing an overlapping PCR using a mixture of the PCR amplification product C1 obtained in step 3 and the PCR amplification product C2 obtained in step 6 as a template and using a primer pair comprised of WY4025 and WY4034.

(317) 8. The enzymatically cleaved product of the PCR amplification product D obtained in step 7, after being subjected to a double enzymatic cleavage using the restriction endonucleases BamH I and Not I, is recovered.

(318) 9. The vector backbone of the plasmid pKOV, after being subjected to a double enzymatic cleavage using the restriction endonucleases BamH I and Not I, is recovered.

(319) 10. A recombinant plasmid pKOV-ilvA*-ilvC is obtained by linking the enzymatically cleaved product obtained in step 8 and the vector backbone obtained in step 9. According to the sequencing result, a structural description for the recombinant plasmid pKOV-ilvA*-ilvC is set forth as follows: a specific DNA molecule is inserted between the enzymatic cleavage sites of BamH I and Not I of the plasmid pKOV; and the specific DNA molecule sequentially consists, from upstream to downstream, of the following elements: the upstream arm shown by the nucleotides at positions 45-696 of SEQ ID No: 11 of the sequence listing, the promoter P.sub.trc “ttgacaattaatcatccggctcgtataatgt”, the RBS sequence “AACCGAGGAGCAGACA” (SEQ ID NO: 173), the DNA molecule shown by SEQ ID No: 24 of the sequence listing (in SEQ ID No: 24, the ilvA*gene is shown by positions 1-1630, and the ilvC gene is shown by positions 1631-3275), and the downstream arm shown by the nucleotides at positions 1760-2240 of SEQ ID No: 11 of the sequence listing. The open reading frame of the ilvA*gene is shown by the nucleotides at positions 1-1545 of SEQ ID No: 24 of the sequence listing, coding for the IlvA*protein (a mutant protein) shown by SEQ ID No: 25 of the sequence listing. The open reading frame of the ilvC gene is shown by the nucleotides at positions 1717-3192 of SEQ ID No: 24 of the sequence listing, coding for the IlvC protein shown by SEQ ID No: 26 of the sequence listing. The sstT gene is shown by SEQ ID No: 11 of the sequence listing, and has an open reading frame shown by the nucleotides at positions 701-1945, coding for the SstT protein shown by SEQ ID No: 12 of the sequence listing.

(320) 11. Recombinant bacteria is obtained by introducing the recombinant plasmid pKOV-ilvA*-ilvC into the recombinant bacteria EC272, and has a sstT gene which has been partially knocked out (the following section of the sstT gene is knocked out: the nucleotides at positions 697-1759 of SEQ ID No: 11) with a DNA molecule consisting of the promoter P.sub.trc “ttgacaattaatcatccggctcgtataatgt” (SEQ ID NO: 174), the RBS sequence “AACCGAGGAGCAGACA” (SEQ ID NO: 173) and the DNA molecule shown by SEQ ID No: 24 of the sequence listing integrated at the sstT gene site. The recombinant bacteria after being verified by sequencing is named as recombinant bacteria E. coli W3110 ΔmetAΔtdhΔtdcCΔlysA::P.sub.PL-thrA*BC ΔsstT::ilvA*-ilvC, referred to as recombinant bacteria EC711 for short.

(321) VII. Construction of Engineered Bacteria EC711ilvG.sup.+ΔhisL

(322) 1. A PCR amplification is performed using the genome DNA of the E. coli K12 MG1655 as a template and using a primer pair comprised of WY4037 and WY4038.

(323) TABLE-US-00033 WY4037: CGCGGATCC GGCTGTAAGCTGTTCTGAG; WY4038: CAAAAAAAACCCCCGGACCT GCATCTTGTTCGAAGGAATG.

(324) 2. A PCR amplification is performed using the genome DNA of the E. coli BL21 (DE3) as a template and using a primer pair comprised of WY4039 and WY4040.

(325) TABLE-US-00034 WY4039: CATTCCTTCGAACAAGATGC AGGTCCGGGGGTTTTTTTTG; WY4040: ATTGCGGCCGCCCAGACGTTC TCAAGTTCGT.

(326) 3. A PCR amplification product is obtained by performing a PCR amplification using a mixture of the PCR amplification product obtained in step 1 and the PCR amplification product obtained in step 2 as a template and using a primer pair comprised of WY4037 and WY4040.

(327) 4. The enzymatically cleaved product of the PCR amplification product obtained in step 3, after being subjected to a double enzymatic cleavage using the restriction endonucleases BamH I and Not I, is recovered.

(328) 5. The vector backbone of the plasmid pKOV, after being subjected to a double enzymatic cleavage using the restriction endonucleases BamH I and Not I, is recovered.

(329) 6. A recombinant plasmid pKOV-ilvL*-ilvG is obtained by linking the enzymatically cleaved product obtained in step 4 and the vector backbone obtained in step 5. According to the sequencing result, a structural description for the recombinant plasmid is set forth as follows: a specific DNA molecule is inserted between the enzymatic cleavage sites of BamH I and Not I of the plasmid pKOV; and the specific DNA molecule sequentially consists, from upstream to downstream, of the following elements: the upstream arm shown by the nucleotides at positions 355-987 of SEQ ID No: 28 of the sequence listing, and the DNA molecule shown by the nucleotides at positions 137-1831 of SEQ ID No: 27 of the sequence listing.

(330) 7. Recombinant bacteria with homologous recombination are obtained by introducing the recombinant plasmid pKOV-ilvL*-ilvG into the recombinant bacteria EC711, and named as engineered bacteria EC711ilvG.sup.+ΔhisL. After being verified by sequencing, the genome of the engineered bacteria EC711ilvG.sup.+ΔhisL has a specific DNA molecule therein; and the specific DNA molecule sequentially consists, from upstream to downstream, of the following elements: the DNA molecule shown by the nucleotides at positions 1-987 of SEQ ID No: 28 of the sequence listing, and the DNA molecule shown by the nucleotides at positions 137-6556 of SEQ ID No: 27 of the sequence listing. As compared with the recombinant bacteria EC711, the engineered bacteria EC711ilvG.sup.+ΔhisL differs in the knockout of a DNA molecule formed by linking the sequence AAGAAAAGACAAA (SEQ ID NO: 179) (upstream) in the genome of the recombinant bacteria EC711 and the nucleotides (downstream) at positions 1-136 of SEQ ID No: 27 of the sequence listing, as well as a substitution of a gene coding for an active IlvG protein for the one coding for the inactive IlvG protein in the recombinant bacteria EC711. The ilvLXGMEDA operon of the E. coli BL21 (DE3) has a gene (shown by the nucleotides at positions 239-1885 of SEQ ID No: 27 of the sequence listing) coding for the IlvG protein, while the corresponding gene in the ilvLXGMEDA operon of the E. coli K12 W3110 is subjected to a mutation (the corresponding gene after a mutation is shown by SEQ ID No: 31 of the sequence listing). Thus, the ilvLXGMEDA operon of the E. coli BL21 (DE3) cannot form an active IlvG protein.

(331) VIII. Construction of engineered bacteria EC711ilvG.sup.+

(332) 1. A PCR amplification product is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 MG1655 as a template and using a primer pair comprised of WY4037 and WY404.

(333) TABLE-US-00035 WY4043: ATTGCGGCCGCCAACTCTTCCAGCGACTGCA.

(334) 2. The enzymatically cleaved product of the PCR amplification product obtained in step 1, after being subjected to a double enzymatic cleavage using the restriction endonucleases BamH I and Not I, is recovered.

(335) 3. The vector backbone of the plasmid pKOV, after being subjected to a double enzymatic cleavage using the restriction endonucleases BamH I and Not I, is recovered.

(336) 4. A recombinant plasmid pKOV-ilvL is obtained by linking the enzymatically cleaved product in step 2 and the vector backbone in step 3.

(337) 5. Recombinant bacteria with homologous recombination are obtained by introducing the recombinant plasmid pKOV-ilvL into the engineered bacteria EC711ilvG.sup.+ΔhisL, and named as engineered bacteria EC711ilvG.sup.+. After being verified by sequencing, the genome of the engineered bacteria EC711ilvG.sup.+ΔhisL has a specific DNA molecule therein; and the specific DNA molecule sequentially consists, from upstream to downstream, of the following elements: the DNA molecule shown by SEQ ID No: 28 of the sequence listing, and the DNA molecule shown by SEQ ID No: 27 of the sequence listing.

(338) IX. Fermentation Test of Engineered Bacteria for Isoleucine in a Shake Flask

(339) The test strain is: the engineered bacteria EC711ilvG.sup.+ΔhisL or the engineered bacteria EC711ilvG.sup.+.

(340) 1. The test strain is streaked onto a solid LB medium plate, followed by static culture for 12 h at 37° C.

(341) 2. A bacterial lawn on the plate is picked and seeded onto a liquid LB medium, followed by shaking culture for 12 h at 37° C., 220 rpm, and a seed solution is obtained (OD.sub.600nm value=5.0).

(342) 3. After completion of step 2, the seed solution is seeded into a fermentation medium in a seeding amount of 3%, followed by shaking culture at 37° C., 220 rpm.

(343) The fermentation medium is: glucose 20.0 g/L, ammonium sulfate 15.0 g/L, potassium dihydrogen phosphate 2.0 g/L, magnesium sulfate heptahydrate 2.0 g/L, yeast powders 2.0 g/L, methionine 0.6 g/L, L-lysinehydrochloride 1.2 g/L, calcium carbonate 15.0 g/L, microelement mixture 5 mL/L, and water as the remainder.

(344) The microelement mixture is: FeSO.sub.4.7H.sub.2O 10 g/L, CaCl.sub.21.35 g/L, ZnSO.sub.4.7H.sub.2O 2.25 g/L, MnSO.sub.4.4H.sub.2O 0.5 g/L, CuSO.sub.4.5H.sub.2O 1 g/L, (NH.sub.4).sub.6Mo.sub.7O.sub.24.4H.sub.2O 0.106 g/L, Na.sub.2B.sub.4O.sub.7.10H.sub.2O 0.23 g/L, CoCl.sub.2.6H.sub.2O 0.48 g/L, 35% HCl10 mL/L, and water as the remainder.

(345) During the culture, ammoniacal liquor is used to adjust the pH value of the reaction system to make it maintain at 6.8-7.0.

(346) During the culture, sampling is made once every 3-4 h to detect the content of glucose by using a biosensor analyzer SBA-40D. When the content of glucose in the system is less than 5 g/L, glucose is supplemented to make the concentration of glucose in the system up to 10 g/L.

(347) Sampling is made after culture for 36 h, followed by centrifugation at 12,000 g for 2 min. The supernatant is taken for detection of the concentration of L-isoleucine.

(348) The results are shown in Table 5 (by a mean±standard deviation from repeated tests in triplicate). As compared with the engineered bacteria EC711ilvG.sup.+, the concentration of L-isoleucine in the fermented supernatant of the engineered bacteria EC711ilvG.sup.+ΔhisL gains a significant improvement.

(349) TABLE-US-00036 TABLE 5 Content of L-isoleucine in fermented supernatant (g/L) The engineered bacteria 1.02 ± 0.17 EC711ilvG.sup.+ The engineered bacteria 2.55 ± 0.35 EC711ilvG.sup.+Δ/hisL

(350) A method for detecting the concentration of L-isoleucine is: HPLC, which is optimized based on the method for detecting amino acids in a reference (Amino Acids & Biotic Resources, 2000, 22, 59-60), and the method is particularly presented as follows (HPLC coupled to pre-column derivatization with 2, 4-dinitrofluorobenzene (FDBN)):

(351) First, 10 μL of the supernatant is taken into a 2 mL centrifuge tube, into which 200 μL of 0.5M NaHCO.sub.3 aqueous solution and 100 μL of 1% (v/v) FDBN-acetonitrile solution are added. Next, the centrifuge tube is placed in a water bath to be heated at a constant temperature of 60° C. for 60 min in the dark, then cooled to the room temperature, into which 700 μL of 0.04 mol/L KH.sub.2PO.sub.4 aqueous solution (pH=7.2±0.05; the pH is adjusted with 40 g/L KOH aqueous solution) is added, and shaken well. After being static for 15 min, filtration is performed and filtrates are collected. The filtrates are for injection, and injection volume is 15 μL.

(352) C18 column (ZORBAX Eclipse XDB-C18, 4.6*150 mm, Agilent, USA) is used as the chromatographic column; column temperature: 40° C.; UV detection wavelength: 360 nm; mobile phase A: 0.04 mol/L KH.sub.2PO.sub.4 aqueous solution (pH=7.2±0.05; the pH is adjusted with 40 g/100 mL KOH aqueous solution), mobile phase B: 55% (v/v) acetonitrile aqueous solution, and total flux of the mobile phases: 1 mL/min.

(353) The process of elution is presented as follows: at the starting time of elution (0 min), the mobile phase A accounts for 86% by volume of the total flux of the mobile phases, and mobile phase B for 14%; the process of elution is divided into 4 stages, and in each stage, parts by volume of the mobile phase A and the mobile phase B accounting for the total flux of the mobile phases appear a linear variation; when the first stage (a total duration of 2 min from the starting time) ends, the mobile phase A accounts for 88% by volume of the total flux of the mobile phases, and mobile phase B for 12%; when the second stage (a total duration of 2 min from the ending time for the first stage) ends, the mobile phase A accounts for 86% by volume of the total flux of the mobile phases, and mobile phase B for 14%; when the third stage (a total duration of 6 min from the ending time for the second stage) ends, the mobile phase A accounts for 70% by volume of the total flux of the mobile phases, and the mobile phase B for 30%; when the fourth stage (a total duration of 10 min from the ending time for the third stage) ends, the mobile phase A accounts for 30% by volume of the total flux of the mobile phases, and mobile phase B for 70%.

(354) A standard curve is depicted by using the commercially available L-isoleucine as the standard, and the concentration of the isoleucine in a sample is calculated.

Example 8. The Expression of the Gfp Gene Under Regulation of an Attenuator Mutant

(355) I. Construction of the Recombinant Plasmid pACYC184-P.sub.thr-trc

(356) 1. The double-stranded DNA molecule (the promoter P.sub.thr-trc) shown by SEQ ID No: 29 of the sequence listing is synthesized.

(357) 2. A PCR amplification product is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 MG1655 as a template and using a primer pair comprised of WY1947 and WY1948.

(358) TABLE-US-00037 WY1947: CTAGTCTAGAGCTTTTCATTCTGACTGCAAC; WY1948: CCCAAGCTTACATTATACGAGCCGGATGATTAATTGTCAACTGTCTGTG CGCTATGCCT.

(359) 3. The enzymatically cleaved product of the PCR amplification product obtained in step 2, after being subjected to a double enzymatic cleavage using the restriction endonucleases Xba I and Hind III, is recovered.

(360) 4. The vector backbone (about 4.1 kb) of the plasmid pACYC184, after being subjected to a double enzymatic cleavage using the restriction endonucleases Xba I and Hind III, is recovered.

(361) 5. A recombinant plasmid pACYC184-P.sub.thr-trc is obtained by linking the enzymatically cleaved product in step 3 and the vector backbone in step 4.

(362) II. Construction of Each Recombinant Plasmid and Corresponding Recombinant Bacteria

(363) 1. Construction of the Recombinant Bacteria GFP3227

(364) (1) A PCR amplification product A1 is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 MG1655 as a template and using a primer pair comprised of WY3227 and WY3254; a PCR amplification product A2 is obtained by performing a PCR amplification using the pGFPuv vector as a template and using a primer pair comprised of WY3105 and WY1859; a PCR amplification product A3 is obtained by performing a PCR amplification using a mixture of the PCR amplification product A1 and the PCR amplification product A2 as a template and using a primer pair comprised of WY3227 and WY1859.

(365) TABLE-US-00038 WY3227: CCCAAGCTTAAGATGCAAGAAAAGACAAAatgACAG; WY3254: AGTTCTTCTCCTTTACTCATAGAACCAGAACCAGAACCTG AGAAACAGAATTTTGTGCT; WY3105: GGTTCTGGTTCTGGTTCTATGAGTAAAGGAGAAGAAC TTTTCA; WY1859:

(366) In the primers, the underline denotes a recognition sequence for enzymatic cleavage, and the box denotes a terminator sequence.

(367) (2) The enzymatically cleaved product of the PCR amplification product A3 obtained in step (1), after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and Sph I, is recovered.

