Growth hormone fusion proteins with growth hormone receptor agonist activity

Abstract

We disclose growth hormone fusion proteins that have increased in vivo stability and activity; nucleic acid molecules encoding said proteins and methods of treatment of growth hormone related diseases that would benefit from growth hormone agonists or antagonists.

Claims

1. A fusion protein agonist comprising: a growth hormone polypeptide as set forth in SEQ ID NO: 70, wherein the polypeptide is linked either directly or indirectly to a polypeptide comprising the amino acid sequence of a growth hormone receptor polypeptide as set forth in SEQ ID NO: 69, wherein said receptor polypeptide is modified by deletion or substitution of tryptophan 104.

2. The fusion protein agonist according to claim 1, wherein said receptor polypeptide is modified by substitution at amino acid residue tryptophan 104.

3. The fusion protein agonist according to claim 2, wherein the tryptophan 104 is substituted with alanine.

4. The fusion protein agonist according to claim 1 wherein said growth hormone polypeptide is linked to said receptor polypeptide by a peptide linker.

5. The fusion protein agonist according to claim 4 wherein said peptide linking molecule comprises at least one copy of the peptide Gly Gly Gly Gly Ser [SEQ ID NO: 55].

6. The fusion protein agonist according to claim 5 wherein said peptide linking molecule comprises 2, 3, 4, 5, 6 or 7 copies of the peptide Gly Gly Gly Gly Ser [SEQ ID NO: 55].

7. The fusion protein agonist according to claim 1 wherein said protein comprises or consists of an amino acid sequence as set forth in SEQ ID NO: 4 or SEQ ID NO: 71.

8. The fusion protein agonist according to claim 1 wherein said protein comprises or consists of an amino acid sequence as set forth in SEQ ID NO: 5 or SEQ ID NO: 72.

9. The fusion protein agonist according to claim 1 wherein said protein comprises or consists of an amino acid sequence as set forth in SEQ ID NO: 6 or SEQ ID NO: 73.

10. A nucleic acid molecule that encodes a fusion protein according to claim 1.

11. A vector comprising a nucleic acid molecule according to claim 10.

12. A cell transfected or transformed with a vector according to claim 11.

13. A pharmaceutical composition comprising the fusion protein agonist according to claim 1 including an excipient or carrier.

14. A method to treat a human subject suffering from growth hormone deficiency comprising administering an effective amount of a fusion protein according to claim 1.

15. The method according to claim 14 wherein said growth hormone deficiency is childhood growth hormone deficiency.

16. The method according to claim 14 wherein said growth hormone deficiency is adult growth hormone deficiency.

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) An embodiment of the invention will now be described by example only and with reference to the following figures:

(2) FIG. 1a is the amino acid sequence of human growth hormone receptor extracellular domain (SEQ ID NO: 1); The amino acid sequence of human growth hormone receptor extracellular domain without the signal sequence indicated in the figure is set forth as SEQ ID NO: 69. FIG. 1b (SEQ ID NO: 2) is the amino acid sequence of human growth hormone receptor extracellular domain with a tryptophan 104 to alanine substitution; signal sequence is shown in bold and is optional;

(3) FIG. 2 (SEQ ID NO: 3) is the amino acid sequence of human growth hormone; signal sequence is shown in bold and is optional The amino acid sequence of human growth hormone without the signal sequence indicated in the figure is set forth as SEQ ID NO: 70;

(4) FIG. 3 (SEQ ID NO: 4) is the amino acid sequence of growth hormone fusion protein 1B7-V1; signal sequence is shown in bold and is optional. The corresponding amino acid sequence without the signal sequence is set forth herein as SEQ ID NO: 71;

(5) FIG. 4 (SEQ ID NO: 5) is the amino acid sequence of growth hormone fusion protein 1B7-V2; signal sequence is shown in bold and is optional. The corresponding amino acid sequence without the signal sequence is set forth herein as SEQ ID NO: 72;

(6) FIG. 5 (SEQ ID NO: 6) is the amino acid sequence of growth hormone fusion protein 1B7-V3; signal sequence is shown in bold and is optional. The corresponding amino acid sequence without the signal sequence is set forth herein as SEQ ID NO: 73;

(7) FIG. 6 (SEQ ID NO: 7) is the amino acid sequence of growth hormone fusion protein 1B8-V1; signal sequence is shown in bold and is optional;

(8) FIG. 7 (SEQ ID NO: 8) is the amino acid sequence of growth hormone fusion protein 1B8-V2; signal sequence is shown in bold and is optional;

(9) FIG. 8 (SEQ ID NO: 9) is the amino acid sequence of growth hormone fusion protein 1B8-V3; signal sequence is shown in bold and is optional;

(10) FIG. 9 (SEQ ID NO: 10) is the amino acid sequence of growth hormone fusion protein 1B9-V1; signal sequence is shown in bold and is optional;

(11) FIG. 10 (SEQ ID NO: 11) is the amino acid sequence of growth hormone fusion protein 1B9-V2; signal sequence is shown in bold and is optional;

(12) FIG. 11 (SEQ ID NO: 12) is the amino acid sequence of growth hormone fusion protein 1B9-V3; signal sequence is shown in bold and is optional;

(13) FIG. 12 (SEQ ID NO: 13) is the amino acid sequence of growth hormone fusion protein 1B7-G1-V1; signal sequence is shown in bold and is optional;

(14) FIG. 13 (SEQ ID NO: 14) is the amino acid sequence of growth hormone fusion protein 1B7-G1-V2; signal sequence is shown in bold and is optional;

(15) FIG. 14 (SEQ ID NO: 15) is the amino acid sequence of growth hormone fusion protein 1B7-G2-V1; signal sequence is shown in bold and is optional;

(16) FIG. 15 (SEQ ID NO: 16) is the amino acid sequence of growth hormone fusion protein 1B7-G2-V2; signal sequence is shown in bold and is optional;

(17) FIG. 16 (SEQ ID NO: 17) is the amino acid sequence of growth hormone fusion protein 1B7-G3-V1; signal sequence is shown in bold and is optional;

