NOVEL CATHEPSIN INHIBITORS

20240352070 ยท 2024-10-24

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to a cathepsin inhibitor comprising or consisting of Formula (I) (X.sub.1)(X.sub.2)(X.sub.3)(X.sub.4)(Y)(X.sub.5)(X.sub.6)(X.sub.7) Formula (I) wherein (X.sub.1) is an amino acid selected from K, L, F and M; (X.sub.2) is an amino acid selected from L, A, D, E, F, G, H, I, K, M, N, S, W, Y, Q and R; (X.sub.3) is an amino acid selected from R, A and L; (X.sub.4) is an amino acid selected from M, I, K, V and Y; (X.sub.5) is an amino acid selected from P, A, I, L, V, W and Y; (X.sub.6) is an amino acid selected from K, A, E, F, G, I, L, M, N, Q, S, T, V, W, Y and Q; (X.sub.7) is an amino acid selected from D, A, E, F, G, I, L, M, N, P, T, V, W, Y, Q and R; and (Y) is a Michael acceptor.

    Claims

    1. A cathepsin inhibitor comprising or consisting of Formula (I)
    (X.sub.1)(X.sub.2)(X.sub.3)(X.sub.4)(Y)(X.sub.5)(X.sub.6)(X.sub.7)Formula (I) wherein (X.sub.1) is an amino acid selected from K, L, F and M; (X.sub.2) is an amino acid selected from L, A, D, E, F, G, H, I, K, M, N, S, W, Y, Q and R; (X.sub.3) is an amino acid selected from R, A and L; (X.sub.4) is an amino acid selected from M, I, K, V and Y; (X.sub.5) is an amino acid selected from P, A, I, L, V, W and Y; (X.sub.6) is an amino acid selected from K, A, E, F, G, I, L, M, N, Q, S, T, V, W, Y and Q; (X.sub.7) is an amino acid selected from D, A, E, F, G, I, L, M, N, P, T, V, W, Y, Q and R; and (Y) is a Michael acceptor.

    2. The cathepsin inhibitor of claim 1, wherein the cathepsin inhibitor selectively inhibits cathepsin S and comprises or consists of Formula (II)
    (X.sub.1)(X.sub.2)(X.sub.3)(X.sub.4)(Y)(X.sub.5)(X.sub.6)(X.sub.7)Formula (II) wherein (X.sub.1) is an amino acid selected from K, L, M, and is preferably K; (X.sub.2) is an amino acid selected from L, A, D, E, F, G, H, I, M, N, Q, S, W, Y, and is preferably F or H; (X.sub.3) is an amino acid selected from R and L; (X.sub.4) is the amino acid M; (X.sub.5) is an amino acid selected from P, A, I, L, V, W, and is preferably V; (X.sub.6) is an amino acid selected from K, A, E, F, G, I, L, M, N, Q, S, T, V, W, Y, and is preferably selected from F, L, M, W and Y, and is most preferably L or M; (X.sub.7) is an amino acid selected from D, A, E, F, G, I, L, M, N, P, Q, T, V, W, Y, and is preferably selected from F, I, L, V, W and Y and is most preferably F or W.

    3. The cathepsin inhibitor of claim 2, wherein the cathepsin inhibitor comprises or consists of KLRM(Y)PKD or KHRM(Y)VMW and preferably comprises or consists of KHRM(Y)VMW.

    4. The cathepsin inhibitor of claim 1, wherein the cathepsin inhibitor selectively inhibits cathepsin B and comprises or consists of Formula (III)
    (X.sub.1)(X.sub.2)(X.sub.3)(X.sub.4)(Y)(X.sub.5)(X.sub.6)(X.sub.7)Formula (III) wherein (X.sub.1) is the amino acid K or F; (X.sub.2) is an amino acid selected from A, H, I, K and R, and is preferably H or R; (X.sub.3) is an amino acid selected from A, R and L, and is preferably L; (X.sub.4) is an amino acid selected from I, K, V and Y, and is preferably K or Y; (X.sub.5) is an amino acid selected from A, I, Y, V and W, and is preferably V or W; (X.sub.6) is an amino acid selected from A, F, L, M, T and V, and is preferably L or M; (X.sub.7) is an amino acid selected from A, F, I, L, N, P, R, W and Y and is preferably F or L.