(368) (3) The vector backbone of the recombinant plasmid pACYC184-P.sub.thr-trc, after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and Sph I, is recovered.

(369) (4) The recombinant plasmid pACYC184-P.sub.thr-trc-ilvLX-gfp3227 is obtained by linking the enzymatically cleaved product in step (2) and the vector backbone in step (3), then transforming into the E. coli EC135, and extracting a plasmid from a transformant. According to the sequencing result, a structural description for the recombinant plasmid pACYC184-P.sub.thr-trc-ilvLX-gfp3227 is set forth as follows: a specific DNA molecule is inserted between the enzymatic cleavage sites of Xba I and Sph I of the plasmid pACYC184; and the specific DNA molecule sequentially consists, from upstream to downstream, of the following elements: the promoter P.sub.thr-trc shown by SEQ ID No: 29 of the sequence listing, a recognition sequence for enzymatic cleavage by restriction endonuclease Hind III, the RBS sequence “AAGATGCAAGAAAAGACAAA” (SEQ ID NO: _187) of the ilvL gene, the nucleotides at positions 1-215 of SEQ ID No: 27 of the sequence listing (inclusive of a complete ilv attenuator sequence and the nucleotide sequence coding for the first 10 amino acid residues in the open reading frame of the ilvX gene), a linker sequence “GGTTCTGGTTCTGGTTCT” (SEQ ID NO: 67), the gfp gene shown by SEQ ID No: 30 of the sequence listing, and the terminator sequence

(370) TABLE-US-00039 CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG.

(371) The E. coli EC135 comprising the recombinant plasmid pACYC184-P.sub.thr-trc-ilvLX-gfp3227 is named as recombinant bacteria GFP3227.

(372) 2. Construction of the Recombinant Bacteria GFP3228

(373) (1) A PCR amplification product A1 is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 MG1655 as a template and using a primer pair comprised of WY3228 and WY3254; a PCR amplification product A2 is obtained by performing a PCR amplification using the pGFPuv vector as a template and using a primer pair comprised of WY3105 and WY1859; a PCR amplification product A3 is obtained by performing a PCR amplification using a mixture of the PCR amplification product A1 and the PCR amplification product A2 as a template and using a primer pair comprised of WY3228 and WY1859.

(374) TABLE-US-00040 WY3228: CCCAAGCTTAGGTCCGGGGGTTTTTTTTGAC.

(375) (2) The enzymatically cleaved product of the PCR amplification product A3 obtained in step (1), after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and Sph I, is recovered.

(376) (3) The vector backbone of the recombinant plasmid pACYC184-P.sub.thr-trc, after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and Sph I, is recovered.

(377) (4) The recombinant plasmid pACYC184-P.sub.thr-trc-ilvLX-gfp3228 is obtained by linking the enzymatically cleaved product in step (2) and the vector backbone in step (3), then transforming into the E. coli EC135, and extracting a plasmid from a transformant. According to the sequencing result, a structural description for the recombinant plasmid pACYC184-P.sub.thr-trc-ilvLX-gfp3228 is set forth as follows: a specific DNA molecule is inserted between the enzymatic cleavage sites of Xba I and Sph I of the plasmid pACYC184; and the specific DNA molecule sequentially consists, from upstream to downstream, of the following elements: the promoter P.sub.thr-trc shown by SEQ ID No: 29 of the sequence listing, a recognition sequence for enzymatic cleavage by restriction endonuclease Hind III, the nucleotides at positions 137-215 of SEQ ID No: 27 of the sequence listing (inclusive of an ilv attenuator sequence after a truncation modification and the nucleotide sequence coding for the first 10 amino acid residues in the open reading frame of the ilvX gene), a linker sequence “GGTTCTGGTTCTGGTTCT” (SEQ ID NO: 67), the gfp gene shown by SEQ ID No: 30 of the sequence listing, and the terminator sequence

(378) TABLE-US-00041 CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG.

(379) The E. coli EC135 comprising the recombinant plasmid pACYC184-P.sub.thr-trc-ilvLX-gfp3228 is named as recombinant bacteria GFP3228.

(380) 3. Construction of the Recombinant Bacteria GFP3229

(381) (1) A PCR amplification product A1 is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 MG1655 as a template and using a primer pair comprised of WY3229 and WY3254; a PCR amplification product A2 is obtained by performing a PCR amplification using the pGFPuv vector as a template and using a primer pair comprised of WY3105 and WY1859; a PCR amplification product A3 is obtained by performing a PCR amplification using a mixture of the PCR amplification product A1 and the PCR amplification product A2 as a template and using a primer pair comprised of WY3229 and WY1859.

(382) TABLE-US-00042 WY3229: CCCAAGCTTACATAACCGAGGAGCAGACA.

(383) (2) The enzymatically cleaved product of the PCR amplification product A3 obtained in step (1), after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and Sph I, is recovered.

(384) (3) The vector backbone of the recombinant plasmid pACYC184-P.sub.thr-trc, after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and Sph I, is recovered.

(385) (4) The recombinant plasmid pACYC184-P.sub.thr-trc-ilvLX-gfp3229 is obtained by linking the enzymatically cleaved product in step (2) and the vector backbone in step (3), and then transforming into the E. coli EC135, and extracting a plasmid from a transformant. According to the sequencing result, a structural description for the recombinant plasmid pACYC184-P.sub.thr-trc-ilvLX-gfp3229 is set forth as follows: a specific DNA molecule is inserted between the enzymatic cleavage sites of Xba I and Sph I of the plasmid pACYC184; and the specific DNA molecule sequentially consists, from upstream to downstream, of the following elements: the promoter P.sub.thr-trc shown by SEQ ID No: 29 of the sequence listing, a recognition sequence for enzymatic cleavage by restriction endonuclease Hind III, the nucleotides at positions 166-215 of SEQ ID No: 27 of the sequence listing (with the ilv attenuator completely removed and inclusive of the nucleotide sequence coding for the first 10 amino acid residues in the open reading frame of the ilvX gene), a linker sequence “GGTTCTGGTTCTGGTTCT” (SEQ ID NO: 67), the gfp gene shown by SEQ ID No: 30 of the sequence listing, and the terminator sequence

(386) TABLE-US-00043 CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG.

(387) The E. coli EC135 comprising the recombinant plasmid pACYC184-P.sub.thr-trc-ilvLX-gfp3229 is named as recombinant bacteria GFP3229.

(388) 4. Construction of the GFP control Recombinant bacteria is obtained by introducing the recombinant plasmid pACYC184-P.sub.thr-trc into the E. coli EC135, and named as GFP control.

(389) III. Analysis for the Fluorescence Intensity of GFP

(390) The test strain is: the recombinant bacteria GFP3227, the recombinant bacteria GFP3228 or the recombinant bacteria GFP3229.

(391) The GFP control is set to the control strain.

(392) 1. The test strain or the control strain is seeded into a liquid LB medium containing 34 mg/L chloramphenicol, followed by shaking culture overnight at 37° C., 220 rpm.

(393) 2. The bacteria liquid obtained in step 1 is seeded into a liquid LB medium containing 34 mg/L chloramphenicol with a seeding amount of 1%, followed by shaking culture for 12 h at 37° C., 220 rpm.

(394) 3. 150 μL of the bacteria liquid obtained in step 2 is added into a 96-well plate having black edges and a transparent bottom, and the density of cells and the fluorescence signal of GFP are simultaneously detected by using a high throughput multifunctional microplate reader (the INFINITE 200 PRO type, TECAN, Switzerland). Parameters associated with detection of the density of cells are set as presented in Table 6. Parameters associated with detection of the fluorescence signal of GFP are set as presented in Table 7.

(395) TABLE-US-00044 TABLE 6 Absorbance Wavelength 600 nm Bandwidth 9 nm Number of Flashes 25 Settle Time 0 ms

(396) TABLE-US-00045 TABLE 7 Fluorescence Top Reading Excitation Wavelength 400 nm Emission Wavelength 510 nm Excitation Bandwidth 9 nm Emission Bandwidth 20 nm Gain 100 (Manual) Number of Flashes 15 Integration Time 20 μs LagTime 0 μs Settle Time 0 ms Z-Position 20000 μm (Manual)

(397) The fluorescence intensity value of each test strain=the fluorescence value actually measured÷the density of cells−the fluorescence value actually measured from the control strain÷the density of cells of the control strain. Repeated tests are set in triplicate, and the results of the corresponding means and standard deviations are shown in Table 8.

(398) As compared with the recombinant bacteria GFP3227 (carrying a complete ilv attenuator), the fluorescence intensity value of the recombinant bacteria GFP3228 (carrying a truncated ilv attenuator) is improved by 149.0%. As compared with the recombinant bacteria GFP3229 (carrying no ilv attenuator), the fluorescence intensity value of the recombinant bacteria GFP3228 is improved by 34.1%. The results indicate that the truncated ilv attenuator located between the promoter and the target gene can function as a regulation element to promote the expression of the target gene.

(399) The ilv attenuator mutant is shown by the nucleotides at positions n1-n2 of SEQ ID No: 27 of the sequence listing; n1 is a natural number greater than or equal to 129 but smaller than or equal to 148 (preferably, n1 is 137), and n2 is a natural number greater than or equal to 155 but smaller than or equal to 215 (n2 particularly can be a natural number greater than or equal to 155 but smaller than or equal to 185, or a natural number greater than or equal to 186 but smaller than or equal to 215, and even more particularly 155, 185 or 215). The ilv attenuator mutant comprises a truncated ilv attenuator and an ilv attenuator variant (its full name is: a variant linking other nucleotides downstream of a truncated ilv attenuator). The truncated ilv attenuator is shown by the nucleotides at positions n1-155 of SEQ ID No: 27 of the sequence listing. The ilv attenuator variant is shown by the nucleotides at positions n1-n3 of SEQ ID No: 27 of the sequence listing; n3 is a natural number greater than or equal to 156 but smaller than or equal to 215 (n3 particularly can be a natural number greater than or equal to 156 but smaller than or equal to 185, or a natural number greater than or equal to 185 but smaller than or equal to 215, and even more particularly 185 or 215).

(400) TABLE-US-00046 TABLE 8 Fluorescence intensity Recombinant bacteria 1465.4 ± 165.5 GFP3227 Recombinant bacteria 3649.3 ± 413.2 GFP3228 Recombinant bacteria 2721.1 ± 138.4 GFP3229

Example 9. Preparation of Valine

(401) I. Construction of the E. coli K-12 MG1655ΔilvA

(402) 1. A DNA fragment-A (a region upstream of the ilvA gene) is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 MG1655 as a template and using a primer pair comprised of WY577 and WY578.

(403) TABLE-US-00047 WY577: CGCGGATCCGAAAGTGTACGAAAGCCAGG; WY578: GCGCTATCAGGCATTTTTCCTATTAACCCCCCAGTTTCGA.

(404) 2. A DNA fragment-B (a region downstream of the ilvA gene) is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 MG1655 as a template and using a primer pair comprised of WY579 and WY580.

(405) TABLE-US-00048 WY579: TCGAAACTGGGGGGTTAATAGGAAAAATGCCTGATAGCGC; WY580: ATTGCGGCCGCGTGAAGCGGATCTGGCGATT.

(406) 3. A DNA fragment-C is obtained by performing a PCR amplification using a mixture of the DNA fragment-A and the DNA fragment-B as a template and using a primer pair comprised of WY577 and WY580.

(407) 4. The vector backbone (about 5.6 kb) of the plasmid pKOV, after being subjected to a double enzymatic cleavage using the restriction endonucleases BamH I and Not I, is recovered.

(408) 5. The enzymatically cleaved product of the DNA fragment-C, after being subjected to a double enzymatic cleavage using the restriction endonucleases BamH I and Not I, is recovered.

(409) 6. A recombinant plasmid ΔilvA is obtained by linking the vector backbone obtained in step 4 and the enzymatically cleaved product obtained in step 5. According to the sequencing result, a structural description for the recombinant plasmid ΔilvA is set forth as follows: the following specific DNA molecule is inserted between the enzymatic cleavage sites of BamH I and Not I of the plasmid pKOV: sequentially consisting, from upstream to downstream, of the upstream section shown by the nucleotides at positions 140-637 of SEQ ID No: 3 of the sequence listing and the downstream section shown by the nucleotides at positions 2183-2712 of SEQ ID No: 3 of the sequence listing. The ilvA gene is shown by SEQ ID No: 3 of the sequence listing, wherein the open reading frame is shown by the nucleotides at positions 638-2182 (coding for the IlvA protein shown by SEQ ID No: 4 of the sequence listing).

(410) 7. Recombinant bacteria with ilvA gene knocked out are obtained by introducing the recombinant plasmid ΔilvA into the E. coli K12 MG1655, and named as E. coli K-12 MG1655ΔilvA.

(411) A method for identifying the recombinant bacteria with ilvA gene knocked out is that: a PCR amplification is performed using a primer pair comprised of WY587 and WY588; if an amplification product with 1344 bp is obtained, the recombinant bacteria preliminarily can be determined as a candidate for the target bacteria; and sequencing will be further performed to verify that the open reading frame of the ilvA gene on the chromosomes of the bacteria has been knocked out.

(412) TABLE-US-00049 WY587: ATGGCTGTATCCGCTCGCTG; WY588: ACACCATCGATCAGCAAGGGC.

(413) II. Construction of the Recombinant Plasmid pACYC184-P.sub.JJ

(414) 1. The double-stranded DNA molecule (the promoter P.sub.JJ) shown by SEQ ID No: 39 of the sequence listing is synthesized.

(415) 2. A PCR amplification product is obtained by performing a PCR amplification using the double-stranded DNA molecule prepared in step 1 as a template and using a primer pair comprised of WY843 and WY842.

(416) TABLE-US-00050 WY843: TGCTCTAGACAATTCCGACGTCTAAGAAA; WY842: CGCGGATCCGGTCAGTGCGTCCTGCTGAT.

(417) 3. The enzymatically cleaved product of the PCR amplification product obtained in step 2, after being subjected to a double enzymatic cleavage using the restriction endonucleases Xba I and BamHI, is recovered.

(418) 4. The vector backbone (about 4.1 kb) of the plasmid pACYC184, after being subjected to a double enzymatic cleavage using the restriction endonucleases Xba I and BamH I, is recovered.

(419) 5. A recombinant plasmid pACYC184-P.sub.JJ is obtained by linking the enzymatically cleaved product in step 3 and the vector backbone in step 4.

(420) III. Construction of the Recombinant Plasmid pACYC184-P.sub.JJ-ilvLXGMED

(421) TABLE-US-00051 WY4047: CGCGGATCC AAGATGCAAGAAAAGACAAA atgACAG; WY4048: CGCGGATCC AGGTCCGGGGGTTTTTTTTGAC; WY4049: CGCGGATCC ACATAACCGAGGAGCAGACA; WY4044: TGACCTGATGTTGCATCATGATAATTTCTCCA; WY4045: TGGAGAAATTATCATGATGCAACATCAGGTCA; WY4046: AAACGGCCG TTAACCCCCCAGTTTCGATTTATCG.

(422) 1. A PCR amplification product B1 is obtained by performing a PCR amplification using the genome DNA of the E. coli BL21 (DE3) as a template and using a primer pair comprised of WY4047 and WY4044.

(423) 2. A PCR amplification product B2 is obtained by performing a PCR amplification using the genome DNA of the E. coli BL21 (DE3) as a template and using a primer pair comprised of WY4048 and WY4044.

(424) 3. A PCR amplification product B3 is obtained by performing a PCR amplification using the genome DNA of the E. coli BL21 (DE3) as a template and using a primer pair comprised of WY4049 and WY4044.

(425) 4. A PCR amplification product B4 is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 MG1655 as a template and using a primer pair comprised of WY4045 and WY4046.

(426) 5. A PCR amplification product C1 is obtained by performing a PCR amplification using a mixture of the PCR amplification product B1 and the PCR amplification product B4 as a template and using a primer pair comprised of WY4047 and WY4046.

(427) 6. A PCR amplification product C2 is obtained by performing a PCR amplification using a mixture of the PCR amplification product B2 and the PCR amplification product B4 as a template and using a primer pair comprised of WY4048 and WY4046.

(428) 7. A PCR amplification product C3 is obtained by performing a PCR amplification using a mixture of the PCR amplification product B3 and the PCR amplification product B4 as a template and using a primer pair comprised of WY4049 and WY4046.

