Method for Treatment of Traumatic Brain Injury Targeting Aggregated Peptides
20180209994 ยท 2018-07-26
Inventors
Cpc classification
A61P25/28
HUMAN NECESSITIES
G01N2800/2871
PHYSICS
G01N2800/52
PHYSICS
International classification
Abstract
A method of preventing, alleviating or treating traumatic brain injury in an individual comprises administering to the individual a therapeutically effective and physiologically acceptable amount of an agent capable of reducing the amount of one or more aggregated forms of one or more peptides in the brain. An agent capable of reducing the amount of one or more aggregated forms of one or more peptides in the brain is suitable for use in preventing, alleviating or treating traumatic brain injury. A method for predication of the risk of an individual for complications after a traumatic brain injury comprises detecting one or more aggregated forms of one or more peptides prone to aggregate as a result of a traumatic brain injury event, in the brain of the individual, wherein an increased level of such aggregates in the brain indicates an increased risk for complications.
Claims
1. A method of preventing, alleviating or treating traumatic brain injury in an individual, comprising administering to the individual a therapeutically effective and physiologically acceptable amount of an agent capable of reducing the amount of one or more aggregated forms of one or more peptides in the brain.
2. The method of claim 1, wherein said traumatic brain injury is a result of an acute brain injury event.
3. The method of claim 1, wherein said traumatic brain injury is a result of physical brain injury event.
4. The method of claim 1, wherein said traumatic brain injury is a result of brain injury caused by stroke or hypoxia.
5. Method according to claim 1, wherein said one or more peptides are selected from the group consisting of A peptides, alpha-synuclein peptides and tau-peptides.
6. Method according to claim 1, wherein said one or more aggregated forms of peptides are aggregated A peptides in the form of protofibrils.
7. Method according to claim 1, wherein the agent is an antibody.
8. Method according to claim 7, wherein said antibody binds A protofibrils.
9. Method according to claim 1, wherein said traumatic brain injury is mild traumatic brain injury.
10. Method according to claim 1, wherein said traumatic brain injury is medium traumatic brain injury.
11. Method according to claim 1, wherein said traumatic brain injury is severe traumatic brain injury.
12. Method according to claim 1, wherein said individual is a carrier of an Apolipoprotein E4 allele.
13. Method according to claim 1, wherein said individual is of Apolipoprotein E3/E4 or Apolipoprotein E4/E4 genotype.
14.-26. (canceled)
27. A method for predication of the risk of an individual for complications after a traumatic brain injury, comprising detecting one or more aggregated forms of one or more peptides prone to aggregate as a result of a traumatic brain injury event, in the brain of the individual, wherein an increased level of such aggregates in the brain indicates an increased risk for complications.
28. The method according to claim 27, wherein the one or more peptides are selected from the group consisting of A peptides, alpha-synuclein peptides and tau-peptides.
29. The method according to claim 27, wherein said one or more aggregated forms of peptides are aggregated A peptides in the form of protofibrils.
30. The method according to claim 27, wherein said one or more aggregated forms of peptides are detectable with an antibody.
31. The method according to claim 27, wherein said one or more aggregated forms of peptides are detectable with an antibody that binds protofibrils.
32. The method according to claim 27, further comprising determination of an Apolipoprotein genotype of the individual.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0013]
[0014]
DETAILED DESCRIPTION
[0015] Certain peptides in the brain have been identified as being prone to aggregate as a result of an acute brain injury. The aggregates that are formed, in particular toxic aggregates, provide a severe contribution to the damages to vital functions that are most often the result already in the acute phase. Methods and means are provided according to the invention for acute treatments and diagnosis, targeting precursors of these peptides, the peptides themselves, or aggregated forms thereof. Accordingly, several possibilities for therapy are available in order to reach the goal that is to eliminate or substantially reduce the amount of aggregates in the brain. In particular, embodiments, the methods and agents of the invention target amyloid- (A), -synuclein and/or tau peptide and/or tau peptide derivatives, e.g. P-tau, and/or oligomeric forms of these peptides, such as protofibrils. Within the present disclosure, protofibrils refers to larger soluble oligomers. In specific embodiments, the protofibrils have an apparent molecular weight greater than 100 kDa. In more specific embodiments, the protofibrils have an apparent molecular weight greater than 100 kDa, and a curvilinear structure of 4-11 nm in diameter and less than 200 nm in length. Such protofibrils are described, for example, by Walsh et al, The Journal of Biological Chemistry, 272(35):22364-22372 (1997), and Walsh et al, The Journal of Biological Chemistry, 274(36):25945-25952 (1999), both of which are incorporated herein by reference. In more specific embodiments, the methods and agents of the invention target the neurotoxic A protofibrils. According to specific embodiments of the invention, prevention, alleviation, treatment and/or diagnosis of a traumatic brain injury is achieved by the use of antibodies against one or more species comprising such a peptide. In the present description, the term peptide(s) will be used while the scientific literature sometimes refers to them as protein(s).