(18) FIG. 17 (SEQ ID NO: 18) is the amino acid sequence of growth hormone fusion protein 1B7-G3-V2; signal sequence is shown in bold and is optional;

(19) FIG. 18 (SEQ ID NO: 19) is the amino acid sequence of growth hormone fusion protein 1B7-G4-V1; signal sequence is shown in bold and is optional;

(20) FIG. 19 (SEQ ID NO: 20) is the amino acid sequence of growth hormone fusion protein 1B7-G4-V2; signal sequence is shown in bold and is optional;

(21) FIG. 20 (SEQ ID NO: 21) is the amino acid sequence of growth hormone fusion protein 1B8-G1-V1; signal sequence is shown in bold and is optional;

(22) FIG. 21 (SEQ ID NO: 22) is the amino acid sequence of growth hormone fusion protein 1B8-G1-V2; signal sequence is shown in bold and is optional;

(23) FIG. 22 (SEQ ID NO: 23) is the amino acid sequence of growth hormone fusion protein 1B9-G1-V1; signal sequence is shown in bold and is optional;

(24) FIG. 23 (SEQ ID NO: 24) is the amino acid sequence of growth hormone fusion protein 1B9-G1-V2; signal sequence is shown in bold and is optional;

(25) FIG. 24 (SEQ ID NO: 25) is the amino acid sequence of growth hormone fusion protein 1B8-G3-V1; signal sequence is shown in bold and is optional;

(26) FIG. 25 (SEQ ID NO: 26) is the amino acid sequence of growth hormone fusion protein 1B8-G3-V2; signal sequence is shown in bold and is optional;

(27) FIG. 26 (SEQ ID NO: 27) is the amino acid sequence of growth hormone fusion protein 1B9-G3-V1; signal sequence is shown in bold and is optional;

(28) FIG. 27 (SEQ ID NO: 28) is the amino acid sequence of growth hormone fusion protein 1B9-G3-V2; signal sequence is shown in bold and is optional;

(29) FIG. 28 (SEQ ID NO: 29) is the amino acid sequence of growth hormone fusion protein 1B8-G4-V1; signal sequence is shown in bold and is optional;

(30) FIG. 29 (SEQ ID NO: 30) is the amino acid sequence of growth hormone fusion protein 1B8-G4-V2; signal sequence is shown in bold and is optional;

(31) FIG. 30 (SEQ ID NO: 31) is the amino acid sequence of growth hormone fusion protein 1B9-G4-V1; signal sequence is shown in bold and is optional; and

(32) FIG. 31 (SEQ ID NO: 32) is the amino acid sequence of growth hormone fusion protein 1B9-G4-V2; signal sequence is shown in bold and is optional.

(33) FIG. 32 western blot of native PAGE gel showing the separation of 1B7v2_wildtype, (Lane 1) and 1B7v2_W104 mutant (Lane 2). The image shows that the inclusion of the mutation, W104A in the GHR moiety in 1B7v2_W104 prevents formation of what is thought to be a dimer between 1B7v2 molecules: formation of this dimer is thought to be primarily the results of intermolecular association of GH with GHR;

(34) FIG. 33: western blot of SDS-PAGE gel showing separation of 1B7v2_W104A; transfection 1 (lane 1), 1B7v2_W104A; transfection 2, (lane 2) and 1B7v2_wild type (lane 3). Both molecules are detected at around 75 kDa;

(35) FIG. 34: Corrected luciferase data from a dual luciferase bioassay performed in 293 Hi cells shows increased bioactivity for 1B7V2_Hist_W104 mutant compared to the non-mutant 1B7V2_Hist. This shows that inclusion of the mutant may indeed increase bioactivity of the 1B7V2 molecule;

(36) FIG. 35 plate 1: rhGH standard curve; plate 2: media from stable GHwt transfected cells; plate 3: media from stable 1B7v2_wt transfected cells; plate 4: media from stable 1B7v2_W104A transfected cells; plate 5: control media samples; and

(37) FIG. 36 illustrates the stimulation of proliferation of Nb2 cells by 1B7v2_W104A mutant compared to recombinant human growth hormone and 1B7v2_wt.

(38) FIG. 37 illustrates the General Schematic of PCR Reaction 1, with primer 1 and primer 2.

(39) FIG. 38 illustrates the General Schematic of PCR Reaction 2, with primer 4 and primer 3.

(40) FIG. 39 illustrates the General Schematic of PCR Reaction 3, with primer 1 and primer 3.

BRIEF DESCRIPTION OF THE DESCRIBED SEQUENCES

(41) The nucleic and/or amino acid sequences provided herewith are shown using standard letter abbreviations for nucleotide bases, and three letter code for amino acids, as defined in 37 C.F.R. 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. The Sequence Listing is submitted as an ASCII text file named 96064_301_1001 seq.txt, created Oct. 2, 2016, about 164 KB, which is incorporated by reference herein.

EXAMPLES

(42) Materials and Methods

(43) All the materials were purchased from Sigma (Poole, UK) unless otherwise stated. Recombinant GH was purchased from Pfizer, recombinant E. coli derived human GH binding protein used in binding assays was a gift from DSL (DSL Research Reagents, Oxfordshire, UK), and iodinated GH a gift from NovoNordisk (NovoNordisk Park, Denmark). GH and GHR mAbs used for purification and characterisation were in-house materials.