(429) 8. The vector backbone of the plasmid pACYC184-P.sub.JJ, after being subjected to a double enzymatic cleavage using the restriction endonucleases BamH I and Eag I, is recovered.

(430) 9. The enzymatically cleaved product of the PCR amplification product C1, after being subjected to a double enzymatic cleavage using the restriction endonucleases BamH I and Eag I, is recovered.

(431) 10. A recombinant plasmid pACYC184-P.sub.JJ-ilvL.sup.4047XGMED is obtained by linking the vector backbone in step 8 and the enzymatically cleaved product in step 9. According to the sequencing result, a structural description for the recombinant plasmid pACYC184-P.sub.JJ-ilvL.sup.4047XGMED is set forth as follows: a specific DNA molecule is inserted between the enzymatic cleavage sites of Xba I and Eag I of the plasmid pACYC184; and the specific DNA molecule sequentially consists, from upstream to downstream, of the following elements: the promoter P.sub.JJ shown by SEQ ID No: 39 of the sequence listing, a recognition sequence for enzymatic cleavage by restriction endonuclease BamH I, the RBS sequence “AAGATGCAAGAAAAGACAAA” (SEQ ID NO: 204) of the ilvL gene, and the double-stranded DNA molecule shown by SEQ ID No: 38 of the sequence listing.

(432) 11. The enzymatically cleaved product of the PCR amplification product C2, after being subjected to a double enzymatic cleavage using the restriction endonucleases BamH I and Eag I, is recovered.

(433) 12. A recombinant plasmid pACYC184-P.sub.JJ-ilvL.sup.4048XGMED is obtained by linking the vector backbone in step 8 and the enzymatically cleaved product in step 11. According to the sequencing result, a structural description for the recombinant plasmid pACYC184-P.sub.JJ-ilvL.sup.4048XGMED is set forth as follows: a specific DNA molecule is inserted between the enzymatic cleavage sites of Xba I and Eag I of the plasmid pACYC184; and the specific DNA molecule sequentially consists, from upstream to downstream, of the following elements: the promoter P.sub.JJ shown by SEQ ID No: 39 of the sequence listing, a recognition sequence for enzymatic cleavage by restriction endonuclease BamH I, and the double-stranded DNA molecule shown by the nucleotides at positions 137-5057 of SEQ ID No: 38 of the sequence listing.

(434) 13. The enzymatically cleaved product of the PCR amplification product C3, after being subjected to a double enzymatic cleavage using the restriction endonucleases BamH I and Eag I, is recovered.

(435) 14. A recombinant plasmid pACYC184-P.sub.JJ-ilvL.sup.4049XGMED is obtained by linking the vector backbone in step 8 and the enzymatically cleaved product in step 13. According to the sequencing result, a structural description for the recombinant plasmid pACYC184-P.sub.JJ-ilvL.sup.4049XGMED is set forth as follows: a specific DNA molecule is inserted between the enzymatic cleavage sites of Xba I and Eag I of the plasmid pACYC184; and the specific DNA molecule sequentially consists, from upstream to downstream, of the following elements: the promoter P.sub.JJ shown by SEQ ID No: 39 of the sequence listing, a recognition sequence for enzymatic cleavage by restriction endonuclease BamH I, and the double-stranded DNA molecule shown by the nucleotides at positions 166-5057 of SEQ ID No: 38 of the sequence listing.

(436) IV. Construction of Engineered Bacteria

(437) Recombinant bacteria is obtained by introducing the recombinant plasmid pACYC184-P.sub.JJ-ilvL.sup.4047XGMED into the E. coli K-12 MG1655ΔilvA, and named as engineered bacteria IlvL4047.

(438) Recombinant bacteria is obtained by introducing the recombinant plasmid pACYC184-P.sub.JJ-ilvL.sup.4048XGMED into the E. coli K-12 MG1655ΔilvA, and named as engineered bacteria IlvL4048.

(439) Recombinant bacteria is obtained by introducing the recombinant plasmid pACYC184-P.sub.JJ-ilvL.sup.4049XGMED into the E. coli K-12 MG1655ΔilvA, and named as engineered bacteria IlvL4049.

(440) V. Fermentation Test of Engineered Bacteria for Valine in a Shake Flask

(441) The test strain is: the engineered bacteria IlvL4047, the engineered bacteria IlvL4048 or the engineered bacteria IlvL4049.

(442) 1. The test strain is streaked onto a solid LB medium plate containing 34 mg/L chloramphenicol, followed by static culture for 12 h at 37° C.

(443) 2. After completion of step 1, a bacterial lawn on the plate is picked and seeded into a liquid LB medium, followed by shaking culture for 12 h at 37° C., 220 rpm (OD.sub.600nm value=5.0), and a seed solution is obtained.

(444) 3. After completion of step 2, the seed solution is seeded into a fermentation medium in a seeding amount of 3%, followed by shaking culture at 37° C., 220 rpm.

(445) The fermentation medium is: glucose 20.0 g/L, ammonium sulfate 15.0 g/L, potassium dihydrogen phosphate 2.0 g/L, magnesium sulfate heptahydrate 2.0 g/L, yeast powders 2.0 g/L, isoleucine 0.6 g/L, calcium carbonate 15.0 g/L, microelement mixture 5 mL/L, and water as the remainder.

(446) The microelement mixture is: FeSO.sub.4.7H.sub.2O 10 g/L, CaCl.sub.21.35 g/L, ZnSO.sub.4.7H.sub.2O 2.25 g/L, MnSO.sub.4.4H.sub.2O 0.5 g/L, CuSO.sub.4.5H.sub.2O 1 g/L, (NH.sub.4).sub.6Mo.sub.7O.sub.24.4H.sub.2O 0.106 g/L, Na.sub.2B.sub.4O.sub.7.10H.sub.2O 0.23 g/L, CoCl.sub.2.6H.sub.2O 0.48 g/L, 35% HCl 10 mL/L, and water as the remainder.

(447) During the culture, ammoniacal liquor is used to adjust the pH value of the reaction system to make it maintain at 6.8-7.0.

(448) During the culture, sampling is made once every 3-4 h to detect the content of glucose by using a biosensor analyzer SBA-40D. When the content of glucose in the system is less than 5 g/L, glucose is supplemented to make the concentration of glucose in the system up to 10 g/L.

(449) Sampling is made after culture for 36 h, followed by centrifugation at 12,000 g for 2 min. The supernatant (the fermented supernatant) is taken for detection of the concentration of L-valine.

(450) The results are shown in Table 9 (by a mean±standard deviation from repeated tests in triplicate). The engineered bacteria IlvL4048 have the highest capability for producing L-valine, and the concentration of L-valine in the fermented supernatant is up to 2.58±0.55.

(451) TABLE-US-00052 TABLE 9 Content of L-valine in fermented supernatant (g/L) Engineered bacteria IlvL4047 1.02 ± 0.15 Engineered bacteria IlvL4048 2.58 ± 0.55 Engineered bacteria IlvL4049 1.82 ± 0.22

(452) A method for detecting the concentration of L-valine in fermented supernatant is: HPLC, which is optimized based on the method for detecting amino acids in a reference (Amino Acids & Biotic Resources, 2000, 22, 59-60), and the method is particularly presented as follows (HPLC coupled to pre-column derivatization with 2, 4-dinitrofluorobenzene (FDBN)):

(453) First, 10 μL of the supernatant is taken into a 2 mL centrifuge tube, into which 200 μL of 0.5M NaHCO.sub.3 aqueous solution and 100 μL of 1% (v/v) FDBN-acetonitrile solution are added. Next, the centrifuge tube is placed in a water bath to be heated at a constant temperature of 60° C. for 60 min in the dark, then cooled to the room temperature, into which 700 μL of 0.04 mol/L KH.sub.2PO.sub.4 aqueous solution (pH=7.2±0.05; the pH is adjusted with 40 g/L KOH aqueous solution) is added, and shaken well. After being static for 15 min, filtration is performed and filtrates are collected. The filtrates are for injection, and injection volume is 15 μL.

(454) C18 column (ZORBAX Eclipse XDB-C18, 4.6*150 mm, Agilent, USA) is used as the chromatographic column; column temperature: 40° C.; UV detection wavelength: 360 nm; mobile phase A: 0.04 mol/L KH.sub.2PO.sub.4 aqueous solution (pH=7.2±0.05; the pH is adjusted with 40 g/100 mL KOH aqueous solution), mobile phase B: 55% (v/v) acetonitrile aqueous solution, and total flux of the mobile phases: 1 mL/min.

(455) The process of elution is presented as follows: at the starting time of elution (0 min), the mobile phase A accounts for 86% by volume of the total flux of the mobile phases, and mobile phase B for 14%; the process of elution is divided into 4 stages, and in each stage, parts by volume of the mobile phase A and the mobile phase B accounting for the total flux of the mobile phases appear a linear variation; when the first stage (a total duration of 2 min from the starting time) ends, the mobile phase A accounts for 88% by volume of the total flux of the mobile phases, and mobile phase B for 12%; when the second stage (a total duration of 2 min from the ending time for the first stage) ends, the mobile phase A accounts for 86% by volume of the total flux of the mobile phases, and mobile phase B for 14%; when the third stage (a total duration of 6 min from the ending time for the second stage) ends, the mobile phase A accounts for 70% by volume of the total flux of the mobile phases, and the mobile phase B for 30%; when the fourth stage (a total duration of 10 min from the ending time for the third stage) ends, the mobile phase A accounts for 30% by volume of the total flux of the mobile phases, and mobile phase B for 70%.

(456) A standard curve is depicted by using the commercially available L-valine as the standard, and the concentration of valine in a sample is calculated.

Example 10. The Expression of the Gfp Gene Under Regulation of an Attenuator Mutant

(457) I. Construction of Each Recombinant Plasmid and Corresponding Recombinant Bacteria

(458) 1. Construction of the Recombinant Bacteria GFP3223

(459) (1) A PCR amplification product A1 is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 MG1655 as a template and using a primer pair comprised of WY3223 and WY3253; a PCR amplification product A2 is obtained by performing a PCR amplification using the pGFPuv vector as a template and using a primer pair comprised of WY3105 and WY1859; a PCR amplification product A3 is obtained by performing a PCR amplification using a mixture of the PCR amplification product A1 and the PCR amplification product A2 as a template and using a primer pair comprised of WY3223 and WY1859.

(460) TABLE-US-00053 WY3223: CCCAAGCTTACGTAAAAAGGGTATCGACA; WY3253: AGTTCTTCTCCTTTACTCATAGAACCAGAACCAGAACCCAGTTCGAGAG TCGGTTTTTG; WY3105: GGTTCTGGTTCTGGTTCTATGAGTAAAGGAGAAGAACTTTTCA; WY1859: ACATGCATGCCAAAAAACCCCTCAAGACCCGTTTAGAGGCCCCAAGGGG TTATGCTAGTTATTTGTAGAGCTCATCCATGCCA.

(461) (2) The enzymatically cleaved product of the PCR amplification product A3 obtained in step (1), after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and Sph I, is recovered.

(462) (3) The vector backbone (about 4.0 kb) of the recombinant plasmid pACYC184-P.sub.thr-trc, after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and Sph I, is recovered.

(463) (4) The recombinant plasmid pACYC184-P.sub.thr-trc-trpLE-gfp3223 is obtained by linking the enzymatically cleaved product in step (2) and the vector backbone in step (3), then transforming into the E. coli EC135, and extracting a plasmid from a transformant. According to the sequencing result, a structural description for the recombinant plasmid pACYC184-P.sub.thr-trc-trpLE-gfp3223 is set forth as follows: a specific DNA molecule is inserted between the enzymatic cleavage sites of Xba I and Sph I of the plasmid pACYC184; and the specific DNA molecule sequentially consists, from upstream to downstream, of the following elements: the promoter P.sub.thr-trc shown by SEQ ID No: 29 of the sequence listing, a recognition sequence for enzymatic cleavage by restriction endonuclease Hind III, the nucleotides at positions 1-186 of SEQ ID No: 40 of the sequence listing, a linker sequence “GGTTCTGGTTCTGGTTCT” (SEQ ID NO: 67), the gfp gene shown by SEQ ID No: 30 of the sequence listing, and the terminator sequence

(464) TABLE-US-00054 “CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGG TTTTTTG”.

(465) The E. coli EC135 comprising the recombinant plasmid pACYC184-P.sub.thr-trc-trpLE-gfp3223 is named as recombinant bacteria GFP3223.

(466) 2. Construction of the recombinant bacteria GFP3224

(467) (1) A PCR amplification product A1 is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 MG1655 as a template and using a primer pair comprised of WY3224 and WY3253; a PCR amplification product A2 is obtained by performing a PCR amplification using the pGFPuv vector as a template and using a primer pair comprised of WY3105 and WY1859; a PCR amplification product A3 is obtained by performing a PCR amplification using a mixture of the PCR amplification product A1 and the PCR amplification product A2 as a template and using a primer pair comprised of WY3224 and WY1859.

(468) TABLE-US-00055 WY3224: CCCAAGCTTCTAATGAGCGGGCTTTTTTTTGAACA.

(469) (2) The enzymatically cleaved product of the PCR amplification product A3 obtained in step (1), after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and Sph I, is recovered.

(470) (3) The vector backbone (about 4.0 kb) of the recombinant plasmid pACYC184-P.sub.thr-trc, after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and Sph I, is recovered.

(471) (4) The recombinant plasmid pACYC184-P.sub.thr-trc-trpLE-gfp3224 is obtained by linking the enzymatically cleaved product in step (2) and the vector backbone in step (3), then transforming into the E. coli EC135, and extracting a plasmid from a transformant. According to the sequencing result, a structural description for the recombinant plasmid pACYC184-P.sub.thr-trc-trpLE-gfp3224 is set forth as follows: a specific DNA molecule is inserted between the enzymatic cleavage sites of Xba I and Sph I of the plasmid pACYC184; and the specific DNA molecule sequentially consists, from upstream to downstream, of the following elements: the promoter P.sub.thr-trc shown by SEQ ID No: 29 of the sequence listing, a recognition sequence for enzymatic cleavage by restriction endonuclease Hind III, the nucleotides at positions 115-186 of SEQ ID No: 40 of the sequence listing, a linker sequence “GGTTCTGGTTCTGGTTCT” (SEQ ID NO: 67), the gfp gene shown by SEQ ID No: 30 of the sequence listing, and the terminator sequence

(472) TABLE-US-00056 “CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGG TTTTTTG”.

(473) The E. coli EC135 comprising the recombinant plasmid pACYC184-P.sub.thr-trc-trpLE-gfp3224 is named as recombinant bacteria GFP3224.

(474) 3. Construction of the Recombinant Bacteria GFP3225

(475) (1) A PCR amplification product A1 is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 MG1655 as a template and using a primer pair comprised of WY3225 and WY3253; a PCR amplification product A2 is obtained by performing a PCR amplification using the pGFPuv vector as a template and using a primer pair comprised of WY3105 and WY1859; a PCR amplification product A3 is obtained by performing a PCR amplification using a mixture of the PCR amplification product A1 and the PCR amplification product A2 as a template and using a primer pair comprised of WY3225 and WY1859.

(476) TABLE-US-00057 WY3225: CCCAAGCTT GCGGGCTTTTTTTTGAACAA.

(477) (2) The enzymatically cleaved product of the PCR amplification product A3 obtained in step (1), after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and Sph I, is recovered.

(478) (3) The vector backbone (about 4.0 kb) of the recombinant plasmid pACYC184-P.sub.thr-trc, after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and Sph I, is recovered.

(479) (4) The recombinant plasmid pACYC184-P.sub.thr-trc-trpLE-gfp3225 is obtained by linking the enzymatically cleaved product in step (2) and the vector backbone in step (3), and then transforming into the E. coli EC135, and extracting a plasmid from a transformant. According to the sequencing result, a structural description for the recombinant plasmid pACYC184-P.sub.thr-trc-trpLE-gfp3225 is set forth as follows: a specific DNA molecule is inserted between the enzymatic cleavage sites of Xba I and Sph I of the plasmid pACYC184; and the specific DNA molecule sequentially consists, from upstream to downstream, of the following elements: the promoter P.sub.thr-trc shown by SEQ ID No: 29 of the sequence listing, a recognition sequence for enzymatic cleavage by restriction endonuclease Hind III, the nucleotides at positions 122-186 of SEQ ID No: 40 of the sequence listing, a linker sequence “GGTTCTGGTTCTGGTTCT” (SEQ ID NO: 67), the gfp gene shown by SEQ ID No: 30 of the sequence listing, and the terminator sequence

(480) TABLE-US-00058 “CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGG TTTTTTG”.