[0016] According to the present invention, elimination or at least substantial reduction of aggregated forms of certain target peptides in the brain provides efficient therapy in a new medical indication, i.e., situations with an acute brain injury event. These target peptides in the brain are characterized by the formation of aggregates in response to an acute brain injury event. The group of peptides prone to aggregate, under these conditions, comprises amyloid peptides, in particular the A peptide, -synuclein and tau peptide. The invention will in the following be illustrated mainly by exemplification with an amyloid peptide, A, one member from the group of peptides in the brain, prone to aggregate as a result of an acute brain injury event. However, the invention covers as well, other peptides prone to aggregate in a similar way, as a result of an acute brain injury event. The elimination or substantial reduction can be obtained in several different ways. Normally the peptide, e.g., A, is part of a receptor expressed in vivo, e.g. the Amyloid Precursor Protein (APP), and is cleaved off with one or more enzymes. By effecting the production of A, e.g., on the expression level or cleavage level of APP, the number of species that can undergo an aggregation reaction is reduced. Substances affecting these processes in the A system are, e.g., -secretase agonists, antagonists of -secretase and -secretase. Reduction of A peptide can also be achieved by stimulation of A degrading enzymes, e.g., by insulin degrading enzyme (IDE), neprilysin and others.
[0017] Elimination or at least substantial reduction of aggregated forms of the peptides may also be achieved by substances inhibiting the aggregation process as such, i.e., making the peptide monomers less prone to aggregate at all or preventing low molecular weight aggregates to undergo further aggregation to the most likely larger toxic aggregates, in particular, the protofibrils, i.e., larger soluble oligomers. For example, this can be achieved by administering substances which bind to peptide monomers and/or the low molecular weight aggregates, preventing them from further aggregation. Elimination of aggregated forms can of course also be achieved by administering substances targeting one or more of such aggregated forms for elimination of the species from the system, e.g., by disintegration to amino acids and/or monomers or less toxic small aggregates. Of special interest is the use of antibodies designed to have high affinity for aggregated forms of A, -synuclein or tau peptide. In specific embodiments, the invention is directed to the use of antibodies designed to have high affinity for, in particular, the protofibrils, for example, protofibrils of A, -synuclein or tau peptide. According to a further aspect of the invention, the toxic oligomeric or protofibril forms can be eliminated by an antibody-mediated uptake by microglial cells. According to a further aspect of the invention, the toxicity of oligomeric forms, in particular, protofibrils, is reduced, e.g., by administration of substances destroying or blocking toxic sites on the protofibrils.
[0018] Accordingly, in one embodiment, methods of preventing, alleviating and/or treating traumatic brain injury comprise administering to an individual an effective amount of an agent for reducing the amount of one or more aggregated forms of the peptide(s), e.g., with antibodies specific for peptides prone to aggregation after an acute brain injury, or their aggregated forms. In a specific embodiment of the invention, antibodies against A or aggregated forms of A are used to reduce the amount of one or more aggregated forms of the peptide(s), in order to enhance arousal and/or behavioral responsiveness, to avoid prolonged disorders of unconsciousness, and/or to alter the pace of recovery or improve the functional outcome. The goal is to regain wakefulness, conscious awareness, avoid a vegetative state and/or improve cognition. In a specific embodiment, antibody is initially administered during the acute phase as an intravenous infusion, intravenous or subcutaneous injection or delivered directly into the brain ventricles or intrathecally. Administration can be prolonged and used during the inpatient neurorehabilitation to further improve recovery.
