Nitrilase mutant, construction method therefor, and application thereof
11492606 · 2022-11-08
Assignee
Inventors
- Renchao Zheng (Hangzhou, CN)
- Yuguo Zheng (Hangzhou, CN)
- Qin Zhang (Hangzhou, CN)
- Zheming Wu (Hangzhou, CN)
- Xiaoling Tang (Hangzhou, CN)
- Xiafeng Lu (Hangzhou, CN)
Cpc classification
C12N9/78
CHEMISTRY; METALLURGY
C12N15/70
CHEMISTRY; METALLURGY
International classification
C12N9/78
CHEMISTRY; METALLURGY
C12P13/00
CHEMISTRY; METALLURGY
Abstract
The present invention discloses a nitrilase mutant and its construction method and its application in the synthesis of chiral intermediate of pregabalin in the technical field of bioengineering. The present invention, respectively, takes turnip nitrilase BrNIT and arabidopsis nitrilase AtNIT as parent, using peptide fragment displacement method, displaces the sites 226-286 of BrNIT amino acid sequence and sites 225-285 of AtNIT amino acid sequence with sites 225-285 of Arabis alpina L. nitrilase AaNIT, obtain nitrilase mutants BrNIT.sub.225-285 and AtNIT.sub.225-285 of which the amino acid sequence is as shown in SEQ ID NO.1 or SEQ ID NO.3. Compared with wild type nitrilase, the activity of the nitrilase mutant provided by the present invention in catalyzing and hydrolyzing racemic IBSN and the stereoselectivity of the product show substantial improvement, it can satisfy the requirements of industrial application, and has good application prospect in efficient catalysis of racemic IBSN to synthesize 3-cyano-5-methylhexanoic Acid.
Claims
1. A nitrilase mutant having the amino acid sequence of SEQ ID NO.1 or SEQ ID NO.3.
2. A coding gene for coding the nitrilase mutant according to claim 1, wherein the coding gene has the nucleotide sequence of SEQ ID NO.2 or SEQ ID NO.4.
3. A recombinant vector containing the coding gene according to claim 2.
4. A recombinant genetic engineering strain containing the recombinant vector according to claim 3.
5. A method for preparing the nitrilase mutant of claim 1, which is characterized in comprising the following steps: (1) based on turnip nitrilase gene or arabidopsis nitrilase gene sequence, designing a PCR primer by using Arabis alpina L, cDNA as a template, utilizing the primer to amplify to obtain a DNA fragment I or a DNA fragment II that contains nucleotide positions 673-855 of the Arabis alpina L, nitrilase nucleotide sequence (SEQ ID NO: 8); (2) taking a recombinant plasmid that carries turnip nitrilase gene or arabidopsis nitrilase gene sequence as a template, utilizing reverse PCR amplification to obtain a Brassica rapa nitrilase (BrNIT) plasmid fragment lack in nucleotide positions 676-858 of the turnip nitrilase nucleotide sequence (SEQ ID NO: 6) or obtain the Arabidopsis thaliana nitrilase (AtNIT) plasmid fragment lack in nucleotide positions 673-855 of the arabidopsis nitrilase nucleotide sequence (SEQ ID NO: 10); (3) recombining the DNA fragment I with the BrNIT plasmid fragment or recombining the DNA fragment II with the AtNIT plasmid fragment, and introducing the recombinant product into the host bacteria, filtering to obtain nitrilase mutant expression strain; (4) conducting induced expression to the nitrilase mutant expression strain to obtain the nitrilase mutant.
6. A method of using the nitrilase mutant of claim 1 in catalyzing racemic isobutylsuccinonitrile (IBSN) to prepare (S)-3-cyano-5-methylhexanoic acid, the method comprising the steps of: taking wet cells comprising a polynucleotide encoding the nitrilase mutant of claim 1, immobilized cells of the wet cells or pure enzyme extracted from ultrasonication of the wet cells as a catalyst, using racemic IBSN as a substrate, and using buffer solution of pH 5.0-10.0 as a reaction medium to conduct hydrolysis reaction at 25-45° C. and 100-300 rpm; after complete reaction, obtaining a mixture containing (S)-3-cyano-5-methylhexanoic acid, separating and purifying the mixture to obtain (S)-3-c5-methylhexanoic acid.
