ANTI-NUCLEOLIN AGENT-CONJUGATED NANOPARTICLES AS RADIO-SENSITIZERS AND MRI AND/OR X-RAY CONTRAST AGENTS
20180200385 ยท 2018-07-19
Inventors
- Mohammad Tariq Malik (Prospect, KY, US)
- Martin G. O'Toole (Louisville, KY, US)
- Paula J. Bates (Louisville, KY)
Cpc classification
A61K45/06
HUMAN NECESSITIES
A61K49/0428
HUMAN NECESSITIES
A61K9/0019
HUMAN NECESSITIES
A61K49/1881
HUMAN NECESSITIES
A61K31/7105
HUMAN NECESSITIES
A61K47/549
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K49/0065
HUMAN NECESSITIES
A61K41/0038
HUMAN NECESSITIES
A61K47/6929
HUMAN NECESSITIES
C12N15/115
CHEMISTRY; METALLURGY
A61K47/6923
HUMAN NECESSITIES
A61K31/7105
HUMAN NECESSITIES
International classification
A61K47/69
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
A61K49/18
HUMAN NECESSITIES
C12N15/115
CHEMISTRY; METALLURGY
Abstract
A composition comprises an anti-nucleolin agent conjugated to nanoparticles, and optionally containing gadolinium. Furthermore, a pharmaceutical composition for treating cancer comprises a composition including an anti-nucleolin agent conjugated to nanoparticles, and a pharmaceutically acceptable carrier. The composition enhances the effectiveness of radiation therapy, enhancing contrast in X-ray imaging techniques, and when gadolinium is present, provide cancer selective MRI contrast agents.
Claims
1. A composition, comprising an anti-nucleolin agent and gadolinium conjugated to nanoparticles.
2. (canceled)
3. The composition of claim 1, wherein the nanoparticles comprise gold.
4. (canceled)
5. The composition of claim 1, wherein the anti-nucleolin agent comprises an antibody.
6-7. (canceled)
8. The composition of claim 1, wherein the anti-nucleolin agent comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-7; 9-16; 19-30 and 31.
9-10. (canceled)
11. The composition of claim 1, wherein the nanoparticles have an average diameter of 1 to 20 nm.
12. The composition of claim 1, wherein the nanoparticles comprise at least one member selected from the group consisting of gold, platinum, iridium and palladium.
13-17. (canceled)
18. A method of treating cancer, comprising administering an effective amount of a pharmaceutical composition comprising an anti-nucleolin agent conjugated to nanoparticles, to a patient in need thereof, followed by radiation therapy.
19. The method of treating cancer of claim 18, wherein the cancer is selected from the group consisting of melanoma, lymphoma, plasmocytoma, sarcoma, glioma, thymoma, leukemia, breast cancer, prostate cancer, colon cancer, liver cancer, esophageal cancer, brain cancer, lung cancer, ovary cancer, cervical cancer and hepatoma.
20. The method of treating cancer of claim 18, wherein the cancer is selected from the group consisting of breast cancer, prostate cancer, colon cancer and lung cancer.
21. The method of treating cancer of claim 18, further comprising administering a second cancer treatment selected from the group consisting of vinorelbine, mytomycin, camptothecin, cyclyphosphamide, methotrexate, tamoxifen citrate, 5-fluorouracil, irinotecan, doxorubicin, flutamide, paclitaxel, docetaxel, vinblastine, imatinib mesylate, anthracycline, letrozole, arsenic trioxide, anastrozole, triptorelin pamoate, ozogamicin, irinotecan hydrochloride, BCG live, leuprolide acetate implant (Viadur), bexarotene, exemestane, topotecan hydrochloride, gemcitabine HCL, daunorubicin hydrochloride, toremifene citrate (Fareston), carboplatin, cisplatin, oxaliplatin and any other platinum-containing oncology drug, trastuzumab, lapatinib, gefitinb, cetuximab, panitumumab, temsirolimus, everolimus, vandetanib, vemurafenib, crizotinib, vorinostat, bevacizumab, hyperthermia, gene therapy and photodynamic therapy.
22-30. (canceled)
31. A method of imaging cancer by MRI in vivo, comprising: administering an imaging agent comprising the composition of claim 1, to a subject, and forming an image of the imaging agent present in the subject by MRI.
32. The method of imaging cancer of claim 31, wherein the administering occurs more than 24 hours before the forming.
33. The method of imaging cancer of claim 31, wherein the administering occurs more than 48 hours before the forming.
34. The method of imaging cancer of claim 31, wherein the cancer is lung cancer.
35. The method of imaging cancer of claim 31, wherein the image comprises images of malignant regions that are less than 4 mm.
36. A method of imaging cancer by X-ray imaging techniques in vivo, comprising: administering an imaging agent, the imaging agent comprising an anti-nucleolin agent conjugated to nanoparticles, to a subject, and forming an image of the imaging agent present in the subject by an X-ray imaging technique.
37. The method of imaging cancer of claim 36, wherein the administering occurs more than 24 hours before the forming.
38. The method of imaging cancer of claim 36, wherein the administering occurs more than 48 hours before the forming.
39. The method of imaging cancer of claim 36, wherein the cancer is lung cancer.
40. The method of imaging cancer of claim 36, wherein the image comprises images of malignant regions that are less than 4 mm.
41. The method of treating cancer of claim 18, wherein the nanoparticles comprise at least one member selected from the group consisting of gold, platinum, iridium and palladium.
42. The method of treating cancer of claim 18, wherein the anti-nucleolin agent comprises AS1411.
43. The composition of claim 1, wherein the anti-nucleolin agent comprises AS1411 and the nanoparticle comprises gold.
44. The method of treating cancer of claim 18, wherein the anti-nucleolin agent comprises AS1411 and the nanoparticles comprises gold.
