Regulation of CRISPR-associated rossman fold (CARF) domain containing proteins by oligoadenylates
12123031 · 2024-10-22
Assignee
Inventors
- Virginijus Šikšnys (Vilnius, LT)
- Migle Kazlauskiene (Vilnius, LT)
- Georgij KOSTIUK (Vilnius, LT)
- Gintautas Tamulaitis (Vilnius, LT)
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C12P19/34
CHEMISTRY; METALLURGY
C12Q1/6811
CHEMISTRY; METALLURGY
International classification
C12N9/12
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C12P19/34
CHEMISTRY; METALLURGY
Abstract
A method of synthetizing cyclic oligoadenylates using a novel catalytic activity of a protein possessing the Palm domain, such as the Cas10 protein, and using such compounds for activation of proteins possessing the CARF doman, such as the Csm6 protein.
Claims
1. A method for activation and/or regulation of a protein containing a CRISPR-Associated Rossmann Fold (CARF) domain using a cyclic oligoadenylate, selected from the group consisting of c(AMP)3, c(AMP)4, c(AMP)6 and c(dAMP)3, or a linear oligoadenylate, selected from the group consisting of tetraadenylate, tetraadenylate phosphate, tetraadenylate triphosphate, hexaadenylate, hexaadenylate phosphate, hexaadenylate triphosphate and any combinations thereof.
2. The method according to claim 1, wherein the protein containing CARF domain is a ribonuclease, a deoxyribonuclease, a transcriptional activator, DNA-binding protein, a RtcR-like protein or a deaminase.
3. The method according to claim 1, wherein the protein containing a CARF domain is a ribonuclease, and wherein the method is used for the degradation of single stranded ribonucleic acid (ssRNA) in controllable fashion, the method further comprising contacting a biological sample containing ssRNA with said ribonuclease and a cyclic or linear oligoadenylate under conditions resulting in degradation of the ssRNA.
4. The method according to claim 1, wherein the protein containing a CARF domain is a ribonuclease, and wherein the method further comprises cleaving RNA in controllable fashion in vitro by using said ribonuclease and cyclic or linear oligoadenylates.
5. The method according to claim 3, wherein the CARF-containing ribonuclease is selected from Csm6, StCsm6, StCsm6, TtCsm6 or Csx1 or any other ribonuclease containing CARF domain.
6. The method according to claim 1, wherein the protein containing a CARF domain is a deoxyribonuclease, and wherein the method further comprises cleaving DNA in controllable fashion in vitro by using said deoxyribonuclease and cyclic or linear oligoadenylates.
7. The method according to claim 3, wherein the CARF-containing ribonuclease or deoxyribonuclease is inactivated by degrading the cyclic or linear oligoadenylate.
8. A method for activation and/or regulation of a CRISPR-Associated Rossmann Fold (CARF) domain containing proteins in vitro and in vivo, comprising effectively applying cyclic or linear oligoadenylates.
Description
BRIEF DESCRIPTION OF THE FIGURES
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
DETAILED DESCRIPTION
(28) Protein cloning, expression and purification. Wild type (wt) and mutant Streptococcus thermophilus (St) Csm complexes were obtained as described (2). Briefly, Escherichia coli BL21 (DE3) was transformed with three plasmids: (i) plasmid pCas/Csm, which contains a cassette including all the cas/csm genes (except cas1 and cast) of the Type III-A CRISPR-Cas system from S. thermophilus DGCC8004, (ii) plasmid pCRISPR_S3, which contains four identical tandem copies of the repeat-spacer S3 unit flanked by the leader sequence and the terminal repeat, (iii) plasmid pCsm2-Tag, which contains a N-terminal-Strepll-tagged variant of csm2 gene. Next, such cells were grown at 37 C. in LB medium supplemented with streptomycin (25 g/l), ampicillin (50 g/l), and chloramphenicol (30 g/l) and expression of StCsm complex was induced with 1 mM IPTG. The StCsm complex was isolated by subsequent Strep-chelating affinity and size exclusion chromatography steps.
(29) Genomic DNA isolated from S. thermophilus DGCC8004 strain was also used as the template for PCR amplification of the cas10 gene (1). The resulting PCR product, containing the cas10 gene, was cloned into pBAD24_C-HSH expression vector via Ncol and Xhol sites. HSH tag is a combination of Strepll-tag and two 6Histidine-tags used to purify Cas10 protein using two different affinity chromatography steps. Full sequencing of cloned DNA fragments confirmed their identity to the original sequences. For purification of Cas10 subunit, E. coli DH10B (ara-) bearing wt pCas10-C-HSH plasmid was grown overnight at 16 C. in LB medium supplemented with ampicillin (50 g/l) after the induction of Cas10 expression with 0.2% arabinose. Cas10 protein was purified using chelating Ni-NTA (nickel-nitrilotriacetic acid) and Strep-Tactin affinity chromatographies. The elutant, containing Cas10, was dialyzed against 10 mM Tris-HCI (pH 8.5) buffer containing 300 mM KCI, 1 mM DTT, 0.1 mM EDTA, and 50% (v/v) glycerol, and stored at 20 C.
(30) csm6 and csm6 genes were amplified separately by means of PCR, using genomic S. thermophilus DGCC8004 DNA as a template, and cloned into pJET1.2 vector. Resulting plasmids were then amplified in E. coli cells, purified, and cleaved with Eco31 I and Pstl in order to clone these genes into pBAD24_N-HSH expression vector and generate pStCsm6-N-HSH and pStCsm6-N-HSH plasmids. Thermus thermophilus csm6 gene (GenBank accession number TTHB152) was synthesized with a C-HSH Tag (General Biosystems) and cloned into pBAD24_N-Strepll vector, resulting in pTtCsm6-N-Strepll-C-HSH plasmid. Full sequencing of cloned DNA fragments confirmed their identity to the original sequences. E. coli DH10B (ara) was transformed with either pStCsm6-N-Tag, pStCsm6-N-Tag or pTtCsm6-N-Strepll-C-HSH plasmid. Next, such cells were grown at 37 C. in LB medium supplemented with ampicillin (50 g/l) and expression of Csm6 proteins was induced with 0.2% arabinose. Subsequent His- and Strep-chelating affinity chromatography steps were employed to isolate StCsm6, StCsm6 and TtCsm6. The elutants, containing StCsm6, StCsm6 or TtCsm6, were dialyzed against 10 mM Tris-HCI (pH 8.0) buffer containing 300 mM KCl, 1 mM DTT, 0.1 mM EDTA, and 50% (v/v) glycerol, and stored at 20 C.