    5. The cathepsin inhibitor of claim 4, wherein the cathepsin inhibitor comprises or consists of KRRY(Y)WMW.

    6. The cathepsin inhibitor of any one of claims 1 to 5, wherein the Michael acceptor is an enone, a nitro group or a sulfonyl fluoride and is preferably an enone.

    7. The cathepsin inhibitor of claim 6, wherein the Michael acceptor has the general formula (IV) or (V) ##STR00008## wherein R1, R2 and R4 each independently is H or a halogen, wherein the halogen is preferably F; R3 is chalcogen and is preferably O or S; and ##STR00009##

    8. The cathepsin inhibitor of any one of claims 1 to 7, wherein the cathepsin inhibitor inhibits cathepsin S or B with IC.sub.50 of below 200 M, preferably below 100 M and most preferably below 75 M.

    9. The cathepsin inhibitor of any one of claims 1 to 8, wherein the cathepsin inhibitor comprises at its N- or C-terminus, preferably at its C-terminus a linking moiety.

    10. The cathepsin inhibitor of claim 9, wherein the linking moiety is an azide, alkyne phenol, secondary or tertiary amine, hydroxyl group, carbamate, or carbonate group, and is preferably an azide.

    11. A fusion construct, wherein the cathepsin inhibitor of any one of claims 1 to 8 is fused to a heterologous compound, preferably fused to a pharmaceutically and/or diagnostically active compound.

    12. The fusion construct of claim 11, wherein the heterologous compound is selected from the group consisting of: (i) antibody or fragment thereof; (ii) an antibody mimetic, preferably selected from the group consisting of Anticalins, Affibodies, Adnectins, DARPins, Avimers, Nanofitins, Affilinss, @-Wrapins, ADAPT, Monobodies, Raslns, FingRs, Pronectins, Centyrins, Affimers, Adhirons, Affitins, Reps, Repebodies, i-bodies, Fynomers and Kunitz domain proteins; (ii) a cytokine, preferably cytokines selected from the group consisting of IL-2, IL-12, TNF-alpha, IFN alpha, IFN beta, IFN gamma, IL-10, IL-15, IL-24, GM-CSF, IL-3, IL-4, IL-5, IL-6, IL-7, IL-9, IL-11, IL-13, LIF, CD80, B70, TNF beta, LT-beta, CD-40 ligand, Fas-ligand, TGF-beta, IL-1alpha and IL-1 beta; (iii) a toxic compound, preferably a small organic compound or polypeptide, and preferably a toxic compound selected from the group consisting of calicheamicin, neocarzinostatin, esperamicin, dynemicin, kedarcidin, maduropeptin, doxorubicin, daunorubicin, auristatin, Ricin-A chain, modeccin, truncated Pseudomonas exotoxin A, diphtheria toxin and recombinant gelonin; (iv) a chemokine, preferably a chemokine selected from the group consisting of IL-8, GRO alpha, GRO beta, GRO gamma, ENA-78, LDGF-PBP, GCP-2, PF4, Mig, IP-10, SDF-1alpha/beta, BUNZO/STRC33, I-TAC, BLC/BCA-1, MIP-1alpha, MIP-1 beta, MDC, TECK, TARC, RANTES, HCC-1, HCC-4, DC-CK1, MIP-3 alpha, MIP-3 beta, MCP-1-5, Eotaxin, Eotaxin-2, 1-309, MPIF-1, 6Ckine, CTACK, MEC, Lymphotactin and Fractalkine; (v) a fluorescent dye, preferably a component selected from a Alexa Fluor or Cy dye; (vi) a photosensitizer, preferably bis(triethanolamine)Sn(IV) chlorine6 (SnChe6); (vii) a pro-coagulant factor, preferably a tissue factor; (viii) an enzyme, preferably an enzyme selected from the group consisting of carboxy-peptidases, glucuronidases and glucosidases; (ix) a radionuclide selected either from the group of gamma-emitting isotopes, preferably 99mTc, 123I, 111In, or from the group of positron emitters, preferably 18F, 64Cu, 68Ga, 86Y, 124I, or from the group of beta-emitters, preferably 131I, 90Y, 177Lu, 67Cu, or from the group of alpha-emitters, preferably 213Bi, 211At; (x) nanoparticles.

    13. A pharmaceutical or diagnostic composition comprising the cathepsin inhibitor of any one of claims 1 to 8 and/or the fusion construct of claim 11 or 12.