45. The method of imaging cancer of claim 36, wherein the anti-nucleolin agent comprises AS1411 and the nanoparticles comprises gold.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
DETAILED DESCRIPTION
[0063] The present invention includes anti-nucleolin agents conjugated to particles comprising metals, such as aptamers conjugated to gold nanoparticles, that are effective radio-sensitizers for treating cancer. The nanoparticles are selectively taken-up by cancer cells and enhance the effects of RT on those cells. This enhances the effectiveness of RT, and/or allows a low effective dose of radiation to be used during RT. Furthermore, the nanoparticles may optionally also contain gadolinium, for example 10-(2-sulfanylethyl)-1,4,7,10-tetraazacyclododecane-1,4,7-triacetic acid (H3-DO3A-SH) coordinated to a trivalent gadolinium ion (Gd-DO3A-SH), which is then bound to the gold nanoparticles through the sulfur atom in a manner similar to thiolated-AS1411, resulting in a mono-layer coating that is a mixture of AS1411 and Gd-DO3A-SH on the gold nanoparticles. The Gd ions of Gd-DO3A-SH enhance the relaxivity (speed up the relaxation rate) of nearby water molecules during an MRI scan and contribute to an increase in contrast when present in the sample being scanned. In addition, both the gold nanoparticles and the Gd ions enhance the absorption and scattering of X-rays, and increase the contrast when present in the sample being scanned or imaged using X-ray based imaging techniques, such as CT scanning. The combination of anti-nucleolin agents (cancer targeting) and gadolinium (MRI contrast enhancement) combine to result in a cancer-targeting MRI-contrast agent. Furthermore the combination of anti-nucleolin agents (cancer targeting) and gold nanoparticle (X-ray contrast enhancement) and optionally gadolinium (MRI contrast enhancement and X-ray contrast enhancement) combine to result in a cancer-targeting MRI-contrast and X-ray (CT scan) contrast agent.
[0064] There are several unmet needs that can be addressed by these cancer-targeted contrast agent, namely: (1) better specificity to differentiate between cancerous and non-cancerous lesions and reduce false positives that can lead to over-treatment, (2) improved sensitivity so that they could be used as screening tools for early detection, and (3) reduced toxicity to allow use in patients with compromised renal function for whom existing contrast agents are contraindicated. These advantages are especially useful in lung cancer screening, particularly early detection of lung cancer.
[0065] In addition, anti-nucleolin agent-conjugated nanoparticles have a longer half-life in circulation than currently available contrast agents. The longer half-life in circulation eliminates the need for continuous intravenous administration during imaging, which greatly improves patient comfort. Anti-nucleolin agent-conjugated nanoparticle contrast agents may be administered multiple days before an imaging scan is performed.
[0066] Anti-nucleolin agents include (i) aptamers, such as GROs; (ii) anti-nucleolin antibodies; and (iii) nucleolin targeting proteins. Examples of aptamers include guanosine-rich oligonucleotides (GROs). Examples of suitable oligonucleotides and assays are also given in Miller et al. [7]. Characteristics of GROs include:
[0067] (1) having at least 1 GGT motif,
[0068] (2) preferably having 4-100 nucleotides, although GROs having many more nucleotides are possible,
[0069] (3) optionally having chemical modifications to improve stability.
[0070] Especially useful GROs form G-quartet structures, as indicated by a reversible thermal denaturation/renaturation profile at 295 nm [6]. Preferred GROs also compete with a telomere oligonucleotide for binding to a target cellular protein in an electrophoretic mobility shift assay [6]. In some cases, incorporating the GRO nucleotides into larger nucleic acid sequences may be advantageous; for example, to facilitate binding of a GRO nucleic acid to a substrate without denaturing the nucleolin-binding site. Examples of oligonucleotides are shown in Table 1; preferred oligonucleotides include SEQ IDs NOs: 1-7; 9-16; 19-30 and 31 from Table 1.
TABLE-US-00001 TABLE1 Non-antisenseGROsthatbindnucleolinandnon- bindingcontrols.sup.1,2,3. SEQ ID GRO Sequence NO: GRO29A.sup.1 tttggtggtggtggttgtggtggtggtgg 1 GRO29-2 tttggtggtggtggttttggtggtggtgg 2 GRO29-3 tttggtggtggtggtggtggtggtggtgg 3 GRO29-5 tttggtggtggtggtttgggtggtggtgg 4 GRO29-13 tggtggtggtggt 5 GRO14C ggtggttgtggtgg 6 GRO15A gttgtttggggtggt 7 GRO15B.sup.2 ttggggggggtgggt 8 GRO25A ggttggggtgggtggggtgggtggg 9 GRO26B.sup.1 ggtggtggtggttgtggtggtggtgg 10 GRO28A tttggtggtggtggttgtggtggtggtg 11 GRO28B tttggtggtggtggtgtggtggtggtgg 12 GRO29-6 ggtggtggtggttgtggtggtggtggttt 13 GRO32A ggtggttgtggtggttgtggtggttgtggtgg 14 GRO32B tttggtggtggtggttgtggtggtggtggttt 15 GRO56A ggtggtggtggttgtggtggtggtggttgt 16 ggtggtggtggttgtggtggtggtgg CRO tttcctcctcctccttctcctcctcctcc 18 GROA ttagggttagggttagggttaggg 19 GROB ggtggtggtgg 20 GROC ggtggttgtggtgg 21 GROD ggttggtgtggttgg 22 GROE gggttttggg 23 GROF ggttttggttttggttttgg 24 GROG.sup.1 ggttggtgtggttgg 25 GROH.sup.1 ggggttttgggg 26 GROI.sup.1 gggttttggg 27 GROJ.sup.1 ggggttttggggttttggggttttgggg 28 GROK.sup.1 ttggggttggggttggggttgggg 29 GROL.sup.1 gggtgggtgggtgggt 30 GROM.sup.1 ggttttggttttggttttggttttgg 31 GRON.sup.2 tttcctcctcctccttctcctcctcctcc 32 GROO.sup.2 cctcctcctccttctcctcctcctcc 33 GROP.sup.2 tggggt 34 GROQ.sup.2 gcatgct 35 GROR.sup.2 gcggtttgcgg 36 GROS.sup.2 tagg 37 GROT.sup.2 ggggttggggtgtggggttgggg 38 .sup.1Indicates a good plasma membrane nucleolin-binding GRO. .sup.2Indicates a nucleolin control (non-plasma membrane nucleolin binding). .sup.3GRO sequence without .sup.1 or .sup.2 designations have some anti-proliferative activity.
[0071] Any antibody that binds nucleolin may also be used. In certain instances, monoclonal antibodies are preferred as they bind single, specific and defined epitopes. In other instances, however, polyclonal antibodies capable of interacting with more than one epitope on nucleolin may be used. Many anti-nucleolin antibodies are commercially available, and are otherwise easily made. See, for example, US Patent Application Publication No. US 2013/0115674 to Sutkowski et al. Table 2 lists a few commercially available anti-nucleolin antibodies.