[0019] It is known that peptides, prone to aggregate after an acute brain injury event, and which in monomer, oligomer and protofibril forms are the target for the methods according to the invention, may appear in various lengths, e.g. as a result of imperfect cleavage reactions in connection with production or as a result of the action of various enzymes at some stage. Again with examples from the A system, the full length peptide, the A peptide, is in most cases 1-39, 1-40, 1-41, 1-42 and 1-43. However, truncations at one or both (N-terminal and/or C-terminal) ends of the peptides are far from uncommon, and the 1-28, 3-40/42, 11-40/42, 17-40/42 and 24-35 are just a few examples of A peptides with various lengths which may appear in the in vivo system. Also, the truncated peptides can aggregate to the oligomer, protofibril and fibril forms mentioned above which means that in vivo aggregated forms of A may contain various combinations and amounts of full length and truncated forms. Aggregated forms of truncated A, including protofibrils, are also targets of the present methods. Antibodies against such truncated protofibrils are disclosed in WO 05/123775 and WO 2011/001366, which are hereby incorporated by reference in their entirety, and are suitable for use in the present methods.
[0020] Further variants of the peptides, prone to aggregate, may comprise mutated forms, where one or more of the amino acids in the peptide sequence are exchanged for a different amino acid. The Flemish (A21G), Arctic (E22G), Dutch (E22Q), Italian (E22K) and Iowa (D23N) mutations are well known and characterized. In particular, the Arctic mutation has been found to be of interest with regard to aggregation as it easily forms fairly stable and toxic A protofibrils. Antibodies against aggregated forms of such mutants, including protofibrils thereof, are also suitable for use in the present methods.
[0021] Another peptide in the brain is -synuclein which also aggregates under certain conditions to give various oligomer forms, protofibrils and fibrils. This peptide and its aggregated forms are strongly linked to the development of Parkinson's disease and Dementia with Lewy bodies. As in the A case, efforts have been focused on the development of therapies targeting the various -synuclein aggregated species. Several antibodies targeting the -synuclein protofibrils are disclosed in WO 2011/104696, which is hereby incorporated by reference in its entirety, and are also suitable for use in the present methods.
[0022] According to one aspect of the invention, a method is provided wherein a person suffering from, or suspected to be a victim of an acute brain injury event, is treated with an agent targeting one or more of these peptides and/or aggregates already formed from such peptides. In specific embodiments, soluble and/or insoluble aggregated forms are targeted. The agent is administered to exert its effect in the brain and must penetrate the blood brain barrier if administered systemically. A possible administration is directly into the brain parenchyma.
[0023] In a specific embodiment of the invention, the agent is an antibody targeting protofibrils. In a more specific embodiment of the invention, the agent is an antibody targeting A protofibrils. An example of a suitable drug candidate is a humanized antibody based on mAb158, disclosed in WO 07/108756, which provides a detailed disclosure of the antibody and is incorporated herein by reference in its entirety.
[0024] An antibody targeting peptides prone to aggregate and/or one or more aggregated forms thereof should have high affinity for one or more of these species. In specific embodiments, the antibody has high affinity for one or more protofibril(s). High affinity is defined as an ELISA method IC50 (the concentration of antibody needed to inhibit 50% of the assay signal) of less than 10.sup.7 M, less than 10.sup.8 M, less than 10.sup.9 M, less than 10.sup.10 M, or assay 10.sup.11 M. In a more specific embodiment, in addition to the high affinity for one or more of the peptide species, the antibodies are of IgG class, e.g. IgG1 or IgG4 subclass or combinations or mutations thereof, and in a more specific embodiment, in addition retain high Fc receptor binding and low C1 (C1q) binding, effective in clearance of the targeted peptide specie(s) and with reduced risk of inflammation.
[0025] In one embodiment of the method for treatment of traumatic brain injury in an individual, which comprises administering to the individual a therapeutically effective and physiologically acceptable amount of an agent reducing in the brain of an individual the amount of one or more aggregated forms of a peptide, prone to aggregate as a result of a traumatic brain injury event, the amount of aggregates is reduced at least by 30%, 40%, 50%, 60%, 70%, 80% or 90% compared to a control. Even as low as 1% reduction may have significant clinical benefits.