    14. The cathepsin inhibitor of any one of claims 1 to 9, the fusion construct of claim 11 or 12 or the pharmaceutical composition of claim 13 for use in treating cancer or an immunological disorder.

    15. The cathepsin inhibitor, fusion construct or pharmaceutical composition for use of claim 14, wherein the cancer is selected from the group consisting of breast cancer, ovarian cancer, endometrial cancer, vaginal cancer, vulvacancer, bladder cancer, salivary gland cancer, pancreatic cancer, thyroid cancer, kidney cancer, lung cancer, cancer concerning the upper gastrointestinal tract, colon cancer, colorectal cancer, prostate cancer, squamous-cell carcinoma of the head and neck, cervical cancer, glioblastomas, malignant ascites, lymphomas and leukemias.

    Description

    [0121] The above considerations apply mutatis mutandis to all appended claims

    [0122] The figures show.

    [0123] FIG. 1. A-C FRET curve of CTSS WT (A), CTSS Y132D (B) and CTSH (C) during 180 minutes of incubation with the P3 inhibitor.

    [0124] FIG. 2. Summary of single-site saturation mutagenesis screening results. Residual activity of CTSS measured by FRET assay, normalized to the activity observed when P3 is used to inhibit CTSS. All inhibitors were tested at 15 uM.

    [0125] FIG. 3. A Dose-response curve of CTSS wild-type activity after 50 minutes of incubation with NPI C10. B CTSS mutated (Y132D) activity after 50 minutes of incubation with NPI C10 at the indicated concentrations.

    [0126] FIG. 4. Summary of single-site saturation mutagenesis screening results. Residual activity of CTSB measured by FRET assay, normalized to the activity observed when P3 is used to inhibit CTSB. All inhibitors were tested at 7.5 uM.

    [0127] FIG. 5. Dose-response curve of CTSB (top) and CTSS (bottom) activity after 50 minutes of incubation with NPI D5.

    [0128] FIG. 6. A-B Results of internalization assay performed by incubating WSU-DLCL2 cells with the Epr-AF488 antibody for 3 hours at 37 C. (A) or 4 C. (B). Single-cell fluorescence was measured by flow cytometry.

    [0129] FIG. 7. A-B CD74 accumulation after 48 hours-long anti-CD22 APeC treatment in WSU cells (A) and Raji cells (B). C-D CD74 accumulation after 48 hours-long anti-CD79 APeC treatment in WSU cells (C) and Raji cells (D). Single-cell fluorescence was measured by flow cytometry. CTSS inhibitor Petesicatib was used as positive control.

    [0130] FIG. 8. Output of quenched activity-based probe (qABP) assay. The presence of a dark band corresponds to the detection of a strong activity of CTSB. Absence of a band means complete CTSB inhibition. APeC=antibody-peptide conjugate. Ab=antibody.

    [0131] FIG. 9. Antibody conjugation strategy. The antibody first reacts with a DBCO-maleimide linker, then with the azide-modified NPI C10. Image adapted from DBCO or azide reactive liposomes, liposomes.org.

    [0132] FIG. 10. Output of quenched activity-based probe (qABP) assay on Raji lymphoma cells (left) and HCC-1569 breast cancer cells (right). The presence of a dark band at a precise molecular weight indicates to the detection of a strong activity of the corresponding cathepsin. Absence of a band means complete cathepsin inhibition. APeC=antibody-peptide conjugate. ab=antibody.

    [0133] FIG. 11. Output of quenched activity-based probe (qABP) assay on primary human B-cells. The presence of a dark band at a precise molecular weight indicates to the detection of a strong activity of the corresponding cathepsin. Absence of a band means complete cathepsin inhibition. APeC=antibody-peptide conjugate. ab=antibody.

    [0134] FIG. 12. Quantification of cells migration of in vitro invasion assay with breast cancer cell lines in transwells, upon treatment with APeC (red), control aHER2 antibody or peptide (grey) and PBS (black). Cells need to invade through a matrigel layer before crossing the membrane. Quantification is based on imaging of stained membranes. The assay was performed with BT-474 (left) and HCC-1569 (right) breast cancer cells. APeC=antibody-peptide conjugate.

    [0135] FIG. 13. Imaging of radiance total flux from luciferase-expressing Raji cells in humanized NSG mice treated twice a week starting on day 8 post-injection of 0.1 M Raji lymphoma cells by tail-vein. APeC=antibody-peptide conjugate.