(481) The E. coli EC135 comprising the recombinant plasmid pACYC184-P.sub.thr-trc-trpLE-gfp3225 is named as recombinant bacteria GFP3225.

(482) 4. Construction of the recombinant bacteria GFP3226

(483) (1) A PCR amplification product A1 is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 MG1655 as a template and using a primer pair comprised of WY3226 and WY3253; a PCR amplification product A2 is obtained by performing a PCR amplification using the pGFPuv vector as a template and using a primer pair comprised of WY3105 and WY1859; a PCR amplification product A3 is obtained by performing a PCR amplification using a mixture of the PCR amplification product A1 and the PCR amplification product A2 as a template and using a primer pair comprised of WY3226 and WY1859.

(484) TABLE-US-00059 WY3226: CCCAAGCTT AACAAAATTAGAGAATAACAATGCAAAC.

(485) (2) The enzymatically cleaved product of the PCR amplification product A3 obtained in step (1), after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and Sph I, is recovered.

(486) (3) The vector backbone (about 4.0 kb) of the recombinant plasmid pACYC184-P.sub.thr-trc, after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and Sph I, is recovered.

(487) (4) The recombinant plasmid pACYC184-P.sub.thr-trc-trpLE-gfp3226 is obtained by linking the enzymatically cleaved product in step (2) and the vector backbone in step (3), then transforming into the E. coli EC135, and extracting a plasmid from a transformant. According to the sequencing result, a structural description for the recombinant plasmid pACYC184-P.sub.thr-trc-trpLE-gfp3226 is set forth as follows: a specific DNA molecule is inserted between the enzymatic cleavage sites of Xba I and Sph I of the plasmid pACYC184; and the specific DNA molecule sequentially consists, from upstream to downstream, of the following elements: the promoter P.sub.thr-trc shown by SEQ ID No: 29 of the sequence listing, a recognition sequence for enzymatic cleavage by restriction endonuclease Hind III, the nucleotides at positions 137-186 of SEQ ID No: 40 of the sequence listing, a linker sequence “GGTTCTGGTTCTGGTTCT” (SEQ ID NO: 67), the gfp gene shown by SEQ ID No: 30 of the sequence listing, and the terminator sequence

(488) TABLE-US-00060 “CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGG TTTTTTG”.

(489) The E. coli EC135 comprising the recombinant plasmid pACYC184-P.sub.thr-trc-trpLE-gfp3226 is named as recombinant bacteria GFP3226.

(490) 5. Construction of the GFP Control

(491) Recombinant bacteria is obtained by introducing the recombinant plasmid pACYC184-P.sub.thr-trc into the E. coli EC135, and named as GFP control.

(492) II. Analysis for the Fluorescence Intensity of GFP

(493) The test strain is: the recombinant bacteria GFP3223, the recombinant bacteria GFP3224, the recombinant bacteria GFP3225 or the recombinant bacteria GFP3226.

(494) The GFP control is set to the control strain.

(495) 1. The test strain or the control strain is seeded into a liquid LB medium containing 34 mg/L chloramphenicol, followed by shaking culture for overnight at 37° C., 220 rpm.

(496) 2. The bacteria liquid obtained in step 1 is seeded into a liquid LB medium containing 34 mg/L chloramphenicol with a seeding amount of 1%, followed by shaking culture for 12 h at 37° C., 220 rpm.

(497) 3. 150 μL of the bacteria liquid obtained in step 2 is added into a 96-well plate having black edges and a transparent bottom, and the density of cells and the fluorescence signal of GFP are simultaneously detected by using a high throughput multifunctional microplate reader (the INFINITE 200 PRO type, TECAN, Switzerland). Parameters associated with detection of the density of cells are set as presented in Table 10. Parameters associated with detection of the fluorescence signal of GFP are set as presented in Table 11.

(498) TABLE-US-00061 TABLE 10 Absorbance Wavelength 600 nm Bandwidth 9 nm Number of Flashes 25 Settle Time 0 ms

(499) TABLE-US-00062 TABLE 11 Fluorescence Top Reading Excitation Wavelength 400 nm Emission Wavelength 510 nm Excitation Bandwidth 9 nm Emission Bandwidth 20 nm Gain 100 (Manual) Number of Flashes 15 Integration Time 20 μs LagTime 0 μs Settle Time 0 ms Z-Position 20000 μm (Manual)

(500) The fluorescence intensity value of each test strain=the fluorescence value actually measured÷the density of cells−the fluorescence value actually measured from the control strain÷the density of cells of the control strain. Repeated tests are set in triplicate, and the results of the corresponding means and standard deviations are shown in Table 12.

(501) As compared with the recombinant bacteria GFP3223 (remaining a complete tryptophan attenuator), the fluorescence intensity of the recombinant bacteria GFP3224 is improved by 10.7 folds. As compared with the recombinant bacteria GFP3226 (having completely removed the tryptophan attenuator), the fluorescence intensity of the recombinant bacteria GFP3224 is improved by 10.6 folds. As compared with the recombinant bacteria GFP3223, the fluorescence intensity of the recombinant bacteria GFP3225 is improved by 3.6 folds. As compared with the recombinant bacteria GFP3226, the fluorescence intensity of the recombinant bacteria GFP3225 is improved by 3.6 folds. The results indicate that the truncated tryptophan attenuator located between the promoter and the target gene can function as a regulation element to promote the expression of the target gene.

(502) The tryptophan attenuator mutant is shown by the nucleotides at positions n1-n2 of SEQ ID No: 40 of the sequence listing; n1 is a natural number greater than or equal to 115 but smaller than or equal to 122 (preferably, n1 is 115), and n2 is a natural number greater than or equal to 135 but smaller than or equal to 186 (n2 particularly can be a natural number greater than or equal to 135 but smaller than or equal to 156, or a natural number greater than or equal to 157 but smaller than or equal to 186, even more particularly 135, 156 or 186). The tryptophan attenuator mutant comprises a truncated tryptophan attenuator and a tryptophan attenuator variant (its full name is: a variant linking other nucleotides downstream of a truncated tryptophan attenuator). The truncated tryptophan attenuator is shown by the nucleotides at positions n1-135 of SEQ ID No: 40 of the sequence listing. The tryptophan attenuator variant is shown by the nucleotides at positions n1-n4 of SEQ ID No: 40 of the sequence listing; n4 is a natural number greater than or equal to 136 but smaller than or equal to 186 (n4 particularly can be a natural number greater than or equal to 136 but smaller than or equal to 156, or a natural number greater than or equal to 157 but smaller than or equal to 186, even more particularly 156 or 186).

(503) TABLE-US-00063 TABLE 12 Fluorescence intensity Recombinant bacteria 2841.4 ± 15.2 GFP3223 Recombinant bacteria 33141.9 ± 283.2 GFP3224 Recombinant bacteria 13084.2 ± 188.3 GFP3225 Recombinant bacteria 2865.1 ± 76.5 GFP3226

Example 11. Preparation of Tryptophan

(504) I. Construction of the Recombinant Plasmid pBR322-aroG*

(505) 1. A PCR amplification product is obtained by performing a PCR amplification using the genome of the E. coli K12 MG1655 as a template and using a primer pair comprised of WY4001 and WY4002.

(506) 2. A PCR amplification product is obtained by performing a PCR amplification using the genome of the E. coli K12 MG1655 as a template and using a primer pair comprised of WY4003 and WY4004.

(507) 3. A PCR amplification product is obtained by performing a PCR amplification using a mixture of the PCR amplification product obtained in step 1 and the PCR amplification product obtained in step 2 as a template and using a primer pair comprised of WY4001 and WY4004.

(508) After sequencing, the nucleotides between the recognition sites for enzymatic cleavage by Nhe I and BamH I of the PCR amplification product obtained in step 3 are shown by SEQ ID No: 41 of the sequence listing. In SEQ ID No: 41 of the sequence listing, the open reading frame is shown by the nucleotides at positions 151-1203, coding for the AroG*protein shown by SEQ ID No: 42 of the sequence listing. As compared with the AroG protein (a wild-type protein), the AroG*protein only differs in one amino acid residue, that is, the amino acid residue at position 150 of the AroG protein is mutated to leucine from proline.

(509) TABLE-US-00064 WY4001: CTAGCTAGCATCTCGTTTTTCGCGACAATCT; WY4002: CAGGTCAGCGAGATATTGTAGGGTGATCATATCGAGAAAC; WY4003: GTTTCTCGATATGATCACCCTACAATATCTCGCTGACCTG; WY4004: CGCGGATCC AGCGAAAGCAGCGGCGGTT.

(510) 4. The vector backbone (about 4.3 kb) of the plasmid pBR322, after being subjected to a double enzymatic cleavage using the restriction endonucleases Nhe I and BamH I, is recovered.

(511) 5. The enzymatically cleaved product of the PCR amplification product obtained in step 3, after being subjected to a double enzymatic cleavage using the restriction endonucleases Nhe I and BamH I, is recovered.

(512) 6. A recombinant plasmid pBR322-aroG* is obtained by linking the vector backbone in step 4 and the enzymatically cleaved product in step 5.

(513) II. Construction of the Recombinant Plasmid pBR322-aroG*-tktA

(514) 1. A PCR amplification product is obtained by performing a PCR amplification using the genome of the E. coli K12 MG1655 as a template and using a primer pair comprised of WY4005 and WY4006. After sequencing, the nucleotides between the recognition sites for enzymatic cleavage by BamH I and Eco 52I of the PCR amplification product are shown by SEQ ID No: 43 of the sequence listing. In SEQ ID No: 43 of the sequence listing, the open reading frame is shown by the nucleotides at positions 151-2142, coding for the TktA protein shown by SEQ ID No: 44 of the sequence listing.

(515) TABLE-US-00065 WY4005: CGC GGATCC ATCCAGAGATTTCTGAAGCG; WY4006: AAT CGGCCG TTAATTTCTTATATAACATTGAGTTATAGATATAACAAC.

(516) 2. The vector backbone (about 5.2 kb) of the recombinant plasmid pBR322-aroG*, after being subjected to a double enzymatic cleavage using the restriction endonucleases BamH I and Eco 52I, is recovered.

(517) 3. The enzymatically cleaved product of the PCR amplification product obtained in step 1, after being subjected to a double enzymatic cleavage using the restriction endonucleases BamH I and Eco 52I, is recovered.

(518) 4. A recombinant plasmid pBR322-aroG*-tktA is obtained by linking the vector backbone in step 2 and the enzymatically cleaved product in step 3. According to the sequencing result, a structural description for the recombinant plasmid pBR322-aroG*-tktA is set forth as follows: a DNA molecule is inserted between the enzymatic cleavage sites of Nhe I and Eco 52I of the plasmid pBR322; and the DNA molecule sequentially consists, from upstream to downstream, of the following elements: the DNA molecule shown by SEQ ID No: 41 of the sequence listing, a recognition sequence for enzymatic cleavage by restriction endonuclease BamH I, and the DNA molecule shown by SEQ ID No: 43 of the sequence listing.

(519) III. Construction of the Recombinant Plasmid pACYC184-P.sub.JJ

(520) 1. The double-stranded DNA molecule (the promoter P.sub.JJ) shown by SEQ ID No: 39 of the sequence listing is synthesized.

(521) 2. A PCR amplification product is obtained by performing a PCR amplification using the double-stranded DNA molecule prepared in step 1 as a template and using a primer pair comprised of WY843 and WY842.

(522) TABLE-US-00066 WY843: TGCTCTAGACAATTCCGACGTCTAAGAAA; WY842: CCCAAGCTTGGTCAGTGCGTCCTGCTGAT.

(523) 3. The enzymatically cleaved product of the PCR amplification product obtained in step 2, after being subjected to a double enzymatic cleavage using the restriction endonucleases XbaI and Hind III, is recovered.

(524) 4. The vector backbone (about 4.1 kb) of the plasmid pACYC184, after being subjected to a double enzymatic cleavage using the restriction endonucleases XbaI and Hind III, is recovered.

(525) 5. A recombinant plasmid pACYC184-P.sub.JJ is obtained by linking the enzymatically cleaved product in step 3 and the vector backbone in step 4.

(526) IV. Construction of the Recombinant Plasmid pACYC184-P.sub.JJ-trpL*E*DCBA

(527) 1. A PCR amplification product A1 is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 MG1655 as a template and using a primer pair comprised of WY4007 and WY4010; a PCR amplification product A2 is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 MG1655 as a template and using a primer pair comprised of WY4008 and WY4010; a PCR amplification product A3 is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 MG1655 as a template and using a primer pair comprised of WY4009 and WY4010; a PCR amplification product A4 is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 MG1655 as a template and using a primer pair comprised of WY4011 and WY4012.

(528) TABLE-US-00067 WY4007: CGCggatccACGTAAAAAGGGTATCGACA; WY4008: CGCggatccCTAATGAGCGGGCTTTTTTTTGAACA; WY4009: CGCggatc AACAAAATTAGAGAATAACAATGCAAAC; WY4010: ATCCTGCATAAAAAACGTGTACGGGCTGGGATTACTC; WY4011: GAGTAATCCCAGCCCGTACACGTTTTTTATGCAGGAT; WY4012: ACATGCATGC GTTATGTTGCGGGATTAATTTGT.

(529) One point mutation is introduced into the trpE gene by using the primers WY4010 and WY4011, and the mutated gene codes for the TrpE*protein shown by SEQ ID No: 45 of the sequence listing. As compared with the TrpE protein (a wild-type protein), the TrpE*protein only differs in one amino acid residue, that is, the amino acid residue at position 293 of the TrpE protein is mutated to threonine from methionine.

(530) 2. A PCR amplification product B1 is obtained by performing a PCR amplification using a mixture of the PCR amplification product A1 and the PCR amplification product A4 as a template and using a primer pair comprised of WY4007 and WY4012; a PCR amplification product B2 is obtained by performing a PCR amplification using a mixture of the PCR amplification product A2 and the PCR amplification product A4 as a template and using a primer pair comprised of WY4008 and WY4012; a PCR amplification product B3 is obtained by performing a PCR amplification using a mixture of the PCR amplification product A3 and the PCR amplification product A4 as a template, and using a primer pair comprised of WY4009 and WY4012.

(531) 3. The vector backbone of the recombinant plasmid pACYC184-P.sub.JJ, after being subjected to a double enzymatic cleavage using the restriction endonucleases BamH I and Sph I, is recovered.

(532) 4. The enzymatically cleaved product of the PCR amplification product B1 obtained in step 2, after being subjected to a double enzymatic cleavage using the restriction endonucleases BamH I and Sph I, is recovered.

(533) 5. A recombinant plasmid pACYC184-P.sub.JJ-trpL.sup.4007E*DCBA is obtained by linking the vector backbone in step 3 and the enzymatically cleaved product in step 4. According to the sequencing result, a structural description for the recombinant plasmid pACYC184-P.sub.JJ-trpL.sup.4007E*DCBA is set forth as follows: the plasmid pACYC184 is used as a starting vector, wherein the promoter P.sub.JJ shown by SEQ ID No: 39 of the sequence listing is inserted between the enzymatic cleavage sites of XbaI and Hind III, and the DNA molecule shown by SEQ ID No: 40 of the sequence listing is inserted between the enzymatic cleavage sites of BamH I and Sph I.

(534) 6. The enzymatically cleaved product of the PCR amplification product B2 obtained in step 2, after being subjected to a double enzymatic cleavage using the restriction endonucleases BamH I and Sph I, is recovered.

(535) 7. A recombinant plasmid pACYC184-P.sub.JJ-trpL.sup.4008E*DCBA is obtained by linking the vector backbone in step 3 and the enzymatically cleaved product in step 6. According to the sequencing result, a structural description for the recombinant plasmid pACYC184-P.sub.JJ-trpL.sup.4008E*DCBA is set forth as follows: the plasmid pACYC184 is used as a starting vector, wherein the promoter P.sub.JJ shown by SEQ ID No: 39 of the sequence listing is inserted between the enzymatic cleavage sites of XbaI and Hind III, and the DNA molecule shown by the nucleotides at positions 115-6865 of SEQ ID No: 40 of the sequence listing is inserted between the enzymatic cleavage sites of BamH I and Sph I.