[0026] It is believed that the time range from the traumatic brain injury event to treatment in accordance with the invention should be as short as possible. This means that a patient reaching the emergency unit of a hospital with a suspected traumatic brain injury should be treated immediately in accordance with the present invention, and at least for a period in which increased levels of peptide aggregates caused by the traumatic brain injury event are present.
[0027] It is believed that increased levels of soluble A protofibrils in the brain will after many years cause dementia, in particular, Alzheimer's disease. For this reason, this invention also pertains to a chronic/preventive treatment of TBI with an agent reducing neurodegeneration which may cause dementia and Alzheimer's disease. For example, an individual at risk of later complications from TBI can be the subject of preventive treatment.
[0028] The formation of aggregates as a result of the brain injury event is of course of diagnostic or perhaps more correctly predictive value, alone or in combination with traditional characteristics of a brain disease of this type. The formation of aggregates of this type in the brain after a traumatic brain injury event indicates a risk for severe complications. For diagnosis/predication of risk, labeled substances targeting one or more of the peptide aggregates, for example, a labeled antibody, can be injected and the localization and amount of aggregates can be measured, e.g. by PET or MRI techniques. For example, fluorescent, magnetic, or radio-labeled antibodies may be employed. Alternatively, tissue of body fluid samples can be collected for in vitro analysis. In particular, antibodies against one or more of the aggregated forms, e.g., the protofibrils, are of great importance in such methods.
[0029] In one aspect of the invention there is provided a method of preventing, alleviating or treating traumatic brain injury in an individual, comprising administering to the individual a therapeutically effective and physiologically acceptable amount of an agent capable of reducing the amount of one or more aggregated forms of one or more peptides in the brain of the individual.
[0030] In one embodiment of this aspect, the traumatic brain injury is a result of an acute brain injury event. In one embodiment of this aspect, the traumatic brain injury is a result of physical brain injury event. In one embodiment of this aspect, the traumatic brain injury is a result of brain injury caused by stroke or hypoxia.
[0031] In one embodiment of this aspect, the one or more peptides are selected from the group consisting of A peptides, alpha-synuclein peptides and tau-peptides.
[0032] In one embodiment of this aspect, the one or more aggregated forms of peptides are aggregated A peptides in the form of protofibrils.
[0033] In one embodiment of this aspect, the agent is an antibody. In a specific embodiment, the antibody binds A protofibrils.
[0034] In one embodiment of this aspect, the traumatic brain injury is mild traumatic brain injury. In one embodiment of this aspect, the traumatic brain injury is medium traumatic brain injury. In one embodiment of this aspect, the traumatic brain injury is severe traumatic brain injury.
[0035] In one embodiment of this aspect, the individual is a carrier of an Apolipoprotein E4 allele. In one embodiment of this aspect, the individual is of Apolipoprotein E3/E4 or Apolipoprotein E4/E4 genotype.
[0036] In one aspect of the invention there is provided an agent capable of reducing the amount of one or more aggregated forms of one or more peptides, in the brain, for use in preventing, alleviating or treating traumatic brain injury. In a specific embodiment, the agent is a medicament for use in preventing, alleviating or treating traumatic brain injury.
[0037] In one embodiment of this aspect, the traumatic brain injury is a result of an acute brain injury event. In one embodiment of this aspect, the traumatic brain injury is a result of physical brain injury event. In one embodiment of this aspect, the traumatic brain injury is a result of brain injury caused by stroke or hypoxia.
[0038] In one embodiment of this aspect, the one or more peptides are selected from the group consisting of A peptide, alpha-synuclein peptide and tau-peptides.
[0039] In one embodiment of this aspect, the one or more aggregated forms of peptides are aggregated A peptides in the form of protofibrils.
[0040] In one embodiment of this aspect, the agent is an antibody. In a specific embodiment, the antibody binds A protofibrils.
[0041] In one embodiment of this aspect, said traumatic brain injury is mild traumatic brain injury. In one embodiment of this aspect, said traumatic brain injury is medium traumatic brain injury. In one embodiment of this aspect, said traumatic brain injury is severe traumatic brain injury.
[0042] In one embodiment of this aspect, said agent for use is for an individual being a carrier of an Apolipoprotein E4 allele. In one embodiment of this aspect, said agent for use is for an individual being of Apolipoprotein E3/E4 or Apolipoprotein E4/E4 genotype.