    [0136] FIG. 14. Time-course of radiance total flux from luciferase-expressing Raji cells in humanized NSG mice treated twice a week starting on day 8 post-injection of 0.1 M Raji lymphoma cells by tail-vein. APeC=antibody-peptide conjugate.

    [0137] The examples illustrate the invention.

    EXAMPLE 1GENERATION OF A CATHEPSIN S INHIBITOR

    [0138] To generate a new cathepsin S inhibitor, it was decided to start from the structure of the human protein CD74, which is a natural substrate of cathepsin S, and we computationally identified the region of the protein that is recognized and cleaved by cathepsin S. After validating the identified peptide by showing in a FRET assay that it is cleaved by cathepsin S, we synthesized multiple candidate inhibitors starting from the peptide structure, by adding a Michael acceptor at different positions in the molecule. Testing the candidates' inhibitory activity by FRET assay allowed to identify a first molecule able to bind and inhibit cathepsin S (Structure 1).

    ##STR00004##

    [0139] Structure 1. Non-natural peptide inhibitor P3. The structure of the Michael acceptor is highlighted in bold.

    [0140] Then, a single-site saturation mutagenesis screen was performed to identify the amino acid changes that would improve the affinity of our inhibitor for cathepsin S. The screening allowed us to identify several inhibitors of cathepsin S more potent than our previously identified P3 (FIG. 2, in the Results section). Based on these results and follow-up experiments, a non-natural peptide inhibitor was identified as a very potent inhibitor of cathepsin S and was named C10. Its structure is the following:

    ##STR00005##

    [0141] Structure 2. Non-natural peptide inhibitor C10. The structure of the Michael acceptor is highlighted in bold.

    EXAMPLE 2GENERATION OF A CATHEPSIN B INHIBITOR

    [0142] Then, an additional single-site saturation mutagenesis screen on cathepsin B was used to identify the amino acid changes that can be combined to obtain a strong cathepsin B inhibitor based on the cathepsin S inhibitor as obtained in Example 1. Information from both screenings was used to select amino acid changes that could improve the specificity of the inhibitor for cathepsin B or cathepsin S. The strongest non-natural peptide inhibitor for cathepsin B that was identified with this screening and follow-up experiments was named D5. Its structure is the following:

    ##STR00006##

    [0143] Structure 3. Non-natural peptide inhibitor D5. The structure of the Michael acceptor is highlighted in bold.

    EXAMPLE 3CONJUGATES WITH THERAPEUTIC ANTIBODIES

    [0144] Next, the conjugation of the non-natural peptide inhibitors as obtained in Examples 1 and 2 with the therapeutic anti-CD22 antibody Epratuzumab was optimized to generate an antibody-peptide conjugate (APeC). The APeC was tested on the WSU-DLCL2 and Raji lymphoma cell lines and the tests showed that the APeC is internalized by lymphoma cells and inhibits cathepsin S in these cells. The same conjugation strategy was then used to demonstrate the efficacy of a second APeC that can target lymphoma cells, which was obtained by conjugating the C10 inhibitor with an anti-CD79 antibody. Finally, to demonstrate that this strategy can be generalized to target other tumor types, an anti-HER2 antibody (Trastuzumab) was conjugated to our C10 inhibitor and tested CTSB inhibition in a breast cancer cell line. The general structure of our three APeCs is the following:

    ##STR00007##

    [0145] Structure 4. General structure of antibody-peptide conjugates carrying the C10 inhibitor of cathepsin S. The structure of the Michael acceptor is highlighted in bold.

    EXAMPLE 4MATERIALS AND METHODS

    [0146] Cathepsins protein expression and purification. For CTSS purification, the human CTSS sequence depleted of the lysosomal localization signal (amino acids 17 to 331) was amplified from pLVX plasmids expressing WT or Y132D CTSS using the following primers:

    TABLE-US-00002 CTSS_pHLsec_fw: (SEQIDNO:1) GCTGAAACCGGTCAGTTGCATAAAGATCCTAC CTSS_pHLsec_rev: (SEQIDNO:2) GTGCTTGGTACCGATTTCTGGGTAAGAGGGAAAGC