(536) 8. The enzymatically cleaved product of the PCR amplification product B3 obtained in step 2, after being subjected to a double enzymatic cleavage using the restriction endonucleases BamH I and Sph I, is recovered.

(537) 9. A recombinant plasmid pACYC184-P.sub.JJ-trpL.sup.4009E*DCBA is obtained by linking the vector backbone in step 3 and the enzymatically cleaved product in step 8. According to the sequencing result, a structural description for the recombinant plasmid pACYC184-P.sub.JJ-trpL.sup.4009E*DCBA is set forth as follows: the plasmid pACYC184 is used as a starting vector, wherein the promoter P.sub.JJ shown by SEQ ID No: 39 of the sequence listing is inserted between the enzymatic cleavage sites of XbaI and Hind III, and the DNA molecule shown by the nucleotides at positions 137-6865 of SEQ ID No: 40 of the sequence listing is inserted between the enzymatic cleavage sites of BamH I and Sph I.

(538) V. Construction of Recombinant Bacteria

(539) Recombinant bacteria is obtained by introducing the recombinant plasmid pBR322-aroG*-tktA into the E. coli K12 MG1655, and named as recombinant bacteria AT.

(540) Recombinant bacteria is obtained by introducing the recombinant plasmid pACYC184-P.sub.JJ-trpL.sup.4007E*DCBA into the recombinant bacteria AT, and named as engineered bacteria Trp4007.

(541) Recombinant bacteria is obtained by introducing the recombinant plasmid pACYC184-P.sub.JJ-trpL.sup.4008E*DCBA into the recombinant bacteria AT, and named as engineered bacteria Trp4008.

(542) Recombinant bacteria is obtained by introducing the recombinant plasmid pACYC184-P.sub.JJ-trpL.sup.4009E*DCBA into the recombinant bacteria AT, and named as engineered bacteria Trp4009.

(543) VI. Fermentation Test of Engineered Bacteria for Tryptophan in a Shake Flask

(544) The test strain is: the engineered bacteria Trp4007, the engineered bacteria Trp4008 or the engineered bacteria Trp4009.

(545) 1. The test strain is streaked onto a solid LB medium plate containing 100 mg/L ampicillin and 34 mg/L chloramphenicol, followed by static culture for 12 h at 37° C.

(546) 2. After completion of step 2, a bacterial lawn on the plate is picked and seeded into a liquid LB medium containing 100 mg/L ampicillin and 34 mg/L chloramphenicol, followed by shaking culture for 8 h at 37° C., 220 rpm, and a seed solution is obtained (OD.sub.600 nm value=5.0).

(547) 3. After completion of step 3, the seed solution is seeded into a fermentation medium in a seeding amount of 3%, followed by shaking culture at 37° C., 220 rpm.

(548) The fermentation medium is: glucose 20.0 g/L, ammonium sulfate 15.0 g/L, potassium dihydrogen phosphate 2.0 g/L, magnesium sulfate heptahydrate 2.0 g/L, yeast powders 2.0 g/L, calcium carbonate 15.0 g/L, microelement mixture 5 mL/L, and water as the remainder.

(549) The microelement mixture is: FeSO.sub.4.7H.sub.2O 10 g/L, CaCl.sub.21.35 g/L, ZnSO.sub.4.7H.sub.2O 2.25 g/L, MnSO.sub.4.4H.sub.2O 0.5 g/L, CuSO.sub.4.5H.sub.2O 1 g/L, (NH.sub.4).sub.6Mo.sub.7O.sub.24.4H.sub.2O 0.106 g/L, Na.sub.2B.sub.4O.sub.7.10H.sub.2O 0.23 g/L, CoCl.sub.2.6H.sub.2O 0.48 g/L, 35% HCl 10 mL/L, and water as the remainder.

(550) During the culture, ammoniacal liquor is used to adjust the pH value of the reaction system to make it maintain at 6.8-7.0.

(551) During the culture, sampling is made once every 3-4 h to detect the content of glucose by using a biosensor analyzer SBA-40D. When the content of glucose in the system is less than 5 g/L, glucose is supplemented to make the concentration of glucose in the system up to 10 g/L.

(552) Sampling is made after culture for 36 h, followed by centrifugation at 12,000 g for 2 min. The supernatant (i.e., the fermented supernatant) is taken for detection of the concentration of L-tryptophan.

(553) The results are shown in Table 13 (by a mean±standard deviation from repeated tests in triplicate). The engineered bacteria Trp4008 have the highest capability for producing L-tryptophan, and the concentration of L-tryptophan in the fermented supernatant is 1.20±0.15 g/L.

(554) TABLE-US-00068 TABLE 13 Content of L-tryptophan in fermented supernatant (g/L) Engineered bacteria 0.43 ± 0.08 Trp4007 Engineered bacteria 1.20 ± 0.15 Trp4008 Engineered bacteria 0.51 ± 0.10 Trp4009

(555) A method for detecting the concentration of L-tryptophan in fermented supernatant is: HPLC, which is optimized based on the method for detecting amino acids in a reference (Amino Acids & Biotic Resources, 2000, 22, 59-60), and the method is particularly presented as follows (HPLC coupled to pre-column derivatization with 2, 4-dinitrofluorobenzene (FDBN)):

(556) First, 10 μL of the supernatant is taken into a 2 mL centrifuge tube, into which 200 μL of 0.5M NaHCO.sub.3 aqueous solution and 100 μL of 1% (v/v) FDBN-acetonitrile solution are added. Next, the centrifuge tube is placed in a water bath to be heated at a constant temperature of 60° C. for 60 min in the dark, then cooled to the room temperature, into which 700 μL of 0.04 mol/L KH.sub.2PO.sub.4 aqueous solution (pH=7.2±0.05; the pH is adjusted with 40 g/L KOH aqueous solution) is added, and shaken well. After being static for 15 min, filtration is performed and filtrates are collected. The filtrates are for injection, and injection volume is 15 μL.

(557) C18 column (ZORBAX Eclipse XDB-C18, 4.6*150 mm, Agilent, USA) is used as the chromatographic column; column temperature: 40° C.; UV detection wavelength: 360 nm; mobile phase A: 0.04 mol/L KH.sub.2PO.sub.4 aqueous solution (pH=7.2±0.05; the pH is adjusted with 40 g/100 mL KOH aqueous solution), mobile phase B: 55% (v/v) acetonitrile aqueous solution, and total flux of the mobile phases: 1 mL/min.

(558) The process of elution is presented as follows: at the starting time of elution (0 min), the mobile phase A accounts for 86% by volume of the total flux of the mobile phases, and mobile phase B for 14%; the process of elution is divided into 4 stages, and in each stage, parts by volume of the mobile phase A and the mobile phase B accounting for the total flux of the mobile phases appear a linear variation; when the first stage (a total duration of 2 min from the starting time) ends, the mobile phase A accounts for 88% by volume of the total flux of the mobile phases, and mobile phase B for 12%; when the second stage (a total duration of 2 min from the ending time for the first stage) ends, the mobile phase A accounts for 86% by volume of the total flux of the mobile phases, and mobile phase B for 14%; when the third stage (a total duration of 6 min from the ending time for the second stage) ends, the mobile phase A accounts for 70% by volume of the total flux of the mobile phases, and the mobile phase B for 30%; when the fourth stage (a total duration of 10 min from the ending time for the third stage) ends, the mobile phase A accounts for 30% by volume of the total flux of the mobile phases, and mobile phase B for 70%.

(559) A standard curve is depicted by using the commercially available L-tryptophan as the standard, and the concentration of tryptophan in a sample is calculated.

Example 12. The Expression of the Gfp Gene Under Regulation of an Attenuator Mutant

(560) I. Construction of the Recombinant Plasmid pACYC184-P.sub.BB

(561) 1. The double-stranded DNA molecule (the promoter P.sub.BB) shown by SEQ ID No: 50 of the sequence listing is synthesized.

(562) 2. A PCR amplification product is obtained by performing a PCR amplification using the double-stranded DNA molecule prepared in step 1 as a template and using a primer pair comprised of WY841 and WY842.

(563) TABLE-US-00069 WY841: TGCTCTAGACAATTCCGACGTCTAAGAGA; WY842: CCCAAGCTTGGTCAGTGCGTCCTGCTGAT.

(564) 3. The enzymatically cleaved product of the PCR amplification product obtained in step 2, after being subjected to a double enzymatic cleavage using the restriction endonucleases XbaI and Hind III, is recovered.

(565) 4. The vector backbone (about 4.1 kb) of the plasmid pACYC184, after being subjected to a double enzymatic cleavage using the restriction endonucleases XbaI and Hind III, is recovered.

(566) 5. A recombinant plasmid pACYC184-P.sub.BB is obtained by linking the enzymatically cleaved product in step 3 and the vector backbone in step 4.

(567) II. Construction of Each Recombinant Plasmid and Corresponding Recombinant Bacteria

(568) 1. Construction of the recombinant bacteria GFP3230

(569) (1) A PCR amplification product A1 is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 MG1655 as a template and using a primer pair comprised of WY3230 and WY3236; a PCR amplification product A2 is obtained by performing a PCR amplification using the pGFPuv vector as a template and using a primer pair comprised of WY3105 and WY1859; a PCR amplification product A3 is obtained by performing a PCR amplification using a mixture of the PCR amplification product A1 and the PCR amplification product A2 as a template and using a primer pair comprised of WY3223 and WY1859.

(570) TABLE-US-00070 WY3230: CCCAAGCTT AAACATTCACAGAGACTTTT atgACAC; WY3236: AGTTCTTCTCCTTTACTCATAGAACCAGAACCAGAACCAA TGCCACAGCGCGCCAGCA; WY3105: GGTTCTGGTTCTGGTTCTATGAGTAAAGGAGAAGAACTTT TCA; WY1859: 0

(571) (2) The enzymatically cleaved product of the PCR amplification product A3 obtained in step (1), after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and Sph I, is recovered.

(572) (3) The vector backbone (about 4.0 kb) of the recombinant plasmid pACYC184-P.sub.BB, after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and Sph I, is recovered.

(573) (4) The recombinant plasmid pACYC184-P.sub.BB-hisLG-gfp3230 is obtained by linking the enzymatically cleaved product in step (2) and the vector backbone in step (3), then transforming into the E. coli EC135, and extracting a plasmid from a transformant. According to the sequencing result, a structural description for the recombinant plasmid pACYC184-P.sub.BB-hisLG-gfp3230 is set forth as follows: a specific DNA molecule is inserted between the enzymatic cleavage sites of Xba I and Sph I of the plasmid pACYC184; and the specific DNA molecule sequentially consists, from upstream to downstream, of the following elements: the promoter P.sub.BB shown by SEQ ID No: 50 of the sequence listing, a recognition sequence for enzymatic cleavage by restriction endonuclease Hind III, the RBS sequence “AAACATTCAC AGAGACTTTT” (SEQ ID NO: 232), the nucleotides at positions 1-286 of SEQ ID No: 51 of the sequence listing (inclusive of a complete histidine attenuator and the sequence coding for the first 30 amino acid residues in the open reading frame of the hisG gene), a linker sequence “GGTTCTGGTTCTGGTTCT” (SEQ ID NO: 67), the gfp gene shown by SEQ ID No: of the sequence listing, and the terminator sequence

(574) TABLE-US-00071 “CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGG TTTTTTG”.

(575) The E. coli EC135 comprising the recombinant plasmid pACYC184-P.sub.BB-hisLG-gfp3230 is named as recombinant bacteria GFP3230.

(576) 2. Construction of the Recombinant Bacteria GFP3231

(577) (1) A PCR amplification product A1 is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 MG1655 as a template and using a primer pair comprised of WY3231 and WY3236; a PCR amplification product A2 is obtained by performing a PCR amplification using the pGFPuv vector as a template and using a primer pair comprised of WY3105 and WY1859; a PCR amplification product A3 is obtained by performing a PCR amplification using a mixture of the PCR amplification product A1 and the PCR amplification product A2 as a template and using a primer pair comprised of WY3231 and WY1859.

(578) TABLE-US-00072 WY3231: CCCAAGCTT ACCTTCCGGGGGCTTTTTTATTGC.

(579) (2) The enzymatically cleaved product of the PCR amplification product A3 obtained in step (1), after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and Sph I, is recovered.

(580) (3) The vector backbone of the recombinant plasmid pACYC184-P.sub.BB, after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and Sph I, is recovered.

(581) (4) The recombinant plasmid pACYC184-P.sub.BB-hisLG-gfp323/is obtained by linking the enzymatically cleaved product in step (2) and the vector backbone in step (3), then transforming into the E. coli EC135, and extracting a plasmid from a transformant. According to the sequencing result, a structural description for the recombinant plasmid pACYC184-P.sub.BB-hisLG-gfp3231 is set forth as follows: a specific DNA molecule is inserted between the enzymatic cleavage sites of Xba I and Sph I of the plasmid pACYC184; and the specific DNA molecule sequentially consists, from upstream to downstream, of the following elements: the promoter P.sub.BB shown by SEQ ID No: 50 of the sequence listing, a recognition sequence for enzymatic cleavage by restriction endonuclease Hind III, the nucleotides at positions 130-286 of SEQ ID No: 51 of the sequence listing (inclusive of a truncated histidine attenuator and the sequence coding for the first 30 amino acid residues in the open reading frame of the hisG gene), a linker sequence “GGTTCTGGTTCTGGTTCT” (SEQ ID NO: 67), the gfp gene shown by SEQ ID No: 30 of the sequence listing, and the terminator sequence

(582) TABLE-US-00073 “CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTT TG”.

(583) The E. coli EC135 comprising the recombinant plasmid pACYC184-P.sub.BB-hisLG-gfp3231 is named as recombinant bacteria GFP3231.

(584) 3. Construction of the Recombinant Bacteria GFP3232

(585) (1) A PCR amplification product A1 is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 MG1655 as a template and using a primer pair comprised of WY3232 and WY3236; a PCR amplification product A2 is obtained by performing a PCR amplification using the pGFPuv vector as a template and using a primer pair comprised of WY3105 and WY1859; a PCR amplification product A3 is obtained by performing a PCR amplification using a mixture of the PCR amplification product A1 and the PCR amplification product A2 as a template and using a primer pair comprised of WY3232 and WY1859.

(586) TABLE-US-00074 WY3232: CCCAAGCTT GTTTAAAGAGGAATAACAAAATGACA.

(587) (2) The enzymatically cleaved product of the PCR amplification product A3 obtained in step (1), after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and Sph I, is recovered.

(588) (3) The vector backbone of the recombinant plasmid pACYC184-P.sub.BB, after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and Sph I, is recovered.

(589) (4) The recombinant plasmid pACYC184-P.sub.BB-hisLG-gfp3232 is obtained by linking the enzymatically cleaved product in step (2) and the vector backbone in step (3), then transforming into the E. coli EC135, and extracting a plasmid from a transformant. According to the sequencing result, a structural description for the recombinant plasmid pACYC184-P.sub.BB-hisLG-gfp3232 is set forth as follows: a specific DNA molecule is inserted between the enzymatic cleavage sites of Xba I and Sph I of the plasmid pACYC184; and the specific DNA molecule sequentially consists, from upstream to downstream, of the following elements: the promoter P.sub.BB shown by SEQ ID No: 50 of the sequence listing, a recognition sequence for enzymatic cleavage by restriction endonuclease Hind III, the nucleotides at positions 177-286 of SEQ ID No: 51 of the sequence listing (inclusive of the sequence coding for the first 30 amino acid residues in the open reading frame of the hisG gene and having completely removed the histidine attenuator), a linker sequence “GGTTCTGGTTCTGGTTCT” (SEQ ID NO: 67), the gfp gene shown by SEQ ID No: 30 of the sequence listing, and the terminator sequence

(590) TABLE-US-00075 “CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTT TG”.

(591) The E. coli EC135 comprising the recombinant plasmid pACYC184-P.sub.BB-hisLG-gfp3232 is named as recombinant bacteria GFP3232.

(592) 4. Construction of the GFP Control

(593) Recombinant bacteria is obtained by introducing the recombinant plasmid pACYC184-P.sub.BB into the E. coli EC135, and named as GFP control.

(594) III. Analysis for the fluorescence intensity of GFP The test strain: the recombinant bacteria GFP3230, the recombinant bacteria GFP3231 or the recombinant bacteria GFP3232.