(44) Construction Expression and Testing of 1B7v2/v3 Molecules Containing a Tryptophan-104 (W104) to Alanine (A104) Substitution

(45) Stage 1: Construction of 1B7v2/v3_Hist Molecules

(46) 1. Digest pGHsecTag-1B7v0-Hist using the restriction enzymes EcoRV and AgeI (see FIG. 2.1 (SEQ ID NO: 56) sequence). This molecule contains a histidine tag at the C-terminal and therefore does NOT have a stop codon in this region (see FIG. 2.2 (SEQ ID NO: 57) for sequence) 2. Take pGHsecTag-1B7v2 and v3 molecules (These molecules contain a STOP codon prior to the Hist tag and therefore are not Hist tagged, see FIG. 1.4). Replacing the EcoRV/AgeI sequence in this molecule with the sequence from pGHsecTag-1B7v0-Hist (FIG. 2.2 (SEQ ID NO: 57)) will allow read through to the Hist-tag.
FIG. 2.1: pGHsecTag-1B7v0-Hist (SEQ ID NO: 56)
EcoRV and AgeI sites shown in red. Hist tag shown in italics and underlined. Linker in bold. Signal sequence underlined

(47) TABLE-US-00001 GCTAGCCACCATGGCTACAGGCTCCCGGACGTCCCTGCTCCTGGCTTTTG GCCTGCTCTGCCTGCCCTGGCTTCAAGAGGGCAGTGCCTTCCCAACCATT CCCTTATCCAGGCTTTTTGACAACGCTAGTCTCCGCGCCCATCGTCTGCA CCAGCTGGCCTTTGACACCTACCAGGAGTTTGAAGAAGCCTATATCCCAA AGGAACAGAAGTATTCATTCCTGCAGAACCCCCAGACCTCCCTCTGTTTC TCAGAGTCTATTCCGACACCCTCCAACAGGGAGGAAACACAACAGAAATC CAACCTAGAGCTGCTCCGCATCTCCCTGCTGCTCATCCAGTCGTGGCTGG AGCCCGTGCAGTTCCTCAGGAGTGTCTTCGCCAACAGCCTGGTGTACGGC GCCTCTGACAGCAACGTCTATGACCTCCTAAAGGACCTAGAGGAAGGCAT CCAAACGCTGATGGGGAGGCTGGAAGATGGCAGCCCCCGGACTGGGCAGA TCTTCAAGCAGACCTACAGCAAGTTCGACACAAACTCACACAACGATGAC GCACTACTCAAGAACTACGGGCTGCTCTACTGCTTCAGGAAGGACATGGA CAAGGTCGAGACATTCCTGCGCATCGTGCAGTGCCGCTCTGTGGAGGGCA GCTGTGGCTTCGGCGGCCGCGGTGGCGGAGGTAGTGGTGGCGGAGGTAGC GGTGGCGGAGGTTCTGGTGGCGGAGGTTCCGAATTC TTTTCTGGAAGTGAGGCCACAGCAGCTATCCTTAGCAGAGCACCCTGGAG TCTGCAAAGTGTTAATCCAGGCCTAAAGACAAATTCTTCTAAGGAGCCTA AATTCACCAAGTGCCGTTCACCTGAGCGAGAGACTTTTTCATGCCACTGG ACAGATGAGGTTCATCATGGTACAAAGAACCTAGGACCCATACAGCTGTT CTATACCAGAAGGAACACTCAAGAATGGACTCAAGAATGGAAAGAATGCC CTGATTATGTTTCTGCTGGGGAAAACAGCTGTTACTTTAATTCATCGTTT ACCTCCATCTGGATACCTTATTGTATCAAGCTAACTAGCAATGGTGGTAC AGTGGATGAAAAGTGTTTCTCTGTTGATGAAATAGTGCAACCAGATCCAC CCATTGCCCTCAACTGGACTTTACTGAACGTCAGTTTAACTGGGATTCAT GCA CAAGTGAGATGGGAAGCACCACGCAATGCAGATATTCAGA AAGGATGGATGGTTCTGGAGTATGAACTTCAATACAAAGAAGTAAATGAA ACTAAATGGAAAATGATGGACCCTATATTGACAACATCAGTTCCAGTGTA CTCATTGAAAGTGGATAAGGAATATGAAGTaCGcGTGAGATCCAAACAAC GAAACTCTGGAAATTATGGCGAGTTCAGTGAGGTGCTCTATGTAACACTT CCTCAGATGAGCCAAAAGCTTTTCGAT CATCATCACCATCACCATSTOP
FIG. 2.2: EcoRV/AgeI Fragment (SEQ ID NO: 57)

(48) TABLE-US-00002 CAAGTGAGATGGGAAGCACCACGCAATGCAGATATTCAGAA AGGATGGATGGTTCTGGAGTATGAACTTCAATACAAAGAAGTAAATG AAACTAAATGGAAAATGATGGACCCTATATTGACAACATCAGTTCCA GTGTACTCATTGAAAGTGGATAAGGAATATGAAGTaCGcGTGAGATC CAAACAACGAAACTCTGGAAATTATGGCGAGTTCAGTGAGGTGCTCT ATGTAACACTTCCTCAGATGAGCCAAAAGCTTTTCGAT
FIG. 2.3: pGHsecTag-1B7v2 (SEQ ID NO: 58)
The EcoRV and AgeI sites are shown in red. Linker in bold. Hist tag underlined and in italics. STOP codon in large font