    [0147] The PCR products were digested using Agel and Kpn1 restriction enzymes (NEB, cat #R3552S and #R3142S), then cloned in pHLsec plasmids carrying a secretion signal at the N-terminal of the MCS and a His-tag sequence at the C-terminal of the MCS. pHLsec-CTSS plasmids were transfected into HEK293 cells with PEI (polyethyleneimine) in presence of VPA (valproic acid). Proteins were purified from the supernatant using a 5 ml His-Trap FF column on an KTA pure system (GE healthcare). Bound proteins were eluted using a 300 mM imidazole solution. Concentrated proteins were further purified by size exclusion chromatography on a HiLoad 16/600 Superdex 75 pg column (GE Healthcare) using PBS as mobile phase. Purified proteins were quantified by Nanodrop, diluted in a buffer containing 12.5 mM MES, 75 mM NaCl and 50% glycerol at ph 6.5 and stored at 20 C. Purified CTSB and CTSH were purchased from RndSystems.

    [0148] FRET (Fluorescence Resonance Energy Transfer) assay to test CTSS activity. For FRET experiments, CTSS-His was diluted to 10 g/mL in assay buffer (50 mM NaOAc, 5 mM DTT, 250 mM NaCl), at pH 4.5 and incubated at 37 C. for 90 minutes to allow auto-activation. The protein was then diluted to 0.5 ng/ul in assay buffer and plated in 96-well plates (50 ul/well). As substrate, we used a peptide (KLRMKLPKP) produced by the PPCF Facility (UNIL) and diluted at 20 uM in assay buffer. The peptide synthesized by the PPCF Facility had a MCA group at the C-term and a DNP group at the N-term. The peptide was added to the activated CTSS (50 ul/well) and fluorescent emission (MCA) was measured with SpectraMax iD3 (Molecular Devices) in kinetic mode for three hours (excitation: 330 nm, emission: 390 nm).

    [0149] Single-site saturation mutagenesis screening. We tested a library of 133 non-natural peptide inhibitors (NPIs), each differing from our initial inhibitor design for only one amino acid in the structure. The peptides were synthesized by GL Biochem (Shanghai), and we tested them using the CTSS FRET assay described above. The FRET assay was miniaturized to perform the screen in a 384-well plate and each NPI was tested in duplicates. CTSS was incubated at 10 ug/ml in the activation buffer for 105 minutes to allow a complete activation of the enzyme. Then, the enzyme was diluted at 1 ug/ml and dispensed in a 396-well plate pre-loaded with the NPIs using an automatic dispenser (Biotek Dispenser Multiflo). The plates were incubated for 30 minutes at room temperature and then 20 uM of substrate was added to each well. The residual CTSS activity was measured by acquiring the fluorescence signal after 90 minutes (excitation: 330 nm, emission: 390 nm). In the plate, we included untreated wells as negative control and we used E64 (150 uM) as positive control. To assess the quality of the screen, a Z-score was calculated for the plate and its value was confirmed to be Z>0.6.

    [0150] The saturation mutagenesis screening was used to identify stronger CTSS inhibitors bearing single amino acid changes compared to our initial inhibitor, and to select modifications that would allow to design new NPIs with the potential to show even stronger activity on CTSS. 13 new NPIs featuring combinations of promising amino acid modifications were synthesized and tested by FRET assay. The strongest inhibitor of cathepsin S identified through this process, which we will refer to as C10, was selected to perform a dose-response curve by FRET assay and cellular assays to determine its efficacy in a cellular environment.

    [0151] Specificity assay. To define whether our non-natural peptide inhibitor of cathepsin S could also inhibit the activity of other cathepsins as cathepsin B (CTSB) or cathepsin H (CTSH), we developed a FRET assay to test CTSB and CTSH activity. First, we used specific conditions to activate the enzymes. CTSB was diluted in a specific activation buffer (MES 25 mM, DTT 5 mM, pH 5) at 10 ug/ml, incubated at 37 C. for 2 h and then diluted to 1 ug/ml in assay buffer (MES 25 mM, pH 5) for the FRET assay. CTSH was diluted in a different activation buffer (MES 50 mM, CaCl.sub.2) 10 mM, NaCl 150 mM, pH 6.5) at 200 ug/ml. In addition, as co-stimulatory activator we used thermolysin diluted at 100 ug/ml in activation buffer and then mixed with an equal volume of the diluted CTSH. The solution was incubated for 1 h at room temperature and then we added 2 mM Phosphoramidon diluted in assay buffer (MES 50 mM, pH 6.5) and we incubated the mix for 10 minutes at room temperature. Lastly, we added an equal volume of assay buffer containing 20 mM DTT and incubated the solution for 5 minutes at room temperature. For the FRET assay, we diluted both CTSH, and CTSB at 1 ug/ml in their specific assay buffer and incubated them with a specific substrate. We used as substrate KPPKPVSD in CTSB FRET assays and KLRMKLPKP in CTSH FRET assays and we tested two doses of our P3 inhibitor (20 uM and 50 uM). Fluorescence emission was measured with SpectraMax iD3 (Molecular Devices) in kinetic mode over three hours (excitation: 330 nm, emission: 390 nm).