[0043] In one aspect of the invention there is provided a method for predication of the risk for complications after a traumatic brain injury in an individual, comprising detecting one or more aggregated forms of one or more peptides prone to aggregate as a result of a traumatic brain injury event, in the brain of the individual, wherein an increased level of such one or more aggregates in the brain indicates an increased risk for complications.
[0044] In one embodiment of this aspect, the one or more peptides are selected from the group consisting of A peptides, alpha-synuclein peptides and tau-peptides.
[0045] In one embodiment of this aspect, the one or more aggregated forms of peptides are aggregated A peptides in the form of protofibrils.
[0046] In one embodiment of this aspect, the one or more aggregated forms of peptides are detectable with an antibody.
[0047] In one embodiment of this aspect, the one or more aggregated forms of peptides are detectable with an antibody that binds A protofibrils.
[0048] In one embodiment of this aspect, the method further comprises determination of Apolipoprotein genotype.
[0049] The following non limiting example illustrates certain aspects of the invention.
EXAMPLE 1
[0050] The use of human post mortem brain material was approved by the regional ethical committee in Uppsala (decision number 2009/089). Written informed consent was obtained from all subjects involved in the study (or their relatives).
[0051] This Example studied twelve severe TBI subjects. Five post-mortem AD temporal cortex brain samples (AD1 (Swedish mutation carrier), AD3, AD10, AD13, and AD18), and four neurologically intact (NI) control samples (UBB12, UBB23, UBB24 and UBB31) from Uppsala brain bank, and patients with normal pressure hydrocephalus (NPH) (n=4), were also included in this study. Characteristics of the twelve severe TBI subjects are provided in Table 1 below:
TABLE-US-00001 TABLE 1 Cause of Other time post- Region of GMS Patient # Age Gender injury injuries injury (h) surgery Surgery pre-op Histology #1 22 M MVA Thi 9 LT Ccx + DC 4 #2 72 M Fall None 4 LF Ccx + DC 2 #3 40 M MVA None 4 RF Ccx 5 #6 74 M Fall None 4 RT Ccx 5 A, AA #7 58 M Fall Efx 9 LT Ccx 5 No A #8 49 M Fall None 84 RT Ccx* 5 No A #9 19 F Fall None 16 RFT Ccx + DC{circumflex over ()}{circumflex over ()} 3 No A #10 65 M Fall Ffx, Thi 180 LT Ccx 3 A #11 25 M SPR None 24 LFP Ccx + DC** 2 APP, AS #14 67 M HBO None 4 LT Ccx 5 A, AA #15 51 M Fall None 53 RF Ccx + DC 5 No A #16 52 M Fall None 42 RT Ccx*** 4 No A *coagulopathy {circumflex over ()}{circumflex over ()}DC prior to Ccx, performed at re-surgery **Initial surgery for aSDH and DC in primary hospital, CCX + revised DC secondary surgery ***Initial surgery for aSDH, Ccx at re-surgery Abbreviations: DC = Decompressive craniectomy, M = male; F = female; L = left; R = right; T = temporal; F = frontal, P = parietal, Ccx = removal of cortical contusion; GMS = motor component of the Glasgow Coma Scale; SPR = sports-related; MVA = motor-vehicle accident; HBO = hit by object; Thi = thoracic injury; Efx = extremity fracture; Ffx = facial fracture, GOS = Glasgow Outcome Scale; A = beta-amyloid, AA = amyloid angiopathy; APP = amyloid precursor protein; AS = axonal swelling.
Methods
[0052] The biopsies and brain samples were homogenized on ice using Dounce homogenizer (210 strokes) in 1:10 weight:volume Tris buffered saline (20 mM Tris, 137 mM NaCl) with the addition of protease inhibitors, according to the manufacturer (Complete Mini, Roche). The samples were centrifuged at 16000g for 1 h at +4 C. and the supernatants were defined as TBS extracts.