(49) TABLE-US-00003 GCTAGCCACCATGGCTACAGGCTCCCGGACGTCCCTGCTCCTGGCTT TTGGCCTGCTCTGCCTGCCCTGGCTTCAAGAGGGCAGTGCCTTCCCA ACCATTCCCTTATCCAGGCTTTTTGACAACGCTATGCTCCGCGCCCA TCGTCTGCACCAGCTGGCCTTTGACACCTACCAGGAGTTTGAAGAAG CCTATATCCCAAAGGAACAGAAGTATTCATTCCTGCAGAACCCCCAG ACCTCCCTCTGTTTCTCAGAGTCTATTCCGACACCCTCCAACAGGGA GGAAACACAACAGAAATCCAACCTAGAGCTGCTCCGCATCTCCCTGC TGCTCATCCAGTCGTGGCTGGAGCCCGTGCAGTTCCTCAGGAGTGTC TTCGCCAACAGCCTGGTGTACGGCGCCTCTGACAGCAACGTCTATGA CCTCCTAAAGGACCTAGAGGAAGGCATCCAAACGCTGATGGGGAGGC TGGAAGATGGCAGCCCCCGGACTGGGCAGATCTTCAAGCAGACCTAC AGCAAGTTCGACACAAACTCACACAACGATGACGCACTACTCAAGAA CTACGGGCTGCTCTACTGCTTCAGGAAGGACATGGACAAGGTCGAGA CATTCCTGCGCATCGTGCAGTGCCGCTCTGTGGAGGGCAGCTGTGGC TTCGGTGGCGGAGGTAGTGGTGGCGGAGGTAGCGGTGGCGGAGGTTC TGGTGGCGGAGGTTCCGGTGGCGGAGGTAGTTTTTCTGGAAGTGAGG CCACAGCAGCTATCCTTAGCAGAGCACCCTGGAGTCTGCAAAGTGTT AATCCAGGCCTAAAGACAAATTCTTCTAAGGAGCCTAAATTCACCAA GTGCCGTTCACCTGAGCGAGAGACTTTTTCATGCCACTGGACAGATG AGGTTCATCATGGTACAAAGAACCTAGGACCCATACAGCTGTTCTAT ACCAGAAGGAACACTCAAGAATGGACTCAAGAATGGAAAGAATGCCC TGATTATGTTTCTGCTGGGGAAAACAGCTGTTACTTTAATTCATCGT TTACCTCCATCTGGATACCTTATTGTATCAAGCTAACTAGCAATGGT GGTACAGTGGATGAAAAGTGTTTCTCTGTTGATGAAATAGTGCAACC AGATCCACCCATTGCCCTCAACTGGACTTTACTGAACGTCAGTTTAA CTGGGATTCATGCAGATATCCAAGTGAGATGGGAAGCACCACGCAAT GCAGATATTCAGAAAGGATGGATGGTTCTGGAGTATGAACTTCAATA CAAAGAAGTAAATGAAACTAAATGGAAAATGATGGACCCTATATTGA CAACATCAGTTCCAGTGTACTCATTGAAAGTGGATAAGGAATATGAA GTGCGTGTGAGATCCAAACAACGAAACTCTGGAAATTATGGCGAGTT CAGTGAGGTGCTCTATGTAACACTTCCTCAGATGAGCCAATAAAAG CTTTTCGAATAAATCGAT CATCATCACCATCACCAT TGA
FIG. 2.4: pGHsecTag-1B7v2_Hist (SEQ ID NO: 59)

(50) TABLE-US-00004 GCTAGCCCACCATGGCTACAGGCTCCCGGACGTCCCTGCTCCTGGCTT TTGGCCTGCTCTGCCTGCCCTGGCTTCAAGAGGGCAGTGCCTTCCCAA CCATTCCCTTATCCAGGCTTTTTGACAACGCTATGCTCCGCGCCCATC GTCTGCACCAGCTGGCCTTTGACACCTACCAGGAGTTTGAAGAAGCCT ATATCCCAAAGGAACAGAAGTATTCATTCCTGCAGAACCCCCAGACCT CCCTCTGTTTCTCAGAGTCTATTCCGACACCCTCCAACAGGGAGGAAA CACAACAGAAATCCAACCTAGAGCTGCTCCGCATCTCCCTGCTGCTCA TCCAGTCGTGGCTGGAGCCCGTGCAGTTCCTCAGGAGTGTCTTCGCCA ACAGCCTGGTGTACGGCGCCTCTGACAGCAACGTCTATGACCTCCTAA AGGACCTAGAGGAAGGCATCCAAACGCTGATGGGGAGGCTGGAAGATG GCAGCCCCCGGACTGGGCAGATCTTCAAGCAGACCTACAGCAAGTTCG ACACAAACTCACACAACGATGACGCACTACTCAAGAACTACGGGCTGC TCTACTGCTTCAGGAAGGACATGGACAAGGTCGAGACATTCCTGCGCA TCGTGCAGTGCCGCTCTGTGGAGGGCAGCTGTGGCTTCGGTGGCGGAG GTAGTGGTGGCGGAGGTAGCGGTGGCGGAGGTTCTGGTGGCGGAGGTT CCGGTGGCGGAGGTAGTTTTTCTGGAAGTGAGGCCACAGCAGCTATCC TTAGCAGAGCACCCTGGAGTCTGCAAAGTGTTAATCCAGGCCTAAAGA CAAATTCTTCTAAGGAGCCTAAATTCACCAAGTGCCGTTCACCTGAGC GAGAGACTTTTTCATGCCACTGGACAGATGAGGTTCATCATGGTACAA AGAACCTAGGACCCATACAGCTGTTCTATACCAGAAGGAACACTCAAG AATGGACTCAAGAATGGAAAGAATGCCCTGATTATGTTTCTGCTGGGG AAAACAGCTGTTACTTTAATTCATCGTTTACCTCCATCTGGATACCTT ATTGTATCAAGCTAACTAGCAATGGTGGTACAGTGGATGAAAAGTGTT TCTCTGTTGATGAAATAGTGCAACCAGATCCACCCATTGCCCTCAACT GGACTTTACTGAACGTCAGTTTAACTGGGATTCATGCAGATATCCAAG TGAGATGGGAAGCACCACGCAATGCAGATATTCAGAAAGGATGGATGG TTCTGGAGTATGAACTTCAATACAAAGAAGTAAATGAAACTAAATGGA AAATGATGGACCCTATATTGACAACATCAGTTCCAGTGTACTCATTGA AAGTGGATAAGGAATATGAAGTaCGcGTGAGATCCAAACAACGAAACT CTGGAAATTATGGCGAGTTCAGTGAGGTGCTCTATGTAACACTTCCTC AGATGAGCCAAAAGCTTTTCGATACCGGTCATCATCACCATCACCAT
Note: same reaction is performed for the construction of 1B7v3_Hist molecule
Stage 2: Construction of W104A GHR Mutation

(51) Use as template pGHsecTag-1B7v2 Hist. After construction of the W104 mutation, the mutation can simply be transferred to other constructs (1B7v2 and GHBP_Hist) using AvrII/HindIII enzymes.

(52) Method 1: PCR Based Method

(53) Aim: The highlighted DNA (see sequence below) will be multiplied by PCR (polymerase Chain reaction) using DNA primers that include both AvrII, EcoRI and W104 mutations. The method produces 2 PCR fragements, both including the W104 mutation. Using overlapping PCR (i.e. both DNA fragments will anneal to each other due to overlapping sequences) we will produce a full length DNA insert with flanking AvrII and EcoRI sites. This can then be digested with both enzymes and ligated into the appropriate vector.