    [0152] Antibody conjugation. To generate a new molecule that can be internalized by B-cells and lymphoma cells to reach cathepsin S molecules and inhibit them, our cathepsin S inhibitor (C10) was conjugated to the Epratuzumab or an anti-CD79 antibody, thereby producing an antibody-peptide conjugate (APeC). As a first step, 30-fold molar excess of TCEP was added to the solution of antibody in PBS, and the mix was incubated at room temperature for 20 minutes. Then, 20-fold molar excess of DBCO-maleimide linker molecule was added and the solution was incubated for 1 hour at room temperature to label cysteines in the antibody. Later, the excess of linker molecule was removed by running the solution through an Econo-Pac 10DG Desalting Column (Bio-Rad, cat. no. 7322010) following the manufacturer's instructions. Finally, 4-fold molar excess of our azide-C10 inhibitor was added to the solution which was incubated overnight at 4 C. To perform antibody internalization assays, Epratuzumab was conjugated with the AlexaFluor-488 azide-dye (ThermoFisher Scientific, A10266) instead of our C10 inhibitor (we will refer to the labelled antibody as Epr-AF488). The Epr-AF488 antibody was subsequently purified from the excess of dye with an Econo-Pac 10DG Desalting Column. To test the conjugation with an antibody targeting breast cancer cells, our C10 inhibitor was conjugated to an anti-her2 antibody (Trastuzumab) following the same protocol described above for Epratuzumab conjugation.

    [0153] Internalization assay. To test the internalization of the conjugated Epratuzumab antibody, 210.sup.5 WSU-DLCL2 cells were incubated at 37 C. for 3 hours with 100 ug/ml of Epr-AF488 in PBS. As negative control, the same number of cells was incubated with 100 ug/ml of Epratuzumab previously incubated with AF488 dye in absence of DBCO-maleimide linker. Each experimental condition was tested in duplicates. Cells were then washed 3 times with PBS and 1 ul of anti-AF488 quencher antibody (ThermoFisher Scientific, A-11094) was added to half of the samples. Samples' fluorescence was measured by flow cytometry using Millipore Guava EasyCyte HT instrument (MilliporeSigma).

    [0154] CD74 accumulation assay for efficacy assessment. To test the efficacy of our APeCs, 210.sup.5 WSU-DLCL2 or Raji cells were incubated for two days with 300 or 500 ug/ml of APeC, in RPMI 1640 medium (ThermoFisher Scientific) supplemented with 10% FBS and 1% Penicillin-Streptomycin (ThermoFisher Scientific, cat. no. 15140122). After the first 24 h treatment, the cells were washed and resuspended in fresh APeC at the same treatment concentration. As negative controls, the same number of cells was either treated with PBS or with 300 ug/ml of the corresponding antibody previously incubated with C10 inhibitor in absence of DBCO-maleimide linker. Each treatment condition was tested in duplicates. At the end of the second day of treatment, cells were fixed and permeabilized with BD Cytofix/Cytoperm Fixation/Permeabilization Kit (BD Biosciences, cat. no. 554714) following the manufacturer's instructions. Cells were then stained with anti-human CD74 antibody (BioLegend, cat. no. 357604) and fluorescence was measured by flow cytometry using BD LSRFortessa instrument (BD Biosciences). Quenched activity-based probe assay to assess cellular CTSB inhibition. To test the efficacy of our APeC for CTSB inhibition, 210.sup.5 MCF-7 cells were incubated for 16 hours with 500 ug/ml of APeC, in Gibco DMEM medium (ThermoFisher Scientific) supplemented with 10% FBS and 1% Penicillin-Streptomycin (ThermoFisher Scientific, cat. no. 15140122). As negative controls, the same number of cells was either treated with PBS or with 500 ug/ml of anti-HER2 antibody previously incubated with C10 inhibitor in absence of DBCO-maleimide linker. Each treatment condition was tested in duplicates. At the end of the 16-hours treatment, cells were incubated for 1 hour with a pan-cathepsin probe (BMV109, quenched-activity based probe). The cells were then centrifuged at 10000 g for 1 min at RT, the supernatant was removed, and the cells were taken up in 9 l hypotonic lysis buffer (50 mM PIPES pH 7.4, 10 mM KCl, 5 mM MgCl, 4 mM DTT, 2 mM EDTA, and 1% NP-40). The lysate was incubated on ice for 5 min, followed by centrifugation at 21130 g for 15 min at 4 C. The supernatant was transferred, diluted with 4 sample buffer (3 l) and the mixture was heated for 5 min at 95 C. The samples were spun down and separated by 15% SDS-PAGE. The gel was analysed by scanning in-gel fluorescence on a Typhoon Trio flat-bed laser scanner (GE Healthcare), and protein loading was confirmed by staining with Coomassie Brilliant Blue R-250 (Schmidt GmbH). When the probe binds to CTSB, a fluorescent band can be observed in the SDS-PAGE gel. Since the BMV109 probe binds to CTSB only if the enzyme is active (i.e. not inhibited), the presence of a dark band corresponds to the detection of a strong activity of CTSB, while the absence of a band means complete CTSB inhibition.