[0053] A 1-42 peptides were purchased from American Peptide Company, CA, USA (batch #12077006T). Lyophilized peptides were dissolved to 100 M in 10 mM NaOH. A 1-42 protofibrils were prepared by diluting the A 1-42 peptide to 50 M in 0.1 M Phosphate buffer containing 0.3 M NaCl, pH 7.4. The preparation was incubated for 30 min at 37 C. and then centrifuged at 16000g for 5 min to pellet potential large aggregates. The supernatants were further purified from monomers by size exclusion chromatography (Superdex 75 column, GE Healthcare, Sweden) at a flow rate of 0.08 ml/min in 0.05M Phosphate buffer, 0.15M NaCl, pH 7.4, and protofibrils were collected in the void fraction as previously described (Nilsberth C et al., (2001) Nat Neurosci 4, 887-893; Walsh D M et al., (1997) J Biol Chem 272, 22364-22372; Sehlin D et al., (2012) PloS One 7, e32014).
[0054] A conventional assay for determination of total protein content was used to generate a dataset for normalization of A-data (BCA protein assay kit, #23227, Pierce).
Assay for A Protofibrils
[0055] The mAb158 sandwich ELISA, previously described in Englund H et al. (2007 J Neurochem 103, 334-345), specifically detects A protofibrils without interference from A monomers. The protofibril-selective monoclonal mouse antibody mAb158 (IgG2a, BioArctic Neuroscience, Stockholm, Sweden) was formulated in sterile PBS (pH 7.5) at a concentration of 2 mg/ml and has previously been characterized. ELISA plates were coated with 2 g/ml mAb158 in PBS overnight at +4 C. and blocked with 1% BSA in PBS for 1 h. TBS extracts were diluted fivefold and incubated in duplicates for 2 h at 22 C. with shaking (600 rpm), thereafter biotinylated mAb158 (0.5 g/ml) was added and the plates were incubated for another hour. Streptavidin-HRP (Mabtech, Sweden 1: 5000) was used as detection agent (1 h incubation). Plates were developed with TMB substrate and the reaction was stopped after 25 min by the addition of 2M H.sub.2SO.sub.4. Optical density was measured at 450 nm and sample concentrations were calculated from an A42 protofibril standard curve using a 4-parameter equation. Data was re-calculated together with the total protein dataset and presented as pg protofibril per mg total protein in each sample.
Assay for A Oligomers/Protofibrils (OLs)
[0056] The mAb82E1 sandwich ELISA detects A oligomers/protofibrils (dimers to protofibrils) without binding A monomers (Tucker Set al., (2015) J Alzheimer's Dis. 2015; 43(2):575-88, Supplementary
Monomeric A 38, 40 and 42
[0057] Two different immunoassay kits measuring both full-length and truncated forms (mAb6E10 detection, cat no. K15200E-2 and mAb4G8 detection, cat no. K15199E-2) of A 38, A 40 and A42 in a three-in-one (triplex) well format, were obtained from Meso Scale Discovery (Rockville, Md., USA). TBS extracts were subject to denaturation and monomerisation by boiling in 1% SDS prior to 10-fold dilution and addition to duplicate wells. The same final concentration of SDS (0.1%) was added to the A standards supplied with the kits, and this procedure has been shown not to interfere with the assay (data not shown). Data was re-calculated and presented as pg A per mg total protein in each sample.
HAMA Analysis
[0058] Human Anti-Mouse Antibodies (HAMA) are found in 10-20% of naive serum samples and can potentially cross-link the antibodies in a sandwich ELISA method, resulting in false positive signals (Koshida et al., 2010). In order to address HAMA, the mAb158 and mAb82E1 ELISAs were run in the presence of HAMA buffer (365 J2, Mabtech, Sweden) and with coating of the ELISA plate with irrelevant mouse IgG (015-000-003, Jackson Immuno Research, West Grove, Pa., USA).
Apolipoprotein E Genotyping
[0059] Apolipoprotein E (ApoE) genotyping was performed essentially as described in Hixson and Vernier (J Lipid Res 1990, March; 31(3):545-8) with slight modification of the primer sequences. Genomic DNA was prepared from 25 mg brain tissue using a commercial kit (QIAamp DNA Mini Kit, cat no 51304). 40 ng DNA was PCR amplified using Taq polymerase as described by the manufacturer (Thermo Scientific, cat no AB0908) using forward ApoE primer (AGACGCGGGCACGGCTGTCCAAGGAGC) (SEQ ID NO: 1) and reverse ApoE primer (TCGCGGGCCCCGGCCTGGTACACTGC) (SEQ ID NO: 2) with the addition of 5% DMSO. The PCR cycling completed 35 rounds of: denaturation 95 C.1 min, annealing, 95 C.1 min and elongation 72 C.1.5 min. The 244 bp PCR product was cleaved using the restriction enzyme Hha I according to the manufacturer (Thermo Scientific, cat no. 10819870) and the digested fragments were separated on a high resolution 4% MetaPhor agarose gel (Lonza, cat no 50181).