TABLE-US-00002 TABLE 2 commercially available anti-nucleolin antibodies Antigen Antibody Source source p7-1A4 Mouse monoclonal Developmental Studies Xenopus laevis antibody (mAb) Hybridoma Bank oocytes Sc-8031 mouse mAb Santa Cruz Biotech human Sc-9893 goat polyclonal Santa Cruz Biotech human Ab (pAb) Sc-9892 goat pAb Santa Cruz Biotech human Clone 4E2 mouse mAb MBL International human Clone 3G4B2 mouse mAb Upstate Biotechnology dog (MDCK cells) Nucleolin, Human MyBioSource human (mouse mAb) Purified anti-Nucleolin- BioLegend human Phospho, Thr76/Thr84 (mouse mAb) Rabbit Polyclonal Novus Biologicals human Nucleolin Antibody Nucleolin (NCL, C23, US Biological human FLJ45706, FLJ59041, Protein C23) Mab Mo xHu Nucleolin (NCL, Nucl, C23, US Biological human FLJ45706, Protein C23) Pab Rb xHu Mouse Anti-Human Cell Sciences human Nucleolin Phospho- Thr76/Thr84 Clone 10C7 mAb Anti-NCL/Nucleolin (pAb) LifeSpan Biosciences human NCL purified MaxPab mouse Abnova human polyclonal antibody (B02P) NCL purified MaxPab rabbit Abnova human polyclonal antibody (D01P) NCL monoclonal antibody, Abnova human clone 10C7 (mouse mAb) Nucleolin Monoclonal Enzo Life Sciences human Antibody (4E2) (mouse mAb) Nucleolin, Mouse Monoclonal Life Technologies human Antibody Corporation NCL Antibody (Center E443) Abgent human (rabbit pAb) Anti-Nucleolin, clone 3G4B2 EMD Millipore human (mouse mAb) NCL (rabbit pAb) Proteintech Group human Mouse Anti-Nucleolin Active Motif human Monoclonal Antibody, Unconjugated, Clone 3G4B20 Nsr1p - mouse monoclonal EnCor Biotechnology human Nucleolin (mouse mAb) Thermo Scientific human Pierce Products Nucleolin [4E2] antibody GeneTex human (mouse mAb)
[0072] Nucleolin targeting proteins are proteins, other than antibodies, that specifically and selectively bind nucleolin. Examples include ribosomal protein S3, tumor-homing F3 peptides [26, 27] and myosin H9 (a non-muscle myosin that binds cell surface nucleolin of endothelial cells in angiogenic vessels during tumorigenesis).
[0073] Anti-nucleolin agents may be conjugated to particles made of a variety of materials solid materials, including (1) metals and high molecular weigh elements; and (2) metal oxides. Metals and elements, preferably non-magnetic metals and elements, include gold, silver, palladium, iridium, platinum and alloys thereof. Oxides include zirconium dioxide, palladium oxide, barium sulfate, thorium oxide, uranium oxide and complex oxides thereof, such as barium titanate. Preferably, the particles are non-toxic. The particles are preferably nanoparticles having an average particle diameter of 1-100 nm, more preferably 1-50 nm, including 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90 and 95 nm.
[0074] Oligonucleotides and proteins have been attached to solid materials, such metals and elements, oxides, semiconductors and polymers, by a variety of techniques. These same techniques may be used to attach anti-nucleolin agents to particles. Further attachment of gadolinium complexes to the anti-nucleolin agent conjugated nanoparticles (conjugates), allows the conjugates to be used as MRI contrast agents, both in vivo and ex vivo.
[0075] Anti-nucleolin agent-conjugated nanoparticles may be used to formulate a pharmaceutical composition for radio-sensitizers for treating cancer and tumors by RT, and targeting cancer cells expressing cell surface nucleolin, by forming mixtures of the anti-nucleolin agent conjugated nanoparticles and a pharmaceutically acceptable carrier, such as a pharmaceutical composition. Methods of treating cancer in a subject include administering a therapeutically effective amount of an anti-nucleolin agent conjugated nanoparticles followed by RT. The small size of nanoparticles allows nanoparticle conjugates to cross the blood-brain barrier, which enables imaging and treatment of brain tumors.
[0076] Particularly preferred compositions are aptamers conjugated to gold nanoparticles, and optionally further conjugated to gadolinium complexes. Gold nanoparticles (GNPs) exhibit low toxicity, versatile surface chemistry, light absorbing/scattering properties, and tunable size. Aptamers effectively cap gold particles and prevent aggregation, are safe, stable, easy to synthesize, and non-immunogenic. Aptamer conjugated GNPs offer improved efficacy of RT in vivo. Aptamer conjugated GNP are highly selective for cancer cells over normal cells, and when attached to cyanine dyes are excellent imaging agents, for example Cy2, Cy3, Cy5, Cy5.5, Cy7, Alexa Fluor 680, Alexa Fluor 750, IRDye 680, and IRDye 800CW (LI-COR Biosciences, Lincoln, Nebr.); and when attached to gadolinium complexes also act as MRI contrast agents specific for cancer cells. Aptamer conjugated GNP, and optionally attached to gadolinium complexes may be used as an imaging agent, MRI contrast agents, and may be administered as compositions which further contain a pharmaceutically acceptable carrier. The imaging agent may be administered to a subject in a method of imaging cancer in vivo, to form an image of the imaging agent present in the subject, by MRI.
[0077] The amounts and ratios of compositions described herein are all by weight, unless otherwise stated. Accordingly, the number of anti-nucleolin agents per nanoparticle may vary when the weight of the nanoparticle varies, even when the equivalent anti-nucleolin agent concentration (or equivalent aptamer concentration) is otherwise the same. For example, the number of anti-nucleolin agent molecules per nanoparticle may vary from 2 to 10,000, or 10 to 1000, including 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800 and 900.
[0078] A pharmaceutical composition is formulated to be compatible with its intended route of administration, including intravenous, intradermal, subcutaneous, oral, inhalation, transdermal, transmucosal, and rectal administration. Solutions and suspensions used for parenteral, intradermal or subcutaneous application can include a sterile diluent, such as water for injection, saline solution, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; buffers such as acetates, citrates or phosphates, and agents for the adjustment of tonicity such as sodium chloride or dextrose. The pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide.