(31) Plasmids p0AS1, encoding human OAS1 fused with an N-terminal His-Tag, and pPDE12, encoding human PDE12 stripped for the mitochondrial targeting peptide and containing a C-terminal His-Tag, were kindly provided by Dr. P. M. Martensen at Aarhus University. E. coli BL21 (DE3) cells were transformed with either p0AS1 or pPDE12 plasmid and grown at 37 C. in LB medium supplemented with ampicillin (50 g/l). After protein expression was induced with 1 mM IPTG, the growth temperature was reduced to 20 C. for OAS1 and 25 C. for PDE12. PDE12 was purified using chelating Ni-NTA and subsequent ion exchange (Mono Q XL, GE Healthcare) chromatographies while chelating Ni-NTA chromatography was sufficient to isolate OAS1. The elutant, containing OAS1, was dialyzed against 10 mM sodium phosphate (pH 7.4) buffer containing 300 mM NaCl, and 50% (v/v) glycerol while the PDE12-containing elutant was dialyzed against 20 mM Tris-HCI (pH 7.5) buffer containing 200 mM KCl, 1 mM DTT, and 50% (v/v) glycerol. Both were stored at 20 C.
(32) Mutagenesis. StCsm containing Cas10 mutations D16A and D575A&D576A were obtained by the Quick Change Mutagenesis (QCM) protocol [37] and isolated following the procedures described for the wt StCsm (see above), as described in [1].
(33) StCsm6 mutations H24A, T107A, N102A+S105A+T107A, Q129A, and R371A+H376A, as well as StCsm6 mutation R331A+H336A, were introduced into pStCsm6-N-HSH or pStCsm6-N-HSH plasmids by means of Phusion Site-Directed Mutagenesis [38]. StCsm6 and StCsm6 proteins containing point mutations were isolated using the same protocol as for the wt Csm6 (see above). The sequences of wild-type (wt) Cas10, wt Csm6 and wt Csm6 were deposited in GenBank (accession number KM222358 for the sequence of CRISPR2-cas locus of DGCC8004).
(34) Gel filtration. Gel filtration was carried out at room temperature on an KTA FPLC system (GE Healthcare) using a Superdex 10/300 GL column (GE Healthcare), preequilibrated with 20 mM Tris-HCI (pH 8.5), 0.5 M NaCl, 7 mM 2-mercatoethanol, 1 mM EDTA. StCsm6 and StCsm6 protein samples at 0.5 mg/ml-0.6 mg/ml loading concentration were prepared in 100 l of the above buffer. Elution from the column was monitored by measuring absorbance at 220 nm. The apparent molecular weights of proteins were evaluated from the elution volume using a series of standards (Gel filtration Calibration Kit from GE Healthcare).
(35) Nucleotide binding assay. Nucleotide binding assays were performed by incubating different amounts of StCsm complexes with 10 nM of .sup.32P-radiolabeled-nucleoside triphosphates in the Binding buffer (40 mM Tris, 20 mM acetic acid (pH 8.4 at 25 C.), 1 mM EDTA, 0.1 mg/ml BSA, 10% (v/v) glycerol). All reactions were incubated for 15 min at room temperature prior to electrophoresis on native 8% (w/v) polyacrylamide gel (PAAG). Electrophoresis was carried out at room temperature for 2 h at 6 V/cm using 40 mM Tris, 20 mM acetic acid (pH 8.4 at 25 C.), 0.1 mM EDTA as the running buffer. Gels were dried and visualized by a FLA-5100 phosphorimager (Fujifilm).
(36) StCsm mediated synthesis of cyclic oligoadenylates from ATP. The synthesis reactions of cyclic oligoadenylates by StCsm were initiated by adding 10 mM CoCl.sub.2 into a mix of 200 nM StCsm, 200 nM target RNA, 50 M ATP and 10 nM .sup.32P-ATP in the Reaction buffer (33 mM Tris-acetate (pH 7.6 at 37 C.), 66 mM K-acetate, 0.1 mg/ml BSA) and carried out at 37 C. for 1 h or 1.5 h, unless stated otherwise. StCsm reactions on different nucleoside triphosphates contained 200 nM of ternary StCsm, 50 M of the non-labeled nucleotide and 10 nM of the corresponding .sup.32P-nucleotide. The reactions were stopped by adding 15 mM EDTA. Reaction products were separated by TLC on PEI Cellulose F plates (Merck) in 0.5 M phosphate buffer (pH 3.5 at 23 C.) or a denaturating 24% (19:1 acrylamide:bis-acrylamide) PAAG and visualized using autoradiography.
(37) StCsm mediated synthesis of cyclic oligoadenylates from linear adenylate triphosphate precursors. 200 nM StCsm was mixed with 200 nM target RNA and 17 M of triphosphate oligoadenylates (pp(pA).sub.3-6) in the Reaction buffer (33 mM Tris-acetate (pH 7.9 at 37 C.), 66 mM K-acetate, 0.1 mg/ml BSA) and incubated for 20 min at 37 C. before initiating the polymerase/cyclase reactions by adding 10 mM CoCl.sub.2. The reactions were performed for 1.5 h at 37 C.
