RNAi agents and compositions for inhibiting expression of Asialoglycoprotein receptor 1

11492624 · 2022-11-08

Assignee

Inventors

Cpc classification

International classification

Abstract

Described herein are compositions and methods for inhibition of Asialoglycoprotein receptor 1 (ASGR1) gene expression. RNA interference (RNAi) agents, e.g., double stranded RNAi agents, and RNAi agent-targeting ligand conjugates for inhibiting the expression of an ASGR1 gene are described. Pharmaceutical compositions comprising one or more ASGR1 RNAi agents, optionally with one or more additional therapeutics, are also described. The ASGR1 RNAi agents can be used in methods of treatment of various diseases and conditions, such as cardiometabolic diseases related to elevated non-HDL cholesterol (non-HDL-C) levels, elevated LDL cholesterol (LDL-C) levels, elevated total cholesterol levels, and/or elevated triglyceride (TG) levels.

Claims

1. An RNAi agent for inhibiting expression of an ASGR1 gene, wherein the antisense strand consists of, consists essentially of, or comprises the nucleotide sequence (5′.fwdarw.3′): TABLE-US-00067 (SEQ ID NO: 6) AGCGACUUCAUCUUUCUUCCG; or (SEQ ID NO: 8) AGCGACUUCAUCUUUCUUCGU; and a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand, wherein at least one nucleotide of the sense strand or the antisense strand is a modified nucleotide or wherein the RNAi agent comprises at least one modified internucleoside linkage.

2. The RNAi agent of claim 1, wherein the sense strand consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5′.fwdarw.3′): TABLE-US-00068 (SEQ ID NO: 15) CGGAAGAAAGAUGAAGUCICU; (SEQ ID NO: 16) ACGAAGAAAGAUGAAGUCICU; (SEQ ID NO: 17) ACGAAGAAAGAUGAAGUCGCU; (SEQ ID NO: 31) CGGAAGAAAGAUGAAIUCICU; or (SEQ ID NO: 33) CGGAAGAAAGAUGAAGUCGCU; wherein I represents an inosine nucleotide.

3. The RNAi agent of claim 1, wherein 0, 1, 2, 3, or 4 nucleotides of the RNAi agent are ribonucleotides (2′-hydroxyl nucleotides).

4. The RNAi agent of claim 3, wherein the sense strand further includes inverted abasic residues at the 3′ terminal end of the nucleotide sequence, at the 5′ end of the nucleotide sequence, or at both the 3′ and 5′ terminal ends.

5. The RNAi agent of claim 1, wherein the antisense strand comprises, consists of, or consists essentially of the modified nucleotide sequence (5′.fwdarw.3′): TABLE-US-00069 (SEQ ID NO: 5) asGfscGfaCfuucauCfuUfuCfuUfcsCfsg; (SEQ ID NO: 7) asGfscGfaCfuucauCfuUfuCfuUfcsGfsu; (SEQ ID NO: 9) asGfscsgacuucauCfuUfuCfuUfcGfsu; or wherein a represents 2′-O-methyl adenosine, c represents 2′-O-methyl cytidine, g represents 2′-O-methyl guanosine, and u represents 2′-O-methyl uridine; Af represents 2′-fluoro adenosine, Cf represents 2′-fluoro cytidine, Gf represents 2′-fluoro guanosine, and Uf represents 2′-fluoro uridine; s represents a phosphorothioate linkage; and wherein 0, 1, or 2 nucleotides of the sense strand are ribonucleotides (2′-hydroxyl nucleotides).

6. The RNAi agent of claim 5, wherein the sense strand comprises, consists of, or consists essentially of a modified nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5′.fwdarw.3′): TABLE-US-00070 (SEQ ID NO: 23) cggaagaaAfGfAfugaagucicu; (SEQ ID NO: 24) acgaagaaAfGfAfugaagucicu; (SEQ ID NO: 25) acgaagaaAfGfAfugaagucgcu; (SEQ ID NO: 32) cggaagaaAfGfAfugaaiucicu; or (SEQ ID NO: 34) cggaagaaAfGfAfugaagucgcu; wherein a represents 2′-O-methyl adenosine, c represents 2′-O-methyl cytidine, g represents 2′-O-methyl guanosine, i represents 2′-O-methyl inosine, and u represents 2′-O-methyl uridine; and Af represents 2′-fluoro adenosine, Cf represents 2′-fluoro cytidine, Gf represents 2′-fluoro guanosine, and Uf represents 2′-fluoro uridine.

7. The RNAi agent of claim 1, wherein the sense strand and antisense strand for a duplex pair that comprises, consists of, or consists essentially of a modified nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequence pairs (5′.fwdarw.3′): TABLE-US-00071 (SEQ ID NO: 5) asGfscGfaCfuucauCfuUfuCfuUfcsCfsg and (SEQ ID NO: 23) cggaagaaAfGfAfugaagucicu; (SEQ ID NO: 7) asGfscGfaCfuucauCfuUfuCfuUfcsGfsu and (SEQ ID NO: 24) acgaagaaAfGfAfugaagucicu; (SEQ ID NO: 9) asGfscsgacuucauCfuUfuCfuUfcGfsu and (SEQ ID NO: 25) acgaagaaAfGfAfugaagucgcu; (SEQ ID NO: 5) asGfscGfaCfuucauCfuUfuCfuUfcsCfsg and (SEQ ID NO: 32) cggaagaaAfGfAfugaaiucicu; or (SEQ ID NO: 5) asGfscGfaCfuucauCfuUfuCfuUfcsCfsg and (SEQ ID NO: 34) cggaagaaAfGfAfugaagucgcu, wherein a represents 2′-O-methyl adenosine, c represents 2′-O-methyl cytidine, g represents 2′-O-methyl guanosine, i represents 2′-O-methyl inosine, and u represents 2′-O-methyl uridine, and Af represents 2′-fluoro adenosine, Cf represents 2′-fluoro cytidine, Gf represents 2′-fluoro guanosine, and Uf represents 2′-fluoro uridine.

8. The RNAi agent of claim 5, wherein the RNAi agent is conjugated to a targeting ligand at the 5′ end of the sense strand.

9. The RNAi agent of claim 8, wherein the targeting ligand is a tridentate ligand that includes N-acetyl-galactosamine and has the structure selected from the group consisting of: ##STR00063## ##STR00064##

10. A composition comprising the RNAi agent of claim 1 and a pharmaceutically acceptable excipient.

11. A method for inhibiting expression of an ASGR1 gene in a cell, the method comprising administering to the cell the RNAi agent of claim 1.

12. The method of claim 11, wherein the cell is within a human subject.

13. A method for inhibiting expression of an ASGR1 gene in a subject, the method comprising administering to the subject the composition of claim 10.

14. A method of treating an ASGR1-related disease or disorder, the method comprising administering to a subject in need thereof an effective amount of the composition of claim 10.

15. The method of claim 14, wherein the ASGR1-related disease or disorder is obesity, metabolic syndrome, hyperlipidemia, hypertriglyceridemia, hypercholesterolemia, abnormal lipid and/or cholesterol metabolism, atherosclerosis, diabetes, cardiovascular disease, coronary artery disease, myocardial infarction, peripheral vascular disease, or cerebrovascular disease.

16. A method for reducing non-HDL cholesterol in a subject in need thereof, the method comprising administering to the subject an effective amount of the composition of claim 10.

17. The method of claim 16, wherein the non-HDL cholesterol is LDL cholesterol.

18. A method for reducing the risk of myocardial infarction in a subject in need thereof, the method comprising administering to the subject an effective amount of the composition of claim 10.

19. The method of claim 18, wherein the subject is diagnosed with coronary artery disease.

20. The method of claim 18, wherein the subject has elevated levels of non-HDL cholesterol.

21. The method of claim 11, wherein the RNAi agent is administered at a dose of about 0.05 mg/kg to about 5.0 mg/kg of body weight of the human subject.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1A. Schematic diagram of the modified sense and antisense strands of ASGR1 RNAi agent AD05126 (see Tables 3-5), conjugated to an N-acetyl-galactosamine tridentate ligand having the structure of (NAG37)s (see Table 6). FIG. 1A discloses SEQ ID NOs: 10 and 631.

(2) The following abbreviations are used in FIGS. 1A to 1M: a, c, g, i, and u are 2′-O-methyl modified nucleotides; Af, Cf, Gf, and Uf are 2′-fluoro modified nucleotides; p is a phosphodiester linkage; s is a phosphorothioate linkage; invAb is an inverted abasic residue (see, e.g., Table 6); C is a cytidine ribonucleotide; U.sub.UNA is a 2′,3′-seco-uridine (see, e.g., Table 6); and (NAG37)s and (NAG37)p are the respective tridentate N-acetyl-galactosamine targeting ligands having the structure depicted in Table 6.

(3) FIG. 1B. Schematic diagram of the modified sense and antisense strands of ASGR1 RNAi agent AD05150 (see Tables 3-5), conjugated to an N-acetyl-galactosamine tridentate ligand having the structure of (NAG37)s (see Table 6). FIG. 1B discloses SEQ ID NOs: 10 and 632.

(4) FIG. 1C. Schematic diagram of the modified sense and antisense strands of ASGR1 RNAi agent AD05183 (see Tables 3-5), conjugated to an N-acetyl-galactosamine tridentate ligand having the structure of (NAG37)s (see Table 6). FIG. 1C discloses SEQ ID NOs: 2 and 636.

(5) FIG. 1D. Schematic diagram of the modified sense and antisense strands of ASGR1RNAi agent AD05186 (see Tables 3-5), conjugated to an N-acetyl-galactosamine tridentate ligand having the structure of (NAG37)s (see Table 6). FIG. 1D discloses SEQ ID NOs: 2 and 639.

(6) FIG. 1E. Schematic diagram of the modified sense and antisense strands of ASGR1 RNAi agent AD05193 (see Tables 3-5), conjugated to an N-acetyl-galactosamine tridentate ligand having the structure of (NAG37)s (see Table 6). FIG. 1E discloses SEQ ID NOs: 5 and 645.

(7) FIG. 1F. Schematic diagram of the modified sense and antisense strands of ASGR1 RNAi agent AD05195 (see Tables 3-5), conjugated to an N-acetyl-galactosamine tridentate ligand having the structure of (NAG37)s (see Table 6). FIG. 1F discloses SEQ ID NOs: 5 and 647.

(8) FIG. 1G. Schematic diagram of the modified sense and antisense strands of ASGR1 RNAi agent AD05196 (see Tables 3-5), conjugated to an N-acetyl-galactosamine tridentate ligand having the structure of (NAG37)s (see Table 6). FIG. 1G discloses SEQ ID NOs: 5 and 648.

(9) FIG. 1H. Schematic diagram of the modified sense and antisense strands of ASGR1 RNAi agent AD05206 (see Tables 3-5), conjugated to an N-acetyl-galactosamine tridentate ligand having the structure of (NAG37)s (see Table 6). FIG. 1H discloses SEQ ID NOs: 28 and 658.

(10) FIG. 1I. Schematic diagram of the modified sense and antisense strands of ASGR1 RNAi agent AD05209 (see Tables 3-5), conjugated to an N-acetyl-galactosamine tridentate ligand having the structure of (NAG37)s (see Table 6). FIG. 1I discloses SEQ ID NOs: 4 and 602.

(11) FIG. 1J. Schematic diagram of the modified sense and antisense strands of ASGR1 RNAi agent AD05256 (see Tables 3-5), conjugated to an N-acetyl-galactosamine tridentate ligand having the structure of (NAG37)s (see Table 6). FIG. 1J discloses SEQ ID NOs: 2 and 674.

(12) FIG. 1K. Schematic diagram of the modified sense and antisense strands of ASGR1 RNAi agent AD05374 (see Tables 3-5), conjugated to an N-acetyl-galactosamine tridentate ligand having the structure of (NAG37)s (see Table 6). FIG. 1K discloses SEQ ID NOs: 2 and 700.

(13) FIG. 1L. Schematic diagram of the modified sense and antisense strands of ASGR1 RNAi agent AD05609 (see Tables 3-5), conjugated to an N-acetyl-galactosamine tridentate ligand having the structure of (NAG37)s (see Table 6). FIG. 1L discloses SEQ ID NOs: 7 and 708.

(14) FIG. 1M. Schematic diagram of the modified sense and antisense strands of ASGR1 RNAi agent AD05692 (see Tables 3-5), conjugated to an N-acetyl-galactosamine tridentate ligand having the structure of (NAG37)s (see Table 6). FIG. 1M discloses SEQ ID NOs: 9 and 721.

(15) FIG. 2A to 2D. Chemical structure representation of ASGR1 RNAi agent AD05193, conjugated to an N-acetyl-galactosamine tridentate ligand having the structure of (NAG37)s (see Table 6) at the 5′ terminal end of the sense strand, shown in a sodium salt form.

(16) FIG. 3A to 3D. Chemical structure representation of ASGR1 RNAi agent AD05193, conjugated to an N-acetyl-galactosamine tridentate ligand having the structure of (NAG37)s (see Table 6) at the 5′ terminal end of the sense strand, shown in a free acid form.

(17) FIG. 4A to 4D. Chemical structure representation of ASGR1 RNAi agent AD05209, conjugated to an N-acetyl-galactosamine tridentate ligand having the structure of (NAG37)s (see Table 6) at the 5′ terminal end of the sense strand, shown in a sodium salt form.

(18) FIG. 5A to 5D. Chemical structure representation of ASGR1 RNAi agent AD05209, conjugated to an N-acetyl-galactosamine tridentate ligand having the structure of (NAG37)s (see Table 6) at the 5′ terminal end of the sense strand, shown in a free acid form.

DETAILED DESCRIPTION

Definitions

(19) As used herein, the terms “oligonucleotide” and “polynucleotide” mean a polymer of linked nucleosides each of which can be independently modified or unmodified.

(20) As used herein, an “RNAi agent” (also referred to as an “RNAi trigger”) means a composition that contains an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule that is capable of degrading or inhibiting (e.g., degrades or inhibits under appropriate conditions) translation of messenger RNA (mRNA) transcripts of a target mRNA in a sequence specific manner. As used herein, RNAi agents may operate through the RNA interference mechanism (i.e., inducing RNA interference through interaction with the RNA interference pathway machinery (RNA-induced silencing complex or RISC) of mammalian cells), or by any alternative mechanism(s) or pathway(s). While it is believed that RNAi agents, as that term is used herein, operate primarily through the RNA interference mechanism, the disclosed RNAi agents are not bound by or limited to any particular pathway or mechanism of action. RNAi agents disclosed herein are comprised of a sense strand and an antisense strand, and include, but are not limited to: short (or small) interfering RNAs (siRNAs), double stranded RNAs (dsRNA), micro RNAs (miRNAs), short hairpin RNAs (shRNA), and dicer substrates. The antisense strand of the RNAi agents described herein is at least partially complementary to the mRNA being targeted (i.e. ASGR1 mRNA). RNAi agents can include one or more modified nucleotides and/or one or more non-phosphodiester linkages.

(21) As used herein, the terms “silence,” “reduce,” “inhibit,” “down-regulate,” or “knockdown” when referring to expression of a given gene, mean that the expression of the gene, as measured by the level of RNA transcribed from the gene or the level of polypeptide, protein, or protein subunit translated from the mRNA in a cell, group of cells, tissue, organ, or subject in which the gene is transcribed, is reduced when the cell, group of cells, tissue, organ, or subject is treated with the RNAi agents described herein as compared to a second cell, group of cells, tissue, organ, or subject that has not or have not been so treated.

(22) As used herein, the terms “sequence” and “nucleotide sequence” mean a succession or order of nucleobases or nucleotides, described with a succession of letters using standard nomenclature.

(23) As used herein, a “base,” “nucleotide base,” or “nucleobase,” is a heterocyclic pyrimidine or purine compound that is a component of a nucleotide, and includes the primary purine bases adenine and guanine, and the primary pyrimidine bases cytosine, thymine, and uracil. A nucleobase may further be modified to include, without limitation, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. (See, e.g., Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008). The synthesis of such modified nucleobases (including phosphoramidite compounds that include modified nucleobases) is known in the art.

(24) As used herein, and unless otherwise indicated, the term “complementary,” when used to describe a first nucleobase or nucleotide sequence (e.g., RNAi agent sense strand or targeted mRNA) in relation to a second nucleobase or nucleotide sequence (e.g., RNAi agent antisense strand or a single-stranded antisense oligonucleotide), means the ability of an oligonucleotide or polynucleotide including the first nucleotide sequence to hybridize (form base pair hydrogen bonds under mammalian physiological conditions (or similar conditions in vitro)) and form a duplex or double helical structure under certain standard conditions with an oligonucleotide or polynucleotide including the second nucleotide sequence. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs and include natural or modified nucleotides or nucleotide mimics, at least to the extent that the above hybridization requirements are fulfilled. Sequence identity or complementarity is independent of modification. For example, a and Af, as defined herein, are complementary to U (or T) and identical to A for the purposes of determining identity or complementarity.

(25) As used herein, “perfectly complementary” or “fully complementary” means that in a hybridized pair of nucleobase or nucleotide sequence molecules, all (100%) of the bases in a contiguous sequence of a first oligonucleotide will hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may comprise all or a part of a first or second nucleotide sequence.

(26) As used herein, “partially complementary” means that in a hybridized pair of nucleobase or nucleotide sequence molecules, at least 70%, but not all, of the bases in a contiguous sequence of a first oligonucleotide will hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may comprise all or a part of a first or second nucleotide sequence.

(27) As used herein, “substantially complementary” means that in a hybridized pair of nucleobase or nucleotide sequence molecules, at least 85%, but not all, of the bases in a contiguous sequence of a first oligonucleotide will hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may comprise all or a part of a first or second nucleotide sequence.

(28) As used herein, the terms “complementary,” “fully complementary,” “partially complementary,” and “substantially complementary” are used with respect to the nucleobase or nucleotide matching between the sense strand and the antisense strand of an RNAi agent, or between the antisense strand of an RNAi agent and a sequence of an ASGR1 mRNA.

(29) As used herein, the term “substantially identical” or “substantial identity,” as applied to a nucleic acid sequence means the nucleotide sequence (or a portion of a nucleotide sequence) has at least about 85% sequence identity or more, e.g., at least 90%, at least 95%, or at least 99% identity, compared to a reference sequence. Percentage of sequence identity is determined by comparing two optimally aligned sequences over a comparison window. The percentage is calculated by determining the number of positions at which the same type of nucleic acid base occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity. The inventions disclosed herein encompass nucleotide sequences substantially identical to those disclosed herein.

(30) As used herein, the terms “treat,” “treatment,” and the like, mean the methods or steps taken to provide relief from or alleviation of the number, severity, and/or frequency of one or more symptoms of a disease in a subject. As used herein, “treat” and “treatment” may include the preventative treatment, management, prophylactic treatment, and/or inhibition or reduction of the number, severity, and/or frequency of one or more symptoms of a disease in a subject.

(31) As used herein, the phrase “introducing into a cell,” when referring to an RNAi agent, means functionally delivering the RNAi agent into a cell. The phrase “functional delivery,” means delivering the RNAi agent to the cell in a manner that enables the RNAi agent to have the expected biological activity, e.g., sequence-specific inhibition of gene expression.

(32) Unless stated otherwise, use of the symbol custom character as used herein means that any group or groups may be linked thereto that is in accordance with the scope of the inventions described herein.

(33) As used herein, the term “isomers” refers to compounds that have identical molecular formulae, but that differ in the nature or the sequence of bonding of their atoms or in the arrangement of their atoms in space. Isomers that differ in the arrangement of their atoms in space are termed “stereoisomers.” Stereoisomers that are not mirror images of one another are termed “diastereoisomers,” and stereoisomers that are non-superimposable mirror images are termed “enantiomers,” or sometimes optical isomers. A carbon atom bonded to four non-identical substituents is termed a “chiral center.”

(34) As used herein, unless specifically identified in a structure as having a particular conformation, for each structure in which asymmetric centers are present and thus give rise to enantiomers, diastereomers, or other stereoisomeric configurations, each structure disclosed herein is intended to represent all such possible isomers, including their optically pure and racemic forms. For example, the structures disclosed herein are intended to cover mixtures of diastereomers as well as single stereoisomers.

(35) As used in a claim herein, the phrase “consisting of” excludes any element, step, or ingredient not specified in the claim. When used in a claim herein, the phrase “consisting essentially of” limits the scope of a claim to the specified materials or steps and those that do not materially affect the basic and novel characteristic(s) of the claimed invention.

(36) The person of ordinary skill in the art would readily understand and appreciate that the compounds and compositions disclosed herein may have certain atoms (e.g., N, O, or S atoms) in a protonated or deprotonated state, depending upon the environment in which the compound or composition is placed. Accordingly, as used herein, the structures disclosed herein envisage that certain functional groups, such as, for example, OH, SH, or NH, may be protonated or deprotonated. The disclosure herein is intended to cover the disclosed compounds and compositions regardless of their state of protonation based on the environment (such as pH), as would be readily understood by the person of ordinary skill in the art.

(37) As used herein, the term “linked” or “conjugated” when referring to the connection between two compounds or molecules means that two compounds or molecules are joined by a covalent bond. Unless stated, the terms “linked” and “conjugated” as used herein may refer to the connection between a first compound and a second compound either with or without any intervening atoms or groups of atoms.

(38) As used herein, the term “including” is used to herein mean, and is used interchangeably with, the phrase “including but not limited to.” The term “or” is used herein to mean, and is used interchangeably with, the term “and/or,” unless the context clearly indicates otherwise.

(39) Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

(40) RNAi Agents

(41) Described herein are RNAi agents for inhibiting expression of an ASGR1 gene (referred to herein as ASGR1 RNAi agents or ASGR1 RNAi triggers). Each ASGR1 RNAi agent comprises a sense strand and an antisense strand. The sense strand and the antisense strand each can be 16 to 30 nucleotides in length. In some embodiments, the sense and antisense strands each can be 17 to 26 nucleotides in length. The sense and antisense strands can be either the same length or they can be different lengths. In some embodiments, the sense and antisense strands are each independently 17-21 nucleotides in length. In some embodiments, the sense and antisense strands are each 21-26 nucleotides in length. In some embodiments, the sense strand is about 19 nucleotides in length while the antisense strand is about 21 nucleotides in length. In some embodiments, the sense strand is about 21 nucleotides in length while the antisense strand is about 23 nucleotides in length. In some embodiments, a sense strand is 23 nucleotides in length and an antisense strand is 21 nucleotides in length. In some embodiments, both the sense and antisense strands are each 21 nucleotides in length. In some embodiments, both the sense and antisense strands are each 26 nucleotides in length. In some embodiments, a sense strand is 22 nucleotides in length and an antisense strand is 21 nucleotides in length. In some embodiments, a sense strand is 19 nucleotides in length and an antisense strand is 21 nucleotides in length. In some embodiments, the RNAi agent sense and antisense strands are each independently 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length.

(42) In some embodiments, a double-stranded RNAi agent has a duplex length of about 16, 17, 18, 19, 20, 21, 22, 23 or 24 nucleotides. This region of perfect or substantial complementarity between the sense strand and the antisense strand is typically 15-26 (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) nucleotides in length and occurs at or near the 5′ end of the antisense strand (e.g., this region may be separated from the 5′ end of the antisense strand by 0, 1, 2, 3, or 4 nucleotides that are not perfectly or substantially complementary).

(43) The sense strand and antisense strand each contain a core stretch sequence that is 16 to 23 nucleobases in length. An antisense strand core stretch sequence is 100% (perfectly) complementary or at least about 85% (substantially) complementary to a nucleotide sequence (sometimes referred to, e.g., as a target sequence) present in the ASGR1 mRNA target. A sense strand core stretch sequence is 100% (perfectly) complementary or at least about 85% (substantially) complementary to a core stretch sequence in the antisense strand, and thus the sense strand core stretch sequence is perfectly identical or at least about 85% identical to a nucleotide sequence (target sequence) present in the ASGR1 mRNA target. A sense strand core stretch sequence can be the same length as a corresponding antisense core sequence or it can be a different length. In some embodiments, the antisense strand core stretch sequence is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the sense strand core stretch sequence is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length.

(44) Examples of sense and antisense strand nucleotide sequences used in forming ASGR1 RNAi agents are provided in Tables 2, 3 and 4. Examples of RNAi agent duplexes, that include the sense strand and antisense strand sequences in Tables 3 and 4, are shown in Table 5.

(45) The ASGR1 RNAi agent sense and antisense strands anneal to form a duplex. A sense strand and an antisense strand of an ASGR1 RNAi agent may be partially, substantially, or fully complementary to each other. Within the complementary duplex region, the sense strand core stretch sequence is at least 85% complementary or 100% complementary to the antisense core stretch sequence. In some embodiments, the sense strand core stretch sequence contains a sequence of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that is at least 85% or 100% complementary to a corresponding 16, 17, 18, 19, 20, 21, 22, or 23 nucleotide sequence of the antisense strand core stretch sequence (i.e., the sense and antisense core stretch sequences of an ASGR1 RNAi agent have a region of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that is at least 85% base paired or 100% base paired.)

(46) In some embodiments, the antisense strand of an ASGR1 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, the sense strand of an ASGR1 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2 or Table 4.

(47) The sense strand and/or the antisense strand may optionally and independently contain an additional 1, 2, 3, 4, 5, or 6 nucleotides (extension) at the 3′ end, the 5′ end, or both the 3′ and 5′ ends of the core stretch sequences. The antisense strand additional nucleotides, if present, may or may not be complementary to the corresponding sequence in an ASGR1 mRNA. The sense strand additional nucleotides, if present, may or may not be identical to the corresponding sequence in an ASGR1 mRNA. The antisense strand additional nucleotides, if present, may or may not be complementary to the corresponding sense strand's additional nucleotides, if present.

(48) As used herein, an extension comprises 1, 2, 3, 4, 5, or 6 nucleotides at the 5′ and/or 3′ end of the sense strand core stretch sequence and/or antisense strand core stretch sequence. The extension nucleotides on a sense strand may or may not be complementary to nucleotides, either core stretch sequence nucleotides or extension nucleotides, in the corresponding antisense strand. Conversely, the extension nucleotides on an antisense strand may or may not be complementary to nucleotides, either core stretch nucleotides or extension nucleotides, in the corresponding sense strand. In some embodiments, both the sense strand and the antisense strand of an RNAi agent contain 3′ and 5′ extensions. In some embodiments, one or more of the 3′ extension nucleotides of one strand base pairs with one or more 5′ extension nucleotides of the other strand. In other embodiments, one or more of 3′ extension nucleotides of one strand do not base pair with one or more 5′ extension nucleotides of the other strand. In some embodiments, an ASGR1 RNAi agent has an antisense strand having a 3′ extension and a sense strand having a 5′ extension.

(49) In some embodiments, an ASGR1 RNAi agent comprises an antisense strand having a 3′ extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In other embodiments, an ASGR1 RNAi agent comprises an antisense strand having a 3′ extension of 1, 2, or 3 nucleotides in length. In some embodiments, one or more of the antisense strand extension nucleotides comprise uracil or thymidine nucleotides or nucleotides which are complementary to the correspondingASGR1 mRNA sequence. In some embodiments, a 3′ antisense strand extension includes or consists of one of the following sequences, but is not limited to: AUA, UGCUU, CUG, UG, UGCC, CUGCC, CGU, CUU, UGCCUA, CUGCCU, UGCCU, UGAUU, GCCUAU, T, TT, U, UU (each listed 5′ to 3′).

(50) In some embodiments, the 3′ end of the antisense strand may include additional abasic residues or sites (Ab). An “abasic residue” or “abasic site” is a nucleotide or nucleoside that lacks a nucleobase at the 1′ position of the sugar. In some embodiments, Ab or AbAb may be added to the 3′ end of the antisense strand. In some embodiments, the abasic residue(s) may be added as inverted abasic residue(s) (see Table 6). (See, e.g., F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16).

(51) In some embodiments, an ASGR1 RNAi agent comprises an antisense strand having a 5′ extension of 1, 2, 3, 4, or 5 nucleotides in length. In other embodiments, an ASGR1 RNAi agent comprises an antisense strand having a 5′ extension of 1 or 2 nucleotides in length. In some embodiments, one or more of the antisense strand extension nucleotides comprises uracil or thymidine nucleotides or nucleotides which are complementary to the corresponding ASGR1 mRNA sequence. In some embodiments, the 5′ antisense strand extension includes or consists of one of the following sequences, but is not limited to, UA, TU, U, T, UU, TT, CUC (each listed 5′ to 3′). An antisense strand may have any of the 3′ extensions described above in combination with any of the 5′ antisense strand extensions described, if present.

(52) In some embodiments, an ASGR1 RNAi agent comprises a sense strand having a 3′ extension of 1, 2, 3, 4, or 5 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprises adenosine, uracil, or thymidine nucleotides, AT dinucleotide, or nucleotides which correspond to nucleotides in the ASGR1 mRNA sequence. In some embodiments, the 3′ sense strand extension includes or consists of one of the following sequences, but is not limited to: T, UT, TT, UU, UUT, TTT, or TTTT (each listed 5′ to 3′).

(53) In some embodiments, the 3′ end of the sense strand may include additional abasic residues. In some embodiments, UUAb, UAb, or Ab may be added to the 3′ end of the sense strand. In some embodiments, the one or more abasic residues added to the 3′ end of the sense strand may be inverted (invAb). In some embodiments, one or more inverted abasic residues may be inserted between the targeting ligand and the nucleobase sequence of the sense strand of the RNAi agent. In some embodiments, the inclusion of one or more inverted abasic residues at or near the terminal end or terminal ends of the sense strand of an RNAi agent may allow for enhanced activity or other desired properties of an RNAi agent.

(54) In some embodiments, an ASGR1 RNAi agent comprises a sense strand having a 5′ extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprise uracil or adenosine nucleotides or nucleotides which correspond to nucleotides in the ASGR1 mRNA sequence. In some embodiments, the sense strand 5′ extension can be one of the following sequences, but is not limited to: CA, AUAGGC, AUAGG, AUAG, AUA, A, AA, AC, GCA, GGCA, GGC, UAUCA, UAUC, UCA, UAU, U, UU (each listed 5′ to 3′). A sense strand may have a 3′ extension and/or a 5′ extension.

(55) In some embodiments, the 5′ end of the sense strand may include one or more additional abasic residues (e.g., (Ab) or (AbAb)). In some embodiments, the one or more abasic residues added to the 5′ end of the sense strand may be inverted (e.g., invAb). In some embodiments, one or more inverted abasic residues may be inserted between the targeting ligand and the nucleobase sequence of the sense strand of the RNAi agent. In some embodiments, the inclusion of one or more inverted abasic residues at or near the terminal end or terminal ends of the sense strand of an RNAi agent may allow for enhanced activity or other desired properties of an RNAi agent.

(56) In some embodiments, the 3′ end of the sense strand core stretch sequence, or the 3′ end of the sense strand sequence, may include an inverted abasic residue (invAb (see Table 6)). In some embodiments, the 5′ end of the sense core stretch, or the 5′ end of the sense strand sequence, may include an inverted abasic site or residue. In some embodiments, both the 3′ and 5′ ends of the sense strand core stretch sequence may include an inverted abasic residue. In some embodiments, both the 3′ and 5′ ends of the sense strand sequence may include an inverted abasic residue.

(57) In some embodiments, the 3′ end of the antisense strand core stretch sequence, or the 3′ end of the antisense strand sequence, may include an inverted abasic residue (invAb (see Table 6)). In some embodiments, the 5′ end of the antisense core stretch, or the 5′ end of the antisense strand sequence, may include an inverted abasic site or residue. In some embodiments, both the 3′ and 5′ ends of the antisense strand core stretch sequence may include an inverted abasic residue. In some embodiments, both the 3′ and 5′ ends of the antisense strand sequence may include an inverted abasic residue.

(58) Examples of sequences used in forming ASGR1 RNAi agents are provided in Tables 2, 3, and 4. In some embodiments, an ASGR1 RNAi agent antisense strand includes a sequence of any of the sequences in Tables 2 or 3. In some embodiments, an ASGR1 RNAi agent antisense strand includes the sequence of nucleotides 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, 2-24, 1-25, 2-25, 1-26, or 2-26 of any of the sequences in Tables 2 or 3. In certain embodiments, an ASGR1 RNAi agent antisense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 3. In some embodiments, an ASGR1 RNAi agent sense strand includes the sequence of any of the sequences in Tables 2 or 4. In some embodiments, an ASGR1 RN Ai agent sense strand includes the sequence of nucleotides 1-18, 1-19, 1-20, 1-21, 1-22, 1-23, 1-24, 1-25, 1-26, 2-19, 2-20, 2-21, 2-22, 2-23, 2-24, 2-25, 2-26, 3-20, 3-21, 3-22, 3-23, 3-24, 3-25, 3-26, 4-21, 4-22, 4-23, 4-24, 4-25, 4-26, 5-22, 5-23, 5-24, 5-25, 5-26, 6-23, 6-24, 6-25, 6-26, 7-24, 7-25, 7-25, 8-25, 8-26 of any of the sequences in Tables 2 or 4. In certain embodiments, an ASGR1 RNAi agent sense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 4.

(59) In some embodiments, the sense and antisense strands of the RNAi agents described herein contain the same number of nucleotides. In some embodiments, the sense and antisense strands of the RNAi agents described herein contain different numbers of nucleotides. In some embodiments, the sense strand 5′ end and the antisense strand 3′ end of an RNAi agent form a blunt end. In some embodiments, the sense strand 3′ end and the antisense strand 5′ end of an RNAi agent form a blunt end. In some embodiments, both ends of an RNAi agent form blunt ends. In some embodiments, neither end of an RNAi agent is blunt-ended. As used herein a blunt end refers to an end of a double stranded RNAi agent in which the terminal nucleotides of the two annealed strands are complementary (form a complementary base-pair).