7. The method according to claim 6, which is characterized in that, in the reaction system, the final concentration of the substrate is 0.5-1.5 M, use amount of the catalyst is calculated based on weight of the wet cell at 10-30 g/L.
8. The method according to claim 6, which is characterized in that, reaction medium is Tris-HCl buffer solution with pH 8.0.
9. The method according to claim 6, which is characterized in that, the wet cells are recombinant E. coli BL21(DE3)/pET28b-BrNIT.sub.225-285 or E. coli BL21(DE3)/pET28b-AtNIT.sub.225-285 containing nitrilase mutant coding gene; and wherein the method of fermental culture comprises: inoculating recombinant E. coli containing nitrilase mutant coding gene in a LB culture medium containing kanamycin and culturing until OD.sub.600=0.6-0.8, adding isopropyl-β-D-thiogalactopyranoside of final concentration 0.1 mM, conducting induced culture at 28° C. for 10-12 hours, conducting centrifugation, collecting cells and obtaining the wet cell; wherein BrNIT represents Brassica rapa nitrilase and AtNIT represents Arabidopsis thaliana nitrilase.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
DETAILED DESCRIPTION OF THE EMBODIMENTS
(3) Below is further description of the invention in conjunction with embodiments, however, the scope of protection of the present invention is not limited to these embodiments only.
(4) The sources of the main experimental materials of the following embodiments:
(5) Escherichia coli host strains E. coli BL21(DE3) and E. coli BL21(DH5α) were purchased from Transgen; the expression vector pET-28b(+) was purchased from Novagen; Phanta Max Super-Fidelity DNA Polymerase was purchased from Vazyme; 2xTsingKe Master Mix(blue) were purchased from TsingKe; kanamycin was purchased from Takara Bio (Dalian); IPTG is product of Promega.
Embodiment 1
(6) 1. Construction of Nitrilase Mutants
(7) The present invention adopts a simple, quick and efficient seamless DNA cloning technology (ClonExpress®) to conduct directed cloning of the amplified peptide fragment into the BrNIT plasmid fragment that is missing the corresponding gene segment.
(8) Through comparing and analyzing the nucleotide sequence and amino acid sequence of crucifer nitrilase, the peptide fragments were determined. The amino acid sequence of the wild type turnip nitrilase was SEQ ID No.5, this protein was coded by the nucleotide sequence of SEQ ID No.6; the amino acid sequence of the wild type Arabis alpina L. nitrilase was SEQ ID No.7, this protein was coded by the nucleotide sequence of SEQ ID No.8.
(9) The AaNIT nucleotide sequence was taken as template for cloning peptide fragment sites 0-85, 85-175, 175-225, 225-285 and 285-342, respectively.
(10) Meanwhile, the recombinant plasmid containing BrNIT nucleotide sequence was taken as a template and the corresponding primers were designed to amplify the BrNIT plasmid fragment that is missing 0-86, 86-176, 176-226, 226-286 and 286-342 peptide fragment.
(11) The plasmid containing BrNIT sequence that is missing the corresponding peptide fragment was linearized, and the forward/reverse PCR primer 5′ for amplifying the inserting fragment was introduced with the terminal sequence of the linearized plasmid, allowing the terminals of PCR primers 5′ and 3′ respectively bear sequences consistent to the two terminals of the linearized vector. The primer sequences were as shown in Table 1.
(12) The PCR amplification for the peptide fragments was conducted as follows: PCR reaction system (50 μL): Template DNA<1 μg, 2×TsingKe® Master Mix, forward and reverse primers at 0.2 μM respectively, ddH.sub.2O was supplemented to the total volume. The PCR progress was performed at 94° C. for 5 minutes, followed by 30 cycles of 94° C. for 30 seconds, 58° C. for 30 seconds and 72° C. for 10 seconds, after which, the reaction was performed at 72° C. again for 10 minutes. The amplified products went through agarose gel electrophoresis analysis, excising recovery, inactivated at 65° C. for 10 minutes, and placed at 4° C. for use.