(38) HLPC-MS. StCsm mediated ATP reaction products were analyzed using MS. Electrospray Ionization mass spectrometry (ESI-MS) was performed in negative mode using an integrated HPLC/ESI-MS system (1290 Infinity, Agilent Technologies/Q-TOF 6520, Agilent Technologies) equipped with a Supelco DiscoveryHS C18 column (7.5 cm2.1 mm, 3 m). Elution was performed with a linear gradient of solvents A (5 mM ammonium acetate in water, pH 7.0) and B (acetonitrile) at a flow of 0.3 ml/min at 30 C. as follows: 0-2 min, 0% B; 2-22 min, 20% B; 22-25 min, 50% B, 25-29 min 100% B. Ionization capillary voltage was set to 5000 V, fragmentorto 150V.
(39) Products of the StCsm mediated AMP reactions with ATP, 2dATP and 3dATP were analyzed using Vanquish Binary U HPLC with DAD coupled to Q Exactive PLUS (Orbitrap) with ESI ion source. HPLC system was equipped with Hypercarb (50 mm2.1 mm, 5p mparticle size; Thermo Fisher Scientific) column. The chromatography was performed by elution with a linear gradient of solvents A (1.0 mM NH.sub.4HCO.sub.3, pH=7.8 water/acetonitrile, 95/5 (v/v)) and B (50 mM NH.sub.4HCO.sub.3, pH=9.5 water/acetonitrile, 40/60 (v/v)) at a flow of 0.4 ml/min at 50 C. as follows: 0% B to 100% B in 3 min; 100% B hold for 4 min, 100% B to 0% in 0.5 min followed by 3.5 min reconditioning. ESI-MS data was acquired in MS Scan mode from 200 to 2000 m/z at 35 k resolution in negative ionization mode. ESI parameters: Cappilary voltage 2.5 kV; Sheath Gas 35 (Arb); Aux Gas 10 (Arb); Sweep Gas 0 (Arb); Ion Tranfer Tube Temp 325 C.; Vaporizer Temp 275 C.
(40) Purification of cyclic oligoadenylates. 200 nM StCsm was mixed with 200 nM target RNA and 50 M ATP in the Reaction buffer (33 mM Tris-acetate (pH 7.6 at 37 C.), 66 mM K-acetate, 0.1 mg/ml BSA) and incubated for 20 min at 37 C. before initiating the reactions by adding 10 mM CoCl.sub.2. The reactions were performed for 1.5 h at 37 C. Next, samples were purified by HPLC. HPLC was performed at room temperature on Waters Breeze HPLC system using a Discovery HS C18 Column (15 cm10 mm, 5 m) (Sigma-Aldrich Supelco) pre-equilibrated with buffer A (100 mM TEAA (pH 7.0)). Samples were fractionated at the at 1 ml/min flow rate with a linear gradient of B (60% CH.sub.3CN in buffer A) in A (0%-100% of B over 100 ml). Fractions containing different cyclic adenylates were pooled and the samples were concentrated on a vacuum concentrator (Eppendorf) prior to ESI-MS analysis.
(41) Treatment with P1. 12 M of cyclic oligoadenylate was incubated with 5 mU P1 nuclease (Sigma) in the P1 reaction buffer (10 mM Tris-acetate (pH 7.1 at 37 C.), 1 mM Zn-acetate) at 37 C. for 1 h. 10 l of such reaction mix was diluted with water and loaded onto HPLC/ESI-MS system for analysis.
(42) Treatment with PDE12. To be used as control, 2,5-oligoadenylates were synthesized by incubating 17 pg/ml OAS1 with 2 mM ATP and 5 nM oc.sup.32P-ATP in the OAS1 reaction buffer (4 mM Tris-HCl (pH 7.8 at 37 C.), 0.2 mM DTT, 0.1 mg/ml BSA), supplemented with 0.2 mg/ml dsRNA and 4 mM Mg-acetate, at 37 C. for 3 h. Every 10 min the reaction mix was supplemented with additional 1 mM ATP and 0.25 nM oc.sup.32P-ATP.
(43) 12 M of compound (mix of ATP reaction products, linear oligoadenylate (Metabion), or OAS1 reaction product) containing 7.5 nM of radioactively labeled compound, was incubated with 1.3 g PDE12 in the PDE12 reaction buffer (20 mM HEPES (pH 7.0 at 37 C.), 1 mM DTT, 1 mM Mg-acetate) at 37 C. for 1 h. The nuclease reaction products, along with control lanes containing identical amount of untreated labeled compound, were analyzed on 24% (19:1 acrylamide:bis-acrylamide) denaturing PAAG and visualized by autoradiography.
(44) 5-labeling reactions. 50 M of compound (linear oligoadenylate (Metabion) or HPLC purified cyclic oligoadenylate) was incubated with 0.5 U T4 Polynucleotide kinase (PNK) and 100 nM .sup.33P-ATP in the Reaction buffer A (50 mM Tris-HCI (pH 7.6 at 25 C.), 10 mM MgCl.sub.2, 5 mM DTT, 1 mM spermidine) at 37 C. for 30 min. In case of direct 5-labeling of the StCsm ATP reaction mix, which initially contained 50 pM ATP, the sample was diluted twice and then incubated with T4 PNK under identical conditions. The 5-labeling reaction products were analyzed on 24% (19:1 acrylamide:bis-acrylamide) denaturing PAAG and visualized by autoradiography.
(45) Sequence alignment. Clustal Omega (Sievers et al. Molecular Systems Biology 7 (2011) 539 (2011) and McWilliam et al. Nucleic acids research 41(W1):W597-W600 (2013) was used for multiple sequence alignment of different Csm6 proteins.