(595) The GFP control is set to the control strain.

(596) 1. The test strain or the control strain is seeded into a liquid LB medium containing 34 mg/L chloramphenicol, followed by shaking culture overnight at 37° C., 220 rpm.

(597) 2. The bacteria liquid obtained in step 1 is seeded into a liquid 2×YT medium containing 34 mg/L chloramphenicol with a seeding amount of 1%, followed by shaking culture for 10 h at 37° C., 220 rpm.

(598) 3. 150 μL of the bacteria liquid obtained in step 2 is added into a 96-well plate having black edges and a transparent bottom, and the density of cells and the fluorescence signal of GFP are simultaneously detected by using a high throughput multifunctional microplate reader (the INFINITE 200 PRO type, TECAN, Switzerland). Parameters associated with detection of the density of cells are set as presented in Table 14. Parameters associated with detection of the fluorescence signal of GFP are set as presented in Table 15.

(599) TABLE-US-00076 TABLE 14 Absorbance Wavelength 600 nm Bandwidth  9 nm Number of Flashes 25 Settle Time  .sup. 0 ms

(600) TABLE-US-00077 TABLE 15 Fluorescence Top Reading Excitation Wavelength 400 nm Emission Wavelength 510 nm Excitation Bandwidth 9 nm Emission Bandwidth 20 nm Gain 100 (Manual) Number of Flashes 15 Integration Time 20 μs LagTime 0 μs Settle Time 0 ms Z-Position 20000 μm (Manual)

(601) The fluorescence intensity value of each test strain=the fluorescence value actually measured÷the density of cells−the fluorescence value actually measured from the control strain÷the density of cells of the control strain. Repeated tests are set in triplicate, and the results of the corresponding means and standard deviations are shown in Table 16.

(602) As compared with the recombinant bacteria GFP3230 (remaining a complete histidine attenuator), the fluorescence intensity of the recombinant bacteria GFP3231 is improved by 36.8 folds. As compared with the recombinant bacteria GFP3232 (having completely deleted the histidine attenuator), the fluorescence intensity of the recombinant bacteria GFP3231 is improved by 43.5 folds. The results indicate that the truncated histidine attenuator located between the promoter and the target gene can function as a regulation element to promote the expression of the target gene.

(603) The histidine attenuator mutant is shown by the nucleotides at positions n1-n2 of SEQ ID No: 51 of the sequence listing; n1 is a natural number greater than or equal to 126 but smaller than or equal to 143 (preferably, n1 is 130), and n2 is a natural number greater than or equal to 148 but smaller than or equal to 286 (n2 particularly can be a natural number greater than or equal to 148 but smaller than or equal to 196, or a natural number greater than or equal to 197 but smaller than or equal to 286, even more particularly 148, 196 or 286). The histidine attenuator mutant comprises a truncated histidine attenuator and a histidine attenuator variant (its full name is: a variant linking other nucleotides downstream of a truncated histidine attenuator). The truncated histidine attenuator is shown by the nucleotides at positions n1-148 of SEQ ID No: 51 of the sequence listing. The histidine attenuator variant is shown by the nucleotides at positions n1-n4 of SEQ ID No: 51 of the sequence listing; n4 is a natural number greater than or equal to 149 but smaller than or equal to (n4 particularly can be a natural number greater than or equal to 149 but smaller than or equal to 196, or a natural number greater than or equal to 197 but smaller than or equal to 286, even more particularly 196 or 286).

(604) TABLE-US-00078 TABLE 16 Fluorescence Intensity Recombinant bacteria 574.4 ± 35.2 GFP3230 Recombinant bacteria 21727.8 ± 583.2  GFP3231 Recombinant bacteria 488.5 ± 28.3 GFP3232

Example 13. Preparation of Histidine

(605) I. Construction of the Engineered Bacteria E.coliMG1655 hisG*ΔhisL

(606) 1. A PCR amplification product A1 is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 MG1655 as a template and using a primer pair comprised of WY4013 and WY4014. A PCR amplification product A2 is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 MG1655 as a template and using a primer pair comprised of WY4015 and WY4016.

(607) TABLE-US-00079 WY4013: CGCGGATCCCGTCCCATGATTCCTCAGA; WY4014: AAAGCCCCCGGAAGGTGATGTGAATGTTTATTCAACTGATGTC. WY4015: GACATCAGTTGAATAAACATTCACATCACCTTCCGGGGGCTTT; WY4016: ATTGCGGCCGCCCCAGAACAG GGTTTTGCTGCTGACC.

(608) The associated sequences in the genome of the E. coli K12 MG1655 are shown by SEQ ID No: 52 of the sequence listing, wherein the histidine attenuator is shown by the nucleotides at positions 596-743, and the nucleotides at positions 792-1691 are the gene coding for ATP phosphoribosyltransferase. The WY4013 and WY4014 are used for the amplification of the upstream homology arm; the WY4015 and WY4016 are used for the amplification of the downstream homology arm and introduction of one point mutation in the gene coding for ATP phosphoribosyltransferase. The upstream homology arm is located upstream of the histidine attenuator; the starting end of the downstream homology arm corresponds to the nucleotide at position 127 of the histidine attenuator, and the termination end of the downstream homology arm is located in the gene coding for ATP phosphoribosyltransferase. The ATP phosphoribosyltransferase coded by a corresponding gene before being introduced with the above point mutation in the genome of the E. coli K12 MG1655 is named as the HisG protein (shown by SEQ ID No: 54 of the sequence listing). The ATP phosphoribosyltransferase coded by a corresponding gene after being introduced with the above point mutation is named as the HisG*protein (shown by SEQ ID No: 53 of the sequence listing). As compared with the HisG protein, the HisG*protein only differs in that the amino acid residue at position 271 of the HisG protein is mutated to lysine from glutamic acid, thereby relieving the feedback repression.

(609) 2. A PCR amplification product is obtained by performing a PCR amplification using a mixture of the PCR amplification product A1 and the PCR amplification product A2 obtained in step 1 as a template and using a primer pair comprised of WY4013 and WY4016.

(610) 3. The enzymatically cleaved product of the PCR amplification product obtained in step 2, after being subjected to a double enzymatic cleavage using the restriction endonucleases BamH I and Not I, is recovered.

(611) 4. The vector backbone (about 5.6 kb) of the plasmid pKOV, after being subjected to a double enzymatic cleavage using the restriction endonucleases BamH I and Not I, is recovered.

(612) 5. A recombinant plasmid pKOV-ΔhisL-hisG* is obtained by linking the enzymatically cleaved product in step 3 and the vector backbone in step 4. According to the sequencing result, a structural description for the recombinant plasmid pKOV-ΔhisL-hisG* is set forth as follows: a specific DNA molecule is inserted between the enzymatic cleavage sites of BamH I and Not I of the plasmid pKOV; and the specific DNA molecule sequentially consists, from upstream to downstream, of the following elements: the upstream homology arm shown by the nucleotides at positions 32-585 of SEQ ID No: 52 of the sequence listing, and the downstream homology arm shown by the nucleotides at positions 722-1617 of SEQ ID No: 52 of the sequence listing.

(613) 6. Recombinant bacteria with homologous recombination are obtained by introducing the recombinant plasmid pKOV-ΔhisL-hisG* into the E. coli K12 MG1655, and named as engineered bacteria E.coliMG1655 hisG*ΔhisL. After being verified by sequencing, as compared with the genome DNA of the E. coli K12 MG1655, the engineered bacteria E.coliMG1655 hisG*ΔhisL differ in the two aspects as follows: (1) the nucleotides at positions 586-721 of the DNA molecule shown by SEQ ID No: 52 in the genome are deleted (in the deleted nucleotides: the first 10 nucleotides are the ones upstream of the histidine attenuator, and the remaining nucleotides are the ones at positions 1-126 of the histidine attenuator); (2) the nucleotide at position 1602 of the DNA molecule shown by SEQ ID No: 52 in the genome is mutated to A from G. The histidine operon of the engineered bacteria E.coliMG1655 hisG*ΔhisL is shown by the nucleotides at positions 127-7230 of SEQ ID No: 51 of the sequence listing.

(614) II. Construction of the Engineered Bacteria E.coliMG1655 hisG*

(615) 1. A PCR amplification product is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 MG1655 as a template and using a primer pair comprised of WY4013 and WY4019.

(616) TABLE-US-00080 WY4019: ATTGCGGCCGCCAGAACCGTTCAGTAAGCAG.

(617) 2. The enzymatically cleaved product of the PCR amplification product obtained in step 1, after being subjected to a double enzymatic cleavage using the restriction endonucleases BamH I and Not I, is recovered.

(618) 3. The vector backbone (about 5.6 kb) of the plasmid pKOV, after being subjected to a double enzymatic cleavage using the restriction endonucleases BamH I and Not I, is recovered.

(619) 4. A recombinant plasmid pKOV-hisL is obtained by linking the enzymatically cleaved product in step 2 and the vector backbone in step 3.

(620) 5. Recombinant bacteria with homologous recombination are obtained by introducing the recombinant plasmid pKOV-hisL into the engineered bacteria E.coliMG1655 hisG*ΔhisL, and named as engineered bacteria E.coliMG1655 hisG*.

(621) After being verified by sequencing, as compared with the genome DNA of the E. coli K12 MG1655, the engineered bacteria E.coliMG1655 hisG* differ in one aspect as follows: the nucleotide at position 1602 of the DNA molecule shown by SEQ ID No: 52 in the genome is mutated to A from G.

(622) III. Fermentation Test of Engineered Bacteria for Histidine in a Shake Flask

(623) The test strain is: the engineered bacteria E.coliMG1655 hisG*ΔhisL or the engineered bacteria E.coliMG1655 hisG*.

(624) 1. The test strain is streaked onto a solid LB medium plate, followed by static culture for 12 h at 37° C.

(625) 2. After completion of step 1, a bacterial lawn on the plate is picked and seeded into a liquid LB medium, followed by shaking culture for 8 h at 37° C., 220 rpm, and a seed solution is obtained (OD.sub.600nm value=5.0).

(626) 3. After completion of step 2, the seed solution is seeded into a fermentation medium in a seeding amount of 3%, followed by shaking culture at 37° C., 220 rpm.

(627) The fermentation medium is: glucose 20.0 g/L, ammonium sulfate 15.0 g/L, potassium dihydrogen phosphate 2.0 g/L, magnesium sulfate heptahydrate 2.0 g/L, yeast powders 2.0 g/L, calcium carbonate 15.0 g/L, microelement mixture 5 mL/L, and water as the remainder.

(628) The microelement mixture is: FeSO.sub.4.7H.sub.2O 10 g/L, CaCl.sub.21.35 g/L, ZnSO.sub.4.7H.sub.2O 2.25 g/L, MnSO.sub.4.4H.sub.2O 0.5 g/L, CuSO.sub.4.5H.sub.2O 1 g/L, (NH.sub.4).sub.6Mo.sub.7O.sub.24.4H.sub.2O 0.106 g/L, Na.sub.2B.sub.4O.sub.7-10H.sub.2O 0.23 g/L, CoCl.sub.2.6H.sub.2O 0.48 g/L, 35% HCl 10 mL/L, and water as the remainder.

(629) During the culture, ammoniacal liquor is used to adjust the pH value of the reaction system to make it maintain at 6.8-7.0.

(630) During the culture, sampling is made once every 3-4 h to detect the content of glucose by using a biosensor analyzer SBA-40D. When the content of glucose in the system is less than 5 g/L, glucose is supplemented to make the concentration of glucose in the system up to 10 g/L.

(631) Sampling is made after culture for 36 h, followed by centrifugation at 12,000 g for 2 min. The supernatant (the fermented supernatant) is taken for detection of the concentration of L-histidine.

(632) The results are shown in Table 17 (by a mean±standard deviation from repeated tests in triplicate). As compared with the engineered bacteria E.coliMG1655 hisG*, the yield of L-histidine produced in fermentation by the engineered bacteria E.coliMG1655 hisG*ΔhisL is significantly improved.

(633) TABLE-US-00081 TABLE 17 Content of L-histidine in fermented supernatant (g/L) Engineered bacteria E. coliMG1655 0.22 ± 0.05 hisG* Engineered bacteria E. coliMG1655 1.35 ± 0.25 hisG*ΔhisL

(634) A method for detecting the concentration of L-histidine is: HPLC, which is optimized based on the method for detecting amino acids in a reference (Amino Acids & Biotic Resources, 2000, 22, 59-60), and the method is particularly presented as follows (HPLC coupled to pre-column derivatization with 2, 4-dinitrofluorobenzene (FDBN)):

(635) First, 10 μL of the supernatant is taken into a 2 mL centrifuge tube, into which 200 μL of 0.5M NaHCO.sub.3 aqueous solution and 100 μL of 1% (v/v) FDBN-acetonitrile solution are added. Next, the centrifuge tube is placed in a water bath to be heated at a constant temperature of 60° C. for 60 min in the dark, then cooled to the room temperature, into which 700 μL of 0.04 mol/L KH.sub.2PO.sub.4 aqueous solution (pH=7.2±0.05; the pH is adjusted with 40 g/L KOH aqueous solution) is added, and shaken well. After being static for 15 min, filtration is performed and filtrates are collected. The filtrates are for injection, and injection volume is 15 μL.

(636) C18 column (ZORBAX Eclipse XDB-C18, 4.6*150 mm, Agilent, USA) is used as the chromatographic column; column temperature: 40° C.; UV detection wavelength: 360 nm; mobile phase A: 0.04 mol/L KH.sub.2PO.sub.4 aqueous solution (pH=7.2±0.05; the pH is adjusted with 40 g/100 mL KOH aqueous solution), mobile phase B: 55% (v/v) acetonitrile aqueous solution, and total flux of the mobile phases: 1 mL/min.

(637) The process of elution is presented as follows: at the starting time of elution (0 min), the mobile phase A accounts for 86% by volume of the total flux of the mobile phases, and mobile phase B for 14%; the process of elution is divided into 4 stages, and in each stage, parts by volume of the mobile phase A and the mobile phase B accounting for the total flux of the mobile phases appear a linear variation; when the first stage (a total duration of 2 min from the starting time) ends, the mobile phase A accounts for 88% by volume of the total flux of the mobile phases, and mobile phase B for 12%; when the second stage (a total duration of 2 min from the ending time for the first stage) ends, the mobile phase A accounts for 86% by volume of the total flux of the mobile phases, and mobile phase B for 14%; when the third stage (a total duration of 6 min from the ending time for the second stage) ends, the mobile phase A accounts for 70% by volume of the total flux of the mobile phases, and the mobile phase B for 30%; when the fourth stage (a total duration of 10 min from the ending time for the third stage) ends, the mobile phase A accounts for 30% by volume of the total flux of the mobile phases, and mobile phase B for 70%.

(638) A standard curve is depicted by using the commercially available L-histidine as the standard, and the concentration of histidine in a sample is calculated.

Example 14. The Expression of the Gfp Gene Under Regulation of an Attenuator Mutant

(639) I. Construction of Recombinant Plasmid pACYC184-P.sub.thr-trc

(640) 1. The double-stranded DNA molecule (the promoter P.sub.thr-trc) shown by SEQ ID No: 29 of the sequence listing is synthesiezed.

(641) 2. A PCR amplification product is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 MG1655 as a template and using a primer pair comprised of WY1947 and WY1948.

(642) TABLE-US-00082 WY1947: CTAGTCTAGA GCTTTTCATTCTGACTGCAAC; WY1948: CCCAAGCTTACATTATACGAGCCGGATGATTAATTGTCAACTGTCTGTGC GCTATGCCT.

(643) 3. The enzymatically cleaved product of the PCR amplification product obtained in step 2, after being subjected to a double enzymatic cleavage using the restriction endonucleases Xba I and Hind III, is recovered.

(644) 4. The vector backbone (about 4.1 kb) of the plasmid pACYC184, after being subjected to a double enzymatic cleavage using the restriction endonucleases Xba I and Hind III, is recovered.

(645) 5. A recombinant plasmid pACYC184-P.sub.thr-trc is obtained by linking the enzymatically cleaved product in step 3 and the vector backbone in step 4.

(646) II. Construction of each recombinant plasmid 1. Construction of the recombinant bacteria GFP3248

(647) (1) A PCR amplification product A1 is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 MG1655 as a template and using a primer pair comprised of WY3248 and WY3258; a PCR amplification product A2 is obtained by performing a PCR amplification using the pGFPuv vector as a template and using a primer pair comprised of WY3105 and WY1859; a PCR amplification product A3 is obtained by performing a PCR amplification using a mixture of the PCR amplification product A1 and the PCR amplification product A2 as a template and using a primer pair comprised of WY3248 and WY1859.