    EXAMPLE 5RESULTS

    [0155] To test the inhibitory potential of the first non-natural peptide inhibitor (NPI) of cathepsin S (CTSS) which was designed, named P3, a specific FRET assay for CTSS we performed. It was observed that P3 was able to inhibit both the wild-type as well as the mutant form of CTSS at 20 uM and at 50 uM (FIG. 1A-B). To test the specificity of the P3 inhibitor, a specific FRET assay for cathepsin H (CTSH) was performed. The assay showed that CTSH is not significantly inhibited by P3 at 20 uM or 50 uM (FIG. 1C).

    [0156] Overall, these results suggested that the P3 inhibitor selectively inhibits CTSS, without significantly affecting CTSH activity.

    [0157] To screen for more potent inhibitors of cathepsin S, a single-site saturation mutagenesis screen was performed, in which 133 different NPIs were tested, each differing from P3 for only one amino acid in their structure. The output of the screening is summarized in FIG. 2. Several of the new NPIs tested had a stronger inhibitory activity on CTSS as compared to P3 (labelled as below 1.0). In particular, some promising amino acid changes were identified in positions 2 (phenylalanine and histidine), 5 (valine), 6 (leucine and methionine) and 7 (phenylalanine and tryptophan).

    [0158] Besides identifying stronger CTSS inhibitors bearing single amino acid changes compared to the initial inhibitor, these results show that it is possible to design new NPIs with the potential to show even stronger activity on CTSS.

    [0159] After testing multiple candidates issued from the saturation mutagenesis screening, a FRET assay was performed to test in a dose-dependent manner the inhibitory activity of our most promising NPI, named C10. The dose-response curve obtained showed that our C10 NPI inhibits CTSS with an IC50 of 49.3 nM in the FRET assay which we designed (FIG. 3A).

    [0160] It was recently reported that 5.7% of lymphoma patients harbour a specific gain of function mutation changing the tyrosine 132 in aspartate (Y132D) or asparagine (Y132N). Hence, it was checked whether the cathepsin inhibitor that was identified in the screen (C10) is also effective on the mutated form of CTSS. This was measured through a FRET assay in which the inhibitor was incubated with CTSS Y132D. It was observed that C10 reduces the activity of CTSS Y132D of more than 50% when tested at 50 nM, and this inhibition efficiency grows to more than 90% at 500 nM (FIG. 3B).

    [0161] Overall, these results suggested that C10 is a potent non-natural peptide inhibitor of both the wild-type and the mutated forms of CTSS.

    [0162] Since the initial NPI showed some inhibitory activity on CTSB, the same library of 133 different NPIs was used to screen for cathepsin B inhibitors. The output of the screening is summarized in FIG. 4. Several new NPIs having a stronger inhibitory activity on CTSB compared to P3 (labelled as below 1.0) were identified. In particular, it was observed that some amino acid changes could improve the activity and specificity for CTSB in positions 2 (arginine), 4 (lysine and tyrosine) and 5 (tryptophan).