(46) Csm6 nuclease assay. StCsm6, StCsm6, and TtCsm6 nuclease assays were conducted in the Reaction buffer (33 mM Tris-acetate (pH 7.6 at 37 C.), 66 mM K-acetate, 0.1 mg/ml BSA) supplemented with 1 mM EDTA and containing 5 nM of 5-radiolabeled and 5 nM of unlabeled RNA NS (unless stated otherwise; see all RNA substrates used in this study in Table 1) and 500 nM of cyclic oligoadenylate mixture or 0.5-500 nM of the HPLC purified cyclic oligoadenylate effectors or 5-500 nM linear oligoadenylate with various phosphorylation levelslinear oligoadenylate 5-triphosphate (ChemGenes); non-phosphorylated, 3P (Metabion) or 5P containing linear oligoadenylates. 5P-oligoadenylates were obtained by incubating 3.(3) M of non-phosphorylated linear oligoadenylate with 0.5 U T4 polynucleotide kinase and 1 mM ATP in the Reaction buffer A at 37 C. for 40 min.
(47) Reactions were started by adding 0-10 M Csm6 and carried out at 37 C. The reaction products were separated on a denaturing 15% (29:1 acrylamide:bis-acrylamide) PAAG and visualized by autoradiography. StCsm6 nuclease assays with ATP additionally contained 1 mM of ATP in the reaction mixture.
(48) Data analysis. The Kyplot 2.0 software [45] was used for calculation of StCsm ATP reaction rate and StCsm6 and StCsm6 ssRNA cleavage efficiency.
(49)
(50)
(51)
(52)
(53)
(54)
(55)
(56)
(57)
(58)
(59)
(60)
(61)
(62)
(63)
(64)
(65)
(66)
(67)
(68)
(69)
(70)
(71)
(72)
(73)
(74)
(75)
(76) I. Synthesis of Oligoadenylates
(77) In the Type III CRISPR-Cas systems, multiple Cas proteins and crRNA assemble into Csm (Type III-A) or Cmr (Type III-B) silencing complexes that provide interference against invading nucleic acids (1, 2, 9-13). Csm/Cmr complexes function as RNA-activated single-stranded (ss) DNases that ensure the destruction of foreign genetic elements while avoiding the degradation of a host's own DNA (1, 10-11, 14-15). When transcription of phage DNA is initiated, Csm/Cmr complex, guided by the crRNA, recognizes a complementary target (called a protospacer) in the nascent phage RNA. The RNA transcript binding by the Csm/Cmr complex triggers target RNA cleavage by Csm3/Cmr4 subunits and simultaneously activates the ssDNase activity of the Cas10 subunit for in cis degradation of ssDNA in the transcription bubble. Type III CRISPR-Cas systems avoid autoimmunity by checking the complementarity between the crRNA 5-handle that originates from the repeat and the 3-sequence flanking the protospacer in RNA target. Base-pairing between the crRNA 5-handle and target RNA represses the Cas10 ssDNase activity thus protecting the host DNA from degradation. Non-complementarity of the crRNA 5-handle to the RNA target in the phage RNA signals of a non-self DNA template and activates the Cas10 ssDNase for degradation (16). The temporal control of ssDNA degradation by the StCsm complex is achieved through the target RNA cleavage.
(78) Cas10 subunit (called Csm1 and Cmr2 in the III-A and III-B systems, respectively) contains an N-terminal HD-domain, two small a-helical domains, and two Palm domains that share ferredoxin-like fold with the core domain of nucleic acid polymerases and nucleotide cyclases (17-19). Cas10 contains two putative active sites: the nuclease active site in HD-domain and the GGDD-(SEQ ID NO: 1)motif in one of the Palm domains (16). Whereas by now there is a consensus that the nuclease activity of the HD-domain is responsible for the ssDNA cleavage in vitro, the role of the GGDD-(SEQ ID NO: 1) motif of the Cas10 Palm domain in Type III-mediated DNA silencing has remained uncertain. This motif is essential for DNA interference in vivo and in vitro by Staphylococcus epidermidis Csm (SeCsm) complex (12, 20) but is dispensable for the in vitro ssDNase activity of Csm complex of Streptococcus thermophilus (StCsm) (1), Thermus thermophilus (TtCsm) (14) and Cmr complex of Pyroccocus furiosus (PfCmr) (10). The crystal structures of P. furiosus Cas10 (PfCas10) alone and the PfCas10/Cmr3 subcomplex show a single ADP, 3-AMP or two ATP molecules coordinated together with divalent metal ions by amino acid residues of the GGDD-(SEQ ID NO: 1) and P-loop motifs in the Palm domains (18). The conservation of the complete set of catalytic residues typical of Palm domain polymerases and cyclases implies that the Palm domain of Cas10 should be enzymatically active but the nature of this activity has remained unknown. The possible ATP-related enzymatic activity of S. thermophilus DGCC8004 Cas10 (StCas10) from a Type III-A CRISPR-Cas system was thus investigated.