(54) PCR Reactions and Primer Design:

(55) Sequence showing GHR portion of 1B7 molecule: W104A mutation is underlined. AvrII and EcoRV site are shown in orange (SEQ ID NO: 60)

(56) TABLE-US-00005 TTTTCTGGAAGTGAGGCCACAGCAGCTATCCTTAGCAGAGCACCCTGG AGTCTGCAAAGTGTTAATCCAGGCCTAAAGACAAATTCTTCTAAGGAG CCTAAATTCACCAAGTGCCGTTCACCTGAGCGAGAGACTTTTTCATGC CACTGGACAGATGAGGTTCATCATGGTACAAAGAA ACCCATACAGCTGTTCTATACCAGAAGGAACACTCAAGAATGGACTCA AGAATGGAAAGAATGCCCTGATTATGTTTCTGCTGGGGAAAACAGCTG TTACTTTAATTCATCGTTTACCTCCATCGCAATACCTTATTGTATCAA GCTAACTAGCAATGGTGGTACAGTGGATGAAAAGTGTTTCTCTGTTGA TGAAATAGTGCAACCAGATCCACCCATTGCCCTCAACTGGACTTTACT GAACGTCAGTTTAACTGGGATTCATGCA CAAGTGAGATGG GAAGCACCACGCAATGCAGATATTCAGAAAGGATGGATGGTTCTGGAG TATGAACTTCAATACAAAGAAGTAAATGAAACTAAATGGAAAATGATG GACCCTATATTGACAACATCAGTTCCAGTGTACTCATTGAAAGTGGAT AAGGAATATGAAGTaCGcGTGAGATCCAAACAACGAAACTCTGGAAAT TATGGCGAGTTCAGTGAGGTGCTCTATGTAACACTTCCTCAGATGAGC CAATAA
PCR Reaction 1: (see FIG. 37)

(57) Primer 1=GHR-AvrII: Forward primer: Binds 5 end of GHR and includes the endogenous restriction site AvrII (C>CTAGG). The AvrII site is shown underlined, GHR sequence is in italics (5>3). Tm=60 C. 28mer

(58) TABLE-US-00006 (SEQIDNO:61) aaatttCCTAGGACCCATACAGCTGTTC

(59) Primer 2=GHR_W104rev: Reverse primer contains the W104 mutation (W>A, TGG>GCA). Also contains overlapping sequence to PCR reaction 2.

(60) Tm for overhang=30 C, Tm for 3end=58 C. 38mer

(61) TABLE-US-00007 (SEQIDNO62) AATTCATCGTTTACCTCCATC[GCA] ATACCTTATTGT (SEQIDNO:63) TTAAGTAGCAAATGGAGGTAG[CGT] TATGGAATAACA (SEQIDNO:64) Flip:ACAATAAGGTAT[TGC] GATGGAGGTAAACGATGAATT

(62) Primer 3=GHR_EcoRVrev. Reverse primer binds to the 3end of GHR and includes the endogenous restriction site EcoRV. The EcoRV site is shown in square brackets. The GHR sequence is shown in italics. Tm=62 C

(63) 34mer

(64) TABLE-US-00008 (SEQIDNO:65) CAGTTTAACTGGGATTCATGCA[GATATC] (SEQIDNO:66) GTCAAATTGACCCTAAGTACGT[CTATAG] (SEQIDNO:67) Flip:aaattt[GATATC] TGCATGAATCCCAGTTAAACTG

(65) Primer 4:=GHR_W104for: Forward primer contains the W104 mutation (W>A, TGG>GCA)

(66) Tm=60 C. Tm for overhang=26 C. 34mer

(67) TABLE-US-00009 (SEOIDNO68) CCTCCATC[GCA] ATACCTTATTGTATCAAGCTAAC
Stage 3: Generation of PCR Fragments
PCR Reaction 1

(68) Using expand enzyme system. Gel isolate PCR fragments on 1% agarose/TAE gel using Qiagen gel isolation kit.

(69) Master Mix 1

(70) TABLE-US-00010 X1 Template: 1B7v2 1 uL (100 ng) GHR_Avrll (10 pmol/ul = 10 uM) 1 ul GHR_W104rev (10 pmol/ul = 10 uM) 1 ul dNTPs (10 mM) 1.25 ul Sterile water 21.75 ul
NB: Add template last to the reaction mix. Add water and dNTP first to prevent contamination by template. Do not take out MM2 material until MMI has been prepared to avoid cross contamination. Place MMI on ice until ready.
Master Mix 2:

(71) TABLE-US-00011 X1 10x polymerase buffer + MgCl2 5 ul (1.5 mM final) Sterile water 19.15. ul Expand Polymerase 0.85 ul

(72) Positive control; sample known to produce product under PCR conditions: GH template (GHstop template with GH1-23 and GH Hindrev primers). Negative controls are above reaction but no template. Mix 25 ul of MMI with 25 ul MMII and overlay with mineral oil.

(73) PCR Reaction:

(74) 95 C for 2 min, [95 C for 30 sec; 54 C for 30 sec; 72 C for 30 sec] 25 cycles, 72 C for 10 min

(75) The above PCR reaction is repeated for PCR2 (replace with appropriate primers)

(76) PCR Reaction 3 (See FIG. 39)

(77) Overlapping PCR reaction. PCR fragments from reactions 1 and 2 are annealed and PCR amplified using appropriate forward and reverse primers that include the restriction enztme sites AvrII and EcoRI.

(78) Master Mix 1

(79) TABLE-US-00012 X1 PCR1 fragment (50 ng) X ul PCR2 fragment (50 ng) X ul GHR_Ayrll (10 pmol/ul = 10 uM) 1 ul GHR_EcoRV (10 pmol/ul = 10 uM) 1 ul dNTPs (10 mM stock) 1.25 ul Sterile water X ul Total Volume (ul) 50

(80) NB: Add template last to the reaction mix. Add water and dNTP first to prevent contamination by template. Do not take out MM2 material until MMI has been prepared to avoid cross contamination.