[0079] Pharmaceutical compositions suitable for injection include sterile aqueous solutions or dispersions for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, CREMOPHOR EL (BASF; Parsippany, N.J.) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be fluid so as to be administered using a syringe. Such compositions should be stable during manufacture and storage and are preferably preserved against contamination from microorganisms such as bacteria and fungi. The carrier can be a dispersion medium containing, for example, water, polyol (such as glycerol, propylene glycol, and liquid polyethylene glycol), and other compatible, suitable mixtures. Various antibacterial and anti-fungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, and thimerosal, can contain microorganism contamination. Isotonic agents such as sugars, polyalcohols, such as mannitol, sorbitol, and sodium chloride can be included in the composition. Compositions that can delay absorption include agents such as aluminum monostearate and gelatin.
[0080] Sterile injectable solutions can be prepared by incorporating the active agents, and other therapeutic components, in the required amount in an appropriate solvent with one or a combination of ingredients as required, followed by sterilization. Methods of preparation of sterile solids for the preparation of sterile injectable solutions include vacuum drying and freeze-drying to yield a solid.
[0081] Radiation treatment (RT) may be by any form of radiation, such as X-rays (for example megavolt energy X-rays), Brachy therapy, proton radiation, and neutron radiation. Also possible is to use doses and/or energy of RT that would normally be considered subclinical; because the anti-nucleolin agent-conjugated nanoparticles enhance the effectiveness of RT, the dosages are effective to kill or reduce the growth of cancer cells and tumors.
[0082] Anti-nucleolin agent-conjugated nanoparticles which contain gadolinium are effective MRI contrast agents, and may also be used to image cancer cells, including individual cancer cells. For example, the anti-nucleolin agent-conjugated nanoparticles which contain gadolinium may be administered to a patient to determine if cancer cells are present in lymph nodes, thus avoiding the removal of lymph node for the sole purpose of determining if they contain cancer cells. Another use can be to avoid the need for a biopsy. The anti-nucleolin agent-conjugated nanoparticles which contain gadolinium may be administered to a patient to determine if cancer is present in a lump, has metastasized to other location in the body, or to determine if all cancer from a tumor has been removed during surgery.
[0083] Anti-nucleolin agent-conjugated nanoparticles which optionally contain gadolinium are effective X-ray contrast agents, and may also be used to image cancer cells, including individual cancer cells. For example, the anti-nucleolin agent-conjugated nanoparticles which optionally contain gadolinium may be administered to a patient to determine if cancer cells are present in lymph nodes, thus avoiding the removal of lymph node for the sole purpose of determining if they contain cancer cells. Another use can be to avoid the need for a biopsy. The anti-nucleolin agent-conjugated nanoparticles which optionally contain gadolinium may be administered to a patient to determine if cancer is present in a lump, has metastasized to other location in the body, or to determine if all cancer from a tumor has been removed during surgery.
[0084] The pharmaceutical composition described herein may further comprise other therapeutically active compounds, and/or may be used in conjunction with physical techniques as noted herein which are suitable for the treatment of cancers and tumors. Examples of commonly used therapeutically active compounds include vinorelbine (Navelbine), mytomycin, camptothecin, cyclyphosphamide (Cytoxin), methotrexate, tamoxifen citrate, 5-fluorouracil, irinotecan, doxorubicin, flutamide, paclitaxel (Taxol), docetaxel, vinblastine, imatinib mesylate (Gleevec), anthracycline, letrozole, arsenic trioxide (Trisenox), anastrozole, triptorelin pamoate, ozogamicin, irinotecan hydrochloride (Camptosar), BCG live (Pacis), leuprolide acetate implant (Viadur), bexarotene (Targretin), exemestane (Aromasin), topotecan hydrochloride (Hycamtin), gemcitabine HCL (Gemzar), daunorubicin hydrochloride (Daunorubicin HCL), toremifene citrate (Fareston), carboplatin (Paraplatin), cisplatin (Platinol and Platinol-AQ) oxaliplatin and any other platinum-containing oncology drug, trastuzumab (Herceptin), lapatinib (Tykerb), gefitinb (Iressa), cetuximab (Erbitux), panitumumab (Vectibix), temsirolimus (Torisel), everolimus (Afinitor), vandetanib (Zactima), vemurafenib (Zelboraf), crizotinib (Xalkori), vorinostat (Zolinza), bevacizumab (Avastin), hyperthermia, gene therapy and photodynamic therapy.
[0085] In the treatment of cancer, an appropriate dosage level of the therapeutic agent will generally be about 0.01 to 500 mg per kg patient body weight per day which can be administered in single or multiple doses. Preferably, the dosage level will be about 0.1 to about 250 mg/kg per day; more preferably about 0.5 to about 100 mg/kg per day. A suitable dosage level may be about 0.01 to 250 mg/kg per day, about 0.05 to 100 mg/kg per day, or about 0.1 to 50 mg/kg per day. Within this range the dosage may be 0.05 to 0.5, 0.5 to 5 or 5 to 50 mg/kg per day. The compounds may be administered on a regimen of 1 to 4 times per day, preferably once per day prior to RT. Administration by continuous infusion is also possible. All amounts and concentrations of anti-nucleolin oligonucleotide conjugated gold nanoparticles are based on the amount or concentration of anti-nucleolin oligonucleotide only.
[0086] Pharmaceutical preparation may be pre-packaged in ready-to-administer form, in amounts that correspond with a single dosage, appropriate for a single administration referred to as unit dosage form. Unit dosage forms can be enclosed in ampoules, disposable syringes or vials made of glass or plastic.
[0087] However, the specific dose level and frequency of dosage for any particular patient may be varied and will depend upon a variety of factors including the activity of the specific compound employed, the metabolic stability and length of action of that compound, the age, body weight, general health, sex, diet, mode and time of administration, rate of excretion, drug combination, the severity of the particular condition, and the patient undergoing therapy.
Examples
[0088] AS1411-linked gold nanoparticles for treating cancer and for cancer imaging were synthesized. Studies to assess the anticancer activity of AS1411 linked to 5 nm gold nanoparticles indicate that the conjugates have greatly enhanced antiproliferative effects on breast cancer cells compared to AS1411 (SEQ ID NO. 10) alone. Microscopic examination revealed increased uptake in breast cancer cells for GNP-AS1411 compared to GNP alone or GNP conjugated to a control oligonucleotide. In addition, GNP-AS1411 induced breast cancer cell vacuolization and death, similar to that seen at higher concentrations of AS1411. The GI50 values for AS1411 conjugated GNP against breast cancer cells are in the 50-250 nM range, compared to 1-10 uM range for unconjugated AS1411 (equivalent aptamer concentration). Studies indicate that these AS1411-GNPs have selective accumulation in tumor tissue following systemic administration in mice. Moreover, AS1411-GNPs retained the cancer-selectivity of AS1411 and had no effect on non-malignant cells.