(79) StCas10 alone or in the context of the binary StCsm complex [Cas10.sub.1:Csm2.sub.3:Csm3.sub.5:Csm4.sub.i:Csm5.sub.i:crRNA(40 nt)] shows no ATPase or ATP cyclase activity (
(80) The ATP reaction, like the DNase activity of the StCas10 HD-domain (1), can be switched on or off depending on the non-complementarity/complementarity of the crRNA 5-handle to the 3-flanking sequence of target RNA (
(81) The Palm domain of StCas10 subunit in StCsm tightly binds adenosine-containing nucleotides ATP and 3dATP with K.sub.d ranging from 10 to 20 nM in the presence or absence of target RNA but shows no significant affinity towards UTP, GTP and CTP (
(82) II. Purification of Oligoadenylates
(83) HPLC and ESI-MS analyses were performed to identify the reaction product obtained in the ATP reaction catalyzed by the StCsm complex. The major ATP reaction product (63.6%) showed molecular mass of 987.15 Da (
(84) HPLC was used to isolate individual ATP reaction products. HPLC was performed at room temperature on Waters Breeze HPLC system using a Discovery HS C18 Column (15 cm10 mm, 5 m) (Sigma-Aldrich Supelco), pre-equilibrated with buffer A (100 mM TEAA (pH 7.0)). Samples were loaded and fractionated at 1 ml/min flow rate with a linear gradient of B (60% CH.sub.3CN in buffer A) in A (0%-100% of B over 100 ml). Three separate peaks were isolated (
(85) III. Structure of Oligoadenylates
(86) The reaction products of the ATP reaction were identified. HPLC-MS analysis revealed that StCsm converts ATP to the products with Mw 987.15 Da, 1316.20 Da, 1645.25 Da and 1974.31 Da (
(87) To confirm the reaction mechanism, linear precursor oligonucleotide triphosphates (pppApApA, pp(pA).sub.4, pp(pA).sub.5, pp(pA).sub.6) were synthesized and used as substrates for StCsm catalyzed cyclization reaction. Corresponding triphosphate oligoadenylates were mixed with the ternary StCsm complex in the Reaction buffer supplemented with 10 mM CoCl.sub.2 and reaction products were analyzed by HPLC-MS. Upon treatment with wt StCsm, pppApApA was converted into c(AMP).sub.3 (
(88) Further, the purified oligoadenylate compounds were subjected to various biochemical reactions and analyzed them with HPLC coupled with ESI-MS or in a denaturing PAAG. First, HPLC purified tri-adenylate, tetra-adenylate, penta-adenylate and hexa-adenylate were treated with P1 nuclease. P1 nuclease from Penicillium citrinum degrades ssRNA (and less efficiently ssDNA) to nucleoside 5-monophosphates. Upon treatment with P1 nuclease, the oligoadenylates were processed entirely into AMP mononucleotides (
(89) P1 nuclease exhibits high phosphomonoesterase activity toward 3,5-ribonucleotides but 2,5-ribonucleotides are extremely resistant to it (3, 4). The ATP reaction products were efficiently degraded by P1 (
(90) Taken together, these data show that in the presence of target RNA the GGDD (SEQ ID NO: 1) active site in the Palm domain of Cas10 subunit in the StCsm ternary complex of a Type III-A CRISPR-Cas system catalyzes synthesis of cyclic oligoadenylates (
(91) IV. Cyclic Adenylates Activate CARF-Domain Ribonucleases
(92) Many CRISPR-Cas systems are associated with genes that appear not to be directly implicated in spacer acquisition, CRISPR transcript processing or interference against invading nucleic acids (23-27; K. S. Makarova et al. The basic building blocks and evolution of CRISPR-CAS systems. Biochemical Society transactions 41 (2013), p. 1392-1400). For example, csm6 gene, that belongs to the COG1517 family [24-25], is associated with Type III-A CRISPR-Cas locus of S. thermophilus DGCC8004 strain. S. thermophilus StCsm6 and StCsm6 proteins do not belong to the StCsm effector complex that provides interference against invading nucleic acids (2). Bioinformatic analysis revealed that StCsm6 and StCsm6 proteins are related (35% sequence identity) (16). They both have a typical Csm6 architecture, which includes the N-terminal CARF (CRISPR-asssociated Rossman fold) domain (
(93) Previously, it was shown that activity of the TtCsm6 RNase resides in the composite active site formed by a pair of HEPN domains, whereas the interface of the CARF domains features a putative ligand-binding site (29). The putative binding site formed by CARF domains might be the site for binding the cyclic oligoadenylates, produced by Cas10 of the Csm complex; to test this, docking experiments were performed using the dimeric structure of TtCsm6 CARF domains as a receptor and adenosine as the ligand. The nucleoside over nucleotide was chosen to test the compatibility of shape with the putative binding site while at the same time avoiding potential complications due to the electrostatic interaction between the nucleotide phosphate(s) and the positively charged cleft formed by the CARF domains. Docking revealed that two distinct pockets within the cleft can bind adenosine (
(94) CARF domains of both StCsm6 and StCsm6 lack a couple of a-helices at the N-terminus compared to the CARF domain of TtCsm6 but otherwise are quite similar to it (
(95) Domains belonging to the HEPN superfamily often exhibit ribonuclease activity and are commonly found in prokaryotic toxin-anti-toxin (T-A) and abortive infection (Abi) defense systems (30). It has been proposed that Csm6 and other CARF family proteins associated with the Type III CRISPR-Cas systems may degrade RNA transcripts of DNA invaders complementing the DNA- and RNA-targeting endonuclease activities of the Csm complex (8). Indeed, in S. epidermidis Csm6 protein is involved in the degradation of RNA transcripts for the late expressed viral genes (31). Alternatively, it was suggested that Csm6/Csx1 proteins could contribute to CRISPR immunity by targeting host (i.e., self) transcripts in order to induce dormancy or promote programmed cell death of the host (28, 29).