(81) Master Mix 2:

(82) TABLE-US-00013 X1 10x polymerase buffer + MgCl2 5 ul (1.5 mM final) Sterile water 19.15. ul Expand Polymerase 0.85 ul
PCR Reaction:

(83) TABLE-US-00014 Stage Time Temperature Denaturation 2 min 94 deg C. 25 cycles @ 30 s 94 deg C. 30 s 54 deg C. 30 s 72 deg C. Extension 10 min 72 deg C.
Stage 4: Cloning of PCR Reaction 3
Digestion of PCR Reaction 3

(84) Gel isolate PCR fragment on 1% agarose/TAE gel using Qiagen gel isolation kit. Restriction digest reaction will be set up as follows:

(85) TABLE-US-00015 Stock Final volume concentration concentration PCR fragment 25 ul 10x buffer XX 4 ul 10x 1x Avrll 2 ul 10 U/ul 20 U EcoRV 2 ul 10 U/ul 20 U acBSA 4 ul 1 mg/ml 100 ug/ml Sterile water 3 ul

(86) 24 hours at 37 C. Isolate digested fragment and analyse digests by TAE/Agarose. Estimate concentration by agarose gel running against standards or use Nanodrop 260 nm.

(87) Stage 5: Ligation of Sticky/Blunt Ends

(88) Set up an initial ratio of plasmid to insert of 1:3 (molar) in a total volume of 10-15 ul

(89) Calculate amount of fragment to use as follows (Taken from Promega T4 DNA ligase data sheet)

(90) $\frac{\mathrm{ng}\mathrm{vector}\mathrm{kb}\mathrm{size}\mathrm{of}\mathrm{insert}}{\mathrm{Kb}\mathrm{size}\mathrm{of}\mathrm{vector}}\frac{\mathrm{molar}\mathrm{ratio}\mathrm{of}\mathrm{insert}}{\mathrm{vector}}=\mathrm{ng}\mathrm{of}\mathrm{insert}$

(91) TABLE-US-00016 R1 C1 C2 PCR fragment X ul pSecTag link, X ul (~50-100 ng) X ul X ul vector 10x ligase buffer 1.5 ul 1.5 ul 1.5 ul Sterile water X ul X ul X ul T4 DNA ligase 1 ul 1 ul

(92) Leave @ 37 C for 3 hours or o/n. Also set up reaction without ligase.

(93) Stage 6: Transformation of Ligation:

(94) Took 5 ul of above ligation and added to XL1-blue chemically competent cells. Leave for 30 minutes on ice, then heat shock @ 42 C. Leave on ice for a further 30 minutes. Plate out ligation mix onto freshly prepared agar plates containing 100 ug/ml Carbenicillin. Leave o/n 37 C.

(95) Analysis of Clones:

(96) Prepare plasmid from +ve clones and check authenticity by restriction digestion using Nhe1/HindIII (produces full length clone). These ligations produce the following constructs:

(97) Stage 7: Verify Clones by PCR Screening and Sequencing:

(98) AScreening ligation clones by PCR using Taq Polymerase

(99) Pick isolated single colony and streak into an agar grid plate, and then add remainder to 5 ul SDW as template.

(100) Master Mix 1:

(101) Add the 5 ul template last to the reaction mix:

(102) TABLE-US-00017 X1 FP (10 pmol/ul = 10 uM) 1 ul RP (10 pmol/ul = 10 uM) 1 ul dNTPs (10 mM) 1.25 ul Sterile water 16.75 ul
Master Mix 2:

(103) TABLE-US-00018 X1 10x polymerase buffer + MgCl2 5 ul Sterile water 19.8 ul Taq polymerase 0.2 ul

(104) Negative control is reaction with above primers but no template.

(105) PCR Reaction:

(106) 95 C for 2 min, [95 C for 30 sec; 52 C for 30 sec; 72 C for 30 sec] 35 cycles, 72 C for 10 min

(107) Stage 8: Sequencing of Clones (Completed at Sheffield University):

(108) Submit at least 2 clones for sequencing: send each plasmid in at least 10 ul @ 100 ng/ul (1 ug total) along with relevant primers @ 1 pmol/ul (send at least 10 ul)

(109) Transient Cell Expression of 1B7v2 and 1B7v2 W104A

(110) 1. Use Trypsin-EDTA to remove CHO cells from a flask and resuspend in DMEM+10% FCS, 4 mM L-glutamine. 2. Seed @ 210E5 CHO cells into wells of a 24 well-plate, using 1 ml per well.

(111) Remember to leave room for a non-transfected control. Leave o/n to attach. 3. The following day transfect using Fugene-6 (or Mirus) at a ratio of 3:2 to DNA i.e. add 4 microg DNA to 6 ul Fugene-6 in a volume of 100 ul serum free media. Briefly, warm Fugene-6 to RmT and premix by vortexing. Pippette 6 ul into 100 ul serum free media. Gently mix by flicking, add DNA, and again mix by flicking gently. Leave at RmT for 15 minutes. Pippette transfection mix into individual wells, swirl well contents to ensure even distribution. Do not allow Fugene-6 to come into contact with the plastic sides of the tubes being used. 4. Leave cells for 24 hrs and change media if required to serum free. Leave cells 48-72 hrs post treatment before harvesting media. 5. Product titre normally levels off after about 3-5 days. 6. Test expression using both Native and SDS-PAGE
Stable Cell Expression

(112) A mammalian expression system has been established using a modified Invitrogen vector pSecTag-V5/FRT-Hist. This vector is used in Invitrogen's Flp-In system to direct integration of the target gene into the host cell line, allowing rapid generation of stable clones into specific sites within the host genome for high expression.

(113) Culturing Flp-In Cell lines; followed manufactures instruction using basic cell culture techniques.

(114) Stable cell lines were generated in 6-well plates using Fugene-6 as the transfection reagent. The CHO Flp-In cells were co-transfected with the expression vector and pOG44, a plasmid that expresses flp recombinase an enzyme which causes the recombination of the LR-fusion gene into a hot-spot of the cell chromosome. Hygromycin B was used to select for cells with positive recombinants.

(115) Purification of GH-exGHR Fusions.