[0089] Preparation of Aptamer Conjugated Gold Nanoparticles (GNP)
[0090] The aptamers AS1411 and CRO (the control oligonucleotide) with 5 prime thiol modification and or 3 fluorophore Cy5 were purchased from Integrated DNA Technologies (IDT).
TABLE-US-00003 AS1411withthiollinkat5: 5-/5ThioMC6-D/TTTTTTGGTGGTGGTGGTTGTGGTGGT GGTGGTTT/-3. CROwiththiollinkat5: 5-/5ThioMC6-D/TTTTTTCCTCCTCCTCCTTCTCCTCCT CCTCCTTT/-3. AS1411withthiollinkat5 andfluorophoreCy5 at3: 5-/5ThioMC6-D/TTTTTTGGTGGTGGTGGTTGTGGTGGT GGTGGTTT/Cy5Sp/-3. CROwiththiollinkat5 fluorophoreCy5at3: 5-/5ThioMC6-D/TTTTTTCCTCCTCCTCCTTCTCCTCCT CCTCCTTT/Cy5Sp/-3.
[0091] The thiol ends of aptamers were reduced by tri(2-carboxyethyl) phosphine TECP (50 mM) which is active in slightly acidic pH 6.5 of Tris-EDTA (10 mM) solution for 4-8 hours at room temperature. The solution of aptamers and TECP was purified using NAP-columns sephadex G-25. Accurate Spherical Gold nanoparticles 5 nm was purchased from NANOPARTZ and/or TED PELLA INC. The gold nanoparticles were filtered using 0.5 micron syringe filter. Gold nanoparticles and aptamers were mixed in the molar ratio of 1:40 in 25 ml RNAse and DNAse free water at room temperature overnight. Excess reagents were then removed by centrifugation at 15000 rpm for 20 min, followed by 3 wash with RNAse and DNAse free water and centrifugation to remove any unbound aptamers. To quantify the amount of aptamers conjugated on the nanoparticles surface, the aptamer conjugated GNP was incubated in 0.1M DTT at room temperature followed by the separation from the GNP by centrifugation. The supernatant was diluted and measured either spectrophotometically (A260 nm), then calculating the concentration from the aptamers standard dilution curve or by NanoDrop 2000 UV-VIS spectrophotometer. Similarly, the concentration of gold nanoparticles was calculated using spectrophotometric optical density (OD) at 511 nm and plotting the standard dilution curve to extrapolate the concentration of gold nanoparticles and the standard data provided by vendors.
[0092]
[0093]
[0094] Comparison of Different Routes of Injection for Delivery of AS1411-GNP to Target Tissue
[0095] Three different routes of injection for delivery of GNP-AS1411 to target tissue were tested: intraperitoneal, intravenous, via tail vein, retro-orbital, injection. Based on pilot studies, it was determined that for long term and repeated injections (as in therapeutic dosing), intraperitoneal injection was preferred for its convenience and because the slower biodistribution (compared to intravenous or retro-orbital) was not a concern. For imaging, either tail vein or retro-orbital injections were used because it delivered the drug directly into the blood, resulting in more rapid systemic distribution and avoiding residual signal in the peritoneum that was observed when delivering through the intraperitoneal route.
[0096] Effect of GNP Size and Linkers Length on Cell Proliferation
[0097] Syntheses and analyses of GNPs and linkers were performed as follows: colloid spherical gold nanoparticles of different size (5, 10, 15 nm) were purchased from Ted Pella Inc. (Redding, Calif.) and Nanopartz (Loveland, Colo.). Size analyses of these gold nanoparticles were confirmed using PARTICLES SIZE ANALYZER 90 PLUS (Brookhaven Instrument), and the sizes of gold nanoparticles were within the ranges as described by the manufacturers. Fluorophore (Cy5)-linked oligonucleotides (AS1411 and CRO), with or without carbon spacers and thiol groups, were purchased from Integrated DNA Technologies (San Diego, Calif.). Cy5, or cyanine-5 phosphoramidite (1-[3-(4-monomethoxytrityloxy)propyl]-1-[3-[(2-cyanoethyl)-(N,N-diisopropyl)phosphoramidityl]propyl]-3,3,3,3-tetramethylindodicarbocyanine chloride) has the structure shown in Formula I:
##STR00001##
[0098] The linkers, C3-thiol (1-O-dimethoxytrityl-propyl-disulfide,1-succinyl-Icaa), MC6-D/iSP-9 (9-O-dimethoxytrityl-triethylene glycol,1-[(2-cyanoethyl)-(N,N-diisopropyl)]), and MC6-D/iSP-18 (18-O-dimethoxytritylhexaethylene glycol,1-[(2-cyanoethyl)-(N,N-diisopropyl)]), have the structures shown in Formulas II, III and IV, respectively:
##STR00002##
[0099]
[0100] In Vivo Biodistribution of AS1411-GNP Conjugated to Fluorophore Cy5
[0101] The use of multimodal imaging approaches utilizing optical and microCT was useful for detection of primary or disseminated breast cancer tumors. In this experiment a Cy5 fluorophore was linked to the 5-end of AS1411 and conjugated to the GNP (to give GNP-AS1411-Cy5), in order to evaluate its utility as a complex not only for optical imaging but also as a contrast agent for computed tomography (CT). A similar construct with CRO was synthesized as a control. Nude mice with MDA-MB-231 breast cancer xenografts on each flank were administered a single injection of fluorophore-oligonucleotide-GNP. Images were acquired using IVIS Imaging System/MAESTRO Fluorescence Imaging and preliminary data showed that GNP-AS1411-Cy5 (1 mg/kg) concentration in the tumor is many times more than that using AS1411-Cy5 without GNP (10 mg/kg), or GNP-CRO-Cy5. It was noted that all mice exhibited strong signals on their extremities (legs and paws) and tails; these were artifacts from the urine and feces of the mice in cage where they were housed (possibly due to a fluorescent substance in the animal feed). Washing the mice and housing them in new clean new cages before imaging can prevent this problem. Biodistribution analysis also confirmed that, besides liver, kidney and intestine, most of the GNP-AS1411 accumulated in the tumor (