(96) To understand the role of the Csm6 and Csm6 proteins in S. thermophilus immunity, StCsm6 (
(97) StCsm6, StCsm6 and TtCsm6 are homodimers in solution (
(98) Next, it was determined which of the cyclic oligoadenylates, synthesized by the ternary StCsm complex, was the activator of the StCsm6 and StCsm6 nucleases. For this a synthetic c(AMP).sub.2 (c-di-AMP) was used and the compounds that isolated from StCsm ATP or triphosphate oligoadenylate reaction mixtures by HPLC: c(AMP).sub.3, c(AMP).sub.4, c(AMP).sub.5 and c(AMP).sub.6. Nuclease assays revealed that of all the cyclic adenylates tested, only c(AMP).sub.6 stimulated ribonuclease activity of StCsm6 and StCsm6 (
(99) To elucidate if cyclic oligoadenylates synthesized by Type III StCsm effector complex are universal activators for Csm6 proteins, considering the TtCsm6 ssRNase activity was also observed only at high (micromolar range) protein concentrations (29), it was examined in the presence of cyclic oligoadenylates, synthesized by the StCsm ternary complex. Only c(AMP).sub.4 stimulated TtCsm6 ribonuclease activity (
(100) To investigate whether StCsm6 and StCsm6 ribonucleases possess sequence specificity, cleavage of 5-radiolabeled ssRNA substrates with random sequences (
(101) Smaller cyclic dinucleotides (c-di-GMP, c-di-AMP or cGAMP) across the three superkingdoms of life are often encountered as intracellular messengers that convey specific as well as global signals (32, 33). They are synthesized in a cell by specific enzymes in response to different stimuli and are recognized by sensor domains embedded within different effector proteins. For example, c-di-AMP is generated in response to direct sensing of endogenous branched DNA, making it a checkpoint regulator (34). In vertebrates, linear 2-5 oligoadenylates (2-5A), ranging from 2 to 30 oligomers, are produced in response to sensing of double-stranded viral RNA and stimulate latent ribonucleases (RNaseL) for the degradation of the invading RNA (35). In prokaryotes, signaling systems utilizing cyclic di-nucleotides have been considerably well studied; however, systems centered on other oligonucleotides remained largely unknown. The data herein show that the cyclic hexa-adenylate c(AMP).sub.6 synthesized by Cas10 protein in the StCsm complex of the Type III-A CRISPR-Cas system in response to the target RNA recognition acts as a novel messenger that activates RNA degradation by Csm6 ribonuclease through binding to the sensor CARF domain (
(102) V. Applications
(103) The inventive method provides a basis for easy enzymatic synthesis of cyclic oligoadenylates under broad reaction conditions. In one embodiment, the synthesis reaction of cyclic oligoadenylates is conducted in vitro by the StCsm complex by adding 10 mM CoCl.sub.2 into a mix of 200 nM StCsm, 200 nM target RNA, 50 M ATP in the Reaction buffer (33 mM Tris-acetate (pH 7.9 at 37 C.), 66 mM K-acetate, 0.1 mg/ml BSA) and incubated at 37 C. for 1 h. If needed, reaction conditions could be changed: (i) incubation could be extended or reduced to a time more or less than one hour, for example, 15 minutes; or (ii) other bivalent metal ions could be used as cofactors, for instance, Mg.sup.2+, Mn.sup.2+, Ni.sup.2+, Zn.sup.2+or Fe.sup.2+or (iii) both StCsm and target RNA concentrations could be changed, or (iv) different substrates could be used at various concentrations, e.g., 17 M short 5ppp oligoadenylates could be used instead of 50 M ATP; or (v) different reaction buffers with different pH, ionic strength could be used. These compounds are stable and can be stored at +4 C. or 20 C. for months and re-thawed multiple times.
(104) Ternary StCsm complex, comprised of Cas10, Csm2, Csm3, Csm4, and Csm5 proteins, a crRNA, and a target RNA transcript which is substantially complementary to a portion of the crRNA was employed. However, other complexes containing Cas10, such as Csm complexes from other organisms or related Cmr complexes (16), should be capable of a very similar if not identical activity. Therefore the invention is not limited to the complex used in the exemplary descriptions and other Cas10-containing complexes may be used in the described methods.
(105) Given that the StCsm complex is capable of polymerizing two ATP molecules and the general mechanism of StCsm-mediated cyclic oligoadenylate synthesis (
(106) Since the Cas10-containing complex was able to synthesize these molecules only in the presence of target RNA, the synthesis of cyclic oligoadenylates (or any cyclic nucleic acid synthesized in Cas10-dependent manner) could be used as a signal to report appearance of target nucleic acids in vitro and in vivo. Neither ssDNA nor dsDNA can cause the StCsm complex to synthesize cyclic compounds. However, known techniques can be used to transcribe a desired DNA and thus produce target RNA for the Cas10-containing complex based on a desired DNA. Thus the described method can be applied for not only RNA but also DNA detection in various samples. The appearance of cyclic oligoadenylates could be detected using, for example, mass spectrometry analysis.
(107) We discovered that a family of CARF-containing nucleases can be activated by cyclic oligoadenylates. CARF-containing RNases Csm6 from different organisms are activated by differently sized cyclic oligoadenylates. Small amounts of cyclic oligoadenylates are required for efficient activation of CARF-containing RNases: 0.5 nM c(AMP).sub.6 for StCsm6, 5 nM c(AMP).sub.6 for StCsm6, 50 nM c(AMP).sub.4 for TtCsm6. However, we found that much higher amount of linear oligoadenylates can also activate these proteins (
(108) Naturally, the cyclic adenylates, required for activation of CARF-containing proteins, can be synthesized by the previously described enzymatic synthesis, using a Cas10-containing complex. CARF-containing protein can be coupled with Cas10-containing complex to create a unique system for in vitro platforms and in vivo tools. For instance, such system could be used for detection of selected nucleic acids, e.g., viral transcripts, in a manner similar to the SHERLOCK platform (36). In vivo such system could be used to induce cell dormancy at desired time and/or desired cell by choosing an appropriate target transcript. This target transcript could appear at certain stage of cell cycle or under certain other conditions. The system allows assaying the cellular content upon emergence of the selected target transcript. Alternatively, the system could be used to distinguish between cells that transcribe the target sequence (either constitutively or occasionally) from the target-free cells. The system could be applied to induce cell suicide in response to a foreign or malignant transcript, e.g., viral or lethal.
(109) For in vivo applications all the necessary components could be delivered to the cells either as DNA, RNA, or proteins, or any combination of them, by transformation, electroporation, transfection, etc. Genes encoding the necessary components could also be integrated into the genome of desired cells. When delivered in DNA form, the expression of system components could be inducible or constitutive, depending on the need. The target transcript, which is substantially complementary to a portion of the crRNA, could be (i) delivered as DNA (for instance, expressed from an expression plasmid), (ii) delivered as RNA, (iii) emerge after infection (for instance, viral) of the cell culture, or (iv) any endogenous gene product or non-coding RNA of the cell could be selected as a target. In embodiments, in the case of eukaryotic cells, the expression of these components would be optimized.