(648) TABLE-US-00083 WY3248: CCCAAGCTT AGTCACTTAAGGAAACAAAC atgA; WY3258: AGTTCTTCTCCTTTACTCAT AGAACCAGAACCAGAACC CAGCGCCAGTAACGGGTTTTC; WY3105: GGTTCTGGTTCTGGTTCTATGAGTAAAGGAGAAGAACTTTTCA; WY1859: ACATGCATGCCAAAAAACCCCTCAAGACCCGTTTAGAGGCCCCAAGGGGT TATGCTAGTTATTTGTAGAGCTCATCCATGCCA.

(649) (2) The enzymatically cleaved product of the PCR amplification product A3 obtained in step (1), after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and Sph I, is recovered.

(650) (3) The vector backbone of the recombinant plasmid pACYC184-P.sub.thr-trc, after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and Sph I, is recovered.

(651) (4) The recombinant plasmid pACYC184-P.sub.thr-trc-pheLA-gfp3248 is obtained by linking the enzymatically cleaved product in step (2) and the vector backbone in step (3), then transforming into the E. coli EC135, and extracting a plasmid from a transformant. According to the sequencing result, a structural description for the recombinant plasmid pACYC184-P.sub.thr-trc-pheLA-gfp3248 is set forth as follows: a specific DNA molecule is inserted between the enzymatic cleavage sites of Xba I and Sph I of the plasmid pACYC184; and the specific DNA molecule sequentially consists, from upstream to downstream, of the following elements: the promoter P.sub.thr-trc shown by SEQ ID No: 29 of the sequence listing, a recognition sequence for enzymatic cleavage by restriction endonuclease Hind III, the RBS sequence “AGTCACTTAAGGAAACAAAC”, the nucleotides at positions 1-176 of SEQ ID No: 62 of the sequence listing (inclusive of a complete phenylalanine attenuator and the sequence coding for the first 10 amino acid residues in the open reading frame of the pheA gene), a linker sequence “GGTTCTGGTTCTGGTTCT” (SEQ ID NO: 67), the gfp gene shown by SEQ ID No: of the sequence listing, and the terminator sequence

(652) TABLE-US-00084 “CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTT TG”.

(653) The E. coli EC135 comprising the recombinant plasmid pACYC184-P.sub.thr-trc-pheLA-gfp3248 is named as recombinant bacteria GFP3248.

(654) 2. Construction of the recombinant bacteria GFP3250

(655) (1) A PCR amplification product A1 is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 MG1655 as a template and using a primer pair comprised of WY3250 and WY3258; a PCR amplification product A2 is obtained by performing a PCR amplification using the pGFPuv vector as a template and using a primer pair comprised of WY3105 and WY1859; a PCR amplification product A3 is obtained by performing a PCR amplification using a mixture of the PCR amplification product A1 and the PCR amplification product A2 as a template and using a primer pair comprised of WY3250 and WY1859.

(656) TABLE-US-00085 WY3250: CCCAAGCTT CTTTTTTATTGATAACAAAAAGGCAACACT.

(657) (2) The enzymatically cleaved product of the PCR amplification product A3 obtained in step (1), after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and Sph I, is recovered.

(658) (3) The vector backbone of the recombinant plasmid pACYC184-P.sub.thr-trc, after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and Sph I, is recovered.

(659) (4) The recombinant plasmid pACYC184-P.sub.thr-trc-pheLA-gfp3250 is obtained by linking the enzymatically cleaved product in step (2) and the vector backbone in step (3), then transforming into the E. coli EC135, and extracting a plasmid from a transformant. According to the sequencing result, a structural description for the recombinant plasmid pACYC184-P.sub.thr-trc-pheLA-gfp3250 is set forth as follows: a specific DNA molecule is inserted between the enzymatic cleavage sites of Xba I and Sph I of the plasmid pACYC184; and the specific DNA molecule sequentially consists, from upstream to downstream, of the following elements: the promoter P.sub.thr-trc shown by SEQ ID No: 29 of the sequence listing, a recognition sequence for enzymatic cleavage by restriction endonuclease Hind III, the nucleotides at positions 117-176 of SEQ ID No: 62 of the sequence listing (inclusive of a truncated phenylalanine attenuator and the sequence coding for the first 10 amino acid residues in the open reading frame of the pheA gene), a linker sequence “GGTTCTGGTTCTGGTTCT” (SEQ ID NO: 67), the gfp gene shown by SEQ ID No: 30 of the sequence listing, and the terminator sequence

(660) TABLE-US-00086 “CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTT TG”.

(661) The E. coli EC135 comprising the recombinant plasmid pACYC184-P.sub.thr-trc-pheLA-gfp3250 is named as recombinant bacteria GFP3250.

(662) 3. Construction of the recombinant bacteria GFP3251

(663) (1) A PCR amplification product A1 is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 MG1655 as a template and using a primer pair comprised of WY3251 and WY3258; a PCR amplification product A2 is obtained by performing a PCR amplification using the pGFPuv vector as a template and using a primer pair comprised of WY3105 and WY1859; a PCR amplification product A3 is obtained by performing a PCR amplification using a mixture of the PCR amplification product A1 and the PCR amplification product A2 as a template and using a primer pair comprised of WY3251 and WY1859.

(664) TABLE-US-00087 WY3251: CCCAAGCTT GATAACAAAAAGGCAACACTATGA.

(665) (2) The enzymatically cleaved product of the PCR amplification product A3 obtained in step (1), after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and Sph I, is recovered.

(666) (3) The vector backbone of the recombinant plasmid pACYC184-P.sub.thr-trc, after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and Sph I, is recovered.

(667) (4) The recombinant plasmid pACYC184-P.sub.thr-trc-pheLA-gfp3251 is obtained by linking the enzymatically cleaved product in step (2) and the vector backbone in step (3), then transforming into the E. coli EC135, and extracting a plasmid from a transformant. According to the sequencing result, a structural description for the recombinant plasmid pACYC184-P.sub.thr-trc-pheLA-gfp3251 is set forth as follows: a specific DNA molecule is inserted between the enzymatic cleavage sites of Xba I and Sph I of the plasmid pACYC184; and the specific DNA molecule sequentially consists, from upstream to downstream, of the following elements: the promoter P.sub.thr-trc shown by SEQ ID No: 29 of the sequence listing, a recognition sequence for enzymatic cleavage by restriction endonuclease Hind III, the nucleotides at positions 127-176 of SEQ ID No: 62 of the sequence listing (inclusive of the sequence coding for the first 10 amino acid residues in the open reading frame of the pheA gene and having completely removed the phenylalanine attenuator), a linker sequence “GGTTCTGGTTCTGGTTCT” (SEQ ID NO: 67), the gfp gene shown by SEQ ID No: 30 of the sequence listing, and the terminator sequence

(668) TABLE-US-00088 “CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTT TG”.

(669) The E. coli EC135 comprising the recombinant plasmid pACYC184-P.sub.thr-trc-pheLA-gfp3251 is named as recombinant bacteria GFP3251.

(670) 4. Construction of the GFP Control

(671) Recombinant bacteria is obtained by introducing the recombinant plasmid pACYC184-P.sub.thr-trc into the E. coli EC135, and named as GFP control.

(672) III. Analysis for the Fluorescence Intensity of GFP

(673) The test strain is: the recombinant bacteria GFP3248, the recombinant bacteria GFP3250 or the recombinant bacteria GFP3251.

(674) The GFP control is set to the control strain. 1. The test strain or the control strain is seeded into a liquid LB medium containing 34 mg/L chloramphenicol, followed by shaking culture for overnight at 37° C., 220 rpm.

(675) 2. The bacteria liquid obtained in step 1 is seeded into a liquid LB medium containing 34 mg/L chloramphenicol with a seeding amount of 1%, followed by shaking culture for 12 h at 37° C., 220 rpm.

(676) 3. 150 μL of the bacteria liquid obtained in step 2 is added into a 96-well plate having black edges and a transparent bottom, and the density of cells and the fluorescence signal of GFP are simultaneously detected by using a high throughput multifunctional microplate reader (the INFINITE 200 PRO type, TECAN, Switzerland). Parameters associated with detection of the density of cells are set as presented in Table 18. Parameters associated with detection of the fluorescence signal of GFP are set as presented in Table 19.

(677) TABLE-US-00089 TABLE 18 Absorbance Wavelength 600 nm Bandwidth  9 nm Number of Flashes 25 Settle Time  .sup. 0 ms

(678) TABLE-US-00090 TABLE 19 Fluorescence Top Reading Excitation Wavelength 400 nm Emission Wavelength 510 nm Excitation Bandwidth 9 nm Emission Bandwidth 20 nm Gain 100 (Manual) Number of Flashes 15 Integration Time 20 μs LagTime 0 μs Settle Time 0 ms Z-Position 20000 μm (Manual)

(679) The fluorescence intensity value of each test strain=the fluorescence value actually measured÷the density of cells−the fluorescence value actually measured from the control strain÷the density of cells of the control strain. Repeated tests are set in triplicate, and the results of the corresponding means and standard deviations are shown in Table 20.

(680) As compared with the recombinant bacteria GFP3248 (remaining a complete phenylalanine attenuator), the fluorescence intensity of the recombinant bacteria GFP3250 is improved by 5.2 folds. As compared with the recombinant bacteria GFP3251 (having completely deleted the phenylalanine attenuator), the fluorescence intensity of the recombinant bacteria GFP3250 is improved by 3.7 folds. The results indicate that the truncated phenylalanine attenuator located between the promoter and the target gene can function as a regulation element to promote the expression of the target gene.

(681) The phenylalanine attenuator mutant is shown by the nucleotides at positions n1-n2 of SEQ ID No: 62 of the sequence listing; n1 is a natural number greater than or equal to 105 but smaller than or equal to 118 (preferably, n1 is 117), and n2 is a natural number greater than or equal to 123 but smaller than or equal to 176 (n2 particularly can be a natural number greater than or equal to 123 but smaller than or equal to 146, or a natural number greater than or equal to 147 but smaller than or equal to 176, even more particularly 123, 146 or 176). The phenylalanine attenuator mutant comprises a truncated phenylalanine attenuator and a phenylalanine attenuator variant (its full name is: a variant linking other nucleotides downstream of the phenylalanine attenuator truncation). The truncated phenylalanine attenuator is shown by the nucleotides at positions n1-123 of SEQ ID No: 62 of the sequence listing. The phenylalanine attenuator variant is shown by the nucleotides at positions n1-n4 of SEQ ID No: 62 of the sequence listing; n4 is a natural number greater than or equal to 124 but smaller than or equal to 176 (n4 particularly can be a natural number greater than or equal to 124 but smaller than or equal to 146, or a natural number greater than or equal to 147 but smaller than or equal to 176, even more particularly 146 or 176).

(682) TABLE-US-00091 TABLE 20 Fluorescence Intensity Recombinant bacteria 770.4 ± 65.2 GFP3248 Recombinant bacteria 4778.4 ± 463.2 GFP3250 Recombinant bacteria 1010.9 ± 128.6 GFP3251

Example 15. Preparation of Phenylalanine

(683) I. Construction of the recombinant plasmid pACYC184-P.sub.JJ

(684) 1. The double-stranded DNA molecule (the promoter P.sub.JJ) shown by SEQ ID No: 39 of the sequence listing is synthesized.

(685) 2. A PCR amplification product is obtained by performing a PCR amplification using the double-stranded DNA molecule prepared in step 1 as a template and using a primer pair comprised of WY843 and WY842.

(686) TABLE-US-00092 WY843: TGCTCTAGA CAATTCCGACGTCTAAGAAA; WY842: CCCAAGCTT GGTCAGTGCGTCCTGCTGAT.

(687) 3. The enzymatically cleaved product of the PCR amplification product obtained in step 2, after being subjected to a double enzymatic cleavage using the restriction endonucleases Xba I and Hind III, is recovered.

(688) 4. The vector backbone (about 4.1 kb) of the plasmid pACYC184, after being subjected to a double enzymatic cleavage using the restriction endonucleases Xba I and Hind III, is recovered.

(689) 5. A recombinant plasmid pACYC184-P.sub.JJ is obtained by linking the enzymatically cleaved product in step 3 and the vector backbone in step 4.

(690) II. Construction of Three Recombinant Plasmids

(691) 1. A PCR amplification product A1 is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 MG1655 as a template and using a primer pair comprised of WY3248 and WY4020; a PCR amplification product A2 is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 MG1655 as a template and using a primer pair comprised of WY3250 and WY4020; a PCR amplification product A3 is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 MG1655 as a template and using a primer pair comprised of WY3251 and WY4020; a PCR amplification product A4 is obtained by performing a PCR amplification using the genome DNA of the E. coli K12 MG1655 as a template and using a primer pair comprised of WY4021 and WY4022.

(692) TABLE-US-00093 WY3248: CCCAAGCTT AGTCACTTAAGGAAACAAAC atgA; WY3250: CCCAAGCTT CTTTTTTATTGATAACAAAAAGGCAACACT; WY3251: CCCAAGCTT GATAACAAAAAGGCAACACTATGA; WY4020: CTTCAACCAGCGCACAGGCTTGTTGCCC; WY4021: GGGCAACAAGCCTGTGCGCTGGTTGAAG WY4022: CGCGGATCC CGCACAGCGTTTTCAGAGT

(693) The WY4020 and WY4021 are used for introducing one point mutation into the gene coding for a bifunctional enzyme of chorismate mutase-prephenate dehydratase (said point mutation is a mutation of G.fwdarw.T corresponding to the nucleotide at position 1071 of SEQ ID No: 62 of the sequence listing). The bifunctional enzyme of chorismate mutase-prephenate dehydratase coded by a corresponding gene before being introduced with the above point mutation in the genome of the E. coli K12 MG1655 is named as the PheA protein (shown by SEQ ID No: 63 of the sequence listing). The bifunctional enzyme of chorismate mutase-prephenate dehydratase coded by a corresponding gene after being introduced with the above point mutation is named as the PheA*protein (shown by SEQ ID No: 64 of the sequence listing). As compared with the PheA protein, the PheA*protein only differs in that the amino acid residue at position 309 of the PheA protein is mutated to cysteine from glycine, thereby relieving the feedback repression.

(694) 2. A PCR amplification product B1 is obtained by performing a PCR amplification using a mixture of the PCR amplification product A1 and the PCR amplification product A4 obtained in step 1 as a template and using a primer pair comprised of WY3248 and WY4022; a PCR amplification product B2 is obtained by performing a PCR amplification using a mixture of the PCR amplification product A2 and the PCR amplification product A4 obtained in step las a template and using a primer pair comprised of WY3250 and WY4022; a PCR amplification product B3 is obtained by performing a PCR amplification using a mixture of the PCR amplification product A3 and the PCR amplification product A4 obtained in step 1 as a template and using a primer pair comprised of WY3251 and WY4022.

(695) 3. The vector backbone of the recombinant plasmid pACYC184-P.sub.JJ, after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and BamH I, is recovered.

(696) 4. The enzymatically cleaved product of the PCR amplification product B1 obtained in step 2, after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and BamH I, is recovered.

(697) 5. A recombinant plasmid pACYC184-P.sub.JJ-pheL.sup.3248A* is obtained by linking the vector backbone in step 3 and the enzymatically cleaved product in step 4. According to the sequencing result, a structural description for the recombinant plasmid pACYC184-P.sub.JJ-pheL.sup.3248A* is set forth as follows: a specific DNA molecule is inserted between the enzymatic cleavage sites of Xba I and BamH I of the plasmid pACYC184; and the specific DNA molecule sequentially consists, from upstream to downstream, of the following elements: the promoter P.sub.JJ shown by SEQ ID No: 39 of the sequence listing, a recognition sequence for enzymatic cleavage by restriction endonuclease Hind III, the RBS sequence “AGTCACTTAAGGAAACAAAC” (SEQ ID NO: 256), and the DNA molecule shown by SEQ ID No: 62 of the sequence listing.

(698) 6. The enzymatically cleaved product of the PCR amplification product B2 obtained in step 2, after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and BamH I, is recovered.