(13) Vector linearization was achieved through reverse PCR amplification. PCR reaction system (50 μL) was as follows: template DNA 0.1 ng-1 ng, 2×Phanta Max Buffer, dNTPs (10 mM each) 0.2 mM, forward and reverse primers at 0.2 μM respectively, Phanta Max Super-Fidelity DNA Polymerase 1 U, ddH.sub.2O was supplemented to the total volume. The PCR progress was performed at 95° C. for 30 seconds, followed with 30 cycles of 95° C. for 15 seconds, 63° C. for 15 seconds and 72° C. for 6.0 minutes, after which the reaction was performed at 72° C. for 5 minutes. The amplified products went through agarose gel electrophoresis analysis, excising recovery, inactivated at 65° C. for 10 minutes, and placed at 4° C. for use.
(14) TABLE-US-00005 TABLE 1 BrNIT chimeric enzyme primer design table Primer Primer sequence designation (5′ to 3′) Peptide fragments CCATGTCTGGTAAAGAAGAAATGTC (0-85) (SEQ ID NO: 11) forward primer Peptide fragments CGTTGTGAACACCAACACCTATACCG (0-85) (SEQ ID NO: 12) reverse primer Cloning vectors GACATTTCTTCTTTACCAGACATGGTATATC (0-86) TCC forward primer (SEQ ID NO: 13) Cloning vectors CGGTATAGGTGTTGGTGTTCACAACG (0-86) (SEQ ID NO: 14) reverse primer Peptide fragments GTGTAGGTGTGCACAACGAAGACGGTCGTGA (85-175) CGAATTC forward primer (SEQ ID NO: 15) Peptide fragments GTCGAACCGTCACCGTAACCCCAGATGCAAC (85-175) GTTCCAG reverse primer (SEQ ID NO: 16) Cloning vectors GAATTCGTCACGACCGTCTTCGTTGTGCACA (86-176) CCTACAC forward primer (SEQ ID NO: 17) Cloning vectors CTGGAACGTTGCATCTGGGGTTACGGTGACG (86-176) GTTCGAC reverse primer (SEQ ID NO: 18) Peptide fragments GGTGACGGTTCGACTATCCCGGTGTACGAC (175-225) (SEQ ID NO: 19) forward primer Peptide fragments GCGATGTGCAGCATAGAAGACTGCCATTC (175-225) (SEQ ID NO: 20) reverse primer Cloning vectors GTCGTACACCGGGATAGTCGAACCGTCACC (176-226) (SEQ ID NO: 21) forward primer Cloning vectors GAATGGCAGTCTTCTATGCTGCACATCGC (176-226) (SEQ ID NO: 22) reverse primer Peptide fragments GAATGGCAGTCTTCTATGATGCACATCGC (225-285) (SEQ ID NO: 23) forward primer Peptide fragments GAAGTTCGGACCAGCCAGAACCTGACCC (225-285) (SEQ ID NO: 24) reverse primer Cloning vectors GCGATGTGCATCATAGAAGACTGCCATTC (226-286) (SEQ ID NO: 25) forward primer Cloning vectors GGGTCAGGTTCTGGCTGGTCCGAACTTC (226-286) (SEQ ID NO: 26) reverse primer Peptide fragments GGTAAAATCCTGGCGGGTCCGAACTTCGAA (285-342) TC forward primer (SEQ ID NO: 27) Peptide fragments GTGGTGGTGGTGGTGCTCGAGTCTTTTTTT (285-342) CGG reverse primer (SEQ ID NO: 28) Cloning vectors GATTCGAAGTTCGGACCCGCCAGGATTTTA (286-343) CC forward primer (SEQ ID NO: 29) Cloning vectors CCGAAAAAAAGACTCGAGCACCACCACCAC (286-343) CAC reverse primer (SEQ ID NO: 30)
(15) NanoDrop™ One/OneC ultramicro-UV spectrophotometer was used to calculate the concentration of the above obtained insert fragments and linearized vectors. The additive amounts of the linearized vectors were calculated for the insert peptide fragments and the corresponding missing peptide fragments. Composition of the ligation reaction system was shown in Table 2. The PCR sample was mixed and placed at 37° C. for 30 minutes, then reduced to 4° C.