(110) Other CRISPR-Cas systems possess Csm6 analogues, such as Csx1 (28, 40). CARF domains occur fused not only to RNases but also DNases, membrane-associated protein domains, TIM barrel adenosine deaminase Ada domain (8) and more domain combinations might be found. It is likely that such proteins could be allosterically regulated by cyclic oligoadenylates or similar compounds; expanding the inventive methods to their regulation. Therefore, while S. thermophilus and T. thermophilus Csm6 proteins are used in the above exemplary descriptions, the invention is not limited to this source of proteins and other proteins may be used in the described methods.
(111) We demonstrated here that cyclic or linear oligoadenylates could be used to activate ribonucleolytic activity of different Csm6 proteins through stimulation of their CARF-domain. Often the CARF domain is found combined with different effector domains. Most of the CARF domain proteins contain a winged HTH (wHTH) DNA-binding domain immediately C-terminal of CARF, for example in CRISPR-Cas associated protein Csa3 (8, 41). It has been suggested that such proteins are allosterically controlled transcriptional regulators (41). Therefore, CARF-containing DNA-binding proteins could be used to regulate gene expression in a variety of both prokariotyc and eukaryotic cells using cyclic or linear oligoadenylates.
(112) Many CARF-domain proteins possess additional not only RNase, but also DNase domains, in particular those of the restriction endonuclease, for example protein VC1899 from Vibrio cholera (8, 25). Therefore, CARF-containing DNases could be used specifically to cleave target DNA seguence or non-specifically to remove DNA from various samples in a controllable fashion in vitro and in vivo.
(113) CARF domains are also found in RtcR proteins, sigma-54 RNA polymerase dependent regulators of the rtcBA tRNA and mRNA splicing and repair operon (8, 42, 43). Binding of RtcR protein near promoter of rtcBA activates transcription of two proteins, RNA ligase RtcB (44) and 3-terminal phosphate RNA cyclase RtcA (45). It was demonstrated that in Escherichia coli bacteria expression of rtcAB is activated by agents and genetic lesions which impair the translation apparatus (42). Therefore, CARF-containing RtcR-like protein could be used to regulate protein translation in a variety of both prokariotyc and eukaryotic cells using cyclic or linear oligoadenylates.
(114) Sometimes CARF domain is fused to a TIM barrel adenosine deaminase Ada domain the enzyme that catalyzes deamination of adenosine to inosine in the purine salvage pathway (8). Therefore, CARF-containing deaminase protein could be fused to Cas9 or Cpf1 cleavage deficient or nicking variants to engineer base editor regulated with cyclic or linear oligoadenylates via CARF-domain in vitro and in vivo.
(115) TABLE-US-00001 TABLE1 Nucleicacidsubstratesused* S3crRNAin SpacerS35-handle StCsmcomplex 3-CUUAUUCACUUGUCUUAAUUUGUCAAUGCUUUCAAAGGCA-5(SEQIDNO:16) Target RNA Description Sequence RNA single |||||||||||||||||||||||||||||||| S3/2 stranded 5-GGGAUCCCCAAAUAUAAGGUGGAAUAAGUGAACAGAAUUAAACAGUUACGAAAAAAAAAAAGGGUACC-3 activator (SEQIDNO:17) RNA RNA68-mer |||||||||||||||||||||||||||||||||||||||| S3/3 containing 5-GGGAUCCCCAAAUAUAAGGUGGAAUAAGUGAACAGAAUUAAACAGUUACGAAAGUUUCCGUGGGUACC-3 32nt (SEQIDNO:18) RNA fragment |||||||||||||||||||||||||||||| S3/7 comple- 5-GGGAUCCCCAAAUAUAAGGUGGAAUAAGUGAACAGAAUUAAACAGUUACCUAAAAAAAAAAGGGUACC-3 mentary (SEQIDNO:19) RNA toS3 ||||||||||||||||||||||||||||||| S3/15 spacer 5-GGGAUCCCCAAAUAUAAGGUGGAUAAAGUGAACAGAAUUAAACAGUUACGAAAAAAAAAAAGGGUACC-3 (SEQIDNO:20) RNA |||||||||||||||||||||||||||||| S3/9 5-GGGAUCCCCAAAUAUAAGGUGGAAUAAGUGAACACUAUUAAACAGUUACGAAAAAAAAAAAGGGUACC-3 (SEQIDNO:21) RNA single |||||||||||||||||||||||||||||||| S3/10 stranded 5-GGGAUCCCCAAAUAUAAGGUGGAAUAAGUGAACAGAAUUAAACAGUUACGAAA-3 activator (SEQIDNO:22) RNA53-mer containing 32nt fragment comple- mentary toS3 spacer RNA single |||||||||||||||||||||||||||||||| S3/14 stranded 5-GGAAUAAGUGAACAGAAUUAAACAGUUACGAAAAAAAAAAAGGGUACC-3 activator (SEQIDNO:23) RNA48-mer containing 32nt fragment comple- mentary toS3 spacer RNA single 5-GGGCGGCAAAUUGAGGAUUUCGUAACUGUUUAAUUCUGUUCACUUAUUCCACCAACAAAAGGUGGCGA-3 NS stranded (SEQIDNO:11) RNA68-mer lackingthe fragment comple- mentary tocrRNA ssRNA single 5-GGGUACCGAGCUCGAAUUGAAAUUCUAAACGCUAAAGAGGAAGAGGACAUGGUGAAUUCGUAAUCAUGGUCAUAGCUGUU NSa stranded UCCC-3(SEQIDNO:24) ssRNA RNA84-mer 5-GGGAAACAGCUAUGACCAUGAUUACGAAUUCACCAUGUCCUCUUCCUCUUUAGCGUUUAGAAUUUCAAUUCGAGCUCGGU NSb lackingthe ACCC-3(SEQIDNO:25) fragment comple- mentary tocrRNA dsRNA double 5- NSa/ stranded GGGUACCGAGCUCGAAUUGAAAUUCUAAACGCUAAAGAGGAAGAGGACAUGGUGAAUUCGUAAUCAUGGUCAUAGCUGUUUCCC- NSb RNA84bp 3(SEQIDNO:24) duplex |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| lackingthe 3- fragment CCCAUGGCUCGAGCUUAACUUUAAGAUUUGCGAUUUCUCCUUCUCCUGUACCACUUAAGCAUUAGUACCAGUAUCGACAAAGGG- comple- 5(SEQIDNO:25) mentary tocrRNA ssRNA single 5-GGGAAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU NSc stranded UU-3 RNA78-mer (SEQIDNO:12) lackingthe fragment comple- mentary tocrRNA ssRNA single 5-GGGUAAAUCUUGCAGAAGCUACAAAGAUAAGGCUUCAUGCCGAAAUCAACACCCUGUCAUUUUAUGGCAGGGUGUUUU NSd stranded CG-3(SEQIDNO:13) RNA80-mer lackingthe fragment comple- mentary tocrRNA ssRNA single 5-GGGUUUCCCAACCAUCCAGCCUACCGGCCGUCCGACCUGCCUUCCCUUUCCC-3 NSe stranded (SEQIDNO:15) RNA52-mer lackingthe fragment comple- mentary tocrRNA ssDNA single |||||||||||||||||||||||||||||||| S3/2 stranded 5-AAATATAAGGTGGAATAAGTGAACAGAATTAAACAGTTACGAAAAAAAAAAA-3 oligodeoxy- (SEQIDNO:26) nucleotide 52-mer containing 32nt fragment comple- mentaryto S3spacer * Above the Table crRNA bound in the StCsm is shown for clarity.