Results
[0060] Traumatic brain injury (TBI) is an established risk factor of Alzheimer's disease (AD). A hallmark pathological finding in AD brains is insoluble plaques of amyloid-beta (A) although recent evidence suggests that soluble and neurotoxic A oligomers (OLs) and protofibrils (PFs) may be more important causes of cognitive impairment and neurodegeneration. Surprisingly, A plaques were previously observed within hours in a subset of TBI patients, persisting up to several years after severe TBI. However, the role for the potentially neurotoxic A OLs and PFs in TBI has not been established.
[0061] Enzyme-linked immunosorbent assay (ELISA) was used to evaluate the presence of A oligomers and protofibrils (OLs) in brain tissue, surgically resected during the first post-injury week in the described 12 severe TBI patients (mean 49.6 years, range 19-74) due to life threatening brain swelling and/or intracranial pressure elevations. Post-mortem brain tissue from the AD patients (n=5), and cortical biopsies from patients with normal pressure hydrocephalus (n=4) and post-mortem brain tissue from neurologically intact (NI) patients dying from unrelated causes (n=4) were used as controls. Immunohistochemistry of a subset of the TBI tissue (n=9) revealed A plaques in 3/9 TBI patients. A OLs (median 129 (range 29-342) vs. 0 (range 0-0) pg/mg total protein, p<0.01) and PFs (median 17.5 (range 0-626) vs. 0 (range 0-0) pg/mg total protein, p<0.01) levels were increased in TBI patients when compared to the control group. The levels of A OLs and PFs in brain tissue were also higher in TBI (median OLs 129, range 29-342 and PFs 17.5, range 0-626 pg/mg total protein) in comparison with AD patients (median OLs 27, range 0-399, p=0.16 and PFs 0, range 0-78, p=0.37). Patients with immunohistochemical evidence of A plaques had the highest levels of A PFs. We conclude that human TBI induces rapid accumulation of soluble A oligomers and protofibrils in injured brain tissue. Induction of soluble A species may aggravate the secondary brain injury and contribute to the increased risk of AD after TBI.
[0062] Results from the ApoE genotyping are provided in the Table 2 below.
TABLE-US-00002 TABLE 2 Patient # ApoE Genotype #1 E3/E3 #2 E3/E3 #3 E3/E3 #6 E3/E4 #7 E3/E3 #8 E3/E4 #9 E2/E4 #10 E3/E4 #11 E3/E3 #14 E3/E4 #15 E3/E3 #16 E3/E3
[0063] The PCR amplification and Hha I restriction was performed in three separate experiments with similar results. Four out of 12 TBI patients with high A protofibril levels (
[0064] The E3/E4 genotype is the most common genotype in the AD group and among the Hydrocephalus controls 1 out of 4 patients carry the E3/E4 genotype, a frequency similar to what is expected in the general population (http://www.alzgene.org/meta.asp?gene)D=83).
[0065] The data suggest a link between carrying the E3/E4 genotype and responding with high A protofibril levels shortly after a traumatic brain injury.
[0066] Results from running the mAb158 and mAb82E1 ELISAs with standard settings in parallel with HAMA buffer and/or irrelevant mouse IgG coating suggested that the observations were true and not a consequence of HAMA activity in the assays (data not shown). It was concluded from the study that in 4 out of 12 TBI patients (33%), it was possible to measure elevated A protofibril levels as compared to control brains. In the same 4 TBI patients, elevated levels of soluble A42 levels were detected as compared to control brains. In 11 out of 12 TBI patients, elevated A oligomer levels were measured as compared to control brains. The soluble A42 are pre-dominantly N-terminally truncated forms.
[0067] The specific examples and embodiments described herein are exemplary only in nature and are not intended to be limiting of the invention defined by the claims. Further embodiments and examples, and advantages thereof, will be apparent to one of ordinary skill in the art in view of this specification and are within the scope of the claimed invention.