(116) Human GH and GH receptor were amplified by RT-PCR from human pituitary and liver respectively and cloned into the vector, pSecTag-V5/FRT/Hist-TOPO (Invitrogen, Paisley, UK) under the human GH secretion signal sequence. Four repeats of a Gly.sub.4Ser linker were used to link the native C-terminus of human GH to the native N-terminus of the human GHR. Stable clones were made in CHO Flp-In cells (Invitrogen, Paisley, UK), adapted to protein free media and grown in suspension culture. LR-fusion expression was confirmed by an in-house ELISA. Affinity purification was performed using a GH mAb column.

(117) Transcription Bioassays

(118) These were performed as previously described in human 293 cells stably expressing the human GHR.sup.16. ELISA. An in house GH and fusion ELISA has been established based on the sandwich ELISA format. In the assay, standards (GH or fusion), controls and unknowns are incubated with biotin-labelled mouse antibody to human GH (mAb 7F8) in wells pre-coated with a mouse antibody to human GH antibody (mAb 10A7). The detection limit for the assay is 2.5 pg and the intra and inter assay CV is <10%. The IGF-I ELISA was purchased from DSL (DSL-10-2900 ACTIVE mouse/rat IGF-I kit; DSL Research Reagents, Oxfordshire, UK).

(119) Nb2 Proliferation Assay

(120) The ability of the Cell line Nb2 to proliferate in the presence of lactogen and assaying of endogenous dehydrogenase activity using the Celltitre Assay reagent (Promega)

(121) Non-Radioactive Proliferation Assay Reagents (Cat# G358C, Lot# 24464403, Ready to use One Solution Reagent: add 20 ul directly to media)

(122) Basic Method

(123) 1. Take Nb2 cells and wash twice with 20 ml of Assay media. Resuspend at 5.510E5 cells per ml in Assay media. 2. Grow cells o/n in T75 flasks to deplete the cells of lactogen @ 37 C, 5% CO2. 3. For the assay: Count cells and adjust density to 210E4 cells in 50 ul (410E5 cells per ml) in Assay media. Plate on a 96 well plate (Require 10050(210E4)=210E6 cells) 4. Prepare a series of PRL standards as show in table below. Prepare sample and control dilutions as shown. Add 50 ul of each to allocated wells. 5. Grow cells in the presence of Standards and test samples for 3 days @ 37C/5%CO2. 6. To Assay: Add 20 ul of CellTitre reagent (Promega CellTitre 96 Aqueous) and leave at 37 C for 2-6 hrs 7. Record the A490 nm reading of each well using a microplate reader.
Pharmacokinetic Studies

(124) Seven week old normal Sprague Dawley rats from Janvier (Le Genest Saint Isle, France) were used for pharmacokinetic studies. Sc or iv administration (penile vein) and blood withdrawal (orbital sinus) were conducted under isoflurane anaesthesia. The rats (n=4-6/group) were injected iv or sc with of 0.1 mg/kg rhGH or fusion. Blood samples were collected from the retro-orbital plexus. Serum was harvested and stored at 70 C. until assays. Pharmacokinetic parameters were estimated by fitting values of hormone concentration versus time to compartmental models using non-linear least-squares regression analysis. Clearance values were normalized to animal weight. Clearance rate per animal weight and terminal half lives (t.sub.1/2) were calculated using the coefficient and exponents obtained from the iv bolus model fits.

(125) Primate Pharmacokinetic Study

(126) The test substances were formulated in solutions containing 11.9 mM sodium and potassium phosphates, 137 mM sodium chloride, 2.7 mM potassium chloride, 0.01% polysorbate 80; pH of the solution was adjusted to 7.4.

(127) Blood samples were obtained from all animals throughout the study in order to determine the concentration of the appropriate test material in serum. These samples were taken at a number of time points throughout the study.

(128) Clinical Endpoints and Measurements

(129) The serum concentration of IB7v2 and IB7v3 was determined using a validated ELISA method. The pharmacokinetic profile for each of the protein was determined by plotting the concentration for each of the protein in serum versus time using WinNonlin Pro (v4.0.1) software.

(130) Growth Studies

(131) The growth studies used hypophysectomized rats and were performed on Sprague Dawley rats from Charles River Laboratories (Larbresle, France). Rats were hypophysectomized under isoflurane anaesthesia at 4 weeks of age by the breeder and delivered one week after selection on body weight criteria for successful surgery. Animals were individually caged and allowed another week of rest before entering the experimental phase. The injection solutions of excipient, rhGH and fusion never exceeded 2 ml/kg. The rats were weighed daily and depending on the administration protocol, received injections of the test substances for 10 days.

(132) Characterisation of Growth Hormone Fusions

(133) Conformation of the fusion protein was examined using a panel of 16 conformationally sensitive hGH receptor mAbs. Denaturing, native gels and western blotting were used to analyse the LR-fusion and western blotting performed with non-conformationally sensitive to GH. The form of the LR-fusion protein in solution was defined by gel filtration using a Superose G200 analytical column and analytical ultracentrifugation. Analytical ultracentrifugation (AUC) was performed by sedimentation velocity (Analytical service, Dr Andy Barry, Astbury, Leeds University, Leeds, UK).

(134) Statistics

(135) Two groups were compared with a Student's test if their variance was normally distributed or by a Student-Satterthwaite's test if not normally distributed. Distribution was tested with an F test. One-way ANOVA was used to compare the means of 3 or more groups and if the level of significance was p<0.05 individual comparisons were performed with Dunnett's tests. All statistical tests were two-sided at the 5% level of significance and no imputation was made for missing values.

Example 1

(136) GHwt as expected shows comparable activity to rhGH; 1B7v2_wt shows lower activity than rhGH at equivalent concentrations (usually 10-20 fold less). However, the mutant 1B7v2_W104A mutant shows increased activity at all concentrations studied. This may imply that the presence of the W104A mutation which prevents dimerisation of the 1B7v2 molecule, increases its activity by increasing the bioavailability of monomeric 1B7v2.