[0102] Uptake Studies in MCF-7 Cells
[0103] Breast Cancer Cells (MCF-7) were treated with gold nanoparticles (GNP) conjugated with gadolinium-AS1411 or gadolinium-CRO and a linked fluorophore (Cy5) for 4 hrs. Confocal microscopy showing the uptake of the corresponding Oligo-Gd-GNP-Cy5 conjugate using Cy5 laser excitation (650 nm) and emission (670 nm) in MCF-7 cells. The results are shown in
[0104] Uptake Studies in MCF-10A Cells
[0105] Non-malignant Breast Epithelial Cells (MCF-10A) were treated with gold nanoparticles (GNP) conjugated with gadolinium-AS1411 or gadolinium-CRO and a linked fluorophore (Cy5) for 4 hrs. Confocal microscopy showing the uptake of the corresponding Oligo-Gd-GNP-Cy5 conjugate using Cy5 laser excitation (650 nm) and emission (670 nm) in MCF-10A cells. The results are shown in
[0106] DNA Damage Response
[0107] Confocal Microscopy images are shown in
[0108] Confocal microscopy images are shown in
[0109] Clonogenic Assay of Breast Cancer Cells
[0110] Breast Cancer Cells (MDA-MB-231) were plated in 35 mm dishes and treated with gold nanoparticle conjugated to gadolinium and AS1411 (0.03 mg/ml gold concentration). After 4 hrs dishes were radiated using X-Rad160/225 radiator at 100 cGy. Dishes were further incubated for 10 days. After incubation the colonies fix with 4% paraformaldehyde in phosphate buffer saline (PBS) and stained with 0.4% crystal violet. The results are shown in
[0111] Relaxivity Analysis
[0112]
[0113] Gadolinium-Functionalized Gold Nanoparticle CT/MRI Contrast Agent with Cancer Targeting Capabilities
[0114] Gold nanoparticles (GNP) provide contrast in computed tomography (CT) images and other X-ray based imaging techniques due to their high atomic mass, and may be modified with bioactive coatings to increase their functionality. We have tailored spherical GNPs (4 nm) with a T1 gadolinium-based magnetic resonance imaging (MRI) contrast agent (Gd(III)-DO3A-SH) and therapeutic/cancer-targeting DNA aptamer (AS1411) for cancer imaging and therapy. GNP coated with Gd(III)-DO3A-SH and AS1411 or CRO had hydrodynamic diameters of 13.452.11 and 19.012.51 nm, respectively, and zeta potentials of 13.830.74 and 52.621.01 mV. Both solutions were stable for more than 6 months in physiological buffer solutions. EDAX analysis of GNP-Gd(III)-DO3A-AS1411 and GNP Gd(III)-DO3A-CRO yielded 285 and 234 Gd centers per GNP, respectively, compared to 151 Gd centers per GNP for GNP-Gd(III)-DO3A solutions. AS1411 was detected on the gold nanoparticle surface using Quant-iT OliGreen ssDNA reagent via fluorescence imaging studies on purified samples of GNP Gd(III)-DO3A-AS1411, GNP-Gd(III)-DO3A and GNP-AS1411.
[0115] The GNP-Gd(III)-DO3A-AS1411/CRO probes have been assessed for their efficacy as CT and/or MRI contrast agents. At both 9.4 and 3.0 Tesla, solutions of GNP-Gd(III)-DO3A-SH-AS1411 and GNP-Gd(III)-DO3A-SH-CRO generate higher relaxivity than GNP-Gd(III)-DO3A, industry standard MULTIHANCE (gadobenate dimeglumine) or Gd(III)-DO3A-SH, Table 3. In CT scans, solutions of GNP-Gd(III)-DO3A-AS1411 and GNP-Gd(III)-DO3A-CRO yield significantly higher X-Ray attenuation (Hounsefield unit per milligram milliliter) values in comparison to Iopamidol, GNP-Gd(III)-DO3A and citrate capped gold, Table 3.
TABLE-US-00004 TABLE 3 Relaxivity and X-ray attenuation data Relaxivity Relaxivity Hounsefield (mM.sup.1s.sup.1) (mM.sup.1s.sup.1) at Unit (HU) mg.sup.1 Samples at 9.4 T 3.0 T ml GNP-(Gd(III) 24.83 27.51 227.46 DO3A SH)-AS1411 GNP-(Gd(III) 15.67 31.61 250.66 DO3A SH)-CRO GNP-(Gd(III) 5.56 81.53 DO3A SH) Gd(III) 2.29 DO3A SH MULTIHANCE 3.75 (gadobenate dimeglumine) GNP AS1411 83.03 GNP CRO 113.47 GNP Citrate Capped 92.47 lopamidol 71.07
[0116] CT Contrast
[0117] The Hounsfield unit is a normalized index of x-ray attenuation ranging from 1000 (air) to +1000 (bone) with water being 0 and is used in CT imaging to evaluate contrast. We have performed 5 microCT studies using a MicroCAT-II (Siemens, Knoxville, Tenn.) to evaluate various conjugated gold nanospheres. The images acquired at 45 kVp and 80 kVp were observed on the ImageJ software and a mean of five ROI (region of interest) values is obtained for the attenuation values in Hounsfield Unit (HU). The solution of GNS-DO3A-Gd3+ decorated with AS1411 yielded a higher magnitude of X-ray attenuation intensities and Hounsfield units per milligram milliliter (slope) values in comparison to equivalent amounts of the industry standard (Iopamidol) or citrate-capped gold nanoparticles (
[0118] Clonogenic Assay of Lung Cancer Cells
[0119] Lung cancer cells (A549) were treated with gold nanoparticles (GNP), 100 nM gold nanoparticle-control aptamer conjugates (GNP-CRO) and 100 nM gold-nanoparticle-AS1411 conjugates (GNP-AS1411). After 36 hours, the cells were exposed to 100 cGy X-ray radiation. The cells were further incubated for 7 days and fixed with 4% formalin and stained with 0.4% crystal violet solution. Colonies were de-stained with 10% acetic acid and absorbance was measured at 570 nm.
[0120] Concentration Study in Breast Cancer Cells
[0121] Triple negative breast cancer cells (MDA-MB-231) were treated with varying concentrations of gold nanoparticles (GNP), gold nanoparticle-control oligonucleotide conjugates (GNP-CRO) and gold-nanoparticle-AS1411 conjugates (GNP-AS1411) for 72 hours. X-ray radiation was then applied to the cells. The Log.sub.10 Survival Fraction of the cells after treatment and application of varying doses of X-ray radiation (cGy) was plotted.