(116) Red and black lettering in crRNA indicates the spacer and 5-handle sequences, respectively. Bold lettering in the substrates represents protospacer sequence.
(117) The 32-mer fragment in the substrates complementary to S3 spacer of crRNA is colored in bold red. Protospacer 3-flanking sequence which is complementary to the 5-handle of crRNA is underlined. Dashes above the sequences of single-stranded RNA and DNA indicate nucleotides which are complementary to the crRNA (shown above the Table). Complementarities in double-stranded RNA are indicated with the dashes between the strands. First 5-GGG nucleotides (or 5-GGA in S3/14) were incorporated into RNA during in vitro transcription.
(118) Each of the following references are expressly incorporated by references herein in its entirety. 1. Kazlauskiene et al., Spatiotemporal Control of Type III-A CRISPR-Cas Immunity: Coupling DNA Degradation with the Target RNA Recognition. Mol Cell, 2016. 62(2): p. 295-306. 2. Tamulaitis et al., Programmable RNA shredding by the type III-A CRISPR-Cas system of Streptococcus thermophilus. Mol Cell, 2014. 56(4): p. 506-17. 3. Fujimoto et al. Identity of Phosphodiesterase and Phosphomonoesterase Activities with Nuclease P1 (a Nuclease from Penicillium citrinum). Agricultural and Biological Chemistry, 1974. 38(4): p. 785-790. 4. Fujimoto et al. Specificity of Nuclease P1. Agricultural and Biological Chemistry, 1974. 38(9): p. 1555-1561. 5. Kubota et al., Identification of 2-phosphodiesterase, which plays a role in the 2-5A system regulated by interferon. J Biol Chem, 2004. 279(36): p. 37832-41. 6. Poulsen et al., Human 2-phosphodiesterase localizes to the mitochondrial matrix with a putative function in mitochondrial RNA turnover. Nucleic Acids Res, 2011. 39(9): p. 3754-70. 7. Poulsen et al., Enzyme assays for synthesis and degradation of 2-5As and other 2-5 oligonucleotides. BMC Biochem, 2015. 16: p. 15. 8. Makarova et al., CARF and WYL domains: ligand-binding regulators of prokaryotic defense systems. Front Genet, 2014. 5: p. 102. 9. Cao et al., Identification and functional study of type III-A CRISPR-Cas systems in clinical isolates of Staphylococcus aureus. Int J Med Microbiol, 2016. 10. Elmore et al., Bipartite recognition of target RNAs activates DNA cleavage by the Type III-B CRISPR-Cas system. Genes Dev, 2016. 30(4): p. 447-59. 11. Estrella et al. RNA-activated DNA cleavage by the Type III-B CRISPR-Cas effector complex. Genes Dev, 2016. 30(4): p. 460-70. 12. Samai et al., Co-transcriptional DNA and RNA Cleavage during Type III CRISPR-Cas Immunity. Cell, 2015. 161(5): p. 1164-74. 13. Goldberg et al., Conditional tolerance of temperate phages via transcription-dependent CRISPR-Cas targeting. Nature, 2014. 514(7524): p. 633-7. 14. Liu et al., RNA and DNA Targeting by a Reconstituted Thermus thermophilus Type III-A CRISPR-Cas System. PLoS One, 2017. 12(1): p. e0170552. 15. Han et al., A type III-B CRISPR-Cas effector complex mediating massive target DNA destruction. Nucleic Acids Res, 2016. 16. Tamulaitis et al. Type III CRISPR-Cas Immunity: Major Differences Brushed Aside. Trends Microbiol, 2017. 25(1): p. 49-61. 17. Zhu and Ye, Crystal structure of Cmr2 suggests a nucleotide cyclase-related enzyme in type Ill CRISPR-Cas systems. FEBS Lett, 2012. 586(6): p. 939-45. 18. Cocozaki et al., Structure of the Cmr2 subunit of the CRISPR-Cas RNA silencing complex. Structure, 2012. 20(3): p. 545-53. 19. Makarova et al., A DNA repair system specific for thermophilic Archaea and bacteria predicted by genomic context analysis. Nucleic Acids Res, 2002. 30(2): p. 482-96. 20. Hatoum-Aslan et al., Genetic characterization of antiplasmid immunity through a type III-A CRISPR-Cas system. J Bacteriol, 2014. 196(2): p. 310-7. 21. Osawa, T., H. Inanaga, and T. Numata, Crystal structure of the Cmr2-Cmr3 subcomplex in the CRISPR-Cas RNA silencing effector complex. J