(16) TABLE-US-00006 TABLE 2 recombination reaction system Recombination Component reaction Linearized vector 0.03 pmol Insert fragment 0.06 pmol 5 × CE II Buffer 4 μL Exnase II 2 μL ddH.sub.2O to 20 μL
(17) 10 μL recombinant product was added into 100 μLE. coli BL21(DH 5α) competent cell, which was sprayed onto LB plate with 50 mg/L kanamycin. The plates were cultured at 37° C. for 10-12 h. A single colony was picked into LB fluid medium with 50 mg/L kanamycin for plasmid extraction. The positive colonies were transformed into E. coli BL21(DE3) competent cell and cultured overnight to obtain nitrilase mutant expression strain.
(18) 2. Nitrilase Mutant Gene Expression
(19) A single colony was picked and placed into 5 mL LB fluid medium with kanamycin at a final concentration of 50 mg/L The cultivation was performed at 37° C. and 200 rpm for 6-8 hours. The above seed solution was transferred to fresh LB fluid medium containing 50 mg/L kanamycin at 2% volume ratio, which was also cultured at 37° C. and 150 rpm. Until the OD.sub.600 of the cell culture reached about 0.6-0.8, IPTG (final concentration at 0.1 mM) was added to induce the gene expression at 28° C. and 150 rpm for 10-12 hours. The cultured cells were collected and centrifuged at 4° C. and 8000 rpm for 10 minutes, washed twice with normal saline and centrifugated again. The obtained cells were disrupted, separated and purified, which was further stored at −20° C. The electrophoresis diagram of the obtain nitrilase mutant BrNIT.sub.225-285 was as shown in
(20) 3. Determine the Activity of Recombinant Escherichia coli Containing Nitrilase Mutant
(21) The activity of the recombinant Escherichia coli containing nitrilase mutant (E. coli BL21(DE3)/pET28b-BrNIT.sub.0-85, E. coli BL21(DE3)/pET28b-BrNIT.sub.85-175, E. coli BL21(DE3)/pET28b-BrNIT.sub.175-225, E. coli BL21(DE3)/pET28b-BrNIT.sub.225-285 and E. coli BL21(DE3)/pET28b-BrNIT.sub.285-342) were determined. The reaction was performed in Tris-HCl buffer solution (50 mM, pH 8.0) containing nitrilase mutant (10 mL), racemic IBSN 30 g/L, wet cells 10 g/L at 30° C. and 200 rpm for 15 minutes. After reaction, 500 μL of reaction sample was taken and added with 200 μL 2 M HCl to end reaction.
(22) The enantiomeric excess value of the substrate racemic IBSN and the product 3-cyano-5-Methylhexanoic acid was determined by gas chromatography. The gas chromatograph model was 7890N (Agilent) and the capillary column model was BGB-174 (BGB Analytik Switzerland). Chromatographic condition: injection volume was 1.0 μL, the temperatures of both the injection port and the detector were 250° C., the column temperature was 120° C. maintaining for 15 minutes, then the temperature was raised from 10° C./min to 170° C. and maintain for 9 minutes. The carrier gas was high-purity helium, the flow rate was 1.0 mL/min, the split ratio was 50:1.
(23) The calculation of the enantiomeric excess value (ee) and the conversion rate (c) was referred to the calculation method of Rakels et al (Enzyme Microb. Technol., 1993, 15:1051).
(24) The activities of the nitrilase mutants were as shown in Table 3:
(25) TABLE-US-00007 TABLE 3 Activity determination results of the recombinant escherichia coli containing nitrilase mutant Relative activity Strain (%) E E. coli BL21(DE3)/pET28b-BrNIT 100 200 E. coli BL21(DE3)/pET28b-BrNIT.sub.0-85 112.4 300 E. coli BL21(DE3)/pET28b-BrNIT.sub.85-175 0 ND E. coli BL21(DE3)/pET28b-BrNIT.sub.175-225 41.75 300 E. coli BL21(DE3)/pET28b-BrNIT.sub.225-285 249.5 500 E. coli BL21(DE3)/pET28b-BrNIT.sub.285-342 22.1 300 Note: ND means No Detection.
(26) 4. Comparison of Nitrilase Mutant BrNIT.sub.225-285 and Wild Type Nitrilase in Catalyzing Racemic IBSN Hydrolysis
(27) The recombinant E. coli BL21(DE3)/pET28b-BrNIT.sub.225-285 obtained from culture and the recombinant E. coli BL21(DE3)/pET28b-BrNIT containing wild type nitrilase were taken as biocatalysts, compare the effect of their stereoselectivity in hydrolyzing racemic IBSN.
(28) Reaction system composition (100 mL): Tris-HCl buffer solution (50 mM, pH 8.0), 1.5 g wet cell and 10 g racemic IBSN. The reaction was conducted at 35° C. and 200 rpm and 500 μL sampled was taken every 1 hours, which was further added with 200 μL 2 M HCl to stop the reaction. The progresses of the mutant and wild type nitrilase in catalyzing racemic IBSN hydrolysis were shown in
(29) 5. Biosynthesis of (S)-3-Cyano-5-Methylhexanoic Acid with Recombinant E. coli BL21(DE3)/pET28b-BrNIT.sub.225-285
(30) The biosynthesis of (S)-3-cyano-5-methylhexanoic acid was performed in 100 mL Tris-HCl buffer solution (pH 8.0) with 2.0 g wet cells of recombinant E. coli BL21(DE3)/pET28b-BrNIT.sub.225-285 (final concentration at 20 g/L) and 1 M racemic IBSN (136 g/L). The reaction was conducted at 30° C. and 200 rpm for 8 h, and during which, 500 μL sample was taken every 1 hours, which was further added with 200 μL 2 M HCl to stop the reaction. The sample test method was in reference to Step 3. The conversion rate reached 39.8%, and the ee value of the product (S)-3-cyano-5-methylhexanoic acid exceeded 99.3%. Compared with reported catalytic process, the additive amount of the cells was reduced by 2.5 times.
Embodiment 2
(31) Construction of arabidopsis nitrilase mutant AtNIT.sub.225-285 and its application in synthesizing (S)-3-cyano-5-methylhexanoic acid.
(32) The amino acid sequence of the wild type arabidopsis nitrilase was SEQ ID No.9, which was encoded by the nucleotide sequence of SEQ ID No.10.
(33) Arabidopsis nitrilase mutant AtNIT.sub.225-285 was constructed in reference to Embodiment 1. The primers used for mutant construction were as shown in Table 4.
(34) TABLE-US-00008 TABLE 4 AtNIT chimeric enzyme primer design table Primer designation Primer sequence (5′ to 3′) Peptide fragment CTAAAGAATGGCAGTCTTCTATGCTGCA forward primer CATCGC (AaNIT) (SEQ ID NO: 31) Peptide fragment GATTCGAAGTTCGGACCAGCCAGAACCT reverse primer GACCCAGC (AaNIT) (SEQ ID NO: 32) AtNIT cloning vectors GCGATGTGCAGCATAGAAGACTGCCATT forward primer CTTTAG (SEQ ID NO: 33) AtNIT cloning vectors GCTGGGTCAGGTTCTGGCTGGTCCGAAC reverse primer TTCGAATC (SEQ ID NO: 34)
(35) The recombinant E. coli BL21(DE3)/pET28b-BrNIT.sub.225-285 containing arabidopsis nitrilase mutant and the recombinant E. coli BL21(DE3)/pET28b-BrNIT containing wild type arabidopsis nitrilase were obtained in reference to Embodiment 1. After induced expression, whole cell was collected and disrupted, separated and purified, to obtain nitrilase mutant AtNIT.sub.225-285. The electrophoresis diagram was shown in
(36) The reaction was performed in 10 mL Tris-HCl buffer solution (50 mM, pH 8.0) with 0.1 g (wet weight) resting cells containing arabidopsis nitrilase mutant and wild type nitrilase and 0.3 g racemic IBSN at 30° C. and 200 rpm. The activity of mutant AtNIT.sub.225-285 in catalyzing racemic IBSN was 1.9 times of that of wild type nitrilase. After reaction for 24 hours, the conversion of IBSN by wild type AtNIT and mutant AtNIT.sub.225-285 reached 25.64% and 48.76%, respectively, both of which the ee value exceeded 98.5%.