(699) 7. A recombinant plasmid pACYC184-P.sub.JJ-pheL.sup.3250A* is obtained by linking the vector backbone in step 3 and the enzymatically cleaved product in step 6. According to the sequencing result, a structural description for the recombinant plasmid pACYC184-P.sub.JJ-pheL.sup.3250A* is set forth as follows: a specific DNA molecule is inserted between the enzymatic cleavage sites of Xba I and BamH I of the plasmid pACYC184; and the specific DNA molecule sequentially consists, from upstream to downstream, of the following elements: the promoter P.sub.JJ shown by SEQ ID No: 39 of the sequence listing, a recognition sequence for enzymatic cleavage by restriction endonuclease Hind III, and the DNA molecule shown by the nucleotides at positions 117-1413 of SEQ ID No: 62 of the sequence listing.

(700) 8. The enzymatically cleaved product of the PCR amplification product B3 obtained in step 2, after being subjected to a double enzymatic cleavage using the restriction endonucleases Hind III and BamH I, is recovered. 9. A recombinant plasmid pACYC184-P.sub.JJ-pheL.sup.3251A* is obtained by linking the vector backbone in step 3 and the enzymatically cleaved product in step 8. According to the sequencing result, a structural description for the recombinant plasmid pACYC184-P.sub.JJ-pheL.sup.3251A* is set forth as follows: a specific DNA molecule is inserted between the enzymatic cleavage sites of Xba I and BamH I of the plasmid pACYC184; and the specific DNA molecule sequentially consists, from upstream to downstream, of the following elements: the promoter P.sub.JJ shown by SEQ ID No: 39 of the sequence listing, a recognition sequence for enzymatic cleavage by restriction endonuclease Hind III, and the DNA molecule shown by the nucleotides at positions 127-1413 of SEQ ID No: 62 of the sequence listing.

(701) III. Construction of Three Recombinant Plasmids

(702) 1. A PCR amplification product is obtained by performing a PCR amplification using the genome of the E. coli K12 MG1655 as a template and using a primer pair comprised of WY4023 and WY4024.

(703) TABLE-US-00094 WY4023: ACATGCATGC CAAAGCATAGCGGATTGTTTTC WY4024: CGCGGATCC TTAAGCCACGCGAGCCGTCA

(704) After a sequencing, in the PCR amplification product, the nucleotide sequence between the enzymatic cleavage sites of Sph I and BamH I is shown by SEQ ID No: 65 of the sequence listing, coding for the protein shown by SEQ ID No: 66 of the sequence listing. The protein shown by SEQ ID No: 66 is 3-deoxy-D-arabino-heptulosonate-7-phosphate synthetase (AroF protein). In SEQ ID No: 65 of the sequence listing, the open reading frame is the nucleotides at positions 195-1265.

(705) 2. The enzymatically cleaved product of the PCR amplification product obtained in step 1, after being subjected to a double enzymatic cleavage using the restriction endonucleases Sph I and BamH I, is recovered.

(706) 3. The vector backbone of the recombinant plasmid pACYC184-P.sub.JJ-pheL.sup.3248A*, after being subjected to a double enzymatic cleavage using the restriction endonucleases Sph I and BamH I, is recovered.

(707) 4. A recombinant plasmid pACYC184-P.sub.JJ-pheL.sup.3248A*-aroF is obtained by linking the enzymatically cleaved product in step 2 and the vector backbone in step 3. According to the sequencing result, a structural description for the recombinant plasmid pACYC184-P.sub.JJ-pheL.sup.3248A*-aroF is set forth as follows: said specific DNA molecule in 5 of step II is inserted between the enzymatic cleavage sites of Xba I and BamH I of the plasmid pACYC184; the aroF gene shown by SEQ ID No: 65 of the sequence listing is inserted between the enzymatic cleavage sites of Sph I and BamH I (in the recombinant plasmid, the specific DNA molecule and the aroF gene are present in reverse).

(708) 5. The vector backbone of the recombinant plasmid pACYC184-P.sub.JJ-pheL.sup.3250A*, after being subjected to a double enzymatic cleavage using the restriction endonucleases Sph I and BamH I, is recovered.

(709) 6. A recombinant plasmid pACYC184-P.sub.JJ-pheL.sup.3250A*-aroF is obtained by linking the enzymatically cleaved product in step 2 and the vector backbone in step 5. According to the sequencing result, a structural description for the recombinant plasmid pACYC184-P.sub.JJ-pheL.sup.3250A*-aroF is set forth as follows: said specific DNA molecule in 7 of step II is inserted between the enzymatic cleavage sites of Xba I and BamH I of the plasmid pACYC184; the aroF gene shown by SEQ ID No: 65 of the sequence listing is inserted between the enzymatic cleavage sites of Sph I and BamH I (in the recombinant plasmid, the specific DNA molecule and the aroF gene are present in reverse). 7. The vector backbone of the recombinant plasmid pACYC184-P.sub.JJ-pheL.sup.3251A* after being subjected to a double enzymatic cleavage using the restriction endonucleases Sph I and BamH I, is recovered.

(710) 8. A recombinant plasmid pACYC184-P.sub.JJ-pheL.sup.3251A*-aroF is obtained by linking the enzymatically cleaved product in step 2 and the vector backbone in step 7. According to the sequencing result, a structural description for the recombinant plasmid pACYC184-P.sub.JJ-pheL.sup.3251A*-aroF is set forth as follows: said specific DNA molecule in 9 of step II is inserted between the enzymatic cleavage sites of Xba I and BamH I of the plasmid pACYC184; the aroF gene shown by SEQ ID No: 65 of the sequence listing is inserted between the enzymatic cleavage sites of Sph I and BamH I (in the recombinant plasmid, the specific DNA molecule and the aroF gene are present in reverse).

(711) IV. Construction of Recombinant Bacteria

(712) Recombinant bacteria is obtained by introducing the recombinant plasmid pACYC184-P.sub.JJ-pheL.sup.3248A*-aroF into the E. coli K12 MG1655, and named as engineered bacteria Phe3248.

(713) Recombinant bacteria is obtained by introducing the recombinant plasmid pACYC184-P.sub.JJ-pheL.sup.3250A*-aroF into the E. coli K12 MG1655, and named as engineered bacteria Phe3250.

(714) Recombinant bacteria is obtained by introducing the recombinant plasmid pACYC184-P.sub.JJ-pheL.sup.3251A*-aroF into the E. coli K12 MG1655, and named as engineered bacteria Phe3251.

(715) V. Fermentation Test of Engineered Bacteria for Phenylalanine in a Shake Flask

(716) The test strain is: the engineered bacteria Phe3248, the engineered bacteria Phe3250 or the engineered bacteria Phe3251.

(717) 1. The test strain is streaked onto a solid LB medium plate, followed by static culture for 12 h at 37° C.

(718) 2. After completion of step 1, a bacterial lawn on the plate is picked and seeded into a liquid LB medium, followed by shaking culture for 8 h at 37° C., 220 rpm, and a seed solution is obtained (OD.sub.600nm value=5.0).

(719) 3. After completion of step 2, the seed solution is seeded into a fermentation medium in a seeding amount of 3%, followed by shaking culture at 37° C., 220 rpm.

(720) The fermentation medium is: glucose 20.0 g/L, ammonium sulfate 15.0 g/L, potassium dihydrogen phosphate 2.0 g/L, magnesium sulfate heptahydrate 2.0 g/L, yeast powders 2.0 g/L, calcium carbonate 15.0 g/L, microelement mixture 5 mL/L, and water as the remainder.

(721) The microelement mixture is: FeSO.sub.4.7H.sub.2O 10 g/L, CaCl.sub.21.35 g/L, ZnSO.sub.4.7H.sub.2O 2.25 g/L, MnSO.sub.4.4H.sub.2O 0.5 g/L, CuSO.sub.4.5H.sub.2O 1 g/L, (NH.sub.4).sub.6Mo.sub.7O.sub.24.4H.sub.2O 0.106 g/L, Na.sub.2B.sub.4O.sub.7.10H.sub.2O 0.23 g/L, CoCl.sub.2.6H.sub.2O 0.48 g/L, 35% HCl 10 mL/L, and water as the remainder.

(722) During the culture, ammoniacal liquor is used to adjust the pH value of the reaction system to make it maintain at 6.8-7.0.

(723) During the culture, sampling is made once every 3-4 h to detect the content of glucose by using a biosensor analyzer SBA-40D. When the content of glucose in the system is less than 5 g/L, glucose is supplemented to make the concentration of glucose in the system up to 10 g/L.

(724) Sampling is made after culture for 36 h, followed by centrifugation at 12,000 g for 2 min. The supernatant (the fermented supernatant) is taken for detection of the concentration of L-phenylalanine.

(725) The results are shown in Table 21 (by a mean±standard deviation from repeated tests in triplicate). As compared with the engineered bacteria Phe3248 and the engineered bacteria Phe3251, the yield of L-phenylalanine produced in fermentation by the engineered bacteria Phe3250 is significantly improved.

(726) TABLE-US-00095 TABLE 21 Content of L-phenylalanine in fermented supernatant (g/L) Engineered bacteria Phe3248 0.82 ± 0.07 Engineered bacteria Phe3250 1.55 ± 0.25 Engineered bacteria Phe3251 0.77 ± 0.15

(727) A method for detecting the concentration of L-phenylalanine is: HPLC, which is optimized based on the method for detecting amino acids in a reference (Amino Acids & Biotic Resources, 2000, 22, 59-60), and the method is particularly presented as follows (HPLC coupled to pre-column derivatization with 2, 4-dinitrofluorobenzene (FDBN)):

(728) First, 10 μL of the supernatant is taken into a 2 mL centrifuge tube, into which 200 μL of 0.5M NaHCO.sub.3 aqueous solution and 100 μL of 1% (v/v) FDBN-acetonitrile solution are added. Next, the centrifuge tube is placed in a water bath to be heated at a constant temperature of 60° C. for 60 min in the dark, then cooled to the room temperature, into which 700 μL of 0.04 mol/L KH.sub.2PO.sub.4 aqueous solution (pH=7.2±0.05; the pH is adjusted with 40 g/L KOH aqueous solution) is added, and shaken well. After being static for 15 min, filtration is performed and filtrates are collected. The filtrates are for injection, and injection volume is 15 μL.

(729) C18 column (ZORBAX Eclipse XDB-C18, 4.6*150 mm, Agilent, USA) is used as the chromatographic column; column temperature: 40° C.; UV detection wavelength: 360 nm; mobile phase A: 0.04 mol/L KH.sub.2PO.sub.4 aqueous solution (pH=7.2±0.05; the pH is adjusted with 40 g/100 mL KOH aqueous solution), mobile phase B: 55% (v/v) acetonitrile aqueous solution, and total flux of the mobile phases: 1 mL/min.

(730) The process of elution is presented as follows: at the starting time of elution (0 min), the mobile phase A accounts for 86% by volume of the total flux of the mobile phases, and mobile phase B for 14%; the process of elution is divided into 4 stages, and in each stage, parts by volume of the mobile phase A and the mobile phase B accounting for the total flux of the mobile phases appear a linear variation; when the first stage (a total duration of 2 min from the starting time) ends, the mobile phase A accounts for 88% by volume of the total flux of the mobile phases, and mobile phase B for 12%; when the second stage (a total duration of 2 min from the ending time for the first stage) ends, the mobile phase A accounts for 86% by volume of the total flux of the mobile phases, and mobile phase B for 14%; when the third stage (a total duration of 6 min from the ending time for the second stage) ends, the mobile phase A accounts for 70% by volume of the total flux of the mobile phases, and the mobile phase B for 30%; when the fourth stage (a total duration of 10 min from the ending time for the third stage) ends, the mobile phase A accounts for 30% by volume of the total flux of the mobile phases, and mobile phase B for 70%.

(731) A standard curve is depicted by using the commercially available L-phenylalanine as the standard, and the concentration of phenylalanine in a sample is calculated.

(732) At last, it should be noted that the above examples obviously are only an illustration for clearly describing the present invention rather than a limitation to the embodiments thereof. For the ordinarily skilled in the art, other variations or alterations in different forms can be made based on the above description. There is no need or probability illustrating all the embodiments herein, but the obvious variations or alterations derived therefrom are still within the protection scope of the present invention.

INDUSTRIAL APPLICATIONS

(733) The present invention provides a method for modification by truncating the functional sequence of a threonine attenuator from the 5′end step by step, and an expressing element of the 5′-untranslated region (5′-UTR) enhancing a gene expression is screened and obtained. Applying the 5′-UTR element optimized and obtained by the present invention to regulate the expression of the alanine dehydrogenase gene ald can improve the yield of L-alanine from engineered bacteria. The present invention obtains a nucleic acid sequence with efficiently enhanced gene expression, and constructs a strain for producing L-alanine, providing a novel method for improving the production of L-alanine in fermentation.

(734) The present invention obtains a threonine attenuator mutant for efficiently relieving feedback repression, which significantly improves the efficiency for removal of the repression, thereby improving a gene expression level. The engineered bacteria overexpressing the threonine operon comprising the mutant can significantly improve the yield of threonine. Mutants in the present invention practically can be used for production of threonine in fermentation by bacteria. The present invention obtains a method for efficiently relieving transcriptive repression of a threonine operon by truncating the functional sequence of a threonine attenuator from the 5′end step by step. Applying the method provided by the present invention for modifying a threonine attenuator can significantly improve the expression level of a threonine operon, thereby improving the performance for fermentation of threonine by engineered bacteria. The present invention obtains a nucleic acid sequence with efficiently relieved feedback repression, and constructs a strain for efficiently producing threonine, providing a novel method for improving the production of threonine in fermentation.

(735) The present invention can be applied to produce isoleucine. Thus, it is obvious that the present invention also can be used for the biosynthesis of the compounds downstream of the metabolic pathway of isoleucine as well as the synthesis of the derivatives of isoleucine. Applying the solutions provided by the present invention can significantly improve the yields of isoleucine and derivatives thereof, possessing an extremely significant value for application and promotion in the field of producing isoleucine and derivatives thereof.

(736) The present invention can be applied to produce valine. Thus, it is obvious that the present invention also can be used for the biosynthesis of the compounds downstream of the metabolic pathway of valine. Applying the solutions provided by the present invention can significantly improve the yields of valine and derivatives thereof, possessing an extremely significant value for application and promotion in the field of producing valine and derivatives thereof.

(737) The present invention can be used for the biosynthesis of the compounds downstream of the metabolic pathway of tryptophan, such as hydroxytryptamine, niacin, coenzymes, indoleacetic acid, pigments, alkaloid and etc. Obviously, the method for relieving a tryptophan attenuator of E. coli in the present invention can likewise be applied for tryptophan attenuators of other genuses. Applying the solutions provided by the present invention can significantly improve the yields of tryptophan and derivatives thereof, possessing an extremely significant value for application and promotion in the field of producing tryptophan and derivatives thereof.

(738) Applying the method provided by the present invention for modifying a histidine attenuator significantly improves the performance for fermentation of histidine by engineered bacteria. The present invention practically can be used for the production of histidine in fermentation by bacteria. It is obvious that the present invention can also be applied for the biosynthesis of the compounds like histamine downstream of the metabolic pathway of histidine. Applying the solutions provided by the present invention can significantly improve the yields of histidine and derivatives thereof, possessing an extremely significant value for application and promotion in the field of producing histidine and derivatives thereof.

(739) Applying the method provided by the present invention for modifying a phenylalanine attenuator significantly improves the performance for fermentation of phenylalanine by engineered bacteria. The present invention practically can be used for the production of phenylalanine in fermentation by bacteria. It is obvious that the present invention can also be applied for the biosynthesis of the compounds downstream of the metabolic pathway of phenylalanine, such as D-phenylalanine, phenylpyruvic acid, mandelic acid, phenyl acetate, phenyl ethanol, phenethylamine, styrene, cinnamic acid and etc. Applying the method provided by the present invention for modifying a phenylalanine attenuator significantly improves the expression levels of a phenylalanine operon or other genes, thereby improving the performance for fermentation of phenylalanine and derivatives thereof by engineered bacteria. The present invention obtains a nucleic acid sequence with efficiently relieved feedback repression, and constructs a strain for producing phenylalanine, providing a novel method for improving the production of phenylalanine in fermentation. Applying the solutions provided by the present invention can significantly improve the yields of phenylalanine and derivatives thereof, possessing an extremely significant value for application and promotion in the field of producing phenylalanine and derivatives thereof.