Method for establishing colorectal cancer HK2 reporter gene cell line

Abstract

The present invention discloses a method for establishing a colorectal cancer HK2 reporter gene cell line, specifically including: firstly, designing a site-specific sgRNA sequence of an HK2 gene, and cloning same into a PX459 plasmid; integrating a homologous recombination sequence of an HK2 gene and a green fluorescent protein DNA fragment (EGFP), and transforming the plasmid and the integrated fragment together into a colorectal cancer cell line HCT116 by electroporation; and performing signal cell screening through a flow cytometer to obtain EGFP-expressing cells, and amplifying a monoclonal cell line; and identifying a positive HK2 reporter gene cell line through PCR identification and Western blot, among screened EGFP-expressing cell lines. The colorectal cancer cell line HK2 gene and EGFP are co-expressed, and the expression level of the EGFP is highly consistent with that of the HK2 gene. Therefore, the expression level of the HK2 gene can be accurately determined by detecting a change in the expression level of the EGFP. The method for establishing a cell line in the present invention are simple, easy to implement and efficient, and a gene site can be precisely positioned.

Claims

1. A method for establishing a colorectal cancer Hexokinase 2 reporter gene cell line, comprising the following steps: Step 1: designing and evaluating a downstream site-specific HK2-sgRNA sequence of a Hexokinase 2 gene; Step 2: constructing a plasmid pX459/HK2-sgRNA; Step 3: integrating a homologous recombination sequence of the Hexokinase 2 gene and an Enhanced Green Fluorescent Protein (EGFP) fragment; Step 4: transforming the plasmid pX459/HK2-sgRNA and the integrated green fluorescent protein fragment together into a colorectal cancer cell line HCT116 by electroporation with a ratio of 1:1; Step 5: performing single cell screening through a flow cytometer to obtain EGFP-expressing cells, and amplifying a monoclonal cell line; and Step 6: further identifying a Hexokinase 2 reporter gene cell line through genome PCR and Western blot, among screened EGFP-expressing cell lines; wherein in step 1, at least two groups of HK2-sgRNA sequences, HK2-sgRNA1 and HK2-sgRNA2, are designed and screened, the HK2-sgRNA1 has the nucleic acid sequence of SEQ ID NO: 1, and the HK2-sgRNA2 has the nucleic acid sequence of SEQ ID NO: 2; wherein in step 2, the method for constructing a plasmid pX459/HK2-sgRNA comprises: directly obtaining a plasmid pX459/HK2-sgRNA1 or pX459/HK2-sgRNA2 with a correct sgRNA sequence according to the sequence of the HK2-sgRNA1 or the sequence of the HK2-sgRNA2; and wherein in step 3, the method for integrating a homologous recombination sequence of the Hexokinase 2 gene and an EGFP fragment comprises: directly obtaining a correct integrated fragment L-EGFP-R according to the homologous recombination sequence of the Hexokinase 2 gene and an EGFP sequence, wherein the fragment L-EGFP-R has the nucleic acid sequence of SEQ ID NO: 3.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 is a schematic diagram of a green fluorescent protein target gene knock-in mechanism.

(2) FIG. 2 is screening of a single cell clone for green fluorescent protein expression through a flow cytometer.

(3) FIG. 3 is expression of a green fluorescent protein by a screened positive HK2 reporter gene cell line.

(4) FIG. 4 is identification of an HK2 reporter gene cell line by PCR.

(5) FIG. 5 is identification of an HK2 reporter gene cell line by Western blot.

(6) FIG. 6 is inhibition of expression of HK2 and EGFP by shRNA.

(7) FIG. 7 is inhibition of expression of HK2 and EGFP by 2-MeOE2.

DETAILED DESCRIPTION

(8) The present invention will be further described below in specific embodiments, so that persons skilled in the art can better understand the present invention and implement same. However, the present invention is not limited to the embodiments.

(9) Unless otherwise specified, the experimental methods used in the following embodiments are all conventional methods, and the used materials and reagents can be obtained by commercial approaches.

Embodiment 1 Establishment of a Colorectal Cancer HK2 Reporter Gene Cell Line

(10) In step 1, a proper HK2-sgRNA sequence is designed and evaluated:

(11) by means of screening and evaluating, obtaining two sections of sgRNA sequences, which are respectively:

(12) TABLE-US-00001 HK2-sgRNA1: TAGAACCCCTGAAATCGGAA (chr2: 74890939-74890958), as shown in SEQ ID NO: 1; and HK2-sgRNA2: TGTGTCAGAGACAGACCCCT (chr2: 74891015-74891034), as shown in SEQ ID NO: 2.