[0122] Clonogenic Survival Assay of Breast Cancer Cells
[0123] Breast cancer cells (MDA-MB-231) were treated with gold nanoparticles (GNP), gold nanoparticle-control oligonucleotide conjugates (GNP-CRO) and gold-nanoparticle-AS1411 conjugates (GNP-AS1411) for 72 hours. The cells were washed in PBS and radiated at varying doses of -rays using a GammaCell-40 irradiator. The cells were trypsinized, counted and plated in six well plates for an additional 10 days. After incubation, the cells were fixed with methanol and stained with 2% crystal violet. The cells were counted and plotted for survival fraction as a function of radiation dose after exposure to -radiation. The results of the radiation treatment are shown in
[0124] Selective Retention of Gold Nanoparticle-Gadolinium-Oligomer Conjugates in Malignant Cells
[0125] Human immortalized breast epithelial cells (MCF10A) (non-malignant) and triple negative breast cancer cells (MDA-MB-231) were incubated with of fluorescent-labeled gold nanoparticle-gadolinium-oligomer conjugates for 4 and 96 hours. The cells were incubated with 50 nM GNP-Gd-CRO-Cy5 (control oligomer) or 50 nM GNP-Gd-AS1411-Cy5 using DO3A (1,4,7-tris(carboxymethyl)-1,4,7,10-tetraazacyclododecane) as the ligand to bind Gd and connect it to the GNP surface through a thiol linker. After incubation, the cells were harvested and washed with PBS (2), counted using a TC-10 Cell Counter (Bio-Rad), plated in a 4 chamber slide (Bio-Tek) at 1,000 cells/well and incubated for an additional 24 hours. The cells were stained with nuclear stain DAPI after incubation and the complete DMEM media was replaced with DMEM without phenol red. Images were acquired using a NIKON confocal microscope.
[0126] Human normal airway epithelial cells (HPLD-1) (non-malignant) and lung adenocarcinoma cells (A549) were incubated with of fluorescent-labeled gold nanoparticle-gadolinium-oligomer conjugates for 4 and 96 hours. The cells were incubated with 50 nM GNP-Gd-CRO-Cy5 (control oligomer) or 50 nM GNP-Gd-AS1411-Cy5 using DO3A as the ligand to bind Gd and connect it to the GNP surface through a thiol linker. After incubation, the cells were harvested and washed with PBS (2), counted using a TC-10 Cell Counter (Bio-Rad), plated in a 4 chamber slide (Bio-Tek) at 1,000 cells/well and incubated for an additional 24 hours. The cells were stained with nuclear stain DAPI after incubation and the complete DMEM media was replaced with DMEM without phenol red. Images were acquired using a NIKON confocal microscope.
[0127] The 4 hour images indicate that the uptake of aptamer conjugates in healthy and malignant cells is similar. The 96 hour images indicate that the AS1411 conjugates are only retained in malignant cells.
[0128] Gold Nanoparticle-Gadolinium-Oligomer Conjugates as MRI Contrast Agents
[0129] Gold nanoparticle-gadolinium-oligomer conjugates were studied as MRI contrast agents in vitro and in cells using a Bruker BioSpec 94/30 USR 9.4T MRI scanner. The change in reflectivity was measured using water to normalize the signals.
[0130] In a first experiment, the correlation between the concentration of the gold nanoparticle-oligomer conjugates and the improvement in the reflectivity due to the gadolinium (III) contrast agent was studied. The gold nanoparticle-oligomer conjugates included gold nanoparticles conjugated to AS1411 (5-d(GGTGGTGGTGGTTGTGGTGGTGGTGG)-3) (GNP-AS1411), gold nanoparticles conjugated to a control oligomer (5-d(CCTCCTCCTCCTTCTCCTCCTCCTCC)-3) (GNP-CRO) and gold nanoparticles conjugated to a control oligonucleotide (5d(TTTT)-3) (GNP-CTR). DO3A ligand was used to bind Gd(III) and connected it to the GNP surface through a thiol linker. GNP-AS1411, GNP-CRO and GNP-CTR were used as controls to compare the relaxivity of GNP-Gd-AS1411, GNP-Gd-CRO and GNP-Gd-CTR. The relaxivity was measured at 75 nM, 300 nM and 1200 nM GNP concentrations. Table 4 shows the change in relaxivity after administration of the Gd conjugates:
TABLE-US-00005 TABLE 4 Change in relaxivity GNP-Gd-CTR GNP-Gd-CRO GNP-Gd-AS1411 75 nM 17% 15% 19% 300 nM 33% 25% 44% 1200 nM 59% 58% 64%
[0131] These results are shown graphically in
[0132] In a second experiment, the correlation between the concentration of the gold nanoparticle-oligomer conjugates in cells and the improvement in the reflectivity due to the gadolinium (III) contrast agent was studied. 30,000,000 cells were treated with GNP-AS1411, GNP-CRO, GNP-CTR, GNP-Gd-AS1411, GNP-Gd-CRO or GNP-Gd-CTR for 48 hours or 96 hours. The relaxivity was measured at 75 nM, 300 nM and 1200 nM GNP concentrations. Table 5 shows the change in relaxivity after the 48 hour treatment:
TABLE-US-00006 TABLE 5 Change in relaxivity after 48 hour treatment 48 hour treatment GNP-Gd-CTR GNP-Gd-CRO GNP-Gd-AS1411 75 nM 5.5% 5% 6% 300 nM 5.7% 8% 9% 1200 nM 22% 19% 37%
[0133] Table 6 shows the change in relaxivity after the 96 hour treatment:
TABLE-US-00007 TABLE 6 Change in relaxivity after 96 hour treatment 96 hour treatment GNP-Gd-CTR GNP-Gd-CRO GNP-Gd-AS1411 75 nM 2.2% 3.5% 3.6% 300 nM 4.7% 7.1% 8.1% 1200 nM 15.3% 17.2% 36.8%
[0134] The 48 hour treatment results are shown graphically in
[0135] Comparison of Gold Nanoparticle-Oligomer Conjugates to Commercially-Available MRI Contrast Agent