(60) In some embodiments, the sense strand 5′ end and the antisense strand 3′ end of an RNAi agent form a frayed end. In some embodiments, the sense strand 3′ end and the antisense strand 5′ end of an RNAi agent form a frayed end. In some embodiments, both ends of an RNAi agent form a frayed end. In some embodiments, neither end of an RNAi agent is a frayed end. As used herein a frayed end refers to an end of a double stranded RNAi agent in which the terminal nucleotides of the two annealed strands form a pair (i.e. do not form an overhang) but are not complementary (i.e. form a non-complementary pair). As used herein, an overhang is a stretch of one or more unpaired nucleotides at the end of one strand of a double stranded RNAi agent. The unpaired nucleotides may be on the sense strand or the antisense strand, creating either 3′ or 5′ overhangs. In some embodiments, the RNAi agent contains: a blunt end and a frayed end, a blunt end and 5′ overhang end, a blunt end and a 3′ overhang end, a frayed end and a 5′ overhang end, a frayed end and a 3′ overhang end, two 5′ overhang ends, two 3′ overhang ends, a 5′ overhang end and a 3′ overhang end, two frayed ends, or two blunt ends.

(61) A nucleotide base (or nucleobase) is a heterocyclic pyrimidine or purine compound which is a constituent of all nucleic acids and includes adenine (A), guanine (G), cytosine (C), thymine (T), and uracil (U). As used herein, the term “nucleotide” can include a modified nucleotide (such as, for example, a nucleotide mimic, abasic site or residue (Ab), or a surrogate replacement moiety). Modified nucleotides, when used in various polynucleotide or oligonucleotide constructs, may preserve activity of the compound in cells while at the same time increasing the serum stability of these compounds, and can also minimize the possibility of activating interferon activity in humans upon administering of the polynucleotide or oligonucleotide construct.

(62) In some embodiments, an ASGR1 RNAi agent is prepared or provided as a salt, mixed salt, or a free-acid. In some embodiments, an ASGR1 RNAi agent is prepared as a sodium salt. Such forms are within the scope of the inventions disclosed herein.

(63) Modified Nucleotides

(64) In some embodiments, an ASGR1 RNAi agent contains one or more modified nucleotides. As used herein, a “modified nucleotide” is a nucleotide other than a ribonucleotide (2′-hydroxyl nucleotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides include, but are not limited to, deoxyribonucleotides, nucleotide mimics, abasic nucleotides (represented herein as Ab), 2′-modified nucleotides, 3′ to 3′ linkages (inverted) nucleotides (represented herein as invdN, invN, invn, invAb), modified nucleobase-comprising nucleotides, bridged nucleotides, peptide nucleic acids (PNAs), 2′,3′-seco nucleotide mimics (unlocked nucleobase analogues, represented herein as N.sub.UNA or NUNA), locked nucleotides (represented herein as N.sub.LNA or NLNA), 3′-O-methoxy (2′ internucleoside linked) nucleotides (represented herein as 3′-OMen), 2′-F-Arabino nucleotides (represented herein as NfANA or Nf.sub.ANA), 5′-Me, 2′-fluoro nucleotide (represented herein as 5Me-Nf), morpholino nucleotides, vinyl phosphonate deoxyribonucleotides (represented herein as vpdN), vinyl phosphonate containing nucleotides, and cyclopropyl phosphonate containing nucleotides (cPrpN). 2′-modified nucleotides (i.e. a nucleotide with a group other than a hydroxyl group at the 2′ position of the five-membered sugar ring) include, but are not limited to, 2′-O-methyl nucleotides (represented herein as a lower case letter ‘n’ in a nucleotide sequence), 2′-deoxy-2′-fluoro nucleotides (represented herein as Nf, also represented herein as 2′-fluoro nucleotide), 2′-deoxy nucleotides (represented herein as dN), 2′-methoxyethyl (2′-O-2-methoxylethyl) nucleotides (represented herein as NM or 2′-MOE), 2′-amino nucleotides, and 2′-alkyl nucleotides. It is not necessary for all positions in a given compound to be uniformly modified. Conversely, more than one modification may be incorporated in a single ASGR1 RNAi agent or even in a single nucleotide thereof. The ASGR1 RNAi agent sense strands and antisense strands may be synthesized and/or modified by methods known in the art. Modification at one nucleotide is independent of modification at another nucleotide.

(65) Modified nucleobases include synthetic and natural nucleobases, such as 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, (e.g., 2-aminopropyladenine, 5-propynyluracil, or 5-propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, inosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl, or 6-n-butyl) derivatives of adenine and guanine, 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl, or 2-n-butyl) and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 5-halouracil, cytosine, 5-propynyl uracil, 5-propynyl cytosine, 6-azo uracil, 6-azo cytosine, 6-azo thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-sulfhydryl, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo (e.g., 5-bromo), 5-trifluoromethyl, and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, and 3-deazaadenine.

(66) In some embodiments, all or substantially all of the nucleotides of an RNAi agent are modified nucleotides. As used herein, an RNAi agent wherein substantially all of the nucleotides present are modified nucleotides is an RNAi agent having four or fewer (i.e., 0, 1, 2, 3, or 4) nucleotides in both the sense strand and the antisense strand being ribonucleotides. As used herein, a sense strand wherein substantially all of the nucleotides present are modified nucleotides is a sense strand having two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand being ribonucleotides. As used herein, an antisense sense strand wherein substantially all of the nucleotides present are modified nucleotides is an antisense strand having two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand being ribonucleotides. In some embodiments, one or more nucleotides of an RNAi agent is a ribonucleotide.

(67) Modified Internucleoside Linkages

(68) In some embodiments, one or more nucleotides of an ASGR1 RNAi agent are linked by non-standard linkages or backbones (i.e., modified internucleoside linkages or modified backbones). Modified internucleoside linkages or backbones include, but are not limited to, phosphorothioate groups (represented herein as a lower case “s”), chiral phosphorothioates, thiophosphates, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters, alkyl phosphonates (e.g., methyl phosphonates or 3′-alkylene phosphonates), chiral phosphonates, phosphinates, phosphoramidates (e.g., 3′-amino phosphoramidate, amino alkylphosphoramidates, or thionophosphoramidates), thionoalkyl-phosphonates, thionoalkylphosphotriesters, morpholino linkages, boranophosphates having normal 3′-5′ linkages, 2′-5′ linked analogs of boranophosphates, or boranophosphates having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3′-5′ to 5′-3′ or 2′-5′ to 5′-2′.

(69) In some embodiments, a modified internucleoside linkage or backbone lacks a phosphorus atom. Modified internucleoside linkages lacking a phosphorus atom include, but are not limited to, short chain alkyl or cycloalkyl inter-sugar linkages, mixed heteroatom and alkyl or cycloalkyl inter-sugar linkages, or one or more short chain heteroatomic or heterocyclic inter-sugar linkages. In some embodiments, modified internucleoside backbones include, but are not limited to, siloxane backbones, sulfide backbones, sulfoxide backbones, sulfone backbones, formacetyl and thioformacetyl backbones, methylene formacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and other backbones having mixed N, O, S, and CH.sub.2 components.

(70) In some embodiments, a sense strand of an ASGR1 RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, an antisense strand of an ASGR1 RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, or both the sense strand and the antisense strand independently can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages. In some embodiments, a sense strand of an ASGR1 RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, an antisense strand of an ASGR1 RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, or both the sense strand and the antisense strand independently can contain 1, 2, 3, or 4 phosphorothioate linkages.

(71) In some embodiments, an ASGR1 RNAi agent sense strand contains at least two phosphorothioate internucleoside linkages. In some embodiments, the at least two phosphorothioate internucleoside linkages are between the nucleotides at positions 1-3 from the 3′ end of the sense strand. In some embodiments, the at least two phosphorothioate internucleoside linkages are between the nucleotides at positions 1-3, 2-4, 3-5, 4-6, 4-5, or 6-8 from the 5′ end of the sense strand. In some embodiments, one phosphorothioate internucleoside linkage is at the 5′ end of the sense strand, and another phosphorothioate linkage is at the 3′ end of the sense strand. In some embodiments, two phosphorothioate internucleoside linkage are located at the 5′ end of the sense strand, and another phosphorothioate linkage is at the 3′ end of the sense strand. In some embodiments, the sense strand does not include any phosphorothioate internucleoside linkages between the nucleotides, but contains one, two, or three phosphorothioate linkages between the terminal nucleotides on both the 5′ and 3′ ends and the optionally present inverted abasic residue terminal caps. In some embodiments, the targeting ligand is linked to the sense strand via a phosphorothioate linkage. In some embodiments, an ASGR1 RNAi agent antisense strand contains four phosphorothioate internucleoside linkages. In some embodiments, the four phosphorothioate internucleoside linkages are between the nucleotides at positions 1-3 from the 5′ end of the antisense strand and between the nucleotides at positions 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 from the 5′ end. In some embodiments, an ASGR1 RNAi agent contains at least two phosphorothioate internucleoside linkages in the sense strand and three or four phosphorothioate internucleoside linkages in the antisense strand.

(72) In some embodiments, an ASGR1 RNAi agent antisense strand contains four phosphorothioate internucleoside linkages. In some embodiments, the four phosphorothioate internucleoside linkages are between the nucleotides at positions 1-3 from the 5′ end of the antisense strand and between the nucleotides at positions 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 from the 5′ end. In some embodiments, three phosphorothioate internucleoside linkages are located between positions 1-4 from the 5′ end of the antisense strand, and a fourth phosphorothioate internucleoside linkage is located between positions 20-21 from the 5′ end of the antisense strand. In some embodiments, an ASGR1 RNAi agent contains at least three or four phosphorothioate internucleoside linkages in the antisense strand.

(73) In some embodiments, an ASGR1 RNAi agent contains one or more modified nucleotides and one or more modified internucleoside linkages. In some embodiments, a 2′-modified nucleoside is combined with modified internucleoside linkage.

(74) ASGR1 RNAi Agents

(75) In some embodiments, the ASGR1 RNAi agents disclosed herein target an ASGR1 gene at or near the positions of the ASGR1 gene shown in Table 1. In some embodiments, the antisense strand of an ASGR1 RNAi agent disclosed herein includes a core stretch sequence that is fully, substantially, or at least partially complementary to a target ASGR1 19-mer sequence disclosed in Table 1.

(76) TABLE-US-00015 TABLE 1 ASGR1 19-mer mRNA Target Sequences (taken from human ASGR1 (transcript variant 1) cDNA, GenBank NM_001671.4 (SEQ ID NO: 1)). Corresponding Gene SEQ ASGR1 19-mer Positions ID Target Sequences (taken from SEQ ID No. (5′ .fwdarw. 3′) NO: 1) 37 AGCCCUAUCAUGACCAAGG 392-410 38 CCUAUCAUGACCAAGGAGU 395-413 39 CUAUCAUGACCAAGGAGUA 396-414 40 UAUCAUGACCAAGGAGUAU 397-415 41 AUCAUGACCAAGGAGUAUC 398-416 42 CAUGACCAAGGAGUAUCAA 400-418 43 GGAGAGUGACCACCAUCAG 442-460 44 GAGUGACCACCAUCAGCUC 445-463 45 CAACUUCACAGCGAGCACG 634-652 46 AGGGAGGCAAUGUGGGAAG 681-699 47 GGAGGCAAUGUGGGAAGAA 683-701 48 GGCAAUGUGGGAAGAAAGA 686-704 49 CAAUGUGGGAAGAAAGAUG 688-706 50 AAUGUGGGAAGAAAGAUGA 689-707 51 GUGGGAAGAAAGAUGAAGU 692-710 52 GGAAGAAAGAUGAAGUCGC 695-713 53 GAAGAAAGAUGAAGUCGCU 696-714 54 UGCUGCUCCACGUGAAGCA 768-786 55 CUGCUCCACGUGAAGCAGU 770-788 56 UGCUCCACGUGAAGCAGUU 771-789 57 GCUCCACGUGAAGCAGUUC 772-790 58 UCCACGUGAAGCAGUUCGU 774-792 59 GCUCCAGGGCAAUGGCUCA 829-847 60 CACGAGCGCAGCUGCUACU 881-899 61 AGCGCAGCUGCUACUGGUU 885-903 62 GCGCAGCUGCUACUGGUUC 886-904 63 GACGCCGACAACUACUGCC 929-947 64 ACCUGGUGGUGGUCACGUC 963-981 65 UGGUGGUGGUCACGUCCUG 966-984 66 AGGAGCAGAAAUUUGUCCA  987-1005 67 GCAGAAAUUUGUCCAGCAC  991-1009 68 GCCUCCACGACCAAAACGG 1038-1056 69 GGACGGGACGGACUACGAG 1072-1090 70 GACGGGACGGACUACGAGA 1073-1091 71 ACGGGACGGACUACGAGAC 1074-1092 72 CAGCCGGACGACUGGUACG 1118-1136 73 CGCUGGAACGACGACGUCU 1187-1205 74 GGUCUGCGAGACAGAGCUG 1225-1243 75 GGAGCCACCUCUCCUUUAA 1258-1276 76 GAGCCACCUCUCCUUUAAU 1259-1277 77 AGCCACCUCUCCUUUAAUU 1260-1278 78 UCUCCUUUAAUUUAUUUCU 1267-1285

(77) In some embodiments, an ASGR1 RNAi agent includes an antisense strand wherein position 19 of the antisense strand (5′.fwdarw.3′) is capable of forming a base pair with position 1 of a 19-mer target sequence disclosed in Table 1. In some embodiments, an ASGR1 RNAi agent includes an antisense strand wherein position 1 of the antisense strand (5′.fwdarw.3′) is capable of forming a base pair with position 19 of the 19-mer target sequence disclosed in Table 1.

(78) In some embodiments, an ASGR1 RNAi agent includes an antisense strand wherein position 2 of the antisense strand (5′.fwdarw.3′) is capable of forming a base pair with position 18 of the 19-mer target sequence disclosed in Table 1. In some embodiments, an ASGR1 RNAi agent includes an antisense strand wherein positions 2 through 18 of the antisense strand (5′.fwdarw.3′) are capable of forming base pairs with each of the respective complementary bases located at positions 18 through 2 of the 19-mer target sequence disclosed in Table 1.

(79) For the RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (from 5′ end.fwdarw.3′ end) can be perfectly complementary to the ASGR1 gene, or can be non-complementary to the ASGR1 gene. In some embodiments, the nucleotide at position 1 of the antisense strand (from 5′ end.fwdarw.3′ end) is a U, A, or dT (or a modified version thereof). In some embodiments, the nucleotide at position 1 of the antisense strand (from 5′ end.fwdarw.3′ end) forms an A:U or U:A base pair with the sense strand.

(80) In some embodiments, an ASGR1 RNAi agent antisense strand comprises the sequence of nucleotides (from 5′ end.fwdarw.3′ end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, an ASGR1 RNAi sense strand comprises the sequence of nucleotides (from 5′ end.fwdarw.3′ end) 1-17, 1-18, or 2-18 of any of the sense strand sequences in Table 2 or Table 4.

(81) In some embodiments, an ASGR1 RNAi agent is comprised of (i) an antisense strand comprising the sequence of nucleotides (from 5′ end 3′ end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2 or Table 3, and (ii) a sense strand comprising the sequence of nucleotides (from 5′ end 3′ end) 1-17, 1-18, or 2-18 of any of the sense strand sequences in Table 2 or Table 4.

(82) In some embodiments, the ASGR1 RNAi agents include core 19-mer nucleotide sequences in the sense strand, antisense strand, or both the sense and antisense strands, shown in the following Table 2.

(83) TABLE-US-00016 TABLE 2 Example ASGR1 RNAi Agent Antisense Strand and Sense Strand Core Stretch Base Sequences Antisense Sense Gene Position SEQ Sequence SEQ Sequence (taken ID (5′ .fwdarw. 3′) ID (5′ .fwdarw. 3′) from SEQ No. (19-mer) No. (19-mer) ID NO: 1)  79 CCUUGGUCAU 242 AGCCCUAUCAU 392-410 GAUAGGGCU GACCAAGG  80 UCUUGGUCAU 243 AGCCCUAUCAU 392-410 GAUAGGGCU GACCAAGA  81 NCUUGGUCAU 244 AGCCCUAUCAU 392-410 GAUAGGGCU GACCAAGN  82 NCUUGGUCAU 245 NGCCCUAUCAU 392-410 GAUAGGGCN GACCAAGN  83 ACUCCUUGGU 246 CCUAUCAUGA 395-413 CAUGAUAGG CCAAGGAGU  84 UCUCCUUGGU 247 CCUAUCAUGA 395-413 CAUGAUAGG CCAAGGAGA  85 NCUCCUUGGU 248 CCUAUCAUGA 395-413 CAUGAUAGG CCAAGGAGN  86 NCUCCUUGGU 249 NCUAUCAUGA 395-413 CAUGAUAGN CCAAGGAGN  87 UACUCCUUGG 250 CUAUCAUGAC 396-414 UCAUGAUAG CAAGGAGUA  88 NACUCCUUGG 251 CUAUCAUGAC 396-414 UCAUGAUAG CAAGGAGUN  89 NACUCCUUGG 252 NUAUCAUGAC 396-414 UCAUGAUAN CAAGGAGUN  87 UACUCCUUGG 253 CUAUCAUGAC 396-414 UCAUGAUAG CAAGGAIUA  88 NACUCCUUGG 254 CUAUCAUGAC 396-414 UCAUGAUAG CAAGGAIUN  89 NACUCCUUGG 255 NUAUCAUGAC 396-414 UCAUGAUAN CAAGGAIUN  89 NACUCCUUGG 256 NUAUCAUGAC 396-414 UCAUGAUAN CAAGGANUN  87 UACUCCUUGG 257 CUAUCAUGAC 396-414 UCAUGAUAG CAAIGAIUA  88 NACUCCUUGG 258 CUAUCAUGAC 396-414 UCAUGAUAG CAAIGAIUN  89 NACUCCUUGG 259 NUAUCAUGAC 396-414 UCAUGAUAN CAAIGAIUN  89 NACUCCUUGG 260 NUAUCAUGAC 396-414 UCAUGAUAN CAANGANUN  90 AUACUCCUUG 261 UAUCAUGACC 397-415 GUCAUGAUA AAGGAGUAU  91 UUACUCCUUG 262 UAUCAUGACC 397-415 GUCAUGAUA AAGGAGUAA  92 NUACUCCUUG 263 UAUCAUGACC 397-415 GUCAUGAUA AAGGAGUAN  93 NUACUCCUUG 264 NAUCAUGACC 397-415 GUCAUGAUN AAGGAGUAN  94 GAUACUCCUU 265 AUCAUGACCA 398-416 GGUCAUGAU AGGAGUAUC  95 UAUACUCCUU 266 AUCAUGACCA 398-416 GGUCAUGAU AGGAGUAUA  96 NAUACUCCUU 267 AUCAUGACCA 398-416 GGUCAUGAU AGGAGUAUN  97 NAUACUCCUU 268 NUCAUGACCA 398-416 GGUCAUGAN AGGAGUAUN  98 UUGAUACUCC 269 CAUGACCAAG 400-418 UUGGUCAUG GAGUAUCAA  99 NUGAUACUCC 270 CAUGACCAAG 400-418 UUGGUCAUG GAGUAUCAN 100 NUGAUACUCC 271 NAUGACCAAG 400-418 UUGGUCAUN GAGUAUCAN 101 CUGAUGGUGG 272 GGAGAGUGAC 442-460 UCACUCUCC CACCAUCAG 102 UUGAUGGUGG 273 GGAGAGUGAC 442-460 UCACUCUCC CACCAUCAA 103 NUGAUGGUGG 274 GGAGAGUGAC 442-460 UCACUCUCC CACCAUCAN 104 NUGAUGGUGG 275 NGAGAGUGAC 442-460 UCACUCUCN CACCAUCAN 105 GAGCUGAUGG 276 GAGUGACCAC 445-463 UGGUCACUC CAUCAGCUC 106 UAGCUGAUGG 277 GAGUGACCAC 445-463 UGGUCACUC CAUCAGCUA 107 NAGCUGAUGG 278 GAGUGACCAC 445-463 UGGUCACUC CAUCAGCUN 108 NAGCUGAUGG 279 NAGUGACCAC 445-463 UGGUCACUN CAUCAGCUN 109 CGUGCUCGCU 280 CAACUUCACA 634-652 GUGAAGUUG GCGAGCACG 110 UGUGCUCGCU 281 CAACUUCACA 634-652 GUGAAGUUG GCGAGCACA 111 NGUGCUCGCU 282 CAACUUCACA 634-652 GUGAAGUUG GCGAGCACN 112 NGUGCUCGCU 283 NAACUUCACA 634-652 GUGAAGUUN GCGAGCACN 113 CUUCCCACAU 284 AGGGAGGCAA 681-699 UGCCUCCCA UGUGGGAAG 114 UUUCCCACAU 285 AGGGAGGCAA 681-699 UGCCUCCCA UGUGGGAAA 115 NUUCCCACAU 286 AGGGAGGCAA 681-699 UGCCUCCCA UGUGGGAAN 116 NUUCCCACAU 287 NGGGAGGCAA 681-699 UGCCUCCCN UGUGGGAAN 117 UUCUUCCCAC 288 GGAGGCAAUG 683-701 AUUGCCUCC UGGGAAGAA 118 NUCUUCCCAC 289 GGAGGCAAUG 683-701 AUUGCCUCC UGGGAAGAN 119 NUCUUCCCAC 290 NGAGGCAAUG 683-701 AUUGCCUCN UGGGAAGAN 120 UCUUUCUUCC 291 GGCAAUGUGG 686-704 CACAUUGCC GAAGAAAGA 121 NCUUUCUUCC 292 GGCAAUGUGG 686-704 CACAUUGCC GAAGAAAGN 122 NCUUUCUUCC 293 NGCAAUGUGG 686-704 CACAUUGCN GAAGAAAGN 123 CAUCUUUCUU 294 CAAUGUGGGA 688-706 CCCACAUUG AGAAAGAUG 124 UAUCUUUCUU 295 CAAUGUGGGA 688-706 CCCACAUUG AGAAAGAUA 125 NAUCUUUCUU 296 CAAUGUGGGA 688-706 CCCACAUUG AGAAAGAUN 126 NAUCUUUCUU 297 NAAUGUGGGA 688-706 CCCACAUUN AGAAAGAUN 127 NAUCUUUCUU 298 NAAUGUNGGA 688-706 CCCACAUUN AGAAAGAUN 128 NAUCUUUCUU 299 NAAUGUGNGA 688-706 CCCACAUUN AGAAAGAUN 129 UCAUCUUUCU 300 AAUGUGGGAA 689-707 UCCCACAUU GAAAGAUGA 130 NCAUCUUUCU 301 AAUGUGGGAA 689-707 UCCCACAUU GAAAGAUGN 131 NCAUCUUUCU 302 NAUGUGGGAA 689-707 UCCCACAUN GAAAGAUGN 132 NCAUCUUUCU 303 NAUGUNGGAA 689-707 UCCCACAUN GAAAGAUGN 133 ACUUCAUCUU 304 GUGGGAAGAA 692-710 UCUUCCCAC AGAUGAAGU 134 UCUUCAUCUU 305 GUGGGAAGAA 692-710 UCUUCCCAC AGAUGAAGA 135 NCUUCAUCUU 306 GUGGGAAGAA 692-710 UCUUCCCAC AGAUGAAGN 136 NCUUCAUCUU 307 NUGGGAAGAA 692-710 UCUUCCCAN AGAUGAAGN 137 GCGACUUCAU 308 GGAAGAAAGA 695-713 CUUUCUUCC UGAAGUCGC 138 UCGACUUCAU 309 GGAAGAAAGA 695-713 CUUUCUUCC UGAAGUCGA 139 NCGACUUCAU 310 GGAAGAAAGA 695-713 CUUUCUUCC UGAAGUCGN 140 NCGACUUCAU 311 NGAAGAAAGA 695-713 CUUUCUUCN UGAAGUCGN 141 AGCGACUUCA 312 GAAGAAAGAU 696-714 UCUUUCUUC GAAGUCGCU 142 UGCGACUUCA 313 GAAGAAAGAU 696-714 UCUUUCUUC GAAGUCGCA 143 NGCGACUUCA 314 GAAGAAAGAU 696-714 UCUUUCUUC GAAGUCGCN 144 NGCGACUUCA 315 NAAGAAAGAU 696-714 UCUUUCUUN GAAGUCGCN 141 AGCGACUUCA 316 GAAGAAAGAU 696-714 UCUUUCUUC GAAGUCICU 142 UGCGACUUCA 317 GAAGAAAGAU 696-714 UCUUUCUUC GAAGUCICA 143 NGCGACUUCA 318 GAAGAAAGAU 696-714 UCUUUCUUC GAAGUCICN 144 NGCGACUUCA 319 NAAGAAAGAU 696-714 UCUUUCUUN GAAGUCICN 145 NGCGACUUCA 320 NAAGAAAGAU 696-714 UCUUUCUUN GAAGUCNCN 141 AGCGACUUCA 852 GAAGAAAGAU 696-714 UCUUUCUUC GAAIUCICU 142 UGCGACUUCA 879 GAAGAAAGAU 696-714 UCUUUCUUC GAAIUCICA 143 NGCGACUUCA 883 GAAGAAAGAU 696-714 UCUUUCUUC GAAIUCICN 144 NGCGACUUCA 886 NAAGAAAGAU 696-714 UCUUUCUUN GAAIUCICN 145 NGCGACUUCA 892 NAAGAAAGAU 696-714 UCUUUCUUN GAANUCNCN 146 UGCUUCACGU 321 UGCUGCUCCA 768-786 GGAGCAGCA CGUGAAGCA 147 NGCUUCACGU 322 UGCUGCUCCA 768-786 GGAGCAGCA CGUGAAGCN 148 NGCUUCACGU 323 NGCUGCUCCA 768-786 GGAGCAGCN CGUGAAGCN 149 ACUGCUUCAC 324 CUGCUCCACG 770-788 GUGGAGCAG UGAAGCAGU 150 UCUGCUUCAC 325 CUGCUCCACG 770-788 GUGGAGCAG UGAAGCAGA 151 NCUGCUUCAC 326 CUGCUCCACG 770-788 GUGGAGCAG UGAAGCAGN 152 NCUGCUUCAC 327 NUGCUCCACG 770-788 GUGGAGCAN UGAAGCAGN 153 AACUGCUUCA 328 UGCUCCACGU 771-789 CGUGGAGCA GAAGCAGUU 154 UACUGCUUCA 329 UGCUCCACGU 771-789 CGUGGAGCA GAAGCAGUA 155 NACUGCUUCA 330 UGCUCCACGU 771-789 CGUGGAGCA GAAGCAGUN 156 NACUGCUUCA 331 NGCUCCACGU 771-789 CGUGGAGCN GAAGCAGUN 157 GAACUGCUUC 332 GCUCCACGUG 772-790 ACGUGGAGC AAGCAGUUC 158 UAACUGCUUC 333 GCUCCACGUG 772-790 ACGUGGAGC AAGCAGUUA 159 NAACUGCUUC 334 GCUCCACGUG 772-790 ACGUGGAGC AAGCAGUUN 160 NAACUGCUUC 335 NCUCCACGUG 772-790 ACGUGGAGN AAGCAGUUN 161 ACGAACUGCU 336 UCCACGUGAA 774-792 UCACGUGGA GCAGUUCGU 162 UCGAACUGCU 337 UCCACGUGAA 774-792 UCACGUGGA GCAGUUCGA 163 NCGAACUGCU 338 UCCACGUGAA 774-792 UCACGUGGA GCAGUUCGN 164 NCGAACUGCU 339 NCCACGUGAA 774-792 UCACGUGGN GCAGUUCGN 165 UGAGCCAUUG 340 GCUCCAGGGC 829-847 CCCUGGAGC AAUGGCUCA 166 NGAGCCAUUG 341 GCUCCAGGGC 829-847 CCCUGGAGC AAUGGCUCN 167 NGAGCCAUUG 342 NCUCCAGGGC 829-847 CCCUGGAGN AAUGGCUCN 168 AGUAGCAGCU 343 CACGAGCGCA 881-899 GCGCUCGUG GCUGCUACU 169 UGUAGCAGCU 344 CACGAGCGCA 881-899 GCGCUCGUG GCUGCUACA 170 NGUAGCAGCU 345 CACGAGCGCA 881-899 GCGCUCGUG GCUGCUACN 171 NGUAGCAGCU 346 NACGAGCGCA 881-899 GCGCUCGUN GCUGCUACN 172 AACCAGUAGC 347 AGCGCAGCUG 885-903 AGCUGCGCU CUACUGGUU 173 UACCAGUAGC 348 AGCGCAGCUG 885-903 AGCUGCGCU CUACUGGUA 174 NACCAGUAGC 349 AGCGCAGCUG 885-903 AGCUGCGCU CUACUGGUN 175 NACCAGUAGC 350 NGCGCAGCUG 885-903 AGCUGCGCN CUACUGGUN 176 GAACCAGUAG 351 GCGCAGCUGC 886-904 CAGCUGCGC UACUGGUUC 177 UAACCAGUAG 352 GCGCAGCUGC 886-904 CAGCUGCGC UACUGGUUA 178 NAACCAGUAG 353 GCGCAGCUGC 886-904 CAGCUGCGC UACUGGUUN 179 NAACCAGUAG 354 NCGCAGCUGC 886-904 CAGCUGCGN UACUGGUUN 180 GGCAGUAGUU 355 GACGCCGACA 929-947 GUCGGCGUC ACUACUGCC 181 UGCAGUAGUU 356 GACGCCGACA 929-947 GUCGGCGUC ACUACUGCA 182 NGCAGUAGUU 357 GACGCCGACA 929-947 GUCGGCGUC ACUACUGCN 183 NGCAGUAGUU 358 NACGCCGACA 929-947 GUCGGCGUN ACUACUGCN 184 GACGUGACCA 359 ACCUGGUGGU 963-981 CCACCAGGU GGUCACGUC 185 UACGUGACCA 360 ACCUGGUGGU 963-981 CCACCAGGU GGUCACGUA 186 NACGUGACCA 361 ACCUGGUGGU 963-981 CCACCAGGU GGUCACGUN 187 NACGUGACCA 362 NCCUGGUGGU 963-981 CCACCAGGN GGUCACGUN 188 CAGGACGUGA 363 UGGUGGUGGU 966-984 CCACCACCA CACGUCCUG 189 UAGGACGUGA 364 UGGUGGUGGU 966-984 CCACCACCA CACGUCCUA 190 NAGGACGUGA 365 UGGUGGUGGU 966-984 CCACCACCA CACGUCCUN 191 NAGGACGUGA 366 NGGUGGUGGU 966-984 CCACCACCN CACGUCCUN 192 UGGACAAAUU 367 AGGAGCAGAA  987-1005 UCUGCUCCU AUUUGUCCA 193 NGGACAAAUU 368 AGGAGCAGAA  987-1005 UCUGCUCCU AUUUGUCCN 194 NGGACAAAUU 369 NGGAGCAGAA  987-1005 UCUGCUCCN AUUUGUCCN 195 GUGCUGGACA 370 GCAGAAAUUU  991-1009 AAUUUCUGC GUCCAGCAC 196 UUGCUGGACA 371 GCAGAAAUUU  991-1009 AAUUUCUGC GUCCAGCAA 197 NUGCUGGACA 372 GCAGAAAUUU  991-1009 AAUUUCUGC GUCCAGCAN 198 NUGCUGGACA 373 NCAGAAAUUU  991-1009 AAUUUCUGN GUCCAGCAN 199 CCGUUUUGGU 374 GCCUCCACGA 1038-1056 CGUGGAGGC CCAAAACGG 200 UCGUUUUGGU 375 GCCUCCACGA 1038-1056 CGUGGAGGC CCAAAACGA 201 NCGUUUUGGU 376 GCCUCCACGA 1038-1056 CGUGGAGGC CCAAAACGN 202 NCGUUUUGGU 377 NCCUCCACGA 1038-1056 CGUGGAGGN CCAAAACGN 203 CUCGUAGUCC 378 GGACGGGACG 1072-1090 GUCCCGUCC GACUACGAG 204 UUCGUAGUCC 379 GGACGGGACG 1072-1090 GUCCCGUCC GACUACGAA 205 NUCGUAGUCC 380 GGACGGGACG 1072-1090 GUCCCGUCC GACUACGAN 206 NUCGUAGUCC 381 NGACGGGACG 1072-1090 GUCCCGUCN GACUACGAN 207 UCUCGUAGUC 382 GACGGGACGG 1073-1091 CGUCCCGUC ACUACGAGA 208 NCUCGUAGUC 383 GACGGGACGG 1073-1091 CGUCCCGUC ACUACGAGN 209 NCUCGUAGUC 384 NACGGGACGG 1073-1091 CGUCCCGUN ACUACGAGN 210 GUCUCGUAGU 385 ACGGGACGGA 1074-1092 CCGUCCCGU CUACGAGAC 211 UUCUCGUAGU 386 ACGGGACGGA 1074-1092 CCGUCCCGU CUACGAGAA 212 NUCUCGUAGU 387 ACGGGACGGA 1074-1092 CCGUCCCGU CUACGAGAN 213 NUCUCGUAGU 388 NCGGGACGGA 1074-1092 CCGUCCCGN CUACGAGAN 214 CGUACCAGUC 389 CAGCCGGACG 1118-1136 GUCCGGCUG ACUGGUACG 215 UGUACCAGUC 390 CAGCCGGACG 1118-1136 GUCCGGCUG ACUGGUACA 216 NGUACCAGUC 391 CAGCCGGACG 1118-1136 GUCCGGCUG ACUGGUACN 217 NGUACCAGUC 392 NAGCCGGACG 1118-1136 GUCCGGCUN ACUGGUACN 218 AGACGUCGUC 393 CGCUGGAACG 1187-1205 GUUCCAGCG ACGACGUCU 219 UGACGUCGUC 394 CGCUGGAACG 1187-1205 GUUCCAGCG ACGACGUCA 220 NGACGUCGUC 395 CGCUGGAACG 1187-1205 GUUCCAGCG ACGACGUCN 221 NGACGUCGUC 396 NGCUGGAACG 1187-1205 GUUCCAGCN ACGACGUCN 222 NGACGUCGUC 397 NGCUGGAACG 1187-1205 GUUCCAGCN ACGANGUCN 223 CAGCUCUGUC 398 GGUCUGCGAG 1225-1243 UCGCAGACC ACAGAGCUG 224 UAGCUCUGUC 399 GGUCUGCGAG 1225-1243 UCGCAGACC ACAGAGCUA 225 NAGCUCUGUC 400 GGUCUGCGAG 1225-1243 UCGCAGACC ACAGAGCUN 226 NAGCUCUGUC 401 NGUCUGCGAG 1225-1243 UCGCAGACN ACAGAGCUN 227 UUAAAGGAGA 402 GGAGCCACCU 1258-1276 GGUGGCUCC CUCCUUUAA 228 NUAAAGGAGA 403 GGAGCCACCU 1258-1276 GGUGGCUCC CUCCUUUAN 229 NUAAAGGAGA 404 NGAGCCACCU 1258-1276 GGUGGCUCN CUCCUUUAN 230 AUUAAAGGAG 405 GAGCCACCUC 1259-1277 AGGUGGCUC UCCUUUAAU 231 UUUAAAGGAG 406 GAGCCACCUC 1259-1277 AGGUGGCUC UCCUUUAAA 232 NUUAAAGGAG 407 GAGCCACCUC 1259-1277 AGGUGGCUC UCCUUUAAN 233 NUUAAAGGAG 408 NAGCCACCUC 1259-1277 AGGUGGCUN UCCUUUAAN 234 AAUUAAAGGA 409 AGCCACCUCU 1260-1278 GAGGUGGCU CCUUUAAUU 235 UAUUAAAGGA 410 AGCCACCUCU 1260-1278 GAGGUGGCU CCUUUAAUA 236 NAUUAAAGGA 411 AGCCACCUCU 1260-1278 GAGGUGGCU CCUUUAAUN 237 NAUUAAAGGA 412 NGCCACCUCU 1260-1278 GAGGUGGCN CCUUUAAUN 238 AGAAAUAAAU 413 UCUCCUUUAA 1267-1285 UAAAGGAGA UUUAUUUCU 239 UGAAAUAAAU 414 UCUCCUUUAA 1267-1285 UAAAGGAGA UUUAUUUCA 240 NGAAAUAAAU 415 UCUCCUUUAA 1267-1285 UAAAGGAGA UUUAUUUCN 241 NGAAAUAAAU 416 NCUCCUUUAA 1267-1285 UAAAGGAGN UUUAUUUCN (N = any nucleobase; I = inosine(hypoxanthine)nucleotide).