(13) In step 2, a plasmid pX459/HK2-sgRNA is constructed, including the following step:

(14) directly obtaining a plasmid pX459/HK2-sgRNA1 or pX459/HK2-sgRNA2 with a correct sgRNA sequence after synthesizing by a biological company according to the sequence of the HK2-sgRNA1 or the sequence of the HK2-sgRNA2.

(15) In step 3, an L-EGFP-R fragment is integrated, including the followings step:

(16) directly obtaining a correct integrated fragment L-EGFP-R after synthesizing by a biological company according to a homologous arm of an HK2 gene and an EGFP sequence, where the sequence is as shown in SEQ ID NO: 3, and the construction process is as shown in FIG. 1.

(17) In step 4, a colorectal cancer HK2 reporter gene cell line having green fluorescence is screened, including the following steps:

(18) transforming the plasmid pX459/HK2-sgRNA and the integrated green fluorescent protein fragment L-EGFP-R together into a colorectal cancer cell line HCT116 by electroporation with a ratio of 1:1.

(19) Firstly, single cell screening is performed with a 96-well plate through a flow cytometer (see FIG. 2), and 7-10 cell strains having EGFP expression can be obtained by each 96-well plate. The EGFP knock-in efficiency reaches 7-8%, which is significantly higher than the knock-in efficiency of generally 1% in this field.

(20) A selected monoclonal cell line is amplified and cultured (see FIG. 3). A genome DNA of cells having EGFP expression is extracted and obtained. Genome PCR is performed, and if positive amplification is obtained, it is indicated that insertion succeeds, and an HK2 reporter gene cell line is obtained. The primer sequence for PCR identification is as follows:

(21) TABLE-US-00002 Forward primer F-GT: GAGTCCTGGTCCTGGTCTCCC, as shown in SEQ ID NO: 4; and Reverse primer R-GT: CCGAGGAGAGGGTTAGGGATAGGC, as shown in SEQ ID NO: 5.

(22) Wild type cells are also subjected to the genome PCR, and the primer sequence for PCR identification is as follows:

(23) TABLE-US-00003 Forward primer F-WT: GAGTCCTGGTCCTGGTCTCCC, as shown in SEQ ID NO: 6; and Reverse primer R-WT: GGAGAACCAATGGGAATGGTTATGATGC, as shown in SEQ ID NO: 7.

(24) The comparison result of PCR identification is shown in FIG. 4, and four HK2 reporter gene cell lines are obtained.

(25) Finally, a positive HK2 gene reporter cell line is further identified through Western blot, among screened EGFP-expressing cells. The identification result is shown in FIG. 5, and finally, four HK2 reporter gene cell lines are obtained.

(26) After stable passage of 30 generations of the HK2 reporter gene cell line, sequencing shows that the gene knock-in sequence still keeps genetic stability.

Embodiment 2 Functional Verification of a Colorectal Cancer HK2 Reporter Gene Cell Line

(27) Three different specific targeted HK2 gene small-molecule interference RNAs are designed, i.e., shRAN-1, shRAN-2, and shRAN-3, as shown in FIG. 6, which are respectively transfected into an HK2 reporter cell line. After 72 hours, according to transcriptional level analysis, it shows that compared with non-knock-down control, the three specific small-molecule interference RNAs effectively reduce the expression level of the HK2 gene (about 70-80% is knocked down). Moreover, the expression of the EGFP gene is also correspondingly reduced by 70-80% along with the knockdown of the HK2 gene. The experimental result proves from a molecular level that the reporter gene EGFP and the HK2 gene in the colorectal cancer HK2 reporter gene cell line constructed in the present invention can be synchronously co-expressed, are synchronously inhibited by shRNA, and can be used for inhibition or over-expression tracing of the HK2 gene.

Embodiment 3 Drug Screening and Evaluation Verification

(28) 2-Methoxyestradiol (2-MeOE2) is an HIF inhibitor, and at present, has entered an anti-tumor clinical second-stage test stage. The inhibitor is used for treating the HK2 cell line, and the result shows that expression of EGFP and HK2 is inhibited, as shown in FIG. 7. The HK2 cell line is treated for 24 h or 48 h in 2-MeOE2 (10 uM), and the relative expression changes of the transcriptional level of HK2 and EGFP and those untreated as a control are analyzed. The result shows that the expression level of HK2 is obviously inhibited, and the expression of the EGFP is also synergistically inhibited. The experimental result further proves that the colorectal cancer HK2 reporter gene cell line constructed in the present invention can be used for screening and evaluating related anticancer drugs.

(29) Finally, it should be noted that the aforementioned embodiments are only used for describing the technical solutions of the present invention rather than limiting the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, persons skilled in the art should understand that the technical solutions of the present invention may be modified or equivalently replaced without departing from the essence and scope of the technical solutions of the present invention.