[0136] The MRI contrast enhancement properties of gold nanoparticle-oligomer conjugates were compared to MULTIHANCE (Bracco), a commercially-available MRI contrast agent. The percent contrast enhancement was measured in breast cancer cells (MDA-MB-231). The gold nanoparticle-oligomer conjugates included gold nanoparticles conjugated to AS1411 (5-d(GGTGGTGGTGGTTGTGGTGGTGGTGG)-3) (GNP DOTA AS1411), gold nanoparticles conjugated to a control oligomer (5-d(CCTCCTCCTCCTTCTCCTCCTCCTCC)-3) (GNP DOTA CRO) and gold nanoparticles conjugated to a control oligonucleotide (5d(TTTT)-3) (GNP DOTA CTR). DOTA (1,4,7,10-tetrakis(carboxymethyl)-1,4,7,10-tetraazacyclododecane) was used as the ligand. The MULTIHANCE cells were treated for 24 hours, 48 hours, 72 hours and 96 hours, while the gold nanoparticle-oligomer conjugate cells were treated for 48 hours and 96 hours. The results are shown in
REFERENCES
[0137] [1] Stedman, T. L. 2000. Stedman's medical dictionary. Lippincott Williams & Wilkins, Philadelphia. xxxvi, [127], 2098. [0138] [2] Miller, D., P. Bates, and J. Trent. 2000. Antiproliferative activity of G-rich oligonucleotides and method of using same to bind to nucleolin, Intl Pub. No. WO 00/61597. [0139] [3] Bates P J, Miller D M, Trent J O, Xu X, A New Method for the Diagnosis and Prognosis of Malignant Diseases International Application, Intl Pub. No. WO 03/086174 A2 (23 Oct. 2003). [0140] [4] Bates P J, Miller D M, Trent J O, Xu X, Method for the Diagnosis and Prognosis of Malignant Diseases U.S. Patent App. Pub., Pub. No. US 2005/0053607 A1 (10 Mar. 2005). [0141] [5] Derenzini M, Sirri V, Trere D, Ochs R L, The Quantity of Nucleolar Proteins Nucleolin and Protein B23 is Related to Cell Doubling Time in Human Cancer Cells Lab. Invest. 73:497-502 (1995). [0142] [6] Bates P J, Kahlon J B, Thomas S D, Trent J O, Miller D M, Antiproliferative Activity of G-rich Oligonucleotides Correlates with Protein Binding J. Biol. Chem. 274:26369-77 (1999). [0143] [7] Miller D M, Bates P J, Trent J O, Xu X, Method for the Diagnosis and Prognosis of Malignant Diseases U.S. Patent App. Pub., Pub. No. US 2003/0194754 A1 (16 Oct. 2003). [0144] [8] Bandman O, Yue H, Corley N C, Shah P, Human Nucleolin-like Protein U.S. Pat. No. 5,932,475 (3 Aug. 1999). [0145] [9] Reyes-Reyes E M, Teng Y, Bates P J, A New Paradigm for Aptamer Therapeutic AS1411 Action: Uptake by Macropinocytosis and Its Stimulation by a Nucleolin-Dependent Mechanism Cancer Res 70(21): 8617-29 (2010). [0146] [10] Huang Y, Shi H, Zhou H, Song X, Yuan S, Luo Y, The Angiogenic Function of Nucleolin is Mediated by Vascular Endothelial Growth Factor and Nonmuscle Myosin Blood 107(9): 3564-71 (2006). [0147] [11] Jain, K. K., Advances in the field of nanooncology. BMC medicine, 2010. 8: p. 83. [0148] [12] Portney, N. G. and M. Ozkan, Nano-oncology: drug delivery, imaging, and sensing. Analytical and bioanalytical chemistry, 2006. 384(3): p. 620-30. [0149] [13] Bates, P. J., E. W. Choi, and L. V. Nayak, G-rich oligonucleotides for cancer treatment. Methods in molecular biology, 2009. 542: p. 379-92. [0150] [14] Bates, P. J., et al., Discovery and development of the G-rich oligonucleotide AS1411 as a novel treatment for cancer. Experimental and molecular pathology, 2009. 86(3): p. 151-64. [0151] [15] Soundararajan, S., et al., The nucleolin targeting aptamer AS1411 destabilizes Bcl-2 messenger RNA in human breast cancer cells. Cancer research, 2008. 68(7): p. 2358-65. [0152] [16] Javier, D. J., et al., Aptamer-targeted gold nanoparticles as molecular-specific contrast agents for reflectance imaging. Bioconjugate chemistry, 2008. 19(6): p. 1309-12. [0153] [17] Euhus, D. M., et al., Tumor measurement in the nude mouse. Journal of surgical oncology, 1986. 31(4): p. 229-34. [0154] [18] Tomayko, M. M. and C. P. Reynolds, Determination of subcutaneous tumor size in athymic (nude) mice. Cancer chemotherapy and pharmacology, 1989. 24(3): p. 148-54. [0155] [19] Girvan, A. C., et al., AGRO100 inhibits activation of nuclear factor-kappaB (NF-kappaB) by forming a complex with NF-kappaB essential modulator (NEMO) and nucleolin. Molecular cancer therapeutics, 2006. 5(7): p. 1790-9. [0156] [20] Mosmann, T., Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. Journal of immunological methods, 1983. 65(1-2): p. 55-63. [0157] [21] Vermes, I., et al., A novel assay for apoptosis. Flow cytometric detection of phosphatidylserine expression on early apoptotic cells using fluorescein labelled Annexin V. Journal of immunological methods, 1995. 184(1): p. 39-51. [0158] [22] Sprague, J. E., et al., Noninvasive imaging of osteoclasts in parathyroid hormone-induced osteolysis using a 64Cu labeled RGD peptide. Journal of nuclear medicine: official publication, Society of Nuclear Medicine, 2007. 48(2): p. 311-8. [0159] [23] Morgan D. M., Methods Mol. Biol. 1998. 79:179-183. [0160] [24] Zhang, Y. et al., A surface-charge study on cellular-uptake behavior of F3-peptide-conjugated iron oxide nanoparticles. Small, 2009 5(17): p. 1990-6. [0161] [25] Orringer, D. A., et al. In vitro characterization of a targeted, dye-loaded nanodevice for intraoperative tumor delineation. Neurosurgery, 2009 64(5): p. 965-72. [0162] [26] Cooper et al. [2014], Front. Chem. 14, 2, 86. [0163] [27] Alkilany, A. M. and C. J. Murphy, Toxicity and cellular uptake of gold nanoparticles: what we have learned so far? Journal of Nanoparticle Research, 2010. 12(7): p. 2313-2333. [0164] [28] National Lung Screening Trial Research, T., et al., Reduced lung-cancer mortality with low-dose computed tomographic screening. N Engl J Med, 2011. 365(5): p. 395-409.