(84) The ASGR1 RNAi agent sense strands and antisense strands that comprise or consist of the nucleotide sequences in Table 2 can be modified nucleotides or unmodified nucleotides. In some embodiments, the ASGR1 RNAi agents having the sense and antisense strand sequences that comprise or consist of the nucleotide sequences in Table 2 are all or substantially all modified nucleotides.

(85) In some embodiments, the antisense strand of an ASGR1 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2. In some embodiments, the sense strand of an ASGR1 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2.

(86) As used herein, each N listed in a sequence disclosed in Table 2 may be independently selected from any and all nucleobases (including those found on both modified and unmodified nucleotides). In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is not complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is the same as the N nucleotide at the corresponding position on the other strand. In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is different from the N nucleotide at the corresponding position on the other strand.

(87) Certain modified ASGR1 RNAi agent sense and antisense strands are provided in Table 3 and Table 4. Certain modified ASGR1 RNAi agent antisense strands, as well as their underlying unmodified nucleobase sequences, are provided in Table 3. Certain modified ASGR1 RNAi agent sense strands, as well as their underlying unmodified sequences, are provided in Table 4. In forming ASGR1 RNAi agents, each of the nucleotides in each of the unmodified sequences listed in Tables 3 and 4, as well as in Table 2, above, can be a modified nucleotide.

(88) The ASGR1 RNAi agents described herein are formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence listed in Table 2 or Table 4, can be hybridized to any antisense strand containing a sequence listed in Table 2 or Table 3, provided the two sequences have a region of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence.

(89) In some embodiments, an ASGR1 RNAi agent antisense strand comprises a nucleotide sequence of any of the sequences in Table 2 or Table 3.

(90) In some embodiments, an ASGR1 RNAi agent comprises or consists of a duplex having the nucleobase sequences of the sense strand and the antisense strand of any of the sequences in Table 2, Table 3, or Table 4.

(91) Examples of antisense strands containing modified nucleotides are provided in Table 3. Examples of sense strands containing modified nucleotides are provided in Table 4.

(92) As used in Tables 3 and 4, the following notations are used to indicate modified nucleotides, targeting groups, and linking groups. As the person of ordinary skill in the art would readily understand, unless otherwise indicated by the sequence, that when present in an oligonucleotide, the monomers are mutually linked by 5′-3′-phosphodiester bonds: A=adenosine-3′-phosphate; C=cytidine-3′-phosphate; G=guanosine-3′-phosphate; U=uridine-3′-phosphate I=inosine-3′-phosphate n=any 2′-O-methyl modified nucleotide a=2′-O-methyladenosine-3′-phosphate as =2′-O-methyladenosine-3′-phosphorothioate c=2′-O-methylcytidine-3′-phosphate cs=2′-O-methylcytidine-3′-phosphorothioate g=2′-O-methylguanosine-3′-phosphate gs=2′-O-methylguanosine-3′-phosphorothioate t=2′-O-methyl-5-methyluridine-3′-phosphate ts=2′-O-methyl-5-methyluridine-3′-phosphorothioate u=2′-O-methyluridine-3′-phosphate us=2′-O-methyluridine-3′-phosphorothioate i=2′-O-methylinosine-3′-phosphate is=2′-O-methylinosine-3′-phosphorothioate Nf=any 2′-fluoro modified nucleotide Af=2′-fluoroadenosine-3′-phosphate Afs=2′-fluoroadenosine-3′-phosporothioate Cf=2′-fluorocytidine-3′-phosphate Cfs=2′-fluorocytidine-3′-phosphorothioate Gf=2′-fluoroguanosine-3′-phosphate Gfs=2′-fluoroguanosine-3′-phosphorothioate Tf=2′-fluoro-5′-methyluridine-3′-phosphate Tfs=2′-fluoro-5′-methyluridine-3′-phosphorothioate Uf=2′-fluorouridine-3′-phosphate Ufs=2′-fluorouridine-3′-phosphorothioate dN=any 2′-deoxyribonucleotide dA=2′-deoxyadenosine-3′-phosphate dAs=2′-deoxyadenosine-3′-phosphorothioate dC=2′-deoxycytidine-3′-phosphate dCs=2′-deoxycytidine-3′-phosphorothioate dG=2′-deoxyguanosine-3′-phosphate dGs=2′-deoxyguanosine-3′-phosphorothioate dT=2′-deoxythymidine-3′-phosphate dTs=2′-deoxythymidine-3′-phosphorothioate dU=2′-deoxyuridine-3′-phosphate dUs=2′-deoxyuridine-3′-phosphorothioate N.sub.UNA=2′,3′-seco nucleotide mimics (unlocked nucleobase analogs)-3′-Phosphate N.sub.UNAS=2′,3′-seco nucleotide mimics (unlocked nucleobase analogs)-3′-phosphorothioate A.sub.UNA=2′,3′-seco-adenosine-3′-phosphate A.sub.UNAS=2′,3′-seco-adenosine-3′-phosphorothioate C.sub.UNA=2′,3′-seco-cytidine-3′-phosphate C.sub.UNAS=2′,3′-seco-cytidine-3′-phosphorothioate G.sub.UNA=2′,3′-seco-guanosine-3′-phosphate G.sub.UNAS=2′,3′-seco-guanosine-3′-phosphorothioate U.sub.UNA=2′,3′-seco-uridine-3′-phosphate U.sub.UNAS=2′,3′-seco-uridine-3′-phosphorothioate a_2N=see Table 6 a_2Ns=see Table 6 pu_2N=see Table 6 pu_2Ns=see Table 6 N.sub.LNA=locked nucleotide Nf.sub.ANA 2′-F-Arabino nucleotide NM=2′-O-methoxyethyl nucleotide AM=2′-O-methoxyethyladenosine-3′-phosphate AMs=2′-O-methoxyethyladenosine-3′-phosphorothioate TM=2′-O-methoxyethylthymidine-3′-phosphate TMs=2′-O-methoxyethylthymidine-3′-phosphorothioate R=ribitol (invdN)=any inverted deoxyribonucleotide (3′-3′ linked nucleotide) (invAb)=inverted (3′-3′ linked) abasic deoxyribonucleotide, see Table 6 (invAb)s=inverted (3′-3′ linked) abasic deoxyribonucleotide-5′-phosphorothioate, see Table 6 (invn)=any inverted 2′-OMe nucleotide (3′-3′ linked nucleotide) s=phosphorothioate linkage sp=see Table 6 vpdN=vinyl phosphonate deoxyribonucleotide (5Me-Nf)=5′-Me, 2′-fluoro nucleotide cPrp=cyclopropyl phosphonate, see Table 6 epTcPr=see Table 6 epTM=see Table 6

(93) As the person of ordinary skill in the art would readily understand, unless otherwise indicated by the sequence (such as, for example, by a phosphorothioate linkage “s”), when present in an oligonucleotide, the nucleotide monomers are mutually linked by 5′-3′-phosphodiester bonds. As the person of ordinary skill in the art would clearly understand, the inclusion of a phosphorothioate linkage as shown in the modified nucleotide sequences disclosed herein replaces the phosphodiester linkage typically present in oligonucleotides (see, e.g., FIGS. 1A through 1M showing all internucleoside linkages). Further, the person of ordinary skill in the art would readily understand that the terminal nucleotide at the 3′ end of a given oligonucleotide sequence would typically have a hydroxyl (—OH) group at the respective 3′ position of the given monomer instead of a phosphate moiety ex vivo. Moreover, as the person of ordinary skill would readily understand and appreciate, while the phosphorothioate chemical structures depicted herein typically show the anion on the sulfur atom, the inventions disclosed herein encompass all phosphorothioate tautomers and/or diastereomers (e.g., where the sulfur atom has a double-bond and the anion is on an oxygen atom). Unless expressly indicated otherwise herein, such understandings of the person of ordinary skill in the art are used when describing the ASGR1 RNAi agents and compositions of ASGR1 RNAi agents disclosed herein.

(94) Certain examples of targeting groups and linking groups used with the ASGR1 RNAi agents disclosed herein are provided below in Table 6. More specifically, targeting groups and linking groups include the following, for which their chemical structures are provided below in Table 6: (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s. Each sense strand and/or antisense strand can have any targeting groups or linking groups listed herein, as well as other targeting or linking groups, conjugated to the 5′ and/or 3′ end of the sequence.

(95) TABLE-US-00017 TABLE 3 ASGR1 RNAi Agent Antisense Strand Sequences. Antisense  SEQ SEQ Strand ID Antisense Sequence (Modified) ID Underlying Base Sequence ID: NO. (5′ .fwdarw. 3′) NO. (5′ .fwdarw. 3′) AM05757-AS 417 asCfsusUfcAfuCfuUfuCfuUfcCfcAfcusu 722 ACUUCAUCUUUCUUCCCACUU AM05761-AS 418 usAfsgsAfaCfcAfgUfaGfcAfgCfuGfcusu 723 UAGAACCAGUAGCAGCUGCUU AM05919-AS 419 asCfsusUfcAfuCfUfUfuCfuUfcCfcAfcAfsu 724 ACUUCAUCUUUCUUCCCACAU AM05920-AS 420 asCfsusUfcAfucuuuCfuUfcCfcAfcAfsu 724 ACUUCAUCUUUCUUCCCACAU AM05921-AS 421 asCfsusUfcAfuCfuUfuCfuUfcCfcAfcAfsu 724 ACUUCAUCUUUCUUCCCACAU AM05922-AS 422 asCfsusUfcAfuCfuUfuCfuUfcCfcAfcAfuUfsg 725 ACUUCAUCUUUCUUCCCACAUUG AM05927-AS 423 usCfsusUfcAfuCfuUfuCfuUfcCfcAfcAfsu 726 UCUUCAUCUUUCUUCCCACAU AM06016-AS 424 usAfscUfcCfuUfgGfuCfaUfgAfuAfgsgsg 727 UACUCCUUGGUCAUGAUAGGG AM06017-AS 425 usAfscUfcCfuUfgGfuCfaUfgAfuAfgsgsu   3 UACUCCUUGGUCAUGAUAGGU AM06020-AS 426 usCfsuCfgUfaGfuCfcGfuCfcCfgUfcscsa 729 UCUCGUAGUCCGUCCCGUCCA AM06021-AS 427 usCfsuCfgUfaGfuCfcGfuCfcCfgUfcsusu 730 UCUCGUAGUCCGUCCCGUCUU AM06023-AS 428 usUfsaAfaGfgAfgAfgGfuGfgCfuCfcsusg 731 UUAAAGGAGAGGUGGCUCCUG AM06026-AS 429 usGfsuAfgCfaGfcUfgCfgCfuCfgUfgscsu 732 UGUAGCAGCUGCGCUCGUGCU AM06027-AS 430 usGfsuAfgCfaGfcUfgCfgCfuCfgUfgsusu 733 UGUAGCAGCUGCGCUCGUGUU AM06029-AS 431 usGfsuGfcUfcGfcUfgUfgAfaGfuUfgscsu 734 UGUGCUCGCUGUGAAGUUGCU AM06030-AS 432 usGfsuGfcUfcGfcUfgUfgAfaGfuUfgcsusg 735 UGUGCUCGCUGUGAAGUUGCUG AM06033-AS 433 usUfsgAfuGfgUfgGfuCfaCfuCfuCfcsusc 736 UUGAUGGUGGUCACUCUCCUC AM06172-AS 434 usUfsgAfuGfgUfgGfuCfaCfuCfuCfcsusu 737 UUGAUGGUGGUCACUCUCCUU AM06175-AS 435 usGfsaCfgUfcGfuCfgUfuCfcAfgCfgusu 738 UGACGUCGUCGUUCCAGCGUU AM06176-AS 436 asGfsaCfgUfcGfuCfgUfuCfcAfgCfgusu 739 AGACGUCGUCGUUCCAGCGUU AM06179-AS 437 usAfsgCfuGfaUfgGfuGfgUfcAfcUfcsusc 740 UAGCUGAUGGUGGUCACUCUC AM06180-AS 438 usAfsgCfuGfaUfgGfuGfgUfcAfcUfcusu 741 UAGCUGAUGGUGGUCACUCUU AM06183-AS 439 usGfsasGfcCfaUfuGfcCfcUfgGfaGfcusu 742 UGAGCCAUUGCCCUGGAGCUU AM06185-AS 440 usAfscGfuGfaCfcAfcCfaCfcAfgGfuusu 743 UACGUGACCACCACCAGGUUU AM06186-AS 441 usAfscGfuGfaCfcAfcCfaCfcAfgGfusgsc 744 UACGUGACCACCACCAGGUGC AM06189-AS 442 usCfsuGfcUfuCfaCfgUfgGfaGfcAfgsusu 745 UCUGCUUCACGUGGAGCAGUU AM06192-AS 443 spasCfsusUfcAfuCfuUfuCfuUfcCfcAfcusu 722 ACUUCAUCUUUCUUCCCACUU AM06193-AS 444 cPrpusCfsusUfcAfuCfuUfuCfuUfcCfcAfcusu 746 UCUUCAUCUUUCUUCCCACUU AM06200-AS 445 cPrpdUsCfsusUfcAfuCfuUfuCfuUfcCfcAfcusu 746 UCUUCAUCUUUCUUCCCACUU AM06201-AS 446 usCfsusUfcAfuCfuUfuCfuUfcCfcAfcusu 746 UCUUCAUCUUUCUUCCCACUU AM06248-AS 447 usAfscUfcCfuUfgGfuCfaUfgAfuAfggsusu 747 UACUCCUUGGUCAUGAUAGGUU AM06249-AS 448 usAfscUfcCfuUfgGfuCfaUfgAfuAfsgsg 748 UACUCCUUGGUCAUGAUAGG AM06250-AS 449 usAfscUfcCfuUfgGfuCfaUfgAfusasg 749 UACUCCUUGGUCAUGAUAG AM06251-AS 450 usAfscUfcCfuUfgGfuCfaUfgAfuAfgsusu 750 UACUCCUUGGUCAUGAUAGUU AM06252-AS 451 usAfscUfcCfuUfgGfuCfaUfgAfuAfggsgsc 751 UACUCCUUGGUCAUGAUAGGGC AM06253-AS 452 cPrpdUAfcUfcCfuUfgGfuCfaUfgAfuAfgg(invAb) 748 UACUCCUUGGUCAUGAUAGG AM06254-AS 453 cPrpdUsAfscUfcCfuUfgGfuCfaUfgAfuAfgsgsu   3 UACUCCUUGGUCAUGAUAGGU AM06442-AS 454 usUfsaAfaGfgAfgAfgGfuGfgCfuCfcsusu 752 UUAAAGGAGAGGUGGCUCCUU AM06443-AS 455 cPrpdUsUfsaAfaGfgAfgAfgGfuGfgCfuCfcsusu 752 UUAAAGGAGAGGUGGCUCCUU AM06444-AS 456 cPrpusUfsaAfaGfgAfgAfgGfuGfgCfuCfcsusu 752 UUAAAGGAGAGGUGGCUCCUU AM06445-AS 457 usUfsaAfaGfgagagGfuGfgCfuCfcsusu 752 UUAAAGGAGAGGUGGCUCCUU AM06446-AS 458 usUfsaaaggAfgAfgGfuGfgcuccsusu 752 UUAAAGGAGAGGUGGCUCCUU AM06447-AS 459 usUfsaAfaGfgAfgAfgGfuGfgCfuscsc 753 UUAAAGGAGAGGUGGCUCC AM06448-AS 460 usUfsaAfaGfgAfgAfgGfuGfgCfuCfcusgsg 754 UUAAAGGAGAGGUGGCUCCUGG AM06575-AS 461 asGfsaCfgUfcGfuCfgUfuCfcAfgCfgsusu 739 AGACGUCGUCGUUCCAGCGUU AM06578-AS 462 usGfsaCfgUfcGfuCfgUfuCfcAfgCfgsusu 738 UGACGUCGUCGUUCCAGCGUU AM06579-AS 463 cPrpusGfsaCfgUfcGfuCfgUfuCfcAfgCfgsusu 738 UGACGUCGUCGUUCCAGCGUU AM06581-AS 464 usCfsuCfgUfaguccGfuCfcCfgUfcsusu 730 UCUCGUAGUCCGUCCCGUCUU AM06582-AS 465 cPrpusCfsuCfgUfaguccGfuCfcCfgUfcsusu 730 UCUCGUAGUCCGUCCCGUCUU AM06584-AS 466 asCfsuCfgUfaguccGfuCfcCfgUfcsusu 755 ACUCGUAGUCCGUCCCGUCUU AM06586-AS 467 asCfsuCfgUfaguccGfuCfcCfgsUfsc 756 ACUCGUAGUCCGUCCCGUC AM06598-AS 468 usAfscUfcCfuUfgGfuCfaUfgAfuAfgsGfsg 727 UACUCCUUGGUCAUGAUAGGG AM06599-AS 469 usAfscUfcCfuugguCfaUfgAfuAfgsGfsg 727 UACUCCUUGGUCAUGAUAGGG AM06601-AS   2 usAfscUfcCfuUfgGfuCfaUfgAfuAfgsGfsu   3 UACUCCUUGGUCAUGAUAGGU AM06639-AS 470 usAfscsUfcCfuugguCfaUfgAfuAfgsGfsg 727 UACUCCUUGGUCAUGAUAGGG AM06641-AS 471 usAfscsUfcCfuUfgGfuCfaUfgAfuAfgsusu 750 UACUCCUUGGUCAUGAUAGUU AM06643-AS 472 usAfscsUfcCfuugguCfaUfgAfuAfgGfsgs(invAb) 727 UACUCCUUGGUCAUGAUAGGG AM06645-AS 473 usGfscsUfuCfacgugGfaGfcAfgCfaGfsg 757 UGCUUCACGUGGAGCAGCAGG AM06647-AS 474 usCfsgsUfuUfuggucGfuGfgAfgGfcCfsu 758 UCGUUUUGGUCGUGGAGGCCU AM06649-AS 475 usUfsusCfcCfacauuGfcCfuCfcCfuGfsg 759 UUUCCCACAUUGCCUCCCUGG AM06651-AS 476 asAfscsCfaGfuagcaGfcUfgCfgCfuCfsg 760 AACCAGUAGCAGCUGCGCUCG AM06653-AS 477 asAfscsCfaGfuagcaGfcUfgCfgCfuusu 761 AACCAGUAGCAGCUGCGCUUU AM06655-AS 478 usGfscAfgUfaguugUfcGfgCfgUfcsAfsg 762 UGCAGUAGUUGUCGGCGUCAG AM06657-AS 479 usAfsgsGfaCfgugacCfaCfcAfcCfaGfsg 763 UAGGACGUGACCACCACCAGG AM06659-AS 480 usUfsgsCfuGfgAfcAfaAfuUfuCfuGfcUfsc 764 UUGCUGGACAAAUUUCUGCUC AM06661-AS 481 usUfscsGfuAfguccgUfcCfcGfuCfcAfsc 765 UUCGUAGUCCGUCCCGUCCAC AM06663-AS 482 usUfscsUfcGfuagucCfgUfcCfcGfuCfsu 766 UUCUCGUAGUCCGUCCCGUCU AM06665-AS 483 usGfsusAfcCfagucgUfcCfgGfcUfgusu 767 UGUACCAGUCGUCCGGCUGUU AM06667-AS 484 asGfsasCfgUfcgucgUfuCfcAfgCfgusu 739 AGACGUCGUCGUUCCAGCGUU AM06669-AS 485 usAfsasCfuGfcuucaCfgUfgGfaGfcAfsg 768 UAACUGCUUCACGUGGAGCAG AM06671-AS 486 usUfscsUfuCfccacaUfuGfcCfuCfcCfsu 769 UUCUUCCCACAUUGCCUCCCU AM06673-AS 487 usUfscsUfuCfccacaUfuGfcCfuCfcusu 770 UUCUUCCCACAUUGCCUCCUU AM06675-AS 488 usGfscGfaCfuucauCfuUfuCfuUfcsCfsc 771 UGCGACUUCAUCUUUCUUCCC AM06677-AS 489 asGfscGfaCfuucauCfuUfuCfutUfsCfsc 772 AGCGACUUCAUCUUUCUUCCC AM06679-AS 490 usUfsuAfaAfgGfaGfaGfgUfgGfcUfcsCfsu 773 UUUAAAGGAGAGGUGGCUCCU AM06681-AS 491 asUfsuAfaAfgGfaGfaGfgUfgGfcUfcsCfsu 774 AUUAAAGGAGAGGUGGCUCCU AM06683-AS 492 asAfsusUfaAfaGfgAfgAfgGfuGfgCfuCfsc 775 AAUUAAAGGAGAGGUGGCUCC AM06685-AS 493 asAfsusUfaAfaGfGfAfgAfgGfuGfgCfuCfsc 775 AAUUAAAGGAGAGGUGGCUCC AM06687-AS 494 usAfsaCfcAfguagcAfgCfuGfcGfcsUfsc 776 UAACCAGUAGCAGCUGCGCUC AM06689-AS 495 usAfsgCfuCfugucuCfgCfaGfaCfcsCfsa 777 UAGCUCUGUCUCGCAGACCCA AM06703-AS 496 cPrpusCfsusUfcAfuCfaAfaCfuUfcCfcAfcusu 778 UCUUCAUCAAACUUCCCACUU AM06705-AS 497 usAfscUfcCfuUfcCfaCfaUfgAfuAfgsgsu 779 UACUCCUUCCACAUGAUAGGU AM06708-AS 498 asCfsusUfcAfuCfuUfuCfuUfcCfcAfcAfsc 780 ACUUCAUCUUUCUUCCCACAC AM06710-AS  10 asCfsusUfcAfuCfuUfuCfuUfcCfcAfcGfsc  11 ACUUCAUCUUUCUUCCCACGC AM06756-AS 499 asCfsusUfcAfuCfuUfuCfuUfcCfcAfgGfsc 781 ACUUCAUCUUUCUUCCCAGGC AM06796-AS 500 usAfscsUfcCfuugguCfaUfgAfuAfgGfsc 782 UACUCCUUGGUCAUGAUAGGC AM06798-AS 501 usAfscsUfcCfuugguCfaUfgAfuAfgCfsc 783 UACUCCUUGGUCAUGAUAGCC AM06799-AS 502 usAfscsUfcCfuugguCfaUfgAfuAfgGfsu   3 UACUCCUUGGUCAUGAUAGGU AM06806-AS 503 usAfscUfcCfuugguCfaUfgAfuAfgsGfsu   3 UACUCCUUGGUCAUGAUAGGU AM06808-AS 504 asAfscUfcCfuUfgGfuCfaUfgAfuAfgsGfsu 784 AACUCCUUGGUCAUGAUAGGU AM06810-AS 505 usGfscsUfuCfacgugGfaGfcAfgCfausu 785 UGCUUCACGUGGAGCAGCAUU AM06815-AS   5 asGfscGfaCfuucauCfuUfuCfuUfcsCfsg   6 AGCGACUUCAUCUUUCUUCCG AM06820-AS 506 asCfsusCfcUfuGfgUfcAfuGfaUfaGfgGfsc 786 ACUCCUUGGUCAUGAUAGGGC AM06822-AS 507 usAfsusCfuUfuCfuUfcCfcAfcAfuUfgCfsc 787 UAUCUUUCUUCCCACAUUGCC AM06824-AS 508 usCfsgsAfcUfuCfaUfcUfuUfcUfuCfcCfsa 788 UCGACUUCAUCUUUCUUCCCA AM06826-AS 509 asAfscsUfgCfuUfcAfcGfuGfgAfgCfausu 789 AACUGCUUCACGUGGAGCAUU AM06828-AS 510 asCfsgsAfaCfuGfcUfuCfaCfgUfgGfausu 790 ACGAACUGCUUCACGUGGAUU AM06830-AS 511 usGfsgsAfcAfaAfuUfuCfuGfcUfcCfuCfsc 791 UGGACAAAUUUCUGCUCCUCC AM06832-AS 512 usUfsgAfuAfcUfcCfuUfgGfuCfaUfgsAfsu 792 UUGAUACUCCUUGGUCAUGAU AM06834-AS 513 usCfsuUfuCfuUfcCfcAfcAfuUfgCfcsUfsc 793 UCUUUCUUCCCACAUUGCCUC AM06836-AS 514 usCfsaUfcUfuUfcUfuCfcCfaCfaUfusGfsc 794 UCAUCUUUCUUCCCACAUUGC AM06838-AS  28 usGfsaAfaUfaAfaUfuAfaAfgGfaGfasGfsg  27 UGAAAUAAAUUAAAGGAGAGG AM06840-AS 515 usGfsaAfaUfaAfaUfuAfaAfgGfaGfcsGfsg 795 UGAAAUAAAUUAAAGGAGCGG AM06842-AS 516 asGfsaAfaUfaAfaUfuAfaAfgGfaGfcsGfsg 796 AGAAAUAAAUUAAAGGAGCGG AM06851-AS   4 usAfscUfcCfU.sub.UNAUfgGfuCfaUfgAfuAfgsGfsu   3 UACUCCUUGGUCAUGAUAGGU AM06853-AS 517 usCfsusUfgGfucaugAfuAfgGfgCfuGfsu 797 UCUUGGUCAUGAUAGGGCUGU AM06855-AS 518 asCfsusCfcUfuggucAfuGfaUfaGfgGfsu 798 ACUCCUUGGUCAUGAUAGGGU AM06857-AS 519 asUfsasCfuCfcuuggUfcAfuGfaUfaGfsc 799 AUACUCCUUGGUCAUGAUAGC AM06859-AS 520 usAfsusAfcUfccuugGfuCfaUfgAfuCfsc 800 UAUACUCCUUGGUCAUGAUCC AM06861-AS 521 usAfsusAfcUfccuugGfuCfaUfgAfuAfsc 801 UAUACUCCUUGGUCAUGAUAC AM06911-AS 522 usAfscsUfcCfuugguCfaUfgAfuAfgGfsg 727 UACUCCUUGGUCAUGAUAGGG AM06796-AS 523 usAfscsUfcCfuugguCfaUfgAfuAfgGfsc 782 UACUCCUUGGUCAUGAUAGGC AM06914-AS 524 asGfscsGfaCfuucauCfuUfuCfuUfcCfsc 772 AGCGACUUCAUCUUUCUUCCC AM06916-AS 525 asGfscsGfaCfuucauCfuUfuCfuUfcCfsg   6 AGCGACUUCAUCUUUCUUCCG AM06918-AS 526 usUfsusAfaAfGfGfaGfaGfgUfgGfcUfcusu 803 UUUAAAGGAGAGGUGGCUCUU AM06920-AS 527 usUfsusAfaAfGfGfaGfaGfgUfgGfcUfgusu 804 UUUAAAGGAGAGGUGGCUGUU AM07073-AS 528 usUfsgAfuAfcUfcCfuUfgGfuCfaUfgsGfsu 805 UUGAUACUCCUUGGUCAUGGU AM07075-AS 529 usUfsgAfuAfcUfcCfuUfgGfuCfaUfgsAfsg 806 UUGAUACUCCUUGGUCAUGAG AM07077-AS 530 usUfsgAfuAfcuccuUfgGfuCfaUfgsGfsc 807 UUGAUACUCCUUGGUCAUGGC AM07079-AS 531 usAfsusCfuUfucuucCfcAfcAfuUfgCfsg 808 UAUCUUUCUUCCCACAUUGCG AM07083-AS 532 usAfsusCfuUfucuucCfcAfcAfuUfgGfsg 809 UAUCUUUCUUCCCACAUUGGG AM07085-AS 533 usCfsaUfcUfuUfcUfuCfcCfaCfaUfusGfsg 810 UCAUCUUUCUUCCCACAUUGG AM07088-AS 534 usCfsaUfcUfuUfcUfuCfcCfaCfaUfusCfsg 811 UCAUCUUUCUUCCCACAUUCG AM07090-AS 535 usCfsaUfcUfuUfcUfuCfcCfaCfaUfcsGfsg 812 UCAUCUUUCUUCCCACAUCGG AM07092-AS 536 usGfsaAfaUfaAfaUfuAfaAfgGfaGfasGfsc 813 UGAAAUAAAUUAAAGGAGAGC AM07096-AS 537 usGfsaAfaUfaAfaUfuAfaAfgGfaGfgsGfsg 814 UGAAAUAAAUUAAAGGAGGGG AM07098-AS 538 usGfsaAfaUfaAfaUfuAfaAfgGfaGfgsGfsc 815 UGAAAUAAAUUAAAGGAGGGC AM07209-AS 539 asGfscGfaCfU.sub.UNAucauCfuUfuCfuUfcsCfsc 772 AGCGACUUCAUCUUUCUUCCC AM07210-AS 540 asGfscGfaCfU.sub.UNAucauCfuUfuCfuUfcsCfsg   6 AGCGACUUCAUCUUUCUUCCG AM07213-AS 541 asGfsC.sub.UNAGfaCfuucauCfuUfuCfuUfcsCfsg   6 AGCGACUUCAUCUUUCUUCCG AM07214-AS 542 asGfscG.sub.UNAaCfuucauCfuUfuCfuUfcsCfsg   6 AGCGACUUCAUCUUUCUUCCG AM07216-AS 543 asGfscGfaCfuucauCfuUfuCfuUfcsCfsu 816 AGCGACUUCAUCUUUCUUCCU AM07390-AS 544 asGfscGfaCfuucauCfuUfuCfuUfcsusu 817 AGCGACUUCAUCUUUCUUCUU AM07392-AS 545 asGfscGfaCfuucauCfuUfuCfUfcsCfsa 818 AGCGACUUCAUCUUUCUUCCA AM07394-AS 546 asGfscGfaCfuucauCfuUfuCfuUfcsGfsg 819 AGCGACUUCAUCUUUCUUCGG AM07396-AS   7 asGfscGfaCfuucauCfuUfuCfuUfcsGfsu   8 AGCGACUUCAUCUUUCUUCGU AM07398-AS 547 asGfscGfaCfuucauCfuUfuCfuUfcsGfsc 820 AGCGACUUCAUCUUUCUUCGC AM07449-AS 548 asGfscGfA.sub.UNACfuucauCfuUfuCfuUfcsCfsg   6 AGCGACUUCAUCUUUCUUCCG AM07487-AS 549 usAfscsuccuugguCfaUfgAfuAfgGfsu   3 UACUCCUUGGUCAUGAUAGGU AM07488-AS 550 usAfscsuccU.sub.UNAugguCfaUfgAfuAfgGfsu   3 UACUCCUUGGUCAUGAUAGGU AM07489-AS 551 asGfscsgacuucauCfuUfuCfuUfcCfsg   6 AGCGACUUCAUCUUUCUUCCG AM07490-AS 552 asGfscsgacU.sub.UNAucauCfuUfuCfuUfcCfsg   6 AGCGACUUCAUCUUUCUUCCG AM07492-AS 553 asGfscGfaCfU.sub.UNAuguaCfuUfuCfuUfcsCfsg 821 AGCGACUUGUACUUUCUUCCG AM07501-AS   9 asGfscsgacuucauCfuUfuCfuUfcGfsu   8 AGCGACUUCAUCUUUCUUCGU AM07576-AS 554 usAfscuccuugguCfaUfgAfuAfgsGfsu   3 UACUCCUUGGUCAUGAUAGGU AM07577-AS 555 usAfscuccU.sub.UNAugguCfaUfgAfuAfgsGfsu   3 UACUCCUUGGUCAUGAUAGGU

(96) TABLE-US-00018 TABLE 4 ASGR1 RNAi Agent Sense Strand Sequences. Sense  SEQ SEQ Strand ID Sense Sequence (Modified) ID Underlying Base Sequence ID: NO. (5′ .fwdarw. 3′) NO. (5′ .fwdarw. 3′) AM05756-SS 556 (NAG31)(invAb)GfuGfgGfaAfGfAfaAfgaugaaguuus(invAb) 822 GUGGGAAGAAAGAUGAAGUUU AM05760-SS 557 (NAG31)(invAb)gcagcuGfCfUfacugguucuauus(invAb) 823 GCAGCUGCUACUGGUUCUAUU AM05923-SS 558 (NAG25)s(invAb)sauGfuGfgGfaAfGfAfaAfgAfuGfaAfgus(invAb) 824 AUGUGGGAAGAAAGAUGAAGU AM05924-SS 559 (NAG25)s(invAb)saugugggaAfGfAfaagaugaagus(invAb) 824 AUGUGGGAAGAAAGAUGAAGU AM05925-SS 560 (NAG25)s(invAb)sgugggaAfGfAfaagaugaagus(invAb) 825 GUGGGAAGAAAGAUGAAGU AM05926-SS 561 (NAG25)s(invAb)sgugggaAfGfAfaagaugaaguuus(invAb) 822 GUGGGAAGAAAGAUGAAGUUU AM05928-SS 562 (NAG25)s(invAb)saugugggaAfGfAfaagaugaagas(invAb) 826 AUGUGGGAAGAAAGAUGAAGA AM06018-SS 563 (NAG25)s(invAb)scccuaucaUfGfAfccaaggagus(invdA) 827 CCCUAUCAUGACCAAGGAGUA AM06019-SS 564 (NAG25)s(invAb)sccuaucaUfGfAfccaaggagus(invdA) 828 CCUAUCAUGACCAAGGAGUA AM06022-SS 565 (NAG25)s(invAb)sgacgggAfCfGfgacuacgags(invdA) 829 GACGGGACGGACUACGAGA AM06024-SS 566 (NAG25)s(invAb)sggagccAfCfCfucuccuuuas(invdA) 830 GGAGCCACCUCUCCUUUAA AM06025-SS 567 (NAG25)s(invAb)scaggagccAfCfCfucuccuuuas(invdA) 831 CAGGAGCCACCUCUCCUUUAA AM06028-SS 568 (NAG25)s(invAb)scacgagCfGfCfagcugcuacs(invdA) 832 CACGAGCGCAGCUGCUACA AM06031-SS 569 (NAG25)s(invAb)sagcaacuuCfAfCfagcgagcacs(invdA) 833 AGCAACUUCACAGCGAGCACA AM06032-SS 570 (NAG25)s(invAb)scagcaacuuCfAfCfagcgagcacs(invdA) 834 CAGCAACUUCACAGCGAGCACA AM06034-SS 571 (NAG25)s(invAb)sgaggagagUfGfAfccaccaucas(invdA) 835 GAGGAGAGUGACCACCAUCAA AM06173-SS 572 (NAG25)s(invAb)sggagagUfGfAfccaccaucas(invdA) 836 GGAGAGUGACCACCAUCAA AM06174-SS 573 (NAG25)sgsaggagagUfGfAfccaccaucas(invdA) 835 GAGGAGAGUGACCACCAUCAA AM06177-SS 574 (NAG25)s(invAb)scgcuggAfAfCfgacgacgucs(invdA) 837 CGCUGGAACGACGACGUCA AM06178-SS 575 (NAG25)s(invAb)scgcuggAfAfCfgacgacgucus(invAb) 838 CGCUGGAACGACGACGUCU AM06181-SS 576 (NAG25)sgsagagugaCfCfAfccaucagcus(invdA) 839 GAGAGUGACCACCAUCAGCUA AM06182-SS 577 (NAG25)s(invAb)sgagugaCfCfAfccaucagcus(invdA) 840 GAGUGACCACCAUCAGCUA AM06184-SS 578 (NAG25)s(invAb)sgcuccaGfGfGfcaauggcucs(invdA) 841 GCUCCAGGGCAAUGGCUCA AM06187-SS 579 (NAG25)s(invAb)saccuggUfGfGfuggucacgus(invdA) 842 ACCUGGUGGUGGUCACGUA AM06188-SS 580 (NAG25)sgscaccuggUfGfGfuggucacgus(invdA) 843 GCACCUGGUGGUGGUCACGUA AM06190-SS 581 (NAG25)s(invAb)scugcucCfAfCfgugaagcags(invdA) 844 CUGCUCCACGUGAAGCAGA AM06194-SS 582 (NAG25)s(invAb)sgugggaAfGfAfaagaugaagas(invAb) 845 GUGGGAAGAAAGAUGAAGA AM06255-SS 583 (NAG37)s(invAb)sccuaucaUfGfAfccaaggagus(invdA) 828 CCUAUCAUGACCAAGGAGUA AM06256-SS 584 (NAG37)s(invAb)scuaucaUfGfAfccaaggagus(invdA) 846 CUAUCAUGACCAAGGAGUA AM06257-SS 585 (NAG37)s(invAb)scccuaucaUfGfAfccaaggagus(invdA) 827 CCCUAUCAUGACCAAGGAGUA AM06258-SS 586 (NAG37)sgscccuaucaUfGfAfccaaggagus(invdA) 847 GCCCUAUCAUGACCAAGGAGUA AM06259-SS 587 (NAG37)s(invAb)sgcccuaucaUfGfAfccaaggagus(invdA) 847 GCCCUAUCAUGACCAAGGAGUA AM06260-SS 588 (NAG37)(invAb)ccuaucaUfGfAfccaaggagu(invdA) 828 CCUAUCAUGACCAAGGAGUA AM06440-SS 589 (NAG37)s(invAb)sgugggaAfGfAfaagaugaagus(invAb) 825 GUGGGAAGAAAGAUGAAGU AM06441-SS 590 (NAG37)s(invAb)sggagccAfCfCfucuccuuuas(invdA) 830 GGAGCCACCUCUCCUUUAA AM06449-SS 591 (NAG37)sgsgagccAfCfCfucuccuuuas(invdA) 830 GGAGCCACCUCUCCUUUAA AM06450-SS 592 (NAG37)scsaggagccAfCfCfucuccuuuas(invdA) 831 CAGGAGCCACCUCUCCUUUAA AM06451-SS 593 (NAG37)scscaggagccAfCfCfucuccuuuas(invdA) 848 CCAGGAGCCACCUCUCCUUUAA AM06458-SS 594 (NAG37)s(invAb)sgugggaAfGfAfaagaugaagas(invAb) 845 GUGGGAAGAAAGAUGAAGA AM06574-SS 595 (NAG37)s(invAb)scgcuggAfAfCfgacgacgucus(invAb) 838 CGCUGGAACGACGACGUCU AM06576-SS 596 (NAG37)s(invAb)scgcuggAfAfCfgacgaugucus(invAb) 849 CGCUGGAACGACGAUGUCU AM06577-SS 597 (NAG37)s(invAb)scgcuggAfAfCfgacgacgucas(invAb) 837 CGCUGGAACGACGACGUCA AM06580-SS 598 (NAG37)s(invAb)sgacgggAfCfGfgacuacgagas(invAb) 829 GACGGGACGGACUACGAGA AM06583-SS 599 (NAG37)s(invAb)sgacgggAfCfGfgacuacgagus(invAb) 850 GACGGGACGGACUACGAGU AM06585-SS 600 (NAG37)s(invAb)sgacgggAfCfGfgacuacgagauus(invAb) 851 GACGGGACGGACUACGAGAUU AM06597-SS 601 (NAG37)s(invAb)scccuaucaUfGfAfccaaggaguas(invAb) 827 CCCUAUCAUGACCAAGGAGUA AM06600-SS 602 (NAG37)s(invAb)saccuaucaUfGfAfccaaggaguas(invAb)  13 ACCUAUCAUGACCAAGGAGUA AM06640-SS 603 (NAG37)s(invAb)scuaucaUfGfAfccaaggaguauus(invAb) 853 CUAUCAUGACCAAGGAGUAUU AM06644-SS 604 (NAG37)s(invAb)sccugcugcUfCfCfacgugaagcas(invAb) 854 CCUGCUGCUCCACGUGAAGCA AM06646-SS 605 (NAG37)s(invAb)saggccuccAfCfGfaccaaaacgas(invAb) 855 AGGCCUCCACGACCAAAACGA AM06648-SS 606 (NAG37)s(invAb)sccagggagGfCfAfaugugggaaas(invAb) 856 CCAGGGAGGCAAUGUGGGAAA AM06650-SS 607 (NAG37)s(invAb)scgagcgcaGfCfUfgcuacugguus(invAb) 857 CGAGCGCAGCUGCUACUGGUU AM06652-SS 608 (NAG37)s(invAb)sagcgcaGfCfUfgcuacugguuuus(invAb) 858 AGCGCAGCUGCUACUGGUUUU AM06654-SS 609 (NAG37)s(invAb)scugacgccGfAfCfaacuacugcas(invAb) 859 CUGACGCCGACAACUACUGCA AM06656-SS 610 (NAG37)s(invAb)sccugguggUfGfGfucacguccuas(invAb) 860 CCUGGUGGUGGUCACGUCCUA AM06658-SS 611 (NAG37)s(invAb)sgagcagaaAfUfUfuguccagcaas(invAb) 861 GAGCAGAAAUUUGUCCAGCAA AM06660-SS 612 (NAG37)s(invAb)sguggacggGfAfCfggacuacgaas(invAb) 862 GUGGACGGGACGGACUACGAA AM06662-SS 613 (NAG37)s(invAb)sagacgggaCfGfGfacuacgagaas(invAb) 863 AGACGGGACGGACUACGAGAA AM06664-SS 614 (NAG37)s(invAb)saacagccgGfAfCfgacugguacas(invAb) 864 AACAGCCGGACGACUGGUACA AM06666-SS 615 (NAG37)s(invAb)scgcuggAfAfCfgacgacgucuuus(invAb) 865 CGCUGGAACGACGACGUCUUU AM06668-SS 616 (NAG37)s(invAb)scugcuccaCfGfUfgaagcaguuas(invAb) 866 CUGCUCCACGUGAAGCAGUUA AM06670-SS 617 (NAG37)s(invAb)sagggaggcAfAfUfgugggaagaas(invAb) 867 AGGGAGGCAAUGUGGGAAGAA AM06672-SS 618 (NAG37)s(invAb)sggaggcAfAfUfgugggaagaauus(invAb) 868 GGAGGCAAUGUGGGAAGAAUU AM06674-SS 619 (NAG37)s(invAb)sgggaagaaAfGfAfugaagucgcas(invAb) 869 GGGAAGAAAGAUGAAGUCGCA AM06676-SS 620 (NAG37)s(invAb)sgggaagaaAfGfAfugaagucgcus(invAb) 870 GGGAAGAAAGAUGAAGUCGCU AM06678-SS 621 (NAG37)s(invAb)saggagccaCfCfUfcuccuuuaaas(invAb) 871 AGGAGCCACCUCUCCUUUAAA AM06680-SS 622 (NAG37)s(invAb)saggagccaCfCfUfcuccuuuaaus(invAb) 872 AGGAGCCACCUCUCCUUUAAU AM06682-SS 623 (NAG37)s(invAb)sggagccacCfUfCfuccuuuaauus(invAb) 873 GGAGCCACCUCUCCUUUAAUU AM06684-SS 624 (NAG37)s(invAb)sGfgAfgCfcAfcCfUfCfuCfcUfuUfaAfuus 873 GGAGCCACCUCUCCUUUAAUU (invAb) AM06686-SS 625 (NAG37)s(invAb)sgagcgcagCfUfGfcuacugguuas(invAb) 874 GAGCGCAGCUGCUACUGGUUA AM06688-SS 626 (NAG37)s(invAb)sugggucugCfGfAfgacagagcuas(invAb) 875 UGGGUCUGCGAGACAGAGCUA AM06702-SS 627 (NAG37)s(invAb)sgugggaAfGfUfuugaugaagas(invAb) 876 GUGGGAAGUUUGAUGAAGA AM06704-SS 628 (NAG37)s(invAb)sccuaucaUfGfUfggaaggagus(invdA) 877 CCUAUCAUGUGGAAGGAGUA AM06706-SS 629 (NAG37)s(invAb)saugugggaAfGfAfaagaugaagus(invAb) 824 AUGUGGGAAGAAAGAUGAAGU AM06707-SS 630 (NAG37)s(invAb)sgugugggaAfGfAfaagaugaagus(invAb) 878 GUGUGGGAAGAAAGAUGAAGU AM06709-SS 631 (NAG37)s(invAb)sgcgugggaAfGfAfaagaugaagus(invAb)  18 GCGUGGGAAGAAAGAUGAAGU AM06754-SS 632 (NAG37)gscgugggaAfGfAfaagaugaagus(invAb)  18 GCGUGGGAAGAAAGAUGAAGU AM06755-SS 633 (NAG37)gsccugggaAfGfAfaagaugaagus(invAb) 880 GCCUGGGAAGAAAGAUGAAGU AM06795-SS 634 (NAG37)s(invAb)sgccuaucaUfGfAfccaaggaguas(invAb) 881 GCCUAUCAUGACCAAGGAGUA AM06797-SS 635 (NAG37)s(invAb)sggcuaucaUfGfAfccaaggaguas(invAb) 882 GGCUAUCAUGACCAAGGAGUA AM06802-SS 636 (NAG37)s(invAb)saccuaucaUfGfAfccaaggaivas(invAb)  12 ACCUAUCAUGACCAAGGAIUA AM06803-SS 637 (NAG37)s(invAb)saccuaucaUfGfAfccaagiaguas(invAb) 884 ACCUAUCAUGACCAAGIAGUA AM06804-SS 638 (NAG37)s(invAb)saccuaucaUfGfAfccaaigaguas(invAb) 885 ACCUAUCAUGACCAAIGAGUA AM06805-SS 639 (NAG37)s(invAb)saccuaucaUfGfAfccaaigaiuas(invAb)  14 ACCUAUCAUGACCAAIGAIUA AM06807-SS 640 (NAG37)s(invAb)saccuaucaUfGfAfccaaggaguus(invAb) 887 ACCUAUCAUGACCAAGGAGUU AM06809-SS 641 (NAG37)s(invAb)sugcugcUfCfCfacgugaagcauus(invAb) 888 UGCUGCUCCACGUGAAGCAUU AM06811-SS 642 (NAG37)s(invAb)sugcugcUfCfCfacgugaaicauus(invAb) 889 UGCUGCUCCACGUGAAICAUU AM06812-SS 643 (NAG37)s(invAb)sugcugcUfCfCfacguiaagcauus(invAb) 890 UGCUGCUCCACGUIAAGCAUU AM06813-SS 644 (NAG37)s(invAb)sugcugcUfCfCfacguiaaicauus(invAb) 891 UGCUGCUCCACGUIAAICAUU AM06814-SS 645 (NAG37)s(invAb)scggaagaaAfGfAfugaagucicus(invAb)  15 CGGAAGAAAGAUGAAGUCICU AM06816-SS 646 (NAG37)s(invAb)scggaagaaAfGfAfugaaiucgcus(invAb) 893 CGGAAGAAAGAUGAAIUCGCU AM06817-SS 647 (NAG37)s(invAb)scggaagaaAfGfAfugaaiucicus(invAb)  31 CGGAAGAAAGAUGAAIUCICU AM06818-SS 648 (NAG37)s(invAb)scggaagaaAfGfAfugaagucgcus(invAb)  33 CGGAAGAAAGAUGAAGUCGCU AM06819-SS 649 (NAG37)s(invAb)sgcccuaucAfUfGfaccaaggagus(invAb) 896 GCCCUAUCAUGACCAAGGAGU AM06821-SS 650 (NAG37)s(invAb)sggcaauguGfGfGfaagaaagauas(invAb) 897 GGCAAUGUGGGAAGAAAGAUA AM06823-SS 651 (NAG37)s(invAb)sugggaagaAfAfGfaugaagucgas(invAb) 898 UGGGAAGAAAGAUGAAGUCGA AM06825-SS 652 (NAG37)s(invAb)sugcuccAfCfGfugaagcaguuuus(invAb) 899 UGCUCCACGUGAAGCAGUUUU AM06827-SS 653 (NAG37)s(invAb)succacgUfGfAfagcaguucguuus(invAb) 900 UCCACGUGAAGCAGUUCGUUU AM06829-SS 654 (NAG37)s(invAb)sggaggagcAfGfAfaauuuguccas(invAb) 901 GGAGGAGCAGAAAUUUGUCCA AM06831-SS 655 (NAG37)s(invAb)saucaugacCfAfAfggaguaucaas(invAb) 902 AUCAUGACCAAGGAGUAUCAA AM06833-SS 656 (NAG37)s(invAb)sgaggcaauGfUfGfggaagaaagas(invAb) 903 GAGGCAAUGUGGGAAGAAAGA AM06835-SS 657 (NAG37)s(invAb)sgcaaugugGfGfAfagaaagaugas(invAb) 904 GCAAUGUGGGAAGAAAGAUGA AM06837-SS 658 (NAG37)s(invAb)sccucuccuUfUfAfauuuauuucas(invAb)  35 CCUCUCCUUUAAUUUAUUUCA AM06839-SS 659 (NAG37)s(invAb)sccgcuccuUfUfAfauuuauuucas(invAb) 906 CCGCUCCUUUAAUUUAUUUCA AM06841-SS 660 (NAG37)s(invAb)sccgcuccuUfUfAfauuuauuucus(invAb) 907 CCGCUCCUUUAAUUUAUUUCU AM06852-SS 661 (NAG37)s(invAb)sacagcccuAfUfCfaugaccaagas(invAb) 908 ACAGCCCUAUCAUGACCAAGA AM06854-SS 662 (NAG37)s(invAb)sacccuaucAfUfGfaccaaggagus(invAb) 909 ACCCUAUCAUGACCAAGGAGU AM06856-SS 663 (NAG37)s(invAb)sgcuaucauGfAfCfcaaggaguaus(invAb) 910 GCUAUCAUGACCAAGGAGUAU AM06858-SS 664 (NAG37)s(invAb)sggaucaugAfCfCfaaggaguauas(invAb) 911 GGAUCAUGACCAAGGAGUAUA AM06860-SS 665 (NAG37)s(invAb)sguaucaugAfCfCfaaggaguauas(invAb) 912 GUAUCAUGACCAAGGAGUAUA AM06909-SS 666 (NAG37)asccuaucaUfGfAfccaaggaguas(invAb)  13 ACCUAUCAUGACCAAGGAGUA AM06910-SS 667 (NAG37)csccuaucaUfGfAfccaaggaguas(invAb) 827 CCCUAUCAUGACCAAGGAGUA AM06912-SS 668 (NAG37)gsccuaucaUfGfAfccaaggaguas(invAb) 881 GCCUAUCAUGACCAAGGAGUA AM06913-SS 669 (NAG37)gsggaagaaAfGfAfugaagucgcus(invAb) 870 GGGAAGAAAGAUGAAGUCGCU AM06915-SS 670 (NAG37)csggaagaaAfGfAfugaagucgcus(invAb)  33 CGGAAGAAAGAUGAAGUCGCU AM06917-SS 671 (NAG37)s(invAb)sgagccaCfCfUfcuccuuuaaauus(invAb) 913 GAGCCACCUCUCCUUUAAAUU AM06919-SS 672 (NAG37)s(invAb)scagccaCfCfUfcuccuuuaaauus(invAb) 914 CAGCCACCUCUCCUUUAAAUU AM06921-SS 673 (NAG37)gsagccaCfCfUfcuccuuuaaauus(invAb) 913 GAGCCACCUCUCCUUUAAAUU AM06930-SS 674 (NAG37)s(invAb)saccuaucaUfGfAfcCaaggaguas(invAb)  13 ACCUAUCAUGACCAAGGAGUA AM06931-SS 675 (NAG37)asccuaucaUfGfAfcCaaggaguas(invAb)  13 ACCUAUCAUGACCAAGGAGUA AM06935-SS 676 (NAG37)s(invAb)scggaagaaAfGfAfugaagucpu_2Ncus(invAb) 915 CGGAAGAAAGAUGAAGUC(pu.sup.2N)CU AM06936-SS 677 (NAG37)s(invAb)scggaagaaAfGfAfugaagucacus(invAb) 916 CGGAAGAAAGAUGAAGUCACU AM06937-SS 678 (NAG37)s(invAb)scggaagaaAfGfAfugaagucucus(invAb) 917 CGGAAGAAAGAUGAAGUCUCU AM06938-SS 679 (NAG37)s(invAb)scggaagaaAfGfAfugaagucccus(invAb) 918 CGGAAGAAAGAUGAAGUCCCU AM06939-SS 680 (NAG37)s(invAb)scggaagaaAfGfAfuGaagucicus(invAb)  15 CGGAAGAAAGAUGAAGUCICU AM06940-SS 681 (NAG37)s(invAb)scggaagaaAfGfAfUgaagucicus(invAb)  15 CGGAAGAAAGAUGAAGUCICU AM06941-SS 682 (NAG37)s(invAb)scggaagaaAfGfAfudGaagucicus(invAb)  15 CGGAAGAAAGAUGAAGUCICU AM07072-SS 683 (NAG37)s(invAb)saccaugacCfAfAfggaguaucaas(invAb) 919 ACCAUGACCAAGGAGUAUCAA AM07074-SS 684 (NAG37)s(invAb)scucaugacCfAfAfggaguaucaas(invAb) 920 CUCAUGACCAAGGAGUAUCAA AM07076-SS 685 (NAG37)s(invAb)sgccaugacCfAfAfggaguaucaas(invAb) 921 GCCAUGACCAAGGAGUAUCAA AM07078-SS 686 (NAG37)s(invAb)scgcaauguGfGfGfaagaaagauas(invAb) 922 CGCAAUGUGGGAAGAAAGAUA AM07080-SS 687 (NAG37)s(invAb)scgcaauguGfiGfaagaaagauas(invAb) 923 CGCAAUGUGIGAAGAAAGAUA AM07081-SS 688 (NAG37)s(invAb)scgcaauguiGfGfaagaaagauas(invAb) 924 CGCAAUGUIGGAAGAAAGAUA AM07082-SS 689 (NAG37)s(invAb)scccaauguGfGfGfaagaaagauas(invAb) 925 CCCAAUGUGGGAAGAAAGAUA AM07084-SS 690 (NAG37)s(invAb)sccaaugugGfGfAfagaaagaugas(invAb) 926 CCAAUGUGGGAAGAAAGAUGA AM07086-SS 691 (NAG37)s(invAb)sccaauguiGfGfAfagaaagaugas(invAb) 927 CCAAUGUIGGAAGAAAGAUGA AM07087-SS 692 (NAG37)s(invAb)scgaaugugGfGfAfagaaagaugas(invAb) 928 CGAAUGUGGGAAGAAAGAUGA AM07089-SS 693 (NAG37)s(invAb)sccgaugugGfGfAfagaaagaugas(invAb) 929 CCGAUGUGGGAAGAAAGAUGA AM07091-SS 694 (NAG37)s(invAb)sgcucuccuUfUfAfauuuauuucas(invAb) 930 GCUCUCCUUUAAUUUAUUUCA AM07093-SS 695 (NAG37)s(invAb)sgcucuccuUfUfAfauuua_2Nuuucas(invAb) 931 GCUCUCCUUUAAUUU(A.sup.2N)UUUCA AM07094-SS 696 (NAG37)s(invAb)sgcucuccuUfUfAfa_2Nuuuauuucas(invAb) 932 GCUCUCCUUUA(A.sup.2N)UUUAUUUCA AM07095-SS 697 (NAG37)s(invAb)sccccuccuUfUfAfauuuauuucas(invAb) 933 CCCCUCCUUUAAUUUAUUUCA AM07097-SS 698 (NAG37)s(invAb)sgcccuccuUfUfAfauuuauuucas(invAb) 934 GCCCUCCUUUAAUUUAUUUCA AM07109-SS 699 (NAG37)s(invAb)saccuaucaUfGfAfcCaaggaiuas(invAb)  12 ACCUAUCAUGACCAAGGAIUA AM07110-SS 700 (NAG37)s(invAb)saccuaucaUfGfAfcCaaigaiuas(invAb)  14 ACCUAUCAUGACCAAIGAIUA AM07211-SS 701 (NAG37)s(invAb)scggaagaaAfGfAfudGaagucgcus(invAb)  33 CGGAAGAAAGAUGAAGUCGCU AM07212-SS 702 (NAG37)s(invAb)scggaagaaAfGfAfuGaagucgcus(invAb)  33 CGGAAGAAAGAUGAAGUCGCU AM07215-SS 703 (NAG37)s(invAb)saggaagaaAfGfAfugaagucicus(invAb) 935 AGGAAGAAAGAUGAAGUCICU AM07388-SS 704 (NAG37)csggaagaaAfGfAfudGaagucgcus(invAb) 33 CGGAAGAAAGAUGAAGUCGCU AM07389-SS 705 (NAG37)s(invAb)sgaagaaAfGfAfugaagucicuuus(invAb) 936 GAAGAAAGAUGAAGUCICUUU AM07391-SS 706 (NAG37)s(invAb)suggaagaaAfGfAfugaagucicus(invAb) 937 UGGAAGAAAGAUGAAGUCICU AM07393-SS 707 (NAG37)s(invAb)sccgaagaaAfGfAfugaagucicus(invAb) 938 CCGAAGAAAGAUGAAGUCICU AM07395-SS 708 (NAG37)s(invAb)sacgaagaaAfGfAfugaagucicus(invAb)  16 ACGAAGAAAGAUGAAGUCICU AM07397-SS 709 (NAG37)s(invAb)sgcgaagaaAfGfAfugaagucicus(invAb) 940 GCGAAGAAAGAUGAAGUCICU AM07414-SS 710 (NAG37)s(invAb)scggaagaaAfGfAfudGaA.sub.UNAgucgcus(invAb)  33 CGGAAGAAAGAUGAAGUCGCU AM07444-SS 711 (NAG37)s(invAb)scggaagaaAfGfAfugaA.sub.UNAgucgcus(invAb)  33 CGGAAGAAAGAUGAAGUCGCU AM07445-SS 712 (NAG37)s(invAb)scggaagaaAfGfAfugaA.sub.UNAgucicus(invAb)  15 CGGAAGAAAGAUGAAGUCICU AM07446-SS 713 (NAG37)s(invAb)scggaagaaAfGfAfuGaA.sub.UNAgucgcus(invAb)  33 CGGAAGAAAGAUGAAGUCGCU AM07447-SS 714 (NAG37)s(invAb)scggaagaaAfGfAfudGaA.sub.UNAgucicus(invAb)  15 CGGAAGAAAGAUGAAGUCICU AM07448-SS 715 (NAG37)s(invAb)scggaagaaAfGfAfugaagU.sub.UNAcgcus(invAb)  33 CGGAAGAAAGAUGAAGUCGCU AM07450-SS 716 (NAG37)s(invAb)scggaagaaAfGfAfdTgaagucgcus(invAb) 941 CGGAAGAAAGATGAAGUCGCU AM07451-SS 717 (NAG37)s(invAb)saccuaucaUfGfAfcdCaaggaguas(invAb)  13 ACCUAUCAUGACCAAGGAGUA AM07452-SS 718 (NAG37)s(invAb)saccuaucaUfGfAfcdCaaggaiuas(invAb)  12 ACCUAUCAUGACCAAGGAIUA AM07491-SS 719 (NAG33)s(invAb)scggaagaaAfGfUfadCaagucgcus(invAb) 943 CGGAAGAAAGUACAAGUCGCU AM07494-SS 720 (NAG33)s(invAb)scggaagaaAfGfAfudGaagucgcus(invAb)  33 CGGAAGAAAGAUGAAGUCGCU AM07500-SS 721 (NAG37)s(invAb)sacgaagaaAfGfAfugaagucgcus(invAb)  17 ACGAAGAAAGAUGAAGUCGCU (A.sup.2N) = 2-aminoadenine nucleotide (pu.sup.2N) = 2-aminopurine nucleotide

(97) The ASGR1 RNAi agents described herein are formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence listed in Table 2 or Table 4 can be hybridized to any antisense strand containing a sequence listed in Table 2 or Table 3, provided the two sequences have a region of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence.

(98) In some embodiments, the antisense strand of an ASGR1 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 3. In some embodiments, the sense strand of an ASGR1 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 4.

(99) In some embodiments, an ASGR1 RNAi agent antisense strand comprises a nucleotide sequence of any of the sequences in Table 2 or Table 3. In some embodiments, an ASGR1 RNAi agent antisense strand comprises the sequence of nucleotides (from 5′ end.fwdarw.3′ end) 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, 2-24, 1-25, 2-25, 1-26, or 2-26 of any of the sequences in Table 2 or Table 3. In certain embodiments, an ASGR1 RNAi agent antisense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 3.

(100) In some embodiments, an ASGR1 RNAi agent sense strand comprises the nucleotide sequence of any of the sequences in Table 2 or Table 4. In some embodiments, an ASGR1 RNAi agent sense strand comprises the sequence of nucleotides (from 5′ end.fwdarw.3′ end) 1-17, 2-17, 3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 4-20, 1-21, 2-21, 3-21, 4-21, 1-22, 2-22, 3-22, 4-22, 1-23, 2-23, 3-23, 4-23, 1-24, 2-24, 3-24, 4-24, 1-25, 2-25, 3-25, 4-25, 1-26, 2-26, 3-26, or 4-26 of any of the sequences in Table 2 or Table 4. In certain embodiments, an ASGR1 RNAi agent sense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 4.

(101) For the ASGR1 RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (from 5′ end.fwdarw.3′ end) can be perfectly complementary to an ASGR1 gene, or can be non-complementary to an ASGR1 gene. In some embodiments, the nucleotide at position 1 of the antisense strand (from 5′ end.fwdarw.3′ end) is a U, A, or dT (or a modified version thereof).

(102) In some embodiments, the nucleotide at position 1 of the antisense strand (from 5′ end.fwdarw.3′ end) forms an A:U or U:A base pair with the sense strand.

(103) In some embodiments, an ASGR1 RNAi agent antisense strand comprises the sequence of nucleotides (from 5′ end.fwdarw.3′ end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, an ASGR1 RNAi sense strand comprises the sequence of nucleotides (from 5′ end.fwdarw.3′ end) 1-17 or 1-18 of any of the sense strand sequences in Table 2 or Table 4.

(104) In some embodiments, an ASGR1 RNAi agent includes (i) an antisense strand comprising the sequence of nucleotides (from 5′ end.fwdarw.3′ end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2 or Table 3, and (ii) a sense strand comprising the sequence of nucleotides (from 5′ end.fwdarw.3′ end) 1-17 or 1-18 of any of the sense strand sequences in Table 2 or Table 4.

(105) A sense strand containing a sequence listed in Table 2 or Table 4 can be hybridized to any antisense strand containing a sequence listed in Table 2 or Table 3, provided the two sequences have a region of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence. In some embodiments, the ASGR1 RNAi agent has a sense strand consisting of the modified sequence of any of the modified sequences in Table 4, and an antisense strand consisting of the modified sequence of any of the modified sequences in Table 3. Representative sequence pairings are exemplified by the Duplex ID Nos. shown in Table 5.

(106) In some embodiments, an ASGR1 RNAi agent comprises any of the duplexes represented by any of the Duplex ID Nos. presented herein. In some embodiments, an ASGR1 RNAi agent consists of any of the duplexes represented by any of the Duplex ID Nos. presented herein. In some embodiments, an ASGR1 RNAi agent comprises the sense strand and antisense strand nucleotide sequences of any of the duplexes represented by any of the Duplex ID Nos. presented herein. In some embodiments, an ASGR1 RNAi agent comprises the sense strand and antisense strand nucleotide sequences of any of the duplexes represented by any of the Duplex ID Nos. presented herein and a targeting group and/or linking group, wherein the targeting group and/or linking group is covalently linked (i.e. conjugated) to the sense strand or the antisense strand. In some embodiments, an ASGR1 RNAi agent comprises a sense strand and an antisense strand having the modified nucleotide sequences of any of the duplexes represented by any of the Duplex ID Nos. presented herein. In some embodiments, an ASGR1 RNAi agent comprises a sense strand and an antisense strand having the modified nucleotide sequences of any of the duplexes represented by any of the Duplex ID Nos. presented herein and a targeting group and/or linking group, wherein the targeting group and/or linking group is covalently linked to the sense strand or the antisense strand.

(107) In some embodiments, an ASGR1 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand/sense strand duplexes of Table 2 or Table 5, and further comprises a targeting group. In some embodiments, an ASGR1 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand/sense strand duplexes of Table 2 or Table 5, and further comprises an asialoglycoprotein receptor ligand targeting group.

(108) In some embodiments, an ASGR1 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand/sense strand duplexes of Table 2 or Table 5, and further comprises a targeting group selected from the group consisting of (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s, each as defined in Table 6. In some embodiments, the targeting group is (NAG25) or (NAG25)s as defined in Table 6. In other embodiments, the targeting group is (NAG37) or (NAG37)s as defined in Table 6.

(109) In some embodiments, an ASGR1 RNAi agent comprises an antisense strand and a sense strand having the modified nucleotide sequence of any of the antisense strand and/or sense strand nucleotide sequences of any of the duplexes of Table 5.

(110) In some embodiments, an ASGR1 RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any of the antisense strand and/or sense strand nucleotide sequences of any of the duplexes of Table 5, and comprises an asialoglycoprotein receptor ligand targeting group.

(111) In some embodiments, an ASGR1 RNAi agent comprises any of the duplexes of Table 2 or Table 5. In certain embodiments, an ASGR1 RNAi agent comprises a duplex selected from the group consisting of AD05126, AD05150, AD05183, AD05186, AD05193, AD05195, AD05196, AD05206, AD05209, AD05256, AD05374, AD05609, and AD05692 or a salt thereof.

(112) In some embodiments, an ASGR1 RNAi agent consists of any of the duplexes of Table 2 or Table 5. In certain embodiments, an ASGR1 RNAi agent consists of a duplex selected from the group consisting of AD05126, AD05150, AD05183, AD05186, AD05193, AD05195, AD05196, AD05206, AD05209, AD05256, AD05374, AD05609, and AD05692 or a salt thereof.

(113) TABLE-US-00019 TABLE 5 ASGR1 RNAi Agent Duplexes Identified by Duplex ID No. with Corresponding Sense and Antisense Strands. Duplex ID Antisense Strand ID Sense Strand ID AD04518 AM05757-AS AM05756-SS AD04519 AM05761-AS AM05760-SS AD04629 AM05919-AS AM05923-SS AD04630 AM05920-AS AM05924-SS AD04631 AM05921-AS AM05924-SS AD04632 AM05921-AS AM05925-SS AD04633 AM05921-AS AM05926-SS AD04634 AM05757-AS AM05925-SS AD04635 AM05922-AS AM05924-SS AD04636 AM05927-AS AM05928-SS AD04697 AM06016-AS AM06018-SS AD04698 AM06017-AS AM06019-SS AD04699 AM06020-AS AM06022-SS AD04700 AM06021-AS AM06022-SS AD04701 AM06023-AS AM06024-SS AD04702 AM06023-AS AM06025-SS AD04703 AM06026-AS AM06028-SS AD04704 AM06027-AS AM06028-SS AD04705 AM06029-AS AM06031-SS AD04706 AM06030-AS AM06032-SS AD04707 AM06033-AS AM06034-SS AD04791 AM06172-AS AM06173-SS AD04792 AM06033-AS AM06174-SS AD04793 AM06175-AS AM06177-SS AD04794 AM06176-AS AM06178-SS AD04795 AM06179-AS AM06181-SS AD04796 AM06180-AS AM06182-SS AD04797 AM06183-AS AM06184-SS AD04798 AM06185-AS AM06187-SS AD04799 AM06186-AS AM06188-SS AD04800 AM06189-AS AM06190-SS AD04801 AM06192-AS AM05925-SS AD04802 AM06193-AS AM06194-SS AD04810 AM06200-AS AM06194-SS AD04811 AM06201-AS AM06194-SS AD04847 AM06017-AS AM06255-SS AD04848 AM06248-AS AM06255-SS AD04849 AM06249-AS AM06255-SS AD04850 AM06250-AS AM06256-SS AD04851 AM06251-AS AM06256-SS AD04852 AM06016-AS AM06257-SS AD04853 AM06252-AS AM06258-SS AD04854 AM06252-AS AM06259-SS AD04855 AM06253-AS AM06260-SS AD04856 AM06254-AS AM06255-SS AD04964 AM05757-AS AM06440-SS AD04965 AM06023-AS AM06441-SS AD04966 AM06442-AS AM06441-SS AD04967 AM06443-AS AM06441-SS AD04968 AM06444-AS AM06441-SS AD04969 AM06445-AS AM06441-SS AD04970 AM06446-AS AM06441-SS AD04971 AM06447-AS AM06441-SS AD04972 AM06447-AS AM06449-SS AD04973 AM06023-AS AM06450-SS AD04974 AM06448-AS AM06451-SS AD04975 AM06193-AS AM06458-SS AD05046 AM06575-AS AM06574-SS AD05047 AM06575-AS AM06576-SS AD05048 AM06578-AS AM06577-SS AD05049 AM06579-AS AM06577-SS AD05050 AM06581-AS AM06580-SS AD05051 AM06582-AS AM06580-SS AD05052 AM06584-AS AM06583-SS AD05053 AM06581-AS AM06585-SS AD05054 AM06586-AS AM06583-SS AD05065 AM06598-AS AM06597-SS AD05066 AM06599-AS AM06597-SS AD05067 AM06601-AS AM06600-SS AD05089 AM06639-AS AM06597-SS AD05090 AM06641-AS AM06640-SS AD05092 AM06643-AS AM06597-SS AD05093 AM06645-AS AM06644-SS AD05094 AM06647-AS AM06646-SS AD05095 AM06649-AS AM06648-SS AD05096 AM06651-AS AM06650-SS AD05097 AM06653-AS AM06652-SS AD05098 AM06655-AS AM06654-SS AD05099 AM06657-AS AM06656-SS AD05100 AM06659-AS AM06658-SS AD05101 AM06661-AS AM06660-SS AD05102 AM06663-AS AM06662-SS AD05103 AM06665-AS AM06664-SS AD05104 AM06667-AS AM06666-SS AD05105 AM06669-AS AM06668-SS AD05106 AM06671-AS AM06670-SS AD05107 AM06673-AS AM06672-SS AD05108 AM06675-AS AM06674-SS AD05109 AM06677-AS AM06676-SS AD05110 AM06679-AS AM06678-SS AD05111 AM06681-AS AM06680-SS AD05112 AM06683-AS AM06682-SS AD05113 AM06685-AS AM06684-SS AD05114 AM06687-AS AM06686-SS AD05115 AM06689-AS AM06688-SS AD05122 AM06703-AS AM06702-SS AD05123 AM06705-AS AM06704-SS AD05124 AM05921-AS AM06706-SS AD05125 AM06708-AS AM06707-SS AD05126 AM06710-AS AM06709-SS AD05150 AM06710-AS AM06754-SS AD05151 AM06756-AS AM06755-SS AD05180 AM06796-AS AM06795-SS AD05181 AM06798-AS AM06797-SS AD05182 AM06799-AS AM06600-SS AD05183 AM06601-AS AM06802-SS AD05184 AM06601-AS AM06803-SS AD05185 AM06601-AS AM06804-SS AD05186 AM06601-AS AM06805-SS AD05187 AM06806-AS AM06804-SS AD05188 AM06808-AS AM06807-SS AD05189 AM06810-AS AM06809-SS AD05190 AM06810-AS AM06811-SS AD05191 AM06810-AS AM06812-SS AD05192 AM06810-AS AM06813-SS AD05193 AM06815-AS AM06814-SS AD05194 AM06815-AS AM06816-SS AD05195 AM06815-AS AM06817-SS AD05196 AM06815-AS AM06818-SS AD05197 AM06820-AS AM06819-SS AD05198 AM06822-AS AM06821-SS AD05199 AM06824-AS AM06823-SS AD05200 AM06826-AS AM06825-SS AD05201 AM06828-AS AM06827-SS AD05202 AM06830-AS AM06829-SS AD05203 AM06832-AS AM06831-SS AD05204 AM06834-AS AM06833-SS AD05205 AM06836-AS AM06835-SS AD05206 AM06838-AS AM06837-SS AD05207 AM06840-AS AM06839-SS AD05208 AM06842-AS AM06841-SS AD05209 AM06851-AS AM06600-SS AD05210 AM06853-AS AM06852-SS AD05211 AM06855-AS AM06854-SS AD05212 AM06857-AS AM06856-SS AD05213 AM06859-AS AM06858-SS AD05214 AM06861-AS AM06860-SS AD05240 AM06601-AS AM06909-SS AD05241 AM06799-AS AM06909-SS AD05242 AM06911-AS AM06910-SS AD05243 AM06796-AS AM06912-SS AD05244 AM06914-AS AM06913-SS AD05245 AM06916-AS AM06915-SS AD05246 AM06918-AS AM06917-SS AD05247 AM06920-AS AM06919-SS AD05248 AM06918-AS AM06921-SS AD05256 AM06601-AS AM06930-SS AD05257 AM06601-AS AM06931-SS AD05261 AM06916-AS AM06818-SS AD05262 AM06916-AS AM06935-SS AD05263 AM06916-AS AM06936-SS AD05264 AM06916-AS AM06937-SS AD05265 AM06916-AS AM06938-SS AD05266 AM06916-AS AM06939-SS AD05267 AM06916-AS AM06940-SS AD05268 AM06916-AS AM06941-SS AD05352 AM07073-AS AM07072-SS AD05353 AM07075-AS AM07074-SS AD05354 AM07077-AS AM07076-SS AD05355 AM07079-AS AM07078-SS AD05356 AM07079-AS AM07080-SS AD05357 AM07079-AS AM07081-SS AD05358 AM07083-AS AM07082-SS AD05359 AM07085-AS AM07084-SS AD05360 AM07085-AS AM07086-SS AD05361 AM07088-AS AM07087-SS AD05362 AM07090-AS AM07089-SS AD05363 AM07092-AS AM07091-SS AD05364 AM07092-AS AM07093-SS AD05365 AM07092-AS AM07094-SS AD05366 AM07096-AS AM07095-SS AD05367 AM07098-AS AM07097-SS AD05373 AM06601-AS AM07109-SS AD05374 AM06601-AS AM07110-SS AD05375 AM06851-AS AM06930-SS AD05376 AM06851-AS AM06802-SS AD05377 AM06851-AS AM07109-SS AD05378 AM06851-AS AM06805-SS AD05379 AM06851-AS AM07110-SS AD05380 AM06806-AS AM06802-SS AD05460 AM07209-AS AM06676-SS AD05461 AM07210-AS AM06818-SS AD05462 AM07210-AS AM07211-SS AD05463 AM07210-AS AM07212-SS AD05464 AM07213-AS AM06818-SS AD05465 AM07214-AS AM06818-SS AD05466 AM07210-AS AM06814-SS AD05467 AM07210-AS AM06941-SS AD05468 AM07213-AS AM06814-SS AD05469 AM07214-AS AM06814-SS AD05470 AM07216-AS AM07215-SS AD05603 AM06815-AS AM07212-SS AD05604 AM06815-AS AM07211-SS AD05605 AM07210-AS AM07388-SS AD05606 AM07390-AS AM07389-SS AD05607 AM07392-AS AM07391-SS AD05608 AM07394-AS AM07393-SS AD05609 AM07396-AS AM07395-SS AD05610 AM07398-AS AM07397-SS AD05624 AM06815-AS AM07414-SS AD05640 AM06815-AS AM07444-SS AD05641 AM06815-AS AM07445-SS AD05642 AM06815-AS AM07446-SS AD05643 AM06815-AS AM07447-SS AD05644 AM06815-AS AM07448-SS AD05645 AM07449-AS AM07211-SS AD05646 AM06815-AS AM07450-SS AD05647 AM07210-AS AM07450-SS AD05648 AM06601-AS AM07451-SS AD05649 AM06851-AS AM07451-SS AD05650 AM06601-AS AM07452-SS AD05651 AM06851-AS AM07452-SS AD05674 AM07487-AS AM06802-SS AD05675 AM07488-AS AM06600-SS AD05676 AM07487-AS AM07110-SS AD05677 AM07489-AS AM06818-SS AD05678 AM07489-AS AM06814-SS AD05679 AM07490-AS AM07211-SS AD05680 AM07492-AS AM07491-SS AD05682 AM07210-AS AM07494-SS AD05692 AM07501-AS AM07500-SS AD05740 AM07576-AS AM06600-SS AD05741 AM07577-AS AM06600-SS AD05742 AM07576-AS AM06802-SS

(114) In some embodiments, an ASGR1 RNAi agent is prepared or provided as a salt, mixed salt, or a free-acid. The RNAi agents described herein, upon delivery to a cell expressing an ASGR1 gene, inhibit or knockdown expression of one or more ASGR1 genes in vivo.

(115) Targeting Groups, Linking Groups, and Delivery Vehicles

(116) In some embodiments, an ASGR1 RNAi agent is conjugated to one or more non-nucleotide groups including, but not limited to a targeting group, linking group, delivery polymer, or a delivery vehicle. The non-nucleotide group can enhance targeting, delivery or attachment of the RNAi agent. Examples of targeting groups and linking groups are provided in Table 6. The non-nucleotide group can be covalently linked to the 3′ and/or 5′ end of either the sense strand and/or the antisense strand. In some embodiments, an ASGR1 RNAi agent contains a non-nucleotide group linked to the 3′ and/or 5′ end of the sense strand. In some embodiments, anon-nucleotide group is linked to the 5′ end of an ASGR1 RNAi agent sense strand. A non-nucleotide group may be linked directly or indirectly to the RNAi agent via a linker/linking group. In some embodiments, a non-nucleotide group is linked to the RNAi agent via a labile, cleavable, or reversible bond or linker.

(117) In some embodiments, a non-nucleotide group enhances the pharmacokinetic or biodistribution properties of an RNAi agent or conjugate to which it is attached to improve cell- or tissue-specific distribution and cell-specific uptake of the RNAi agent or conjugate. In some embodiments, a non-nucleotide group enhances endocytosis of the RNAi agent.

(118) Targeting groups or targeting moieties enhance the pharmacokinetic or biodistribution properties of a conjugate or RNAi agent to which they are attached to improve cell-specific (including, in some cases, organ specific) distribution and cell-specific (or organ specific) uptake of the conjugate or RNAi agent. A targeting group can be monovalent, divalent, trivalent, tetravalent, or have higher valency for the target to which it is directed. Representative targeting groups include, without limitation, compounds with affinity to cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments, and antibody mimics with affinity to cell surface molecules. In some embodiments, a targeting group is linked to an RNAi agent using a linker, such as a PEG linker or one, two, or three abasic and/or ribitol (abasic ribose) residues, which can in some instances serve as linkers. In some embodiments, a targeting group comprises a galactose-derivative cluster.

(119) The ASGR1 RNAi agents described herein may be synthesized having a reactive group, such as an amino group (also referred to herein as an amine), at the 5′-terminus and/or the 3′-terminus. The reactive group may be used to subsequently attach a targeting group using methods typical in the art.

(120) In some embodiments, a targeting group comprises an asialoglycoprotein receptor ligand. As used herein, an asialoglycoprotein receptor ligand is a ligand that contains a compound having affinity for the asialoglycoprotein receptor. As noted herein, the asialoglycoprotein receptor is highly expressed on hepatocytes. In some embodiments, an asialoglycoprotein receptor ligand includes or consists of one or more galactose derivatives. As used herein, the term galactose derivative includes both galactose and derivatives of galactose having affinity for the asialoglycoprotein receptor that is equal to or greater than that of galactose. Galactose derivatives include, but are not limited to: galactose, galactosamine, N-formylgalactosamine, N-acetyl-galactosamine, N-propionyl-galactosamine, N-n-butanoyl-galactosamine, and N-iso-butanoylgalactos-amine (see for example: S. T. Iobst and K. Drickamer, J. B. C., 1996, 271, 6686). Galactose derivatives, and clusters of galactose derivatives, that are useful for in vivo targeting of oligonucleotides and other molecules to the liver are known in the art (see, for example, Baenziger and Fiete, 1980, Cell, 22, 611-620; Connolly et al., 1982, J. Biol. Chem., 257, 939-945).

(121) Galactose derivatives have been used to target molecules to hepatocytes in vivo through their binding to the asialoglycoprotein receptor expressed on the surface of hepatocytes. Binding of asialoglycoprotein receptor ligands to the asialoglycoprotein receptor(s) facilitates cell-specific targeting to hepatocytes and endocytosis of the molecule into hepatocytes. Asialoglycoprotein receptor ligands can be monomeric (e.g., having a single galactose derivative) or multimeric (e.g., having multiple galactose derivatives). The galactose derivative or galactose derivative cluster may be attached to the 3′ or 5′ end of the sense or antisense strand of the RNAi agent using methods known in the art. The preparation of targeting groups, such as galactose derivative clusters, is described in, for example, International Patent Application Publication No. WO 2018/044350 to Arrowhead Pharmaceuticals, Inc., and International Patent Application Publication No. WO 2017/156012 to Arrowhead Pharmaceuticals, Inc., the contents of both of which are incorporated by reference herein in their entirety.

(122) As used herein, a galactose derivative cluster comprises a molecule having two to four terminal galactose derivatives. A terminal galactose derivative is attached to a molecule through its C-1 carbon. In some embodiments, the galactose derivative cluster is a galactose derivative trimer (also referred to as tri-antennary galactose derivative or tri-valent galactose derivative). In some embodiments, the galactose derivative cluster comprises N-acetyl-galactosamines. In some embodiments, the galactose derivative cluster comprises three N-acetyl-galactosamines. In some embodiments, the galactose derivative cluster is a galactose derivative tetramer (also referred to as tetra-antennary galactose derivative or tetra-valent galactose derivative). In some embodiments, the galactose derivative cluster comprises four N-acetyl-galactosamines.

(123) As used herein, a galactose derivative trimer contains three galactose derivatives, each linked to a central branch point. As used herein, a galactose derivative tetramer contains four galactose derivatives, each linked to a central branch point. The galactose derivatives can be attached to the central branch point through the C-1 carbons of the saccharides. In some embodiments, the galactose derivatives are linked to the branch point via linkers or spacers. In some embodiments, the linker or spacer is a flexible hydrophilic spacer, such as a PEG group (see, for example, U.S. Pat. No. 5,885,968; Biessen et al. J. Med. Chem. 1995 Vol. 39 p. 1538-1546). In some embodiments, the PEG spacer is a PEGS spacer. The branch point can be any small molecule which permits attachment of three galactose derivatives and further permits attachment of the branch point to the RNAi agent. An example of branch point group is a di-lysine or di-glutamate. Attachment of the branch point to the RNAi agent can occur through a linker or spacer. In some embodiments, the linker or spacer comprises a flexible hydrophilic spacer, such as, but not limited to, a PEG spacer. In some embodiments, the linker comprises a rigid linker, such as a cyclic group. In some embodiments, a galactose derivative comprises or consists of N-acetyl-galactosamine. In some embodiments, the galactose derivative cluster is comprised of a galactose derivative tetramer, which can be, for example, an N-acetyl-galactosamine tetramer.

(124) Embodiments of the present disclosure include pharmaceutical compositions for delivering an ASGR1 RNAi agent to a liver cell in vivo. Such pharmaceutical compositions can include, for example, an ASGR1 RNAi agent conjugated to a galactose derivative cluster. In some embodiments, the galactose derivative cluster is comprised of a galactose derivative trimer, which can be, for example, an N-acetyl-galactosamine trimer, or galactose derivative tetramer, which can be, for example, an N-acetyl-galactosamine tetramer.

(125) Targeting groups include, but are not limited to, (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27) (NAG27)s, (NAG28) (NAG28)s, (NAG29) (NAG29)s, (NAG30) (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), and (NAG39)s, as defined in Table 6. Other targeting groups, including galactose cluster targeting ligands, are known in the art.

(126) In some embodiments, a linking group is conjugated to the RNAi agent. The linking group facilitates covalent linkage of the agent to a targeting group or delivery polymer or delivery vehicle. The linking group can be linked to the 3′ or the 5′ end of the RNAi agent sense strand or antisense strand. In some embodiments, the linking group is linked to the RNAi agent sense strand. In some embodiments, the linking group is conjugated to the 5′ or 3′ end of an RNAi agent sense strand. In some embodiments, a linking group is conjugated to the 5′ end of an RNAi agent sense strand. Examples of linking groups, include, but are not limited to: reactive groups such a primary amines and alkynes, alkyl groups, abasic nucleotides, ribitol (abasic ribose), and/or PEG groups.

(127) A linker or linking group is a connection between two atoms that links one chemical group (such as an RNAi agent) or segment of interest to another chemical group (such as a targeting group or delivery polymer) or segment of interest via one or more covalent bonds. A labile linkage contains a labile bond. A linkage may optionally include a spacer that increases the distance between the two joined atoms. A spacer may further add flexibility and/or length to the linkage. Spacers may include, but are not be limited to, alkyl groups, alkenyl groups, alkynyl groups, aryl groups, aralkyl groups, aralkenyl groups, and aralkynyl groups; each of which can contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and saccharides. Spacer groups are well known in the art and the preceding list is not meant to limit the scope of the description.

(128) Any of the ASGR1 RNAi agent nucleotide sequences listed in Tables 2, 3 or 4, whether modified or unmodified, may contain 3′ or 5′ targeting groups or linking groups. Any of the ASGR1 RNAi agent sequences listed in Tables 3 or 4 which contain a 3′ or 5′ targeting group or linking group, may alternatively contain no 3′ or 5′ targeting group or linking group, or may contain a different 3′ or 5′ targeting group or linking group including, but not limited to, those depicted in Table 6. Any of the ASGR1 RNAi agent duplexes listed in Table 2 or Table 5, whether modified or unmodified, may further comprise a targeting group or linking group, including, but not limited to, those depicted in Table 6, and the targeting group or linking group may be attached to the 3′ or 5′ terminus of either the sense strand or the antisense strand of the ASGR1 RNAi agent duplex.

(129) Examples of targeting groups and linking groups are provided in Table 6. Table 4 provides several embodiments of ASGR1 RNAi agent sense strands having a targeting group or linking group linked to the 5′ or 3′ end.

(130) TABLE-US-00020 TABLE 6 Structures Representing Various Modified Nucleotides, Targeting Groups, and Linking Groups. embedded image embedded image embedded image embedded image embedded image embedded image embedded image embedded image embedded image 0embedded image embedded image embedded image embedded image embedded image embedded image embedded image embedded image embedded image embedded image 0embedded image embedded image embedded image embedded image embedded image embedded image embedded image embedded image embedded image embedded image 0embedded image embedded image embedded image embedded image embedded image embedded image embedded image embedded image embedded image embedded image 0embedded image embedded image embedded image embedded image embedded image embedded image embedded image embedded image embedded image embedded image 0embedded image embedded image embedded image embedded image embedded image embedded image embedded image embedded image embedded image embedded image 0embedded image

(131) In each of the above structures in Table 6, NAG comprises an N-acetyl-galactosamine or another asialoglycoprotein receptor ligand, as would be understood by a person of ordinary skill in the art to be attached in view of the structures above and description provided herein. For example, in some embodiments, NAG in the structures provided in Table 6 is represented by the following structure:

(132) ##STR00061##

(133) Each (NAGx) may be attached to an ASGR1 RNAi agent via a phosphate group (as in (NAG25), (NAG30), and (NAG31)), or a phosphorothioate group, (as is (NAG25)s, (NAG29)s, (NAG30)s, (NAG31)s, or (NAG37)s), or another linking group.

(134) ##STR00062##

(135) Other linking groups known in the art may be used.

(136) In some embodiments, a delivery vehicle can be used to deliver an RNAi agent to a cell or tissue. A delivery vehicle is a compound that improves delivery of the RNAi agent to a cell or tissue. A delivery vehicle can include, or consist of, but is not limited to: a polymer, such as an amphipathic polymer, a membrane active polymer, a peptide, a melittin peptide, a melittin-like peptide (MLP), a lipid, a reversibly modified polymer or peptide, or a reversibly modified membrane active polyamine.

(137) In some embodiments, the RNAi agents can be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs or other delivery systems available in the art. The RNAi agents can also be chemically conjugated to targeting groups, lipids (including, but not limited to cholesterol and cholesteryl derivatives), nanoparticles, polymers, liposomes, micelles, DPCs (see, for example WO 2000/053722, WO 2008/0022309, WO 2011/104169, and WO 2012/083185, WO 2013/032829, WO 2013/158141, each of which is incorporated herein by reference), or other delivery systems available in the art.

(138) Pharmaceutical Compositions and Formulations

(139) The ASGR1 RNAi agents disclosed herein can be prepared as pharmaceutical compositions or formulations (also referred to herein as “medicaments”). In some embodiments, pharmaceutical compositions include at least one ASGR1 RNAi agent. These pharmaceutical compositions are particularly useful in the inhibition of the expression of the target mRNA in a target cell, a group of cells, a tissue, or an organism. The pharmaceutical compositions can be used to treat a subject having a disease or disorder that would benefit from reduction in the level of the target mRNA, or inhibition in expression of the target gene. The pharmaceutical compositions can be used to treat a subject at risk of developing a disease or disorder that would benefit from reduction of the level of the target mRNA or an inhibition in expression the target gene. In one embodiment, the method includes administering an ASGR1 RNAi agent linked to a targeting ligand as described herein, to a subject to be treated. In some embodiments, one or more pharmaceutically acceptable excipients (including vehicles, carriers, diluents, and/or delivery polymers) are added to the pharmaceutical compositions including an ASGR1 RNAi agent, thereby forming a pharmaceutical formulation suitable for in vivo delivery to a subject, including a human.

(140) The pharmaceutical compositions that include an ASGR1 RNAi agent and methods disclosed herein decrease the level of the target mRNA in a cell, group of cells, group of cells, tissue, or subject, including by administering to the subject a therapeutically effective amount of a herein described ASGR1 RNAi agent, thereby inhibiting the expression of ASGR1 mRNA in the subject. In some embodiments, the subject has been previously identified as having a pathogenic upregulation of the target gene in the targeted cell or tissue.

(141) In some embodiments, the described pharmaceutical compositions including an ASGR1 RNAi agent are used for treating or managing clinical presentations associated with elevated non-HDL-C levels, and/or elevated LDL-C levels, and/or elevated total cholesterol levels, and/or elevated TG levels, and/or over-expression of ASGR1 mRNA. In some embodiments, a therapeutically or prophylactically effective amount of one or more of pharmaceutical compositions is administered to a subject in need of such treatment, prevention or management. In some embodiments, administration of any of the disclosed ASGR1 RNAi agents can be used to decrease the number, severity, and/or frequency of symptoms of a disease in a subject. In some embodiments, the subject has been previously identified or diagnosed as having elevated cholesterol levels, elevated triglyceride levels, and/or some other dyslipidemia.

(142) The described pharmaceutical compositions including an ASGR1 RNAi agent can be used to treat at least one symptom in a subject having a disease or disorder that would benefit from reduction or inhibition in expression of ASGR1 mRNA. In some embodiments, the subject is administered a therapeutically effective amount of one or more pharmaceutical compositions including an ASGR1 RNAi agent thereby treating the symptom. In other embodiments, the subject is administered a prophylactically effective amount of one or more ASGR1 RNAi agents, thereby preventing the at least one symptom.

(143) The route of administration is the path by which an ASGR1 RNAi agent is brought into contact with the body. In general, methods of administering drugs, oligonucleotides, and nucleic acids, for treatment of a mammal, are well known in the art and can be applied to administration of the compositions described herein. The ASGR1 RNAi agents disclosed herein can be administered via any suitable route in a preparation appropriately tailored to the particular route. Thus, herein described pharmaceutical compositions can be administered by injection, for example, intravenously, intramuscularly, intracutaneously, subcutaneously, intraarticularly, or intraperitoneally. In some embodiments, the herein described pharmaceutical compositions are administered via subcutaneous injection.

(144) The pharmaceutical compositions including an ASGR1 RNAi agent described herein can be delivered to a cell, group of cells, tissue, or subject using oligonucleotide delivery technologies known in the art. In general, any suitable method recognized in the art for delivering a nucleic acid molecule (in vitro or in vivo) can be adapted for use with the herein described compositions. For example, delivery can be by local administration, (e.g., direct injection, implantation, or topical administering), systemic administration, or subcutaneous, intravenous, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal and intrathecal), intramuscular, transdermal, airway (aerosol), nasal, oral, rectal, or topical (including buccal and sublingual) administration. In certain embodiments, the compositions are administered by subcutaneous or intravenous infusion or injection.

(145) Accordingly, in some embodiments, the herein described pharmaceutical compositions may comprise one or more pharmaceutically acceptable excipients. In some embodiments, the pharmaceutical compositions described herein can be formulated for administration to a subject.

(146) As used herein, a pharmaceutical composition or medicament includes a pharmacologically effective amount of at least one of the described ASGR1 RNAi agents and one or more pharmaceutically acceptable excipients. Pharmaceutically acceptable excipients (excipients) are substances other than the Active Pharmaceutical Ingredient (API, therapeutic product, e.g., ASGR1 RNAi agent) that are intentionally included in the drug delivery system. Excipients do not exert or are not intended to exert a therapeutic effect at the intended dosage. Excipients may act to a) aid in processing of the drug delivery system during manufacture, b) protect, support or enhance stability, bioavailability or patient acceptability of the API, c) assist in product identification, and/or d) enhance any other attribute of the overall safety, effectiveness, of delivery of the API during storage or use. A pharmaceutically acceptable excipient may or may not be an inert substance.

(147) Excipients include, but are not limited to: absorption enhancers, anti-adherents, anti-foaming agents, anti-oxidants, binders, buffering agents, carriers, coating agents, colors, delivery enhancers, delivery polymers, dextran, dextrose, diluents, disintegrants, emulsifiers, extenders, fillers, flavors, glidants, humectants, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, suspending agents, sustained release matrices, sweeteners, thickening agents, tonicity agents, vehicles, water-repelling agents, and wetting agents.

(148) Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor® ELTM (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS). It should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

(149) Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filter sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, methods of preparation include vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

(150) Formulations suitable for intra-articular administration can be in the form of a sterile aqueous preparation of the drug that can be in microcrystalline form, for example, in the form of an aqueous microcrystalline suspension. Liposomal formulations or biodegradable polymer systems can also be used to present the drug for both intra-articular and ophthalmic administration.

(151) The active compounds can be prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. Liposomal suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.

(152) The ASGR1 RNAi agents can be formulated in compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms of the disclosure are dictated by and directly dependent on the unique characteristics of the active compound and the therapeutic effect to be achieved, and the limitations inherent in the art of compounding such an active compound for the treatment of individuals.

(153) A pharmaceutical composition can contain other additional components commonly found in pharmaceutical compositions. Such additional components include, but are not limited to: anti-pruritics, astringents, local anesthetics, or anti-inflammatory agents (e.g., antihistamine, diphenhydramine, etc.). It is also envisioned that cells, tissues or isolated organs that express or comprise the herein defined RNAi agents may be used as “pharmaceutical compositions.” As used herein, “pharmacologically effective amount,” “therapeutically effective amount,” or simply “effective amount” refers to that amount of an RNAi agent to produce a pharmacological, therapeutic or preventive result.

(154) Generally, an effective amount of an active compound will be in the range of from about 0.1 to about 100 mg/kg of body weight/day, e.g., from about 1.0 to about 50 mg/kg of body weight/day. In some embodiments, an effective amount of an active compound will be in the range of from about 0.25 to about 5 mg/kg of body weight per dose. In some embodiments, an effective amount of an active ingredient will be in the range of from about 0.5 to about 4 mg/kg of body weight per dose. The amount administered will also likely depend on such variables as the overall health status of the patient, the relative biological efficacy of the compound delivered, the formulation of the drug, the presence and types of excipients in the formulation, and the route of administration. Also, it is to be understood that the initial dosage administered can be increased beyond the above upper level in order to rapidly achieve the desired blood-level or tissue level, or the initial dosage can be smaller than the optimum.

(155) For treatment of disease or for formation of a medicament or composition for treatment of a disease, the pharmaceutical compositions described herein including an ASGR1 RNAi agent can be combined with an excipient or with a second therapeutic agent or treatment including, but not limited to: a second or other RNAi agent, a small molecule drug, an antibody, an antibody fragment, peptide and/or aptamer.

(156) The described ASGR1 RNAi agents, when added to pharmaceutically acceptable excipients or adjuvants, can be packaged into kits, containers, packs, or dispensers. The pharmaceutical compositions described herein may be packaged in pre-filled syringes or vials.

(157) Methods of Treatment and Inhibition of Expression

(158) The ASGR1 RNAi agents disclosed herein can be used to treat a subject (e.g., a human or other mammal) having a disease or disorder that would benefit from administration of the compound. In some embodiments, the RNAi agents disclosed herein can be used to treat a subject (e.g., a human) having a disease or disorder that would benefit from reduction or inhibition in expression of ASGR1 mRNA. The subject is administered a therapeutically effective amount of any one or more of the ASGR1 RNAi agents described herein. The subject can be a human, patient, or human patient. The subject may be an adult, adolescent, child, or infant. The described pharmaceutical compositions including an ASGR1 RNAi agent can be used to provide methods for the therapeutic treatment of diseases. Such methods include administration of a pharmaceutical composition described herein to a human being or animal.

(159) In some embodiments, the ASGR1 RNAi agents described herein are used to treat a subject with an ASGR1-related disease or disorder. An “ASGR1-related disease or disorder” refers to conditions, diseases, or disorders in which ASGR1 expression levels are altered or where elevated expression levels of ASGR1 are associated with an increased risk of developing the condition, disease or disorder. ASGR1-related diseases or disorders include, but are not limited to, obesity, metabolic syndrome, hyperlipidemia, hypertriglyceridemia, hypercholesterolemia, abnormal lipid and/or cholesterol metabolism, atherosclerosis, diabetes, cardiovascular disease, coronary artery disease, myocardial infarction, peripheral vascular disease, cerebrovascular disease and other metabolic-related disorders and diseases. In some embodiments, the described ASGR1 RNAi agents are used to treat at least one symptom in a subject having an ASGR1-related disease or disorder. The subject is administered a therapeutically effective amount of any one or more of the described RNAi agents. In some embodiments, the present invention provides for the use of an ASGR1 RNAi agent described herein for the preparation of a medicament for treating an ASGR1-related disease or disorder in a patient in need thereof. In other embodiments, the present invention provides an ASGR1 RNAi agent described herein for use in a method for treating ASGR1-related diseases in a patient in need thereof.

(160) In certain embodiments, the present invention provides a method for reducing the risk of myocardial infarction in a patient in need thereof comprising administering to the patient any of the ASGR1 RNAi agents described herein. A patient who is at risk of having a myocardial infarction may be a patient who has a history of myocardial infarction (e.g. has had a previous myocardial infarction). A patient at risk of having a myocardial infarction may also be a patient who has a familial history of myocardial infarction or who has one or more risk factors of myocardial infarction. Such risk factors include, but are not limited to, hypertension, elevated levels of non-HDL cholesterol, elevated levels of triglycerides, diabetes, obesity, or history of autoimmune diseases (e.g. rheumatoid arthritis, lupus). In one embodiment, a patient who is at risk of having a myocardial infarction is a patient who has or is diagnosed with coronary artery disease. The risk of myocardial infarction in these and other patients can be reduced by administering to the patients any of the ASGR1 RNAi agents described herein. In some embodiments, the present invention provides for the use of an ASGR1 RNAi agent described herein for the preparation of a medicament for reducing the risk of myocardial infarction in a patient in need thereof. In other embodiments, the present invention provides an ASGR1 RNAi agent described herein for use in a method for reducing the risk of myocardial infarction in a patient in need thereof.

(161) In some embodiments, the present invention provides a method for reducing non-HDL cholesterol in a patient in need thereof by administering to the patient any of the ASGR1 RNAi agents described herein. Non-HDL cholesterol is a measure of all cholesterol-containing proatherogenic lipoproteins, including LDL cholesterol, very low-density lipoprotein, intermediate-density lipoprotein, lipoprotein(a), chylomicron, and chylomicron remnants. Non-HDL cholesterol has been reported to be a good predictor of cardiovascular risk (Rana et al., Curr. Atheroscler. Rep., Vol. 14:130-134, 2012). Non-HDL cholesterol levels can be calculated by subtracting HDL cholesterol levels from total cholesterol levels. In one embodiment, a patient's LDL cholesterol levels are reduced following administration of the ASGR1 RNAi agent. In another embodiment, a patient's lipoprotein (a) levels are reduced following administration of the ASGR1 RNAi agent. In some embodiments, the present invention provides for the use of an ASGR1 RNAi agent described herein for the preparation of a medicament for reducing non-HDL cholesterol in a patient in need thereof. In other embodiments, the present invention provides an ASGR1 RNAi agent described herein for use in a method for reducing non-HDL cholesterol in a patient in need thereof.

(162) In some embodiments, a patient to be treated according to the methods of the invention is a patient who has elevated levels of non-HDL cholesterol (e.g. elevated serum levels of non-HDL cholesterol). Ideally, levels of non-HDL cholesterol should be about 30 mg/dL above the target for LDL cholesterol levels for any given patient. In particular embodiments, a patient is administered an ASGR1 RNAi agent of the invention if the patient has a non-HDL cholesterol level of about 130 mg/dL or greater. In one embodiment, a patient is administered an ASGR1 RNAi agent of the invention if the patient has a non-HDL cholesterol level of about 160 mg/dL or greater. In another embodiment, a patient is administered an ASGR1 RNAi agent of the invention if the patient has a non-HDL cholesterol level of about 190 mg/dL or greater. In still another embodiment, a patient is administered an ASGR1 RNAi agent of the invention if the patient has a non-HDL cholesterol level of about 220 mg/dL or greater. In certain embodiments, a patient is administered an ASGR1 RNAi agent of the invention if the patient is at a high or very high risk of cardiovascular disease according to the 2013 ACC/AHA Guideline on the Assessment of Cardiovascular Risk (Goff et al., ACC/AHA guideline on the assessment of cardiovascular risk: a report of the American College of Cardiology/American Heart Association Task Force on Practice Guidelines. Circulation. 2013; 00:000-000) and has a non-HDL cholesterol level of about 100 mg/dL or greater.

(163) In some embodiments of the methods of the invention, a patient is administered an ASGR1 RNAi agent described herein if they are at a moderate risk or higher for cardiovascular disease according to the 2013 ACC/AHA Guideline on the Assessment of Cardiovascular Risk (referred to herein as the “2013 Guidelines”). In certain embodiments, an ASGR1 RNAi agent of the invention is administered to a patient if the patient's LDL cholesterol level is greater than about 160 mg/dL. In other embodiments, an ASGR1 RNAi agent of the invention is administered to a patient if the patient's LDL cholesterol level is greater than about 130 mg/dL and the patient has a moderate risk of cardiovascular disease according to the 2013 Guidelines. In still other embodiments, an ASGR1 RNAi agent of the invention is administered to a patient if the patient's LDL cholesterol level is greater than 100 mg/dL and the patient has a high or very high risk of cardiovascular disease according to the 2013 Guidelines.

(164) In some embodiments, the ASGR1 RNAi agents are used to treat or manage a clinical presentation of a subject with an ASGR1-related disease or disorder. The subject is administered a therapeutically effective amount of one or more of the ASGR1 RNAi agents or ASGR1 RNAi agent-containing compositions described herein. In some embodiments, the method comprises administering a composition comprising an ASGR1 RNAi agent described herein to a subject to be treated.

(165) In some embodiments, the gene expression level and/or mRNA level of an ASGR1 gene in a subject to whom a described ASGR1 RNAi agent is administered is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 95%, 96%, 97%, 98%, 99%, or greater than 99% relative to the subject prior to being administered the ASGR1 RNAi agent or to a subject not receiving the ASGR1 RNAi agent. The gene expression level and/or mRNA level in the subject may be reduced in a cell, group of cells, and/or tissue of the subject. In some embodiments, the protein level of ASGR1 in a subject to whom a described ASGR1 RNAi agent has been administered is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99% relative to the subject prior to being administered the ASGR1 RNAi agent or to a subject not receiving the ASGR1 RNAi agent. The protein level in the subject may be reduced in a cell, group of cells, tissue, blood, and/or other fluid of the subject. A reduction in gene expression, mRNA, or protein levels can be assessed by any methods known in the art. Reduction or decrease in ASGR1 mRNA level and/or protein level are collectively referred to herein as a reduction or decrease in ASGR1 or inhibiting or reducing the expression of ASGR1.

(166) Cells, Tissues, Organs, and Non-Human Organisms

(167) Cells, tissues, organs, and non-human organisms that include at least one of the ASGR1 RNAi agents described herein is contemplated. The cell, tissue, organ, or non-human organism is made by delivering the RNAi agent to the cell, tissue, organ or non-human organism.

(168) The above provided embodiments and items are now illustrated with the following, non-limiting examples.

EXAMPLES

Example 1. Synthesis of ASGR1 RNAi Agents

(169) ASGR1 RNAi agent duplexes shown in Table 5 (with corresponding sense and antisense strand sequences identified in Tables 3 and 4) above, were synthesized in accordance with the following:

(170) A. Synthesis.

(171) The sense and antisense strands of the ASGR1 RNAi agents were synthesized according to phosphoramidite technology on solid phase used in oligonucleotide synthesis. Depending on the scale, either a MerMade96E® (Bioautomation), a MerMade12® (Bioautomation), or an OP Pilot 100 (GE Healthcare) was used. Syntheses were performed on a solid support made of controlled pore glass (CPG, 500 Å or 600 Å, obtained from Prime Synthesis, Aston, Pa., USA). All RNA and 2′-modified RNA phosphoramidites were purchased from Thermo Fisher Scientific (Milwaukee, Wis., USA). The 2′-O-methyl phosphoramidites included the following: (5′-O-dimethoxytrityl-N.sup.6-(benzoyl)-2′-O-methyl-adenosine-3′-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, 5′-O-dimethoxy-trityl-N.sup.4-(acetyl)-2′-O-methyl-cytidine-3′-O-(2-cyanoethyl-N,N-diisopropyl-amino) phosphoramidite, (5′-O-dimethoxytrityl-N.sup.2-(isobutyryl)-2′-O-methyl-guanosine-3′-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, and 5′-O-dimethoxytrityl-2′-O-methyl-uridine-3′-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite. The 2′-deoxy-2′-fluoro-phosphoramidites carried the same protecting groups as the 2′-O-methyl amidites. 5′-(4,4′-Dimethoxytrityl)-2′,3′-seco-uridine-2′-benzoyl-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite was also purchased from Thermo Fisher Scientific. 5′-dimethoxytrityl-2′-O-methyl-inosine-3′-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidites were purchased from Glen Research (Virginia). The inverted abasic (3′-O-dimethoxytrityl-2′-deoxyribose-5′-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidites were purchased from ChemGenes (Wilmington, Mass., USA).

(172) Targeting ligand containing phosphoramidites were dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM), while all other amidites were dissolved in anhydrous acetonitrile (50 mM or 100 mM, depending on scale) and molecular sieves (3 Å) were added. 5-Benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-Ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) was used as activator solution. Coupling times were 12 min (RNA), 15 min (targeting ligand), 90 sec (2′OMe), and 60 sec (2′F). In order to introduce phosphorothioate linkages, a 100 mM solution of 3-phenyl 1,2,4-dithiazoline-5-one (POS, obtained from PolyOrg, Inc., Leominster, Mass., USA) in anhydrous acetonitrile was employed. Unless specifically identified as a “naked” RNAi agent having no targeting ligand present, each of the ASGR1 RNAi agent duplexes synthesized and tested in the following Examples utilized N-acetyl-galactosamine as “NAG” in the targeting ligand chemical structures represented in Table 6.

(173) B. Cleavage and Deprotection of Support Bound Oligomer.

(174) After finalization of the solid phase synthesis, the dried solid support was treated with a 1:1 volume solution of 40 wt. % methylamine in water and 28% ammonium hydroxide solution (Aldrich) for 1.5 hours at 30° C. The solution was evaporated and the solid residue was reconstituted in water (see below).

(175) C. Purification.

(176) Crude oligomers were purified by anionic exchange HPLC using a TSKgel SuperQ-5PW 13 μm column and Shimadzu LC-20AP system. Buffer A was 20 mM Tris, pH 9.0 and contained 20% Acetonitrile and buffer B was the same as buffer A with the addition of 1.5 M sodium chloride. UV traces at 260 nm were recorded. Appropriate fractions were pooled then run on size exclusion HPLC using a GE Healthcare XK 26/40 column packed with Sephadex G-25 fine with a running buffer of filtered DI water or 100 mM ammonium bicarbonate, pH 6.7 and 20% Acetonitrile.

(177) D. Annealing.

(178) Complementary strands were mixed by combining equimolar RNA solutions (sense and antisense) in 1× Phosphate-Buffered Saline (Corning, Cellgro) to form the RNAi agents. Some RNAi agents were lyophilized and stored at −15 to −25° C. Duplex concentration was determined by measuring the solution absorbance on a UV-Vis spectrometer in 1× Phosphate-Buffered Saline. The solution absorbance at 260 nm was then multiplied by a conversion factor and the dilution factor to determine the duplex concentration. The conversion factor used was either 0.037 mg/(mL.Math.cm) or was calculated from an experimentally determined extinction coefficient.

Example 2. ASGR1-SEAP Mouse Model

(179) To assess the potency of the RNAi agents, an ASGR1-SEAP mouse model was used. Six to eight week old female C57BL/6 albino mice were transiently transfected in vivo with plasmid by hydrodynamic tail vein injection, administered at least 15 days prior to administration of an ASGR1 RNAi agent or control. The plasmid contains the ASGR1 cDNA sequence (GenBank NM_001671.4 (SEQ ID NO:1)) inserted into the 3′ UTR of the SEAP (secreted human placental alkaline phosphatase) reporter gene. 50 μg of the plasmid containing the ASGR1 cDNA sequence in Ringer's Solution in a total volume of 10% of the animal's body weight was injected into mice via the tail vein to create ASGR1-SEAP model mice. The solution was injected through a 27-gauge needle in 5-7 seconds as previously described (Zhang G et al., “High levels of foreign gene expression in hepatocytes after tail vein injection of naked plasmid DNA.” Human Gene Therapy 1999 Vol. 10, p 1735-1737). Inhibition of expression of ASGR1 by an ASGR1 RNAi agent results in concomitant inhibition of SEAP expression, which is measured by the Phospha-Light™ SEAP Reporter Gene Assay System (Invitrogen). Prior to treatment, SEAP expression levels in serum were measured and the mice were grouped according to average SEAP levels.

(180) Analyses:

(181) SEAP levels may be measured at various times, both before and after administration of ASGR1 RNAi agents.

(182) i) Serum Collection:

(183) Mice were anesthetized with 2-3% isoflurane and blood samples were collected from the submandibular area into serum separation tubes (Sarstedt AG & Co., Nümbrecht, Germany). Blood was allowed to coagulate at ambient temperature for 20 min. The tubes were centrifuged at 8,000×g for 3 min to separate the serum and stored at 4° C.

(184) ii) Serum SEAP Levels:

(185) Serum was collected and measured by the Phospha-Light™ SEAP Reporter Gene Assay System (Invitrogen) according to the manufacturer's instructions. Serum SEAP levels for each animal was normalized to the control group of mice injected with saline in order to account for the non-treatment related decline in ASGR1 expression with this model. First, the SEAP level for each animal at a time point was divided by the pre-treatment level of expression in that animal (“pre-treatment”) in order to determine the ratio of expression “normalized to pre-treatment”. Expression at a specific time point was then normalized to the control group by dividing the “normalized to pre-treatment” ratio for an individual animal by the average “normalized to pre-treatment” ratio of all mice in the normal saline control group. Alternatively, in some Examples set forth herein, the serum SEAP levels for each animal were assessed by normalizing to pre-treatment levels only.

Example 3. In Vivo Testing of ASGR1 RNAi Agents in ASGR1-SEAP Mice

(186) The ASGR1-SEAP mouse model described in Example 2, above, was used. At day 1, each mouse was given a single subcutaneous injection of 200 μl containing either 3.0 mg/kg (mpk) of an ASGR1 RNAi agent or 200 μl of saline without an ASGR1 RNAi agent to be used as a control, according to the following Table 7.

(187) TABLE-US-00021 TABLE 7 Dosing groups of ASGR1-SEAP mice of Example 3. Group RNAi Agent and Dose Dosing Regimen 1 Saline (no RNAi agent) Single injection on day 1 2 3.0 mg/kg AD04634 Single injection on day 1 3 3.0 mg/kg AD04698 Single injection on day 1 4 3.0 mg/kg AD04699 Single injection on day 1 5 3.0 mg/kg AD04700 Single injection on day 1 6 3.0 mg/kg AD04701 Single injection on day 1 7 3.0 mg/kg AD04702 Single injection on day 1 8 3.0 mg/kg AD04703 Single injection on day 1 9 3.0 mg/kg AD04704 Single injection on day 1

(188) Each of the ASGR1 RNAi agents included N-acetyl-galactosamine targeting ligands conjugated to the 5′-terminal end of the sense strand, as shown in Tables 4 and 5. The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Three (3) mice in each group were tested (n=3). Serum was collected on day 3, day 8, day 15, day 22, day 29, and day 36, and SEAP expression levels were determined pursuant to the procedure set forth in Example 2, above. Data from the experiment are shown in the following Table 8, with Average SEAP reflecting the normalized average value of SEAP:

(189) TABLE-US-00022 TABLE 8 Average SEAP normalized to pre-treatment and saline control in ASGR1-SEAP mice from Example 3. Day 3 Day 8 Day 15 Day 22 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID SEAP (+/−) SEAP (+/−) SEAP (+/−) SEAP (+/−) Group 1 (Saline) 1.000 0.192 1.000 0.176 1.000 0.614 1.000 0.287 Group 2 (3.0 mg/kg AD04634) 0.757 0.404 0.282 0.164 0.235 0.202 0.316 0.243 Group 3 (3.0 mg/kg AD04698) 0.442 0.395 0.068 0.067 0.010 0.011 0.049 0.047 Group 4 (3.0 mg/kg AD04699) 0.904 0.324 0.380 0.130 0.253 0.115 0.427 0.236 Group 5 (3.0 mg/kg AD04700) 0.924 0.487 0.382 0.117 0.246 0.089 0.392 0.164 Group 6 (3.0 mg/kg AD04701) 0.480 0.263 0.234 0.135 0.133 0.085 0.362 0.244 Group 7 (3.0 mg/kg AD04702) 0.480 0.283 0.379 0.349 0.351 0.170 0.331 0.157 Group 8 (3.0 mg/kg AD04703) 0.669 0.283 0.429 0.226 0.313 0.267 0.285 0.202 Group 9 (3.0 mg/kg AD04704) 0.674 0.367 0.343 0.178 0.296 0.228 0.303 0.184 Day 29 Day 36 Avg Std Dev Avg Std Dev Group ID SEAP (+/−) SEAP (+/−) Group 1 (Saline) 1.000 0.258 1.000 0.241 Group 2 (3.0 mg/kg AD04634) 0.284 0.196 0.262 0.187 Group 3 (3.0 mg/kg AD04698) 0.071 0.078 0.094 0.101 Group 4 (3.0 mg/kg AD04699) 0.395 0.216 0.424 0.191 Group 5 (3.0 mg/kg AD04700) 0.383 0.218 0.376 0.165 Group 6 (3.0 mg/kg AD04701) 0.484 0.307 0.552 0.306 Group 7 (3.0 mg/kg AD04702) 0.360 0.121 0.264 0.257 Group 8 (3.0 mg/kg AD04703) 0.472 0.411 0.380 0.288 Group 9 (3.0 mg/kg AD04704) 0.545 0.537 0.610 0.503

(190) Each of the ASGR1 RNAi agents in each of the dosing groups (i.e., Groups 2 through 9) showed reduction in SEAP as compared to the saline control (Group 1) across all measured time points, which as described herein, indicates inhibition of ASGR1 in the ASGR1-SEAP mouse model. For example, Group 3 showed normalized SEAP levels of 0.010 (±0.011) on day 15, which indicates a 99% inhibition of expression at that time point after a single administration of 3.0 mg/kg of duplex AD04698.

Example 4. In Vivo Testing of ASGR1 RNAi Agents in ASGR1-SEAP Mice

(191) The ASGR1-SEAP mouse model described in Example 2, above, was used. At day 1, each mouse was given a single subcutaneous injection of 200 μl containing either 3.0 mg/kg of an ASGR1 RNAi agent or 200 μl of saline without an ASGR1 RNAi agent to be used as a control, according to the following Table 9.

(192) TABLE-US-00023 TABLE 9 Dosing groups of ASGR1-SEAP mice of Example 4. Group RNAi Agent and Dose Dosing Regimen 1 Saline (no RNAi agent) Single injection on day 1 2 3.0 mg/kg AD04634 Single injection on day 1 3 3.0 mg/kg AD04705 Single injection on day 1 4 3.0 mg/kg AD04706 Single injection on day 1 5 3.0 mg/kg AD04707 Single injection on day 1 6 3.0 mg/kg AD04791 Single injection on day 1 7 3.0 mg/kg AD04792 Single injection on day 1 8 3.0 mg/kg AD04793 Single injection on day 1 9 3.0 mg/kg AD04794 Single injection on day 1 10 3.0 mg/kg AD04797 Single injection on day 1 11 3.0 mg/kg AD04800 Single injection on day 1

(193) Each of the ASGR1 RNAi agents included N-acetyl-galactosamine targeting ligands conjugated to the 5′-terminal end of the sense strand, as shown in Tables 4 and 5. The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Three (3) mice in each group were tested (n=3). Serum was collected on day 4, day 8, day 15, day 22, and day 29, and SEAP expression levels were determined pursuant to the procedure set forth in Example 2, above. Data from the experiment are shown in the following Table 10, with Average SEAP reflecting the normalized average value of SEAP:

(194) TABLE-US-00024 TABLE 10 Average SEAP normalized to pre-treatment and saline control in ASGR1-SEAP mice from Example 4. Day 4 Day 8 Day 15 Day 22 Day 29 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID SEAP (+/−) SEAP (+/−) SEAP (+/−) SEAP (+/−) SEAP (+/−) Group 1 (Saline) 1.000 0.271 1.000 0.036 1.000 0.546 1.000 0.428 1.000 0.517 Group 2 (3.0 mg/kg AD04634) 0.505 0.105 0.357 0.066 0.333 0.079 0.276 0.076 0.308 0.200 Group 3 (3.0 mg/kg AD04705) 0.747 0.305 0.734 0.293 0.509 0.111 0.387 0.149 0.430 0.186 Group 4 (3.0 mg/kg AD04706) 0.830 0.239 0.885 0.133 0.555 0.160 0.519 0.165 0.568 0.087 Group 5 (3.0 mg/kg AD04707) 0.625 0.035 0.763 0.187 0.596 0.134 0.595 0.059 0.393 0.073 Group 6 (3.0 mg/kg AD04791) 1.236 0.622 0.834 0.197 0.650 0.148 0.713 0.030 0.654 0.131 Group 7 (3.0 mg/kg AD04792) 1.345 1.033 0.988 0.400 0.886 0.175 0.796 0.602 1.120 0.647 Group 8 (3.0 mg/kg AD04793) 1.431 1.439 0.496 0.044 0.368 0.110 0.346 0.168 0.343 0.091 Group 9 (3.0 mg/kg AD04794) 1.066 1.144 0.491 0.092 0.453 0.209 0.795 0.334 0.880 0.303 Group 10 (3.0 mg/kg AD04797) 0.764 0.617 1.156 0.366 0.939 0.412 1.113 0.490 1.344 0.375 Group 11 (3.0 mg/kg AD04800) 0.412 0.235 1.641 1.240 0.869 0.234 0.829 0.144 0.615 0.199

Example 5. In Vivo Testing of ASGR1 RNAi Agents in ASGR1-SEAP Mice

(195) The ASGR1-SEAP mouse model described in Example 2, above, was used. At day 1, each mouse was given a single subcutaneous injection of 200 μl containing either 0.5 mg/kg, 1.0 mg/kg, or 3.0 mg/kg of an ASGR1 RNAi agent, or 200 μl of saline without an ASGR1 RNAi agent to be used as a control, according to the following Table 11.

(196) TABLE-US-00025 TABLE 11 Dosing groups of ASGR1-SEAP mice of Example 5. Group RNAi Agent and Dose Dosing Regimen 1 Saline (no RNAi agent) Single injection on day 1 2 3.0 mg/kg AD04634 Single injection on day 1 3 1.0 mg/kg AD04697 Single injection on day 1 4 3.0 mg/kg AD04697 Single injection on day 1 5 0.5 mg/kg AD04698 Single injection on day 1 6 1.0 mg/kg AD04698 Single injection on day 1 7 3.0 mg/kg AD04698 Single injection on day 1 8 3.0 mg/kg AD04795 Single injection on day 1 9 3.0 mg/kg AD04796 Single injection on day 1 10 3.0 mg/kg AD04798 Single injection on day 1 11 3.0 mg/kg AD04799 Single injection on day 1

(197) Each of the ASGR1 RNAi agents included N-acetyl-galactosamine targeting ligands conjugated to the 5′-terminal end of the sense strand, as shown in Tables 4 and 5. The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Three (3) mice in each group were tested (n=3). Serum was collected on day 8, day 15, day 22, and day 29, and SEAP expression levels were determined pursuant to the procedure set forth in Example 2, above. Data from the experiment are shown in the following Table 12, with Average SEAP reflecting the normalized average value of SEAP:

(198) TABLE-US-00026 TABLE 12 Average SEAP normalized to pre-treatment and saline control in ASGR1-SEAP mice from Example 5. Day 8 Day 15 Day 22 Day 29 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID SEAP (+/−) SEAP (+/−) SEAP (+/−) SEAP (+/−) Group 1 (Saline) 1.000 0.253 1.000 0.145 1.000 0.372 1.000 0.593 Group 2 (3.0 mg/kg AD04634) 0.323 0.032 0.351 0.050 0.343 0.055 0.451 0.252 Group 3 (1.0 mg/kg AD04697) 0.384 0.145 0.364 0.066 0.363 0.184 0.563 0.353 Group 4 (3.0 mg/kg AD04697) 0.236 0.073 0.144 0.007 0.119 0.044 0.207 0.047 Group 5 (0.5 mg/kg AD04698) 0.557 0.112 0.633 0.137 0.688 0.245 1.134 0.293 Group 6 (1.0 mg/kg AD04698) 0.331 0.030 0.301 0.041 0.242 0.010 0.560 0.109 Group 7 (3.0 mg/kg AD04698) 0.186 0.024 0.094 0.013 0.079 0.012 0.203 0.033 Group 8 (3.0 mg/kg AD04795) 0.601 0.258 0.754 0.292 0.862 0.565 1.863 1.301 Group 9 (3.0 mg/kg AD04796) 0.532 0.093 0.949 0.199 0.729 0.076 1.068 0.257 Group 10 (3.0 mg/kg AD04798) 0.643 0.154 1.310 0.700 1.063 0.323 1.252 0.251 Group 11 (3.0 mg/kg AD04799) 0.489 0.220 0.373 0.161 0.400 0.135 0.519 0.315

Example 6. In Vivo Testing of ASGR1 RNAi Agents in ASGR1-SEAP Mice

(199) The ASGR1-SEAP mouse model described in Example 2, above, was used. At day 1, each mouse was given a single subcutaneous injection of 200 μl containing either 1.0 mg/kg or 3.0 mg/kg of an ASGR1 RNAi agent, or 200 μl of saline without an ASGR1 RNAi agent to be used as a control, according to the following Table 13.

(200) TABLE-US-00027 TABLE 13 Dosing groups of ASGR1-SEAP mice of Example 6. Group RNAi Agent and Dose Dosing Regimen 1 Saline (no RNAi agent) Single injection on day 1 2 1.0 mg/kg AD04634 Single injection on day 1 3 3.0 mg/kg AD04634 Single injection on day 1 4 1.0 mg/kg AD04964 Single injection on day 1 5 3.0 mg/kg AD04964 Single injection on day 1 6 1.0 mg/kg AD04698 Single injection on day 1 7 3.0 mg/kg AD04698 Single injection on day 1 8 1.0 mg/kg AD04847 Single injection on day 1 9 3.0 mg/kg AD04847 Single injection on day 1 10 1.0 mg/kg AD04701 Single injection on day 1 11 3.0 mg/kg AD04701 Single injection on day 1 12 1.0 mg/kg AD04965 Single injection on day 1 13 3.0 mg/kg AD04965 Single injection on day 1 14 3.0 mg/kg AD04700 Single injection on day 1 15 3.0 mg/kg AD04793 Single injection on day 1

(201) Each of the ASGR1 RNAi agents included N-acetyl-galactosamine targeting ligands conjugated to the 5′-terminal end of the sense strand, as shown in Tables 4 and 5. The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Four (4) mice in each group were tested (n=4). Serum was collected on day 8, day 13, day 22, and day 29, and SEAP expression levels were determined pursuant to the procedure set forth in Example 2, above. Data from the experiment are shown in the following Table 14, with Average SEAP reflecting the normalized average value of SEAP:

(202) TABLE-US-00028 TABLE 14 Average SEAP normalized to pre-treatment and saline control in ASGR1-SEAP mice from Example 6. Day 8 Day 13 Day 22 Day 29 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID SEAP (+/−) SEAP (+/−) SEAP (+/−) SEAP (+/−) Group 1 (Saline) 1.000 0.639 1.000 0.384 1.000 0.364 1.000 0.477 Group 2 (1.0 mg/kg AD04634) 0.851 0.116 0.825 0.222 0.576 0.086 0.491 0.208 Group 3 (3.0 mg/kg AD04634) 0.538 0.128 0.355 0.150 0.194 0.057 0.249 0.098 Group 4 (1.0 mg/kg AD04964) 0.608 0.217 0.564 0.138 0.358 0.090 0.402 0.244 Group 5 (3.0 mg/kg AD04964) 0.476 0.255 0.374 0.194 0.325 0.204 0.327 0.247 Group 6 (1.0 mg/kg AD04698) 0.404 0.163 0.198 0.069 0.191 0.067 0.186 0.079 Group 7 (3.0 mg/kg AD04698) 0.256 0.073 0.078 0.026 0.083 0.048 0.138 0.103 Group 8 (1.0 mg/kg AD04787) 0.307 0.129 0.138 0.056 0.145 0.068 0.210 0.119 Group 9 (3.0 mg/kg AD04787) 0.383 0.161 0.193 0.154 0.147 0.191 0.230 0.231 Group 10 (1.0 mg/kg AD04701) 0.788 0.122 0.925 0.142 0.759 0.141 0.726 0.078 Group 11 (3.0 mg/kg AD04701) 0.491 0.138 0.640 0.206 0.436 0.067 0.651 0.130 Group 12 (1.0 mg/kg AD04965) 0.813 0.248 0.900 0.209 0.643 0.124 0.904 0.504 Group 13 (3.0 mg/kg AD04965) 0.672 0.338 0.845 0.129 0.523 0.155 0.394 0.090 Group 14 (3.0 mg/kg AD04700) 0.743 0.063 0.793 0.378 0.438 0.287 0.424 0.215 Group 15 (3.0 mg/kg AD04793) 0.504 0.072 0.525 0.142 0.417 0.140 0.458 0.108

Example 7. In Vivo Testing of ASGR1 RNAi Agents in ASGR1-SEAP Mice

(203) The ASGR1-SEAP mouse model described in Example 2, above, was used. At day 1, each mouse was given a single subcutaneous injection of 200 μl containing either 1.0 mg/kg or 3.0 mg/kg of an ASGR1 RNAi agent, or 200 μl of saline without an ASGR1 RNAi agent to be used as a control, according to the following Table 15.

(204) TABLE-US-00029 TABLE 15 Dosing groups of ASGR1-SEAP mice of Example 7. Group RNAi Agent and Dose Dosing Regimen 1 Saline (no RNAi agent) Single injection on day 1 2 1.0 mg/kg AD04698 Single injection on day 1 3 3.0 mg/kg AD04698 Single injection on day 1 4 1.0 mg/kg AD04847 Single injection on day 1 5 3.0 mg/kg AD04847 Single injection on day 1 6 1.0 mg/kg AD04802 Single injection on day 1 7 3.0 mg/kg AD04802 Single injection on day 1 8 1.0 mg/kg AD04975 Single injection on day 1 9 3.0 mg/kg AD04975 Single injection on day 1

(205) Each of the ASGR1 RNAi agents included N-acetyl-galactosamine targeting ligands conjugated to the 5′-terminal end of the sense strand, as shown in Tables 4 and 5. The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Four (4) mice in each group were tested (n=4). Serum was collected on day 8, day 15, day 22, and day 29, and SEAP expression levels were determined pursuant to the procedure set forth in Example 2, above. Data from the experiment are shown in the following Table 16, with Average SEAP reflecting the normalized average value of SEAP:

(206) TABLE-US-00030 TABLE 16 Average SEAP normalized to pre-treatment and saline control in ASGR1-SEAP mice from Example 7. Day 8 Day 15 Day 22 Day 29 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID SEAP (+/−) SEAP (+/−) SEAP (+/−) SEAP (+/−) Group 1 (Saline) 1.000 0.412 1.000 0.421 1.000 0.497 1.000 0.582 Group 2 (1.0 mg/kg AD04698) 0.494 0.104 0.295 0.149 0.239 0.080 0.377 0.108 Group 3 (3.0 mg/kg AD04698) 0.188 0.032 0.077 0.028 0.076 0.048 0.143 0.131 Group 4 (1.0 mg/kg AD04847) 0.517 0.196 0.304 0.129 0.297 0.109 0.533 0.184 Group 5 (3.0 mg/kg AD04847) 0.160 0.069 0.071 0.030 0.085 0.031 0.153 0.025 Group 6 (1.0 mg/kg AD04802) 0.579 0.170 0.372 0.127 0.336 0.152 0.403 0.229 Group 7 (3.0 mg/kg AD04802) 0.304 0.075 0.185 0.083 0.220 0.131 0.297 0.172 Group 8 (1.0 mg/kg AD04975) 0.487 0.069 0.338 0.069 0.453 0.295 0.689 0.537 Group 9 (3.0 mg/kg AD04975) 0.193 0.046 0.097 0.031 0.247 0.060 0.125 0.042

Example 8. In Vivo Testing of ASGR1 RNAi Agents in ASGR1-SEAP Mice

(207) The ASGR1-SEAP mouse model described in Example 2, above, was used. At day 1, each mouse was given a single subcutaneous injection of 200 μl containing either 1.0 mg/kg or 3.0 mg/kg of an ASGR1 RNAi agent, or 200 μl of saline without an ASGR1 RNAi agent to be used as a control, according to the following Table 17.

(208) TABLE-US-00031 TABLE 17 Dosing groups of ASGR1-SEAP mice of Example 8. Group RNAi Agent and Dose Dosing Regimen 1 Saline (no RNAi agent) Single injection on day 1 2 1.0 mg/kg AD04847 Single injection on day 1 3 1.0 mg/kg AD04634 Single injection on day 1 4 1.0 mg/kg AD05067 Single injection on day 1 5 1.0 mg/kg AD05090 Single injection on day 1 6 1.0 mg/kg AD05065 Single injection on day 1 7 1.0 mg/kg AD05066 Single injection on day 1 8 1.0 mg/kg AD05089 Single injection on day 1 9 1.0 mg/kg AD05092 Single injection on day 1 10 1.0 mg/kg AD05093 Single injection on day 1 11 3.0 mg/kg AD05093 Single injection on day 1 12 1.0 mg/kg AD05094 Single injection on day 1 13 3.0 mg/kg AD05094 Single injection on day 1

(209) Each of the ASGR1 RNAi agents included N-acetyl-galactosamine targeting ligands conjugated to the 5′-terminal end of the sense strand, as shown in Tables 4 and 5. The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Three (3) mice in each group were tested (n=3). Serum was collected on day 8, day 15, day 22, and day 29, and SEAP expression levels were determined pursuant to the procedure set forth in Example 2, above. Data from the experiment are shown in the following Table 18, with Average SEAP reflecting the normalized average value of SEAP:

(210) TABLE-US-00032 TABLE 18 Average SEAP normalized to pre-treatment and saline control in ASGR1-SEAP mice from Example 8. Day 8 Day 15 Day 22 Day 29 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID SEAP (+/−) SEAP (+/−) SEAP (+/−) SEAP (+/−) Group 1 (Saline) 1.000 0.160 1.000 0.202 1.000 0.132 1.000 0.346 Group 2 (1.0 mg/kg AD04847) 0.444 0.181 0.404 0.186 0.372 0.226 0.369 0.184 Group 3 (1.0 mg/kg AD04634) 0.619 0.033 0.673 0.209 0.716 0.480 0.671 0.048 Group 4 (1.0 mg/kg AD05067) 0.679 0.059 0.454 0.129 0.200 0.174 0.416 0.557 Group 5 (1.0 mg/kg AD05090) 0.540 0.054 0.489 0.265 0.499 0.176 0.598 0.240 Group 6 (1.0 mg/kg AD05065) 0.605 0.056 0.537 0.118 0.416 0.192 0.483 0.221 Group 7 (1.0 mg/kg AD05066) 0.967 0.193 0.837 0.649 0.426 0.345 0.746 0.488 Group 8 (1.0 mg/kg AD05089) 1.017 0.434 0.547 0.041 0.446 0.134 0.406 0.071 Group 9 (1.0 mg/kg AD05092) 1.191 0.462 1.315 0.217 1.269 0.442 1.143 0.337 Group 10 (1.0 mg/kg AD05093) 1.698 0.150 1.075 0.577 1.056 0.243 0.900 0.365 Group 11 (3.0 mg/kg AD05093) 1.437 0.307 1.368 0.637 1.254 0.589 1.000 0.496 Group 12 (1.0 mg/kg AD05094) 1.838 0.167 1.367 0.548 1.455 0.552 2.236 1.451 Group 13 (3.0 mg/kg AD05094) 1.197 0.622 1.567 0.658 1.451 0.371 1.719 0.279

Example 9. In Vivo Testing of ASGR1 RNAi Agents in ASGR1-SEAP Mice

(211) The ASGR1-SEAP mouse model described in Example 2, above, was used. At day 1, each mouse was given a single subcutaneous injection of 200 μl containing either 1.0 mg/kg or 3.0 mg/kg of an ASGR1 RNAi agent, or 200 μl of saline without an ASGR1 RNAi agent to be used as a control, according to the following Table 19.

(212) TABLE-US-00033 TABLE 19 Dosing groups of ASGR1-SEAP mice of Example 9. Group RNAi Agent and Dose Dosing Regimen 1 Saline (no RNAi agent) Single injection on day 1 2 1.0 mg/kg AD04847 Single injection on day 1 3 3.0 mg/kg AD04634 Single injection on day 1 4 3.0 mg/kg AD04700 Single injection on day 1 5 3.0 mg/kg AD05053 Single injection on day 1 6 3.0 mg/kg AD05096 Single injection on day 1 7 3.0 mg/kg AD05097 Single injection on day 1 8 3.0 mg/kg AD05108 Single injection on day 1 9 3.0 mg/kg AD05109 Single injection on day 1 10 3.0 mg/kg AD05110 Single injection on day 1 11 3.0 mg/kg AD05111 Single injection on day 1 12 3.0 mg/kg AD05112 Single injection on day 1 13 3.0 mg/kg AD05113 Single injection on day 1 14 3.0 mg/kg AD05114 Single injection on day 1 15 3.0 mg/kg AD05115 Single injection on day 1 16 1.0 mg/kg AD05180 Single injection on day 1 17 1.0 mg/kg AD05181 Single injection on day 1 18 1.0 mg/kg AD05182 Single injection on day 1

(213) Each of the ASGR1 RNAi agents included N-acetyl-galactosamine targeting ligands conjugated to the 5′-terminal end of the sense strand, as shown in Tables 4 and 5. The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Three (3) mice in each group were tested (n=3). Serum was collected on day 8, day 13, day 22, day 29, and day 36, and SEAP expression levels were determined pursuant to the procedure set forth in Example 2, above. Data from the experiment are shown in the following Table 20, with Average SEAP reflecting the normalized average value of SEAP:

(214) TABLE-US-00034 TABLE 20 Average SEAP normalized to pre-treatment and saline control in ASGR1-SEAP mice from Example 9. Day 8 Day 13 Day 22 Day 29 Day 36 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID SEAP (+/−) SEAP (+/−) SEAP (+/−) SEAP (+/−) SEAP (+/−) Group 1 (Saline) 1.000 0.323 1.000 0.356 1.000 0.183 1.000 0.045 1.000 0.188 Group 2 (1.0 mg/kg AD04847) 0.411 0.129 0.289 0.121 0.491 0.259 0.631 0.428 1.115 0.941 Group 3 (3.0 mg/kg AD04634) 0.430 0.127 0.466 0.232 0.356 0.142 0.583 0.341 0.600 0.421 Group 4 (3.0 mg/kg AD04700) 0.550 0.021 0.597 0.139 0.826 0.228 0.770 0.131 0.847 0.340 Group 5 (3.0 mg/kg AD05053) 0.591 0.116 0.396 0.068 0.658 0.214 0.745 0.191 0.649 0.226 Group 6 (3.0 mg/kg AD05096) 0.511 0.089 0.445 0.030 0.421 0.085 0.503 0.129 0.532 0.098 Group 7 (3.0 mg/kg AD05097) 0.588 0.095 0.987 0.221 0.996 0.217 1.083 0.206 1.425 0.289 Group 8 (3.0 mg/kg AD05108) 0.253 0.126 0.155 0.093 0.132 0.074 0.134 0.091 0.191 0.093 Group 9 (3.0 mg/kg AD05109) 0.219 0.022 0.141 0.021 0.109 0.041 0.105 0.027 0.181 0.089 Group 10 (3.0 mg/kg AD05110) 0.217 0.061 0.285 0.097 0.335 0.110 0.491 0.073 0.575 0.244 Group 11 (3.0 mg/kg AD05111) 0.470 0.255 0.592 0.160 0.596 0.167 0.821 0.138 0.803 0.477 Group 12 (3.0 mg/kg AD05112) 0.600 0.173 0.862 0.252 0.905 0.517 0.992 0.343 0.905 0.252 Group 13 (3.0 mg/kg AD05113) 0.897 0.105 1.156 0.170 1.124 0.122 0.920 0.319 0.789 0.207 Group 14 (3.0 mg/kg AD05114) 0.567 0.053 0.640 0.087 0.602 0.015 0.763 0.321 0.532 0.185 Group 15 (3.0 mg/kg AD05115) 0.619 0.283 0.608 0.264 0.627 0.198 0.570 0.246 0.514 0.178 Group 16 (1.0 mg/kg AD05180) 0.491 0.111 0.337 0.152 0.466 0.084 0.573 0.152 0.429 0.041 Group 17 (1.0 mg/kg AD05181) 0.493 0.155 0.448 0.338 0.490 0.298 0.617 0.475 0.428 0.322 Group 18 (1.0 mg/kg AD05182) 0.453 0.057 0.405 0.071 0.379 0.065 0.592 0.134 0.718 0.149

Example 10. In Vivo Testing of ASGR1 RNAi Agents in ASGR1-SEAP Mice

(215) The ASGR1-SEAP mouse model described in Example 2, above, was used. At day 1, each mouse was given a single subcutaneous injection of 200 μl containing either 1.0 mg/kg or 3.0 mg/kg of an ASGR1 RNAi agent, or 200 μl of saline without an ASGR1 RNAi agent to be used as a control, according to the following Table 21.

(216) TABLE-US-00035 TABLE 21 Dosing groups of ASGR1-SEAP mice of Example 10. Group RNAi Agent and Dose Dosing Regimen 1 Saline (no RNAi agent) Single injection on day 1 2 1.0 mg/kg AD04847 Single injection on day 1 3 3.0 mg/kg AD05183 Single injection on day 1 4 3.0 mg/kg AD05184 Single injection on day 1 5 3.0 mg/kg AD05185 Single injection on day 1 6 3.0 mg/kg AD05186 Single injection on day 1 7 3.0 mg/kg AD05187 Single injection on day 1 8 3.0 mg/kg AD05188 Single injection on day 1 9 3.0 mg/kg AD05189 Single injection on day 1 10 3.0 mg/kg AD05190 Single injection on day 1 11 3.0 mg/kg AD05191 Single injection on day 1 12 3.0 mg/kg AD05192 Single injection on day 1 13 3.0 mg/kg AD05193 Single injection on day 1 14 3.0 mg/kg AD05194 Single injection on day 1 15 3.0 mg/kg AD05195 Single injection on day 1 16 3.0 mg/kg AD05196 Single injection on day 1

(217) Each of the ASGR1 RNAi agents included N-acetyl-galactosamine targeting ligands conjugated to the 5′-terminal end of the sense strand, as shown in Tables 4 and 5. The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Three (3) mice in each group were tested (n=3). Serum was collected on day 8, day 15, day 22, day 29, and day 36, and SEAP expression levels were determined pursuant to the procedure set forth in Example 2, above. Data from the experiment are shown in the following Table 22, with Average SEAP reflecting the normalized average value of SEAP:

(218) TABLE-US-00036 TABLE 22 Average SEAP normalized to pre-treatment and saline control in ASGR1-SEAP mice from Example 10. Day 8 Day 15 Day 22 Day 29 Day 36 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID SEAP (+/−) SEAP (+/−) SEAP (+/−) SEAP (+/−) SEAP (+/−) Group 1 (Saline) 1.000 0.018 1.000 0.190 1.000 0.205 1.000 0.178 1.000 0.191 Group 2 (1.0 mg/kg AD04847) 0.318 0.103 0.339 0.056 0.247 0.074 0.412 0.095 0.456 0.114 Group 3 (3.0 mg/kg AD05183) 0.106 0.015 0.043 0.025 0.062 0.017 0.062 0.009 0.119 0.055 Group 4 (3.0 mg/kg AD05184) 0.134 0.030 0.143 0.109 0.170 0.150 0.146 0.151 0.215 0.248 Group 5 (3.0 mg/kg AD05185) 0.186 0.060 0.141 0.052 0.095 0.039 0.147 0.018 0.150 0.044 Group 6 (3.0 mg/kg AD05186) 0.107 0.030 0.097 0.032 0.141 0.063 0.170 0.087 0.195 0.069 Group 7 (3.0 mg/kg AD05187) 0.255 0.132 0.264 0.138 0.420 0.204 0.520 0.341 0.678 0.388 Group 8 (3.0 mg/kg AD05188) 0.188 0.061 0.160 0.075 0.182 0.158 0.367 0.297 0.487 0.323 Group 9 (3.0 mg/kg AD05189) 0.538 0.300 0.755 0.256 0.924 0.312 0.752 0.578 0.720 0.486 Group 10 (3.0 mg/kg AD05190) 0.540 0.049 0.697 0.037 0.653 0.150 0.812 0.340 1.114 0.559 Group 11 (3.0 mg/kg AD05191) 0.489 0.293 0.769 0.706 0.686 0.636 0.550 0.566 0.685 0.693 Group 12 (3.0 mg/kg AD05192) 1.307 0.511 1.908 1.094 2.401 0.835 1.826 0.514 3.280 1.958 Group 13 (3.0 mg/kg AD05193) 0.279 0.403 0.204 0.275 0.137 0.171 0.226 0.280 0.475 0.622 Group 14 (3.0 mg/kg AD05194) 0.954 1.497 0.523 0.774 0.377 0.570 0.487 0.702 0.908 1.380 Group 15 (3.0 mg/kg AD05195) 0.153 0.228 0.137 0.187 0.130 0.151 0.094 0.098 0.046 0.039 Group 16 (3.0 mg/kg AD05196) 0.358 0.550 0.024 0.008 0.200 0.297 0.294 0.440 0.479 0.707

Example 11. In Vivo Testing of ASGR1 RNAi Agents in ASGR1-SEAP Mice

(219) The ASGR1-SEAP mouse model described in Example 2, above, was used. At day 1, each mouse was given a single subcutaneous injection of 200 μl containing 1.0 mg/kg of an ASGR1 RNAi agent, or 200 μl of saline without an ASGR1 RNAi agent to be used as a control, according to the following Table 23.

(220) TABLE-US-00037 TABLE 23 Dosing groups of ASGR1-SEAP mice of Example 11. Group RNAi Agent and Dose Dosing Regimen 1 Saline (no RNAi agent) Single injection on day 1 2 1.0 mg/kg AD05067 Single injection on day 1 3 1.0 mg/kg AD05209 Single injection on day 1 4 1.0 mg/kg AD05240 Single injection on day 1 5 1.0 mg/kg AD05256 Single injection on day 1 6 1.0 mg/kg AD05257 Single injection on day 1 7 1.0 mg/kg AD05245 Single injection on day 1 8 1.0 mg/kg AD05246 Single injection on day 1 9 1.0 mg/kg AD05210 Single injection on day 1 10 1.0 mg/kg AD05211 Single injection on day 1 11 1.0 mg/kg AD05213 Single injection on day 1

(221) Each of the ASGR1 RNAi agents included N-acetyl-galactosamine targeting ligands conjugated to the 5′-terminal end of the sense strand, as shown in Tables 4 and 5. The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Three (3) mice in each group were tested (n=3). Serum was collected on day 8, day 15, day 22, day 29, and day 36, and SEAP expression levels were determined pursuant to the procedure set forth in Example 2, above. Data from the experiment are shown in the following Table 24, with Average SEAP reflecting the normalized average value of SEAP:

(222) TABLE-US-00038 TABLE 24 Average SEAP normalized to pre-treatment and saline control in ASGR1-SEAP mice from Example 11. Day 8 Day 15 Day 22 Day 29 Day 36 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID SEAP (+/−) SEAP (+/−) SEAP (+/−) SEAP (+/−) SEAP (+/−) Group 1 (Saline) 1.000 0.378 1.000 0.326 1.000 0.308 1.000 0.264 1.000 0.513 Group 2 (1.0 mg/kg AD05067) 0.380 0.065 0.251 0.090 0.185 0.060 0.296 0.011 0.413 0.082 Group 3 (1.0 mg/kg AD05209) 0.190 0.023 0.103 0.025 0.106 0.079 0.164 0.154 0.210 0.175 Group 4 (1.0 mg/kg AD05240) 0.358 0.158 0.254 0.148 0.354 0.207 0.344 0.183 0.463 0.303 Group 5 (1.0 mg/kg AD05256) 0.237 0.155 0.135 0.081 0.147 0.092 0.108 0.052 0.106 0.062 Group 6 (1.0 mg/kg AD05257) 0.313 0.136 0.172 0.097 0.267 0.152 0.300 0.141 0.337 0.164 Group 7 (1.0 mg/kg AD05245) 0.278 0.029 0.227 0.061 0.324 0.080 0.414 0.130 0.469 0.214 Group 8 (1.0 mg/kg AD05246) 0.793 0.290 1.056 0.066 1.529 0.334 1.297 0.359 1.132 0.308 Group 9 (1.0 mg/kg AD05210) 0.451 0.018 0.394 0.082 0.585 0.075 0.509 0.100 0.715 0.194 Group 10 (1.0 mg/kg AD05211) 0.637 0.160 0.680 0.273 0.660 0.216 0.782 0.209 0.890 0.212 Group 11 (1.0 mg/kg AD05213) 0.280 0.123 0.206 0.070 0.334 0.165 0.469 0.240 0.658 0.459

Example 12. In Vivo Testing of ASGR1 RNAi Agents in ASGR1-SEAP Mice

(223) The ASGR1-SEAP mouse model described in Example 2, above, was used. At day 1, each mouse was given a single subcutaneous injection of 200 μl containing 1.0 mg/kg of an ASGR1 RNAi agent, or 200 μl of saline without an ASGR1 RNAi agent to be used as a control, according to the following Table 25.

(224) TABLE-US-00039 TABLE 25 Dosing groups of ASGR1-SEAP mice of Example 12. Group RNAi Agent and Dose Dosing Regimen 1 Saline (no RNAi agent) Single injection on day 1 2 1.0 mg/kg AD05109 Single injection on day 1 3 1.0 mg/kg AD05193 Single injection on day 1 4 1.0 mg/kg AD05196 Single injection on day 1 5 1.0 mg/kg AD05262 Single injection on day 1 6 1.0 mg/kg AD05263 Single injection on day 1 7 1.0 mg/kg AD05264 Single injection on day 1 8 1.0 mg/kg AD05265 Single injection on day 1 9 1.0 mg/kg AD05266 Single injection on day 1 10 1.0 mg/kg AD05267 Single injection on day 1 11 1.0 mg/kg AD05268 Single injection on day 1

(225) Each of the ASGR1 RNAi agents included N-acetyl-galactosamine targeting ligands conjugated to the 5′-terminal end of the sense strand, as shown in Tables 4 and 5. The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Three (3) mice in each group were tested (n=3). Serum was collected on day 8, day 15, day 23, day 29, and day 36, and SEAP expression levels were determined pursuant to the procedure set forth in Example 2, above. Data from the experiment are shown in the following Table 26, with Average SEAP reflecting the normalized average value of SEAP:

(226) TABLE-US-00040 TABLE 26 Average SEAP normalized to pre-treatment and saline control in ASGR1-SEAP mice from Example 12. Day 8 Day 15 Day 23 Day 29 Day 36 Std Std Std Std Std Avg Dev Avg Dev Avg Dev Avg Dev Avg Dev Group ID SEAP (+/−) SEAP (+/−) SEAP (+/−) SEAP (+/−) SEAP (+/−) Group 1 (Saline) 1.000 0.418 1.000 0.481 1.000 0.215 1.000 0.643 1.000 0.655 Group 2 (1.0 mg/kg AD05109) 0.372 0.050 0.255 0.047 0.358 0.190 0.205 0.005 0.184 0.125 Group 3 (1.0 mg/kg AD05193) 0.166 0.074 0.093 0.061 0.122 0.092 0.087 0.063 0.085 0.081 Group 4 (1.0 mg/kg AD05196) 0.177 0.034 0.142 0.049 0.219 0.088 0.191 0.098 0.132 0.055 Group 5 (1.0 mg/kg AD05262) 0.768 0.215 0.606 0.192 1.108 0.429 0.642 0.344 0.717 0.422 Group 6 (1.0 mg/kg AD05263) 0.267 0.084 0.162 0.042 0.215 0.023 0.263 0.042 0.206 0.084 Group 7 (1.0 mg/kg AD05264) 0.420 0.016 0.425 0.049 0.715 0.239 0.744 0.103 0.498 0.163 Group 8 (1.0 mg/kg AD05265) 0.561 0.280 0.703 0.391 1.105 0.732 0.793 0.532 0.652 0.412 Group 9 (1.0 mg/kg AD05266) 0.329 0.071 0.338 0.050 1.021 0.541 0.456 0.195 0.397 0.229 Group 10 (1.0 mg/kg AD05267) 0.369 0.038 0.652 0.223 1.581 0.403 0.748 0.255 0.653 0.079 Group 11 (1.0 mg/kg AD05268) 0.216 0.093 0.201 0.067 0.299 0.134 0.151 0.050 0.213 0.034

Example 13. In Vivo Testing of ASGR1 RNAi Agents in ASGR1-SEAP Mice

(227) The ASGR1-SEAP mouse model described in Example 2, above, was used. At day 1, each mouse was given a single subcutaneous injection of 200 μl containing 1.0 mg/kg of an ASGR1 RNAi agent, or 200 μl of saline without an ASGR1 RNAi agent to be used as a control, according to the following Table 27.

(228) TABLE-US-00041 TABLE 27 Dosing groups of ASG7R1-SEAP mice of Example 13. Group RNAi Agent and Dose Dosing Regimen 1 Saline (no RNAi agent) Single injection on day 1 2 1.0 mg/kg AD05067 Single injection on day 1 3 1.0 mg/kg AD05241 Single injection on day 1 4 1.0 mg/kg AD05242 Single injection on day 1 5 1.0 mg/kg AD05243 Single injection on day 1 6 1.0 mg/kg AD05109 Single injection on day 1 7 1.0 mg/kg AD05244 Single injection on day 1 8 1.0 mg/kg AD05247 Single injection on day 1 9 1.0 mg/kg AD05248 Single injection on day 1 10 1.0 mg/kg AD05212 Single injection on day 1 11 1.0 mg/kg AD05214 Single injection on day 1 12 1.0 mg/kg AD05206 Single injection on day 1 13 1.0 mg/kg AD05207 Single injection on day 1 14 1.0 mg/kg AD05208 Single injection on day 1

(229) Each of the ASGR1 RNAi agents included N-acetyl-galactosamine targeting ligands conjugated to the 5′-terminal end of the sense strand, as shown in Tables 4 and 5. The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Three (3) mice in each group were tested (n=3). Serum was collected on day 8, day 16, day 22, day 29, and day 36, and SEAP expression levels were determined pursuant to the procedure set forth in Example 2, above. Data from the experiment are shown in the following Table 28, with Average SEAP reflecting the normalized average value of SEAP:

(230) TABLE-US-00042 TABLE 28 Average SEAP normalized to pre-treatment and saline control in ASGR1-SEAP mice from Example 13. Day 8 Day 16 Day 22 Day 29 Day 36 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID SEAP (+/−) SEAP (+/−) SEAP (+/−) SEAP (+/−) SEAP (+/−) Group 1 (Saline) 1.000 0.252 1.000 0.134 1.000 0.375 1.000 0.454 1.000 0.337 Group 2 (1.0 mg/kg AD05067) 0.353 0.107 0.203 0.074 0.239 0.044 0.270 0.039 0.307 0.064 Group 3 (1.0 mg/kg AD05241) 0.457 0.177 0.338 0.184 0.217 0.093 0.236 0.129 0.325 0.186 Group 4 (1.0 mg/kg AD05242) 0.302 0.181 0.209 0.147 0.209 0.148 0.214 0.099 0.164 0.019 Group 5 (1.0 mg/kg AD05243) 0.379 0.133 0.141 0.022 0.111 0.040 0.134 0.033 0.158 0.041 Group 6 (1.0 mg/kg AD05109) 0.454 0.087 0.171 0.054 0.114 0.036 0.136 0.063 0.176 0.066 Group 7 (1.0 mg/kg AD05244) 0.468 0.138 0.363 0.209 0.274 0.189 0.170 0.096 0.244 0.086 Group 8 (1.0 mg/kg AD05247) 0.662 0.249 0.670 0.299 0.569 0.232 0.594 0.288 0.804 0.531 Group 9 (1.0 mg/kg AD05248) 0.597 0.127 0.325 0.252 0.276 0.182 0.246 0.241 0.293 0.301 Group 10 (1.0 mg/kg AD05212) 0.413 0.045 0.244 0.122 0.123 0.072 0.119 0.047 0.171 0.077 Group 11 (1.0 mg/kg AD05214) 0.486 0.049 0.252 0.104 0.213 0.063 0.198 0.015 0.189 0.023 Group 12 (1.0 mg/kg AD05206) 0.359 0.166 0.196 0.066 0.214 0.089 0.284 0.104 0.416 0.127 Group 13 (1.0 mg/kg AD05207) 1.109 0.103 0.484 0.223 0.381 0.275 0.404 0.247 0.605 0.382 Group 14 (1.0 mg/kg AD05208) 0.529 0.063 0.252 0.022 0.221 0.026 0.160 0.042 0.303 0.112

Example 14. In Vivo Testing of ASGR1 RNAi Agents in ASGR1-SEAP Mice

(231) The ASGR1-SEAP mouse model described in Example 2, above, was used. At day 1, each mouse was given a single subcutaneous injection of 200 μl containing either 0.5 mg/kg, 1.0 mg/kg, or 3.0 mg/kg of an ASGR1 RNAi agent, or 200 μl of saline without an ASGR1 RNAi agent to be used as a control, according to the following Table 29.

(232) TABLE-US-00043 TABLE 29 Dosing groups of ASGR1-SEAP mice of Example 14. Group RNAi Agent and Dose Dosing Regimen 1 Saline (no RNAi agent) Single injection on day 1 2 0.5 mg/kg AD05067 Single injection on day 1 3 1.0 mg/kg AD05067 Single injection on day 1 4 3.0 mg/kg AD05067 Single injection on day 1 5 0.5 mg/kg AD05183 Single injection on day 1 6 1.0 mg/kg AD05183 Single injection on day 1 7 3.0 mg/kg AD05183 Single injection on day 1 8 0.5 mg/kg AD05209 Single injection on day 1 9 1.0 mg/kg AD05209 Single injection on day 1 10 4.0 mg/kg AD05209 Single injection on day 1 11 0.5 mg/kg AD05256 Single injection on day 1 12 1.0 mg/kg AD05256 Single injection on day 1 13 3.0 mg/kg AD05256 Single injection on day 1

(233) Each of the ASGR1 RNAi agents included N-acetyl-galactosamine targeting ligands conjugated to the 5′-terminal end of the sense strand, as shown in Tables 4 and 5. The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Three (3) mice in each group were tested (n=3). Serum was collected on day 8, day 15, day 22, day 29, and day 36, and SEAP expression levels were determined pursuant to the procedure set forth in Example 2, above. Data from the experiment are shown in the following Table 30, with Average SEAP reflecting the normalized average value of SEAP:

(234) TABLE-US-00044 TABLE 30 Average SEAP normalized to pre-treatment and saline control in ASGR1-SEAP mice from Example 14. Day 8 Day 15 Day 22 Day 29 Day 36 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID SEAP (+/−) SEAP (+/−) SEAP (+/−) SEAP (+/−) SEAP (+/−) Group 1 (Saline) 1.000 0.479 1.000 0.737 1.000 0.401 1.000 0.359 1.000 0.601 Group 2 (0.5 mg/kg AD05067) 0.315 0.178 0.215 0.087 0.175 0.072 0.143 0.047 0.218 0.042 Group 3 (1.0 mg/kg AD05067) 0.265 0.136 0.129 0.071 0.139 0.025 0.165 0.029 0.238 0.046 Group 4 (3.0 mg/kg AD05067) 0.250 0.092 0.069 0.036 0.083 0.029 0.083 0.060 0.138 0.130 Group 5 (0.5 mg/kg AD05183) 0.274 0.140 0.156 0.053 0.173 0.069 0.215 0.039 0.261 0.111 Group 6 (1.0 mg/kg AD05183) 0.305 0.047 0.123 0.020 0.158 0.093 0.221 0.069 0.157 0.051 Group 7 (3.0 mg/kg AD05183) 0.182 0.060 0.052 0.028 0.069 0.036 0.070 0.045 0.069 0.068 Group 8 (0.5 mg/kg AD05209) 0.295 0.110 0.193 0.062 0.268 0.131 0.399 0.232 0.404 0.160 Group 9 (1.0 mg/kg AD05209) 0.185 0.034 0.073 0.031 0.113 0.051 0.120 0.055 0.175 0.106 Group 10 (3.0 mg/kg AD05209) 0.100 0.021 0.020 0.007 0.024 0.004 0.025 0.013 0.036 0.024 Group 11 (0.5 mg/kg AD05256) 0.618 0.069 0.334 0.087 0.397 0.128 0.430 0.312 0.484 0.298 Group 12 (1.0 mg/kg AD05256) 0.392 0.126 0.129 0.015 0.195 0.067 0.238 0.075 0.255 0.111 Group 13 (3.0 mg/kg AD05256) 0.199 0.063 0.070 0.033 0.110 0.078 0.134 0.079 0.121 0.063

(235) As shown in Table 30 above, a dose response is observed for each of the ASGR1 RNAi agents tested. For example, on day 22, ASGR1 RNAi agent AD05209 showed knockdown of approximately 73% (0.268) at 0.5 mg/kg; approximately 89% (0.113) at 1.0 mg/kg; and approximately 98% (0.024) at 3.0 mg/kg administered dose.

Example 15. In Vivo Testing of ASGR1 RNAi Agents in Cynomolgus Monkeys

(236) ASGR1 RNAi agents were evaluated in cynomolgus monkeys. On day 1, cynomolgus macaque (Macaca fascicularis) primates (“cynomolgus monkeys”) were given a single subcutaneous injection of 0.3 mL/kg (approximately 2-3 mL volume, depending on animal mass) containing 5.0 mg/kg of ASGR1 RNAi agent AD05126 or AD05150, formulated in saline. Each of the ASGR1 RNAi agents included N-acetyl-galactosamine targeting ligands conjugated to the 5′-terminal end of the sense strand, as shown in Tables 4 and 5.

(237) Two (2) monkeys in each group were tested (n=2). Blood samples were drawn and serum samples were analyzed on days 1 (predose), 8, 15, 22, 29, 36, and 50, for alkaline phosphatase (referred to as “ALP”, “ALKP”, or “Alk-Phos”) and standard clinical chemistry panel. As ALP is a substrate of ASGR1, reduction of ASGR1 is expected to increase ALP levels, as observed in the ASGR1 del12 carriers in the human population. Overall, reduction of ASGR1 levels by 50% in ASGR1 del12 carriers showed an increase in ALP levels of around 50.1%. Therefore, ALP has been shown to serve as a surrogate biomarker for monitoring reduction in ASGR1 and inhibition of an ASGR1 gene. (Nioi et al., 2016). ALP levels in serum were measured on a Cobas® Integra 400 (Roche Diagnostics), according to the manufacturer's recommendations.

(238) Data from the experiment are shown in the following Tables 31 and 32, which report raw ALP values (units/L) as well as ALP normalized to averaged individual pre-treatment levels.

(239) TABLE-US-00045 TABLE 31 ALP levels from cynomolgus monkeys from Example 15 (ALP levels reported in units/L) from Cobas ®. Mean Predose Day 8 Day 15 Day 22 Day 29 Day 36 Day 50 Group ID ALP ALP ALP ALP ALP ALP ALP AD05126 (Cyno A) (5.0 mg/kg) 74 88 100 120 122 115 107 AD05126 (Cyno B) (5.0 mg/kg) 115 128 151 159 160 146 159 AD05150 (Cyno A) (5.0 mg/kg) 90 100 103 110 104 111 101 AD05150 (Cyno B) (5.0 mg/kg) 105 112 136 152 165 153 161

(240) TABLE-US-00046 TABLE 32 Normalized ALP levels from cynomolgus monkeys from Example 15 from Cobas ®. Mean Predose Day 8 Day 15 Day 22 Day 29 Day 36 Day 50 Group ID ALP ALP ALP ALP ALP ALP ALP AD05126 (Cyno A) (5.0 mg/kg) 1.00 1.19 1.36 1.63 1.66 1.56 1.45 AD05126 (Cyno B) (5.0 mg/kg) 1.00 1.12 1.32 1.39 1.40 1.27 1.39 AD05150 (Cyno A) (5.0 mg/kg) 1.00 1.11 1.14 1.22 1.15 1.23 1.12 AD05150 (Cyno B) (5.0 mg/kg) 1.00 1.06 1.29 1.44 1.57 1.45 1.53

(241) Each of cynomolgus monkeys dosed with either AD05126 or AD05150 showed in increase in ALP compared to pre-dose measurements across all measured time points, indicating a reduction in ASGR1 protein levels and inhibition of ASGR1.

Example 16. In Vivo Testing of ASGR1 RNAi Agents in Cynomolgus Monkeys

(242) ASGR1 RNAi agents were evaluated in cynomolgus monkeys. On day 1, cynomolgus macaque (Macaca fascicularis) primates (“cynomolgus monkeys”) were given a single subcutaneous injection of 0.3 mL/kg (approximately 2-3 mL volume, depending on animal mass) containing 5.0 mg/kg of ASGR1 RNAi agent AD05186 or AD05196, formulated in saline. Each of the ASGR1 RNAi agents included N-acetyl-galactosamine targeting ligands conjugated to the 5′-terminal end of the sense strand, as shown in Tables 4 and 5.

(243) Two (2) monkeys in each group were tested (n=2). Blood samples were drawn and serum samples were analyzed on days 1 (predose), 8, 15, 22, 29, 36, and 43, for ALP and standard clinical chemistry panel. As noted in Example 15, ALP serves as a surrogate biomarker for monitoring reduction in ASGR1 and inhibition of an ASGR1 gene. ALP levels in serum were measured on a Cobas® Integra 400 (Roche Diagnostics), according to the manufacturer's recommendations.

(244) Data from the experiment are shown in the following Tables 33 and 34, which report raw ALP values (units/L) as well as ALP normalized to averaged individual pre-treatment levels.

(245) TABLE-US-00047 TABLE 33 ALP levels from cynomolgus monkeys from Example 16 (ALP levels reported in units/L) from Cobas ®. Mean Predose Day 8 Day 15 Day 22 Day 29 Day 36 Day 43 Group ID ALP ALP ALP ALP ALP ALP ALP AD05186 (Cyno A) (5.0 mg/kg) 89 96 118 135 134 127 134 AD05186 (Cyno B) (5.0 mg/kg) 177 213 284 324 354 380 364 AD05196 (Cyno A) (5.0 mg/kg) 97 107 143 178 206 219 199 AD05196 (Cyno B) (5.0 mg/kg) 170 177 237 255 292 285 304

(246) TABLE-US-00048 TABLE 34 Normalized ALP levels from cynomolgus monkeys from Example 16 from Cobas ®. Mean Predose Day 8 Day 15 Day 22 Day 29 Day 36 Day 43 Group ID ALP ALP ALP ALP ALP ALP ALP AD05186 (Cyno A) (5.0 mg/kg) 1.00 1.08 1.33 1.52 1.51 1.43 1.51 AD05186 (Cyno B) (5.0 mg/kg) 1.00 1.21 1.61 1.84 2.01 2.15 2.06 AD05196 (Cyno A) (5.0 mg/kg) 1.00 1.10 1.47 1.84 2.12 2.26 2.05 AD05196 (Cyno B) (5.0 mg/kg) 1.00 1.04 1.40 1.50 1.72 1.68 1.79

Example 17. In Vivo Testing of ASGR1 RNAi Agents in Cynomolgus Monkeys

(247) ASGR1 RNAi agents were evaluated in cynomolgus monkeys. On day 1, cynomolgus macaque (Macaca fascicularis) primates were given a single subcutaneous injection of 0.3 mL/kg (approximately 2-3 mL volume, depending on animal mass) containing 3.0 mg/kg of ASGR1 RNAi agent AD05183 or AD05193, formulated in saline. Each of the ASGR1 RNAi agents included N-acetyl-galactosamine targeting ligands conjugated to the 5′-terminal end of the sense strand, as shown in Tables 4 and 5.

(248) Two (2) monkeys in each group were tested (n=2). Blood samples were drawn and serum samples were analyzed on days 8, 15, 22, 29, 36, and 43, for ALP and standard clinical chemistry panel. As noted in Example 15, ALP serves as a surrogate biomarker for monitoring reduction in ASGR1 and inhibition of an ASGR1 gene. ALP levels in serum were measured on a Cobas® Integra 400 (Roche Diagnostics), according to the manufacturer's recommendations.

(249) Data from the experiment are shown in the following Tables 35 and 36, which report raw ALP values (units/L) as well as ALP normalized to averaged individual pre-treatment levels.

(250) TABLE-US-00049 TABLE 35 ALP levels from cynomolgus monkeys from Example 17 (ALP levels reported in units/L) from Cobas ®. Mean Predose Day 8 Day 15 Day 22 Day 29 Day 36 Day 43 Group ID ALP ALP ALP ALP ALP ALP ALP AD05183 (Cyno A) (3.0 mg/kg) 236 245 347 472 575 630 578 AD05183 (Cyno B) (3.0 mg/kg) 193 186 250 318 411 452 458 AD05193 (Cyno A) (3.0 mg/kg) 295 272 374 490 620 693 593 AD05193 (Cyno B) (3.0 mg/kg) 242 238 284 369 427 481 440

(251) TABLE-US-00050 TABLE 36 Normalized ALP levels from cynomolgus monkeys from Example 17 from Cobas ®. Mean Predose Day 8 Day 15 Day 22 Day 29 Day 36 Day 43 Group ID ALP ALP ALP ALP ALP ALP ALP AD05183 (Cyno A) (3.0 mg/kg) 1.00 1.04 1.47 2.00 2.44 2.67 2.45 AD05183 (Cyno B) (3.0 mg/kg) 1.00 0.97 1.30 1.65 2.13 2.35 2.38 AD05193 (Cyno A) (3.0 mg/kg) 1.00 0.92 1.27 1.66 2.10 2.35 2.01 AD05193 (Cyno B) (3.0 mg/kg) 1.00 0.98 1.17 1.52 1.76 1.99 1.82

Example 18. In Vivo Testing of ASGR1 RNAi Agents in Cynomolgus Monkeys

(252) ASGR1 RNAi agents were evaluated in cynomolgus monkeys. On day 1, cynomolgus macaque (Macaca fascicularis) primates were given a single subcutaneous injection of 0.3 mL/kg (approximately 2-3 mL volume, depending on animal mass) containing 16.7 mg/mL for a total dose of 5.0 mg/kg of ASGR1 RNAi agent AD05209, AD05195, or AD05256, formulated in saline. Each of the ASGR1 RNAi agents included N-acetyl-galactosamine targeting ligands conjugated to the 5′-terminal end of the sense strand, as shown in Tables 4 and 5.

(253) Two (2) monkeys in each group were tested, except for AD05195 where only 1 monkey was dosed. Blood samples were drawn and serum samples were analyzed on days 8, 15, 22, and 29, for ALP and standard clinical chemistry panel. As noted in Example 15, ALP serves as a surrogate biomarker for monitoring reduction in ASGR1 and inhibition of an ASGR1 gene. ALP levels in serum were measured on a Cobas® Integra 400 (Roche Diagnostics), according to the manufacturer's recommendations.

(254) Data from the experiment are shown in the following Tables 37 and 38, which report raw ALP values (units/L) as well as ALP normalized to averaged individual pre-treatment levels.

(255) TABLE-US-00051 TABLE 37 ALP levels from cynomolgus monkeys from Example 18 (ALP levels reported in units/L) from Cobas ®. Mean Predose Day 8 Day 15 Day 22 Day 29 Group ID ALP ALP ALP ALP ALP AD05209 (Cyno 64 77 147 199 231 A) (5.0 mg/kg) AD05209 (Cyno 81 114 174 214 223 B) (5.0 mg/kg) AD05195 (Cyno 116 122 161 181 177 A) (5.0 mg/kg) AD05256 (Cyno 69 73 79 86 91 A) (5.0 mg/kg) AD05256 (Cyno 122 163 255 313 352 B) (5.0 mg/kg)

(256) TABLE-US-00052 TABLE 38 Normalized ALP levels from cynomolgus monkeys from Example 18 from Cobas ®. Mean Predose Day 8 Day 15 Day 22 Day 29 Group ID ALP ALP ALP ALP ALP AD05209 (Cyno 1.00 1.20 2.30 3.11 3.61 A) (5.0 mg/kg) AD05209 (Cyno 1.00 1.41 2.15 2.64 2.75 B) (5.0 mg/kg) AD05195 (Cyno 1.00 1.06 1.39 1.57 1.53 A) (5.0 mg/kg) AD05256 (Cyno 1.00 1.06 1.14 1.25 1.32 A) (5.0 mg/kg) AD05256 (Cyno 1.00 1.34 2.10 2.58 2.90 B) (5.0 mg/kg)

Example 19. In Vivo Testing of ASGR1 RNAi Agents in Cynomolgus Monkeys

(257) ASGR1 RNAi agents were evaluated in cynomolgus monkeys. On day 1, cynomolgus macaque (Macaca fascicularis) primates were given a single subcutaneous injection of 0.3 mL/kg (approximately 2-3 mL volume, depending on animal mass) containing 10.0 mg/mL, 16.7 mg/mL, or 26.7 mg/mL, for a total dose of 3.0 mg/kg, 5.0 mg/kg, or 8.0 mg/kg, respectively, of ASGR1 RNAi agent AD05183 formulated in saline. An additional group was dosed with 0.3 mL/kg (approximately 2-3 mL volume, depending on animal mass) with saline to be used as a control. Each of ASGR1 RNAi agents included N-acetyl-galactosamine targeting ligands conjugated to the 5′-terminal end of the sense strand, as shown in Tables 4 and 5.

(258) Two (2) monkeys in each group were tested, except that one of the monkeys dosed with saline control died prior to day 15. Blood samples were drawn and serum samples were analyzed on days 8, 15, 22, 29, 36, 43, 50 and 57 for ALP and standard clinical chemistry panel. As noted in Example 15, ALP serves as a surrogate biomarker for monitoring reduction in ASGR1 and inhibition of an ASGR1 gene. ALP levels in serum were measured on a Cobas® Integra 400 (Roche Diagnostics), according to the manufacturer's recommendations.

(259) Data from the experiment are shown in the following Tables 39 and 40, which report raw ALP values (units/L) as well as ALP normalized to averaged individual pre-treatment levels.

(260) TABLE-US-00053 TABLE 39 ALP levels from cynomolgus monkeys from Example 19 (ALP levels reported in units/L) from Cobas ®. Day 1 (pre-dose) Day 8 Day 15 Day 22 Day 29 Day 36 Day 43 Day 50 Day 57 Group ID ALP ALP ALP ALP ALP ALP ALP ALP ALP Saline vehicle (Cyno A) 644 544 Saline vehicle (Cyno B) 337 341 317 297 313 331 342 329 347 3.0 mg/kg AD05183 (Cyno A) 350 421 698 919 847 739 727 776 759 3.0 mg/kg AD05183 (Cyno B) 633 735 1053 1116 1423 1161 1181 1187 1130 5.0 mg/kg AD05183 (Cyno A) 554 681 1079 1146 1317 1184 1179 1386 1391 5.0 mg/kg AD05183 (Cyno B) 415 491 790 799 815 848 794 818 788 8.0 mg/kg AD05183 (Cyno A) 459 592 874 1006 1249 1065 1028 1251 1120 8.0 mg/kg AD05183 (Cyno B) 630 689 816 957 959 888 913 1007 959

(261) TABLE-US-00054 TABLE 40 Normalized ALP levels from cynomolgus monkeys from Example 19 from Cobas ®. Day 1 (pre-dose) Day 8 Day 15 Day 22 Day 29 Day 36 Day 43 Day 50 Day 57 Group ID ALP ALP ALP ALP ALP ALP ALP ALP ALP Saline vehicle (Cyno A) 1.00 0.85 Saline vehicle (Cyno B) 1.00 1.01 0.94 0.88 0.93 0.98 1.02 0.98 1.03 3.0 mg/kg AD05183 (Cyno A) 1.00 1.20 1.99 2.62 2.42 2.11 2.08 2.22 2.17 3.0 mg/kg AD05183 (Cyno B) 1.00 1.16 1.66 1.76 2.25 1.84 1.87 1.88 1.79 5.0 mg/kg AD05183 (Cyno A) 1.00 1.23 1.95 2.07 2.38 2.14 2.13 2.50 2.51 5.0 mg/kg AD05183 (Cyno B) 1.00 1.18 1.90 1.93 1.96 2.04 1.91 1.97 1.90 8.0 mg/kg AD05183 (Cyno A) 1.00 1.29 1.90 2.19 2.72 2.32 2.24 2.72 2.44 8.0 mg/kg AD05183 (Cyno B) 1.00 1.09 1.30 1.52 1.52 1.41 1.45 1.60 1.52

Example 20. In Vivo Testing of ASGR1 RNAi Agents in ASGR1-SEAP Mice

(262) The ASGR1-SEAP mouse model described in Example 2, above, was used. At day 1, each mouse was given a single subcutaneous injection of 200 μl containing 1.0 mg/kg of an ASGR1 RNAi agent, or 200 μl of saline without an ASGR1 RNAi agent to be used as a control, according to the following Table 41.

(263) TABLE-US-00055 TABLE 41 Dosing groups of ASGR1-SEAP mice of Example 20. Group RNAi Agent and Dose Dosing Regimen 1 Saline (no RNAi agent) Single injection on day 1 2 1.0 mg/kg AD05067 Single injection on day 1 3 1.0 mg/kg AD05183 Single injection on day 1 4 1.0 mg/kg AD05209 Single injection on day 1 5 1.0 mg/kg AD05256 Single injection on day 1 6 1.0 mg/kg AD05373 Single injection on day 1 7 1.0 mg/kg AD05374 Single injection on day 1 8 1.0 mg/kg AD05375 Single injection on day 1 9 1.0 mg/kg AD05376 Single injection on day 1 10 1.0 mg/kg AD05377 Single injection on day 1 11 1.0 mg/kg AD05378 Single injection on day 1 12 1.0 mg/kg AD05379 Single injection on day 1 13 1.0 mg/kg AD05380 Single injection on day 1

(264) Each of the ASGR1 RNAi agents included N-acetyl-galactosamine targeting ligands conjugated to the 5′-terminal end of the sense strand, as shown in Tables 4 and 5. The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Three (3) mice in each group were tested (n=3). Serum was collected on day 8, day 15, day 22, day 29, and day 36, and SEAP expression levels were determined pursuant to the procedure set forth in Example 2, above. Data from the experiment are shown in the following Table 42, with Average SEAP reflecting the normalized average value of SEAP:

(265) TABLE-US-00056 TABLE 42 Average SEAP normalized to pre-treatment and saline control in ASGR1-SEAP mice from Example 20. Day 8 Day 15 Day 22 Day 29 Day 36 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID SEAP (+/−) SEAP (+/−) SEAP (+/−) SEAP (+/−) SEAP (+/−) Group 1 (Saline) 1.000 0.214 1.000 0.205 1.000 0.253 1.000 0.469 1.000 0.207 Group 2 (1.0 mg/kg AD05067) 0.490 0.126 0.303 0.102 0.284 0.099 0.286 0.173 0.570 0.459 Group 3 (1.0 mg/kg AD05183) 0.404 0.138 0.205 0.109 0.216 0.093 0.311 0.089 0.574 0.343 Group 4 (1.0 mg/kg AD05209) 0.209 0.100 0.110 0.084 0.146 0.101 0.233 0.209 0.483 0.403 Group 5 (1.0 mg/kg AD05256) 0.413 0.159 0.238 0.124 0.252 0.148 0.338 0.172 0.276 0.113 Group 6 (1.0 mg/kg AD05373) 0.397 0.091 0.236 0.091 0.572 0.136 0.654 0.233 0.987 0.489 Group 7 (1.0 mg/kg AD05374) 0.266 0.051 0.248 0.148 0.281 0.069 0.443 0.204 0.634 0.357 Group 8 (1.0 mg/kg AD05375) 0.388 0.156 0.519 0.255 0.672 0.090 1.005 0.327 1.208 0.523 Group 9 (1.0 mg/kg AD05376) 0.270 0.071 0.321 0.239 0.295 0.078 0.349 0.166 0.455 0.233 Group 10 (1.0 mg/kg AD05377) 0.442 0.085 0.624 0.228 0.846 0.308 1.012 0.413 1.133 0.236 Group 11 (1.0 mg/kg AD05378) 0.304 0.080 0.203 0.097 0.280 0.117 0.315 0.079 0.635 0.184 Group 12 (1.0 mg/kg AD05379) 0.372 0.029 0.366 0.077 0.471 0.191 0.660 0.185 1.169 0.244 Group 13 (1.0 mg/kg AD05380) 0.298 0.084 0.320 0.251 0.289 0.098 0.409 0.233 0.846 0.702

Example 21. In Vivo Testing of ASGR1 RNAi Agents in ASGR1-SEAP Mice

(266) The ASGR1-SEAP mouse model described in Example 2, above, was used. At day 1, each mouse was given a single subcutaneous injection of 200 μl containing 1.0 mg/kg of an ASGR1 RNAi agent, or 200 μl of saline without an ASGR1 RNAi agent to be used as a control, according to the following Table 43.

(267) TABLE-US-00057 TABLE 43 Dosing groups of ASGR1-SEAP mice of Example 21. Group RNAi Agent and Dose Dosing Regimen 1 Saline (no RNAi agent) Single injection on day 1 2 1.0 mg/kg AD05193 Single injection on day 1 3 1.0 mg/kg AD05196 Single injection on day 1 4 1.0 mg/kg AD05462 Single injection on day 1 5 1.0 mg/kg AD05603 Single injection on day 1 6 1.0 mg/kg AD05604 Single injection on day 1 7 1.0 mg/kg AD05605 Single injection on day 1 8 1.0 mg/kg AD05606 Single injection on day 1 9 1.0 mg/kg AD05607 Single injection on day 1 10 1.0 mg/kg AD05608 Single injection on day 1 11 1.0 mg/kg AD05609 Single injection on day 1 12 1.0 mg/kg AD05610 Single injection on day 1 13 1.0 mg/kg AD05624 Single injection on day 1

(268) Each of the ASGR1 RNAi agents included N-acetyl-galactosamine targeting ligands conjugated to the 5′-terminal end of the sense strand, as shown in Tables 4 and 5. The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Three (3) mice in each group were tested (n=3). Serum was collected on day 8, day 15, day 22, day 29, and day 36, and SEAP expression levels were determined pursuant to the procedure set forth in Example 2, above. Data from the experiment are shown in the following Table 44, with Average SEAP reflecting the normalized average value of SEAP:

(269) TABLE-US-00058 TABLE 44 Average SEAP normalized to pre-treatment and saline control in ASGR1-SEAP mice from Example 21. Day 8 Day 15 Day 22 Day 29 Day 36 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID SEAP (+/−) SEAP (+/−) SEAP (+/−) SEAP (+/−) SEAP (+/−) Group 1 (Saline) 1.000 0.349 1.000 0.246 1.000 0.152 1.00 0.330 1.000 0.305 Group 2 (1.0 mg/kg AD05193) 0.307 0.177 0.275 0.273 0.480 0.451 0.465 0.442 0.539 0.557 Group 3 (1.0 mg/kg AD05196) 0.176 0.072 0.120 0.052 0.181 0.053 0.186 0.107 0.481 0.272 Group 4 (1.0 mg/kg AD05462) 0.230 0.015 0.176 0.121 0.374 0.054 0.739 0.097 0.775 0.320 Group 5 (1.0 mg/kg AD05603) 0.186 0.060 0.242 0.033 0.529 0.170 0.645 0.134 1.321 0.295 Group 6 (1.0 mg/kg AD05604) 0.170 0.029 0.171 0.128 0.204 0.159 0.318 0.343 0.452 0.448 Group 7 (1.0 mg/kg AD05605) 0.149 0.026 0.127 0.036 0.222 0.036 0.304 0.018 0.404 0.115 Group 8 (1.0 mg/kg AD05606) 0.144 0.024 0.130 0.035 0.380 0.038 0.406 0.081 0.672 0.054 Group 9 (1.0 mg/kg AD05607) 0.166 0.032 0.095 0.046 0.137 0.049 0.194 0.084 0.268 0.176 Group 10 (1.0 mg/kg AD05608) 0.181 0.051 0.149 0.085 0.247 0.186 0.342 0.184 0.587 0.393 Group 11 (1.0 mg/kg AD05609) 0.120 0.008 0.118 0.031 0.223 0.047 0.210 0.109 0.493 0.333 Group 12 (1.0 mg/kg AD05610) 0.151 0.028 0.098 0.053 0.255 0.138 0.274 0.117 0.342 0.161 Group 13 (1.0 mg/kg AD05624) 0.165 0.072 0.595 0.582 0.912 1.128 0.391 0.306 0.611 0.757

Example 22. In Vivo Testing of ASGR1 RNAi Agents in Cynomolgus Monkeys

(270) ASGR1 RNAi agents were evaluated in cynomolgus monkeys. On day 1, cynomolgus macaque (Macaca fascicularis) primates were given a single subcutaneous injection of 0.3 mL/kg (approximately 2-3 mL volume, depending on animal mass) containing 10.0 mg/mL, for a total dose of 3.0 mg/kg, of either ASGR1 RNAi agent AD05209, AD05374, AD05609, or AD05692, each formulated in saline. Each of ASGR1 RNAi agents included N-acetyl-galactosamine targeting ligands conjugated to the 5′-terminal end of the sense strand, as shown in Tables 4 and 5.

(271) Two (2) monkeys in each group were tested. Blood samples were drawn and serum samples were analyzed on days 8, 15, 22, 29, and 36 for ALP and standard clinical chemistry panel. As noted in Example 15, ALP serves as a surrogate biomarker for monitoring reduction in ASGR1 and inhibition of an ASGR1 gene. ALP levels in serum were measured on a Cobas® Integra 400 (Roche Diagnostics), according to the manufacturer's recommendations.

(272) Data from the experiment are shown in the following Tables 45 and 46, which report raw ALP values (units/L) as well as ALP normalized to the mean of the individual pre-treatment levels.

(273) TABLE-US-00059 TABLE 45 ALP levels from cynomolgus monkeys from Example 22 (ALP levels reported in units/L) from Cobas ® Mean Predose Day 8 Day 15 Day 22 Day 29 Day 36 Group ID ALP ALP ALP ALP ALP ALP 3.0 mg/kg AD05209 (Cyno A) 342 427 616 750 707 754 3.0 mg/kg AD05209 (Cyno B) 253 323 410 521 573 520 3.0 mg/kg AD05374 (Cyno A) 298 345 406 420 420 415 3.0 mg/kg AD05374 (Cyno B) 225 292 397 402 367 338 3.0 mg/kg AD05609 (Cyno A) 320 365 428 475 542 532 3.0 mg/kg AD05609 (Cyno B) 214 299 380 481 427 371 3.0 mg/kg AD05692 (Cyno A) 320 370 405 406 388 430 3.0 mg/kg AD05692 (Cyno B) 110 144 186 182 175 148

(274) TABLE-US-00060 TABLE 46 Normalized ALP levels from cynomolgus monkeys from Example 22 from Cobas ®. Mean Predose Day 8 Day 15 Day 22 Day 29 Day 36 Group ID ALP ALP ALP ALP ALP ALP 3.0 mg/kg AD05209 (Cyno A) 1.00 1.25 1.80 2.19 2.07 2.20 3.0 mg/kg AD05209 (Cyno B) 1.00 1.28 1.62 2.06 2.26 2.05 3.0 mg/kg AD05374 (Cyno A) 1.00 1.16 1.36 1.41 1.41 1.39 3.0 mg/kg AD05374 (Cyno B) 1.00 1.30 1.76 1.79 1.63 1.50 3.0 mg/kg AD05609 (Cyno A) 1.00 1.14 1.34 1.49 1.70 1.66 3.0 mg/kg AD05609 (Cyno B) 1.00 1.40 1.77 2.24 1.99 1.73 3.0 mg/kg AD05692 (Cyno A) 1.00 1.16 1.27 1.27 1.21 1.35 3.0 mg/kg AD05692 (Cyno B) 1.00 1.31 1.69 1.65 1.59 1.35

(275) As shown in the data presented in Tables 45 and 46 above, each of the RNAi agents showed an increase in reported ALP levels after administration in cynomolgus monkeys. For example, both of the cynomolgus monkeys dosed with 3.0 mg/kg of AD05209 had their respective ALP levels doubled compared to baseline at days 22, 29, and 36 (see, e.g., Table 46 showing the ratio compared to baseline).

Example 23. In Vivo Testing of ASGR1 RNAi Agents in ASGR1-SEAP Mice

(276) The ASGR1-SEAP mouse model described in Example 2, above, was used. At day 1, each mouse was given a single subcutaneous injection of 200 μl containing 1.0 mg/kg of an ASGR1 RNAi agent, or 200 μl of saline without an ASGR1 RNAi agent to be used as a control, according to the following Table 47.

(277) TABLE-US-00061 TABLE 47 Dosing groups of ASGR1-SEAP mice of Example 23. Group RNAi Agent and Dose Dosing Regimen 1 Saline (no RNAi agent) Single injection on day 1 2 1.0 mg/kg AD05183 Single injection on day 1 3 1.0 mg/kg AD05209 Single injection on day 1 4 1.0 mg/kg AD05648 Single injection on day 1 5 1.0 mg/kg AD05649 Single injection on day 1 6 1.0 mg/kg AD05650 Single injection on day 1 7 1.0 mg/kg AD05651 Single injection on day 1 8 1.0 mg/kg AD05674 Single injection on day 1 9 1.0 mg/kg AD05675 Single injection on day 1 10 1.0 mg/kg AD05676 Single injection on day 1 11 1.0 mg/kg AD05740 Single injection on day 1 12 1.0 mg/kg AD05741 Single injection on day 1 13 1.0 mg/kg AD05742 Single injection on day 1 14 1.0 mg/kg AD05193 Single injection on day 1 15 1.0 mg/kg AD05692 Single injection on day 1 16 1.0 mg/kg AD05677 Single injection on day 1 17 1.0 mg/kg AD05678 Single injection on day 1 18 1.0 mg/kg AD05679 Single injection on day 1

(278) Each of the ASGR1 RNAi agents included N-acetyl-galactosamine targeting ligands conjugated to the 5′-terminal end of the sense strand, as shown in Tables 4 and 5. The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Three (3) mice in each group were tested (n=3). Serum was collected on day 8, day 15, day 22, and day 29, and SEAP expression levels were determined pursuant to the procedure set forth in Example 2, above. Data from the experiment are shown in the following Table 48, showing Average SEAP reflecting the normalized average value of SEAP normalized to pre-treatment and control, and in the following Table 49, showing Average SEAP reflecting the normalized average value of SEAP normalized to pre-treatment levels only:

(279) TABLE-US-00062 TABLE 48 Average SEAP normalized to pre-treatment and saline control in ASGR1-SEAP mice from Example 23. Day 8 Day 15 Day 22 Day 29 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID SEAP (+/−) SEAP (+/−) SEAP (+/−) SEAP (+/−) Group 1 (Saline) 1.000 0.326 1.000 0.281 1.000 0.554 1.000 0.346 Group 2 (1.0 mg/kg AD05183) 0.658 0.363 0.276 0.142 0.379 0.177 0.534 0.180 Group 3 (1.0 mg/kg AD05209) 0.290 0.104 0.272 0.236 0.300 0.302 0.467 0.387 Group 4 (1.0 mg/kg AD05648) 0.476 0.242 0.317 0.186 0.270 0.199 0.332 0.183 Group 5 (1.0 mg/kg AD05649) 0.215 0.119 0.121 0.099 0.174 0.156 0.353 0.312 Group 6 (1.0 mg/kg AD05650) 0.390 0.119 0.210 0.060 0.274 0.104 0.408 0.147 Group 7 (1.0 mg/kg AD05651) 0.316 0.198 0.189 0.116 0.343 0.154 0.943 0.275 Group 8 (1.0 mg/kg AD05674) 0.506 0.228 0.341 0.308 0.500 0.166 0.917 0.389 Group 9 (1.0 mg/kg AD05675) 0.337 0.040 0.158 0.059 0.251 0.221 0.470 0.453 Group 10 (1.0 mg/kg AD05676) 0.451 0.195 0.273 0.122 0.317 0.100 0.795 0.549 Group 11 (1.0 mg/kg AD05740) 0.345 0.217 0.258 0.170 0.266 0.201 0.368 0.247 Group 12 (1.0 mg/kg AD05741) 0.241 0.014 0.136 0.073 0.175 0.100 0.288 0.180 Group 13 (1.0 mg/kg AD05742) 0.294 0.076 0.210 0.138 0.405 0.285 0.641 0.387 Group 14 (1.0 mg/kg AD05193) 0.237 0.094 0.096 0.060 0.137 0.115 0.242 0.157 Group 15 (1.0 mg/kg AD05692) 0.468 0.285 0.304 0.325 0.545 0.497 0.718 0.902 Group 16 (1.0 mg/kg AD05677) 0.353 0.097 0.205 0.208 0.387 0.380 0.588 0.580 Group 17 (1.0 mg/kg AD05678) 0.274 0.065 0.236 0.143 0.309 0.286 0.715 0.568 Group 18 (1.0 mg/kg AD05679) 0.348 0.049 0.195 0.122 0.260 0.138 0.271 0.085

(280) TABLE-US-00063 TABLE 49 Average SEAP normalized to pre-treatment only in ASGR1-SEAP mice from Example 23. Day 8 Day 15 Day 22 Day 29 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID SEAP (+/−) SEAP (+/−) SEAP (+/−) SEAP (+/−) Group 1 (Saline) 0.756 0.247 0.574 0.161 0.421 0.233 0.400 0.138 Group 2 (1.0 mg/kg AD05183) 0.497 0.275 0.159 0.081 0.160 0.075 0.214 0.072 Group 3 (1.0 mg/kg AD05209) 0.220 0.079 0.156 0.136 0.126 0.127 0.187 0.155 Group 4 (1.0 mg/kg AD05648) 0.360 0.183 0.182 0.107 0.114 0.084 0.133 0.073 Group 5 (1.0 mg/kg AD05649) 0.162 0.090 0.070 0.057 0.073 0.066 0.141 0.125 Group 6 (1.0 mg/kg AD05650) 0.295 0.090 0.120 0.034 0.115 0.044 0.163 0.059 Group 7 (1.0 mg/kg AD05651) 0.239 0.150 0.109 0.067 0.145 0.065 0.377 0.110 Group 8 (1.0 mg/kg AD05674) 0.382 0.172 0.196 0.177 0.211 0.070 0.367 0.156 Group 9 (1.0 mg/kg AD05675) 0.255 0.031 0.091 0.034 0.106 0.093 0.188 0.181 Group 10 (1.0 mg/kg AD05676) 0.341 0.147 0.157 0.070 0.133 0.042 0.318 0.220 Group 11 (1.0 mg/kg AD05740) 0.261 0.164 0.148 0.098 0.112 0.085 0.147 0.099 Group 12 (1.0 mg/kg AD05741) 0.182 0.010 0.078 0.042 0.074 0.042 0.115 0.072 Group 13 (1.0 mg/kg AD05742) 0.240 0.062 0.130 0.085 0.186 0.130 0.267 0.161 Group 14 (1.0 mg/kg AD05193) 0.194 0.077 0.059 0.037 0.063 0.052 0.101 0.065 Group 15 (1.0 mg/kg AD05692) 0.382 0.232 0.187 0.200 0.250 0.228 0.299 0.375 Group 16 (1.0 mg/kg AD05677) 0.288 0.079 0.126 0.128 0.177 0.174 0.245 0.241 Group 17 (1.0 mg/kg AD05678) 0.224 0.053 0.145 0.088 0.142 0.131 0.297 0.236 Group 18 (1.0 mg/kg AD05679) 0.263 0.037 0.112 0.070 0.109 0.058 0.113 0.035

Example 24. In Vivo Testing of ASGR1 RNAi Agents in Cynomolgus Monkeys

(281) ASGR1 RNAi agents were evaluated for reduction in ASGR1 mRNA levels in cynomolgus monkeys. On day 1, female cynomolgus macaque (Macaca fascicularis) primates (“cynomolgus monkeys”) were given a single subcutaneous injection of 0.3 mL/kg (approximately 2-3 mL volume, depending on animal mass) containing 10.0 mg/mL, for a total dose of 3.0 mg/kg, of either ASGR1 RNAi agent AD05193 or AD05209, each formulated in saline. Each of ASGR1 RNAi agents included N-acetyl-galactosamine targeting ligands conjugated to the 5′-terminal end of the sense strand having the structure of (NAG37)s, as shown in Tables 4, 5, and 6.

(282) Four (4) monkeys in each group were tested. On days −7 (pre-dose), 15, 29, 43, and 57, liver biopsies were taken. On the date of each biopsy collection, the cynomolgus monkeys were anesthetized and ultrasound-guided liver biopsies were performed to extract liver tissue samples. Approximately 100 mg liver samples from the median lobes were collected and snap-frozen in liquid nitrogen for RNA isolation. The biopsy samples were then homogenized, and levels of ASGR1 mRNA in the cyno livers were measured by RT-qPCR. Resulting values were then normalized to the pre-dose (in this case, at day −7) ASGR1 mRNA measurements using the ΔΔCT method, which are reflected in the following Table 50.

(283) Additionally, serum samples were taken on −14, −1, day 1 (pre-dose), day 8, day 15, day 22, day 29, day 36, day 43, day 57, day 71, and day 85, and ALP levels in serum for each day were measured on a Cobas® Integra 400 (Roche Diagnostics), according to the manufacturer's recommendations, which are reported in Tables 51 and 52, below.

(284) TABLE-US-00064 TABLE 50 ASGR1 mRNA Expression Levels Relative to Pre-Dose (Day −7) from Example 24. Day 15 Day 29 Day 43 Day 57 Mean Mean Mean Mean Relative Relative Relative Relative ASGR1 ASGR1 ASGR1 ASGR1 mRNA Low High mRNA Low High mRNA Low High mRNA Low High Group Expression Error Error Expression Error Error Expression Error Error Expression Error Error AD05193 0.292 0.057 0.071 0.284 0.128 0.233 0.248 0.383 0.151 0.598 0.295 0.197 AD05209 0.237 0.055 0.071 0.286 0.041 0.048 0.237 0.068 0.095 0.421 0.233 0.150

(285) TABLE-US-00065 TABLE 51 Normalized ALP Levels By Group in Cynomolgus Monkeys from Example 24 (Normalized to Pre-Dose) from Cobas ®. Day 8 Day 15 Day 22 Day 29 Day 36 Day 43 Day 57 Day 71 Day 85 Group ID ALP ALP ALP ALP ALP ALP ALP ALP ALP AD05193 (3.0 mg/kg) 1.44 2.08 2.27 2.60 2.33 2.33 2.09 1.49 1.47 AD05209 (3.0 mg/kg) 1.56 1.99 2.07 2.08 2.01 1.94 1.59 1.34 1.26

(286) TABLE-US-00066 TABLE 52 Normalized ALP Levels in Cynomolgus Monkeys from Example 24 (Normalized to Pre-Dose) from Cobas ®. Day 8 Day 15 Day 22 Day 29 Day 36 Day 43 Day 57 Day 71 Day 85 Group ID ALP ALP ALP ALP ALP ALP ALP ALP ALP 3.0 mg/kg AD05193 (Cyno A) 1.48 2.09 2.54 2.74 2.25 1.89 1.81 1.16 1.21 3.0 mg/kg AD05193 (Cyno B) 1.51 2.61 2.39 2.88 2.54 2.44 2.15 1.54 1.53 3.0 mg/kg AD05193 (Cyno C) 1.42 1.62 1.91 1.99 1.95 2.04 2.04 1.46 1.40 3.0 mg/kg AD05193 (Cyno D) 1.37 2.00 2.24 2.77 2.60 2.97 2.34 1.82 1.73 3.0 mg/kg AD05209 (Cyno A) 1.68 1.89 2.39 2.13 2.41 1.83 1.50 1.27 1.16 3.0 mg/kg AD05209 (Cyno B) 1.40 1.66 1.50 1.31 1.17 1.17 1.05 1.00 0.96 3.0 mg/kg AD05209 (Cyno C) 1.79 2.45 2.48 2.55 2.44 2.51 1.84 1.50 1.51 3.0 mg/kg AD05209 (Cyno D) 1.36 1.94 1.91 2.32 2.01 2.23 1.95 1.60 1.43

(287) The cynomolgus monkeys in both groups showed a significant reduction in liver-specific ASGR1 mRNA compared to pre-treatment measurements at all measured time points. On day 43, for example, the cynomolgus monkeys of Group 1 (AD05193) had a reduction of ASGR1 mRNA of approximately 75.2% (0.248), while cynomolgus monkeys of Group 2 (AD05209) had a reduction of approximately 76.3% (0.237), compared to pre-dose levels.

OTHER EMBODIMENTS

(288) It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.