    [0163] After testing multiple candidates designed on the basis of the saturation mutagenesis screening output, a FRET assay was performed to test in a dose-dependent manner the inhibitory activity of the most promising NPI, named D5. The dose-response curve obtained showed that D5 NPI inhibits CTSB with an IC50 of 61.93 nM in the FRET assay as described herein (FIG. 5). A similar dose-response assay was performed to test the inhibition of CTSS by D5, for which the IC50 value obtained was much higher (86.57 uM, FIG. 5). These results suggested that D5 is a potent and specific non-natural peptide inhibitor of CTSB.

    [0164] To conjugate our C10 inhibitor with the Epratuzumab antibody or the anti-CD79 antibody, a version of the NPI was used that was modified to bear an azide group at the N-term, and the antibody was labelled with a commercially available DBCO-maleimide linker, as illustrated in FIG. 9. The final conjugation reaction occurs between the azide group and the DBCO group, and is based on copper-free click chemistry. The product of this conjugation reaction is referred to herein with the general name antibody-peptide conjugate (APeC). To perform antibody internalization assays, the Epratuzumab antibody was conjugated with AlexaFluor-488 azide-dye instead of our C10 inhibitor (we will refer to the labelled antibody as Epr-AF488).

    [0165] To test the binding and internalization of our APeC, an internalization assay was performed with WSU-DLCL2 cells and the Epr-AF488 antibody. The assay showed that the conjugated antibody was still able to bind lymphoma cells. Moreover, the addition of a quencher antibody allowed to assess internalization of the labelled Epratuzumab, showing that at 37 C. Epr-AF488 was internalized by lymphoma cells and thus inaccessible to the quencher (FIG. 6).

    [0166] In summary, the results of this flow cytometry assay indicated that the antibody conjugation strategy generates molecules that retain the ability to bind to lymphoma cells and be internalized by them.

    [0167] To test the efficacy of our APeCs to inhibit CTSS in lymphoma cells, a CD74 accumulation assay was performed with WSU-DLCL2 cells as well as with Raji cells. It was observed that cells treated for 48 hours with our APeCs showed greater CD74 accumulation compared to cells treated with the same amount of PBS or antibody mixed to C10 in absence of linker molecules (FIG. 7). Moreover, the CD74 accumulation levels measured when treating with high doses of the CTSS inhibitor Petesicatib were lower than what we obtained with lower doses of our APeCs.

    [0168] Overall, these results suggested that treatment of lymphoma cells with our APeCs results in CTSS inhibition in such cells.

    [0169] Finally, to assess if the above described strategy could be generalized to the inhibition of a different cathepsin in a different tumor type, the inhibition of CTSB in a breast cancer cell line, MCF-7, was tested through a qABP assay. It was observed that cells treated with anti-HER2 APeC for 16 hours showed lower residual CTSB activity as compared to cells treated with the same amount of PBS or antibody mixed to C10 in absence of linker molecules (FIG. 8). E64, a strong protease inhibitor, was used as positive control and inhibited CTSB activity as expected.

    [0170] These last results suggested that treatment of breast cancer cells with our APeC results in CTSB inhibition in such cells, indicating that our inhibitors can be used to treat multiple tumor types, including solid tumors.

    EXAMPLE 6FURTHER EXPERIMENTAL RESULTS

    [0171] Additional quenched activity-based probe (qABP) assays have been performed to assess the activity of our antibody-peptide conjugates (APeC). FIG. 10 shows that our anti-CD79-C10 APeC efficiently inhibits CTSS in Raji lymphoma cells, while our anti-HER2-D5 APeC efficiently inhibits CTSB in HCC-1569 breast cancer cells.

    [0172] FIG. 11 shows that our anti-CD79-C10 APeC inhibits CTSS in primary human B-cells (2 different donors represented), an effect that is comparable to the small molecule Petesicatib, which is a specific CTSS inhibitor.

    [0173] To assess the functional consequences of CTSB inhibition through our APeC, we performed an in vitro invasion assay with breast cancer cell lines in transwells. FIG. 12 shows that the number of cells that can invade through the matrigel layer is strongly reduced upon treatment with our anti-HER2-D5 APeC.

    [0174] Lastly, an in vivo experiment was performed to test the efficacy of our APeC in semi-humanized NSG mice injected with human Raji lymphoma cells. Mice were treated twice a week, starting on day 8 after injection of tumor cells. FIG. 13 and FIG. 14 show that the tumor regressed in the group of mice treated with our anti-CD79-C10 APeC (20 mg/kg twice a week).