Example 2

(137) The Nb2 cell line shows a greater level of proliferation in the presence of the 1B7v2_W104A mutant when compared to 1B7v2_wt. The growth curve for 1B7v2_W104A is shifted closer to rhGH. This may imply that the presence of the W104A mutation which prevents dimerisation of the 1B7v2 molecule, increases its activity by increasing the bioavailability of monomeric 1B7v2.

References

(138) 1. Woodhouse, L. J., Mukherjee, A., Shalet, S. M. & Ezzat, S. The influence of growth hormone status on physical impairments, functional limitations, and health-related quality of life in adults. Endocr Rev. 27, 287317 (2006). 2. Clark, R. et al. Long-acting growth hormones produced by conjugation with polyethylene glycol. Journal of Biological Chemistry. 271, 2196921977 (1996). 3. Cook, D. M. et al. The pharmacokinetic and pharmacodynamic characteristics of a long-acting growth hormone (GH) preparation (nutropin depot) in GH-deficient adults. J Clin Endocrinol Metab. 87, 450814 (2002). 4. Reiter, E. O. et al. A multicenter study of the efficacy and safety of sustained release GH in the treatment of naive pediatric patients with GH deficiency. J Clin Endocrinol Metab. 86, 47006 (2001). 5. Jostel, A., Mukherjee, A., Alenfall, J., Smethurst, L. & Shalet, S. M. A new sustained-release preparation of human growth hormone and its pharmacokinetic, pharmacodynamic and safety profile. Clin Endocrinol (Oxf). 62, 6237 (2005). 6. Laursen, T. et al. Long-term effects of continuous subcutaneous infusion versus daily subcutaneous injections of growth hormone (GH) on the insulin-like growth factor system, insulin sensitivity, body composition, and bone and lipoprotein metabolism in GH-deficient adults. J Clin Endocrinol Metab. 86, 12228 (2001). 7. Laursen, T., Jorgensen, J. O., Jakobsen, G., Hansen, B. L. & Christiansen, J. S. Continuous infusion versus daily injections of growth hormone (GH) for 4 weeks in GH-deficient patients. J Clin Endocrinol Metab. 80, 24108 (1995). 8. Muller-Newen, G., Kohne, C. & Heinrich, P. C. Soluble receptors for cytokines and growth factors. [Review] [58 refs]. International Archives of Allergy & Immunology. 111, 99106 (1996). 9. Baumann, G., Amburn, K. D. & Buchanan, T. A. The effect of circulating growth hormone-binding protein on metabolic clearance, distribution, and degradation of human growth hormone. J Clin Endocrinol Metab. 64, 65760 (1987). 10. Baumann, G. Growth hormone heterogeneity: genes, isohormones, variants, and binding proteins. Endocrine Reviews 12, 424449 (1991). 11. Baumann, G., Shaw, M. A. & Buchanan, T. A. In vivo kinetics of a covalent growth hormone-binding protein complex. Metabolism. 38, 3303 (1989). 12. Clark, R. G. et al. Recombinant human growth hormone (GH)-binding protein enhances the growth-promoting activity of human GH in the rat. Endocrinology. 137, 43084315 (1996). 13. Baumann, G. Growth hormone binding protein--errant receptor or active player?

(139) [editorial]. Endocrinology. 136, 377378 (1995). 14. Ayling, R. M. et al. A dominant-negative mutation of the growth hormone receptor causes familial short stature. Nature Genetics. 16, 1314 (1997). 15. Ross, R. J. et al. A short isoform of the human growth hormone receptor functions as a dominant negative inhibitor of the full-length receptor and generates large amounts of binding protein. Molecular Endocrinology. 11, 265273 (1997). 16. Ross, R. J. M. et al. Binding and functional studies with the growth hormone receptor antagonist, B2036-PEG (pegvisomant), reveal effects of pegylation and evidence that it binds to a receptor dimer. Journal of Clinical Endocrinology & Metabolism. 86, 17161723 (2001). 17. Cunningham, B. C. et al. Dimerization of the extracellular domain of the human growth hormone receptor by a single hormone molecule. Science. 254, 821825 (1991). 18. Huston, J. S., Tai, M. S., McCartney, J., Keck, P. & Oppermann, H. Antigen recognition and targeted delivery by the single-chain Fv. Cell Biophys. 22, 189-224 (1993). 19. Herington, A. C., Smith, A. I., Wallace, C. & Stevenson, J. L. Partial purification from human serum of a specific binding protein for human growth hormone. Mol Cell Endocrinol. 53, 2039 (1987). 20. Frick, G. P., Tai, L. R., Baumbach, W. R. & Goodman, H. M. Tissue distribution, turnover, and glycosylation of the long and short growth hormone receptor isoforms in rat tissues. Endocrinology. 139, 282430 (1998). 21. Mannor, D. A., Winer, L. M., Shaw, M. A. & Baumann, G. Plasma growth hormone (GH)-binding proteins: effect on GH binding to receptors and GH action. J Clin Endocrinol Metab. 73, 304 (1991). 22. Lim, L., Spencer, S. A., McKay, P. & Waters, M. J. Regulation of growth hormone (GH) bioactivity by a recombinant human GH-binding protein. Endocrinology. 127, 128791 (1990). 23. Haffner, D., Schaefer, F., Girard, J., Ritz, E. & Mehls, O. Metabolic clearance of recombinant human growth hormone in health and chronic renal failure. J Clin Invest. 93, 116371 (1994). 24. Johnson, V. & Maack, T. Renal extraction, filtration, absorption, and catabolism of growth hormone. American Journal of Physiology 233, F185F196 (1977). 25. Veldhuis, J. D. et al. Impact of experimental blockade of peripheral growth hormone (GH) receptors on the kinetics of endogenous and exogenous GH removal in healthy women and men. Journal of Clinical Endocrinology & Metabolism 87, 57375745 (2002). 26. Osborn, B. L. et al. Albutropin: a growth hormone-albumin fusion with improved pharmacokinetics and pharmacodynamics in rats and monkeys. Eur J Pharmacol 456, 14958 (2002). 27. de Vos, A. M., Ultsch, M. & Kossiakoff, A. A. Human growth hormone and extracellular domain of its receptor: crystal structure of the complex. Science 255, 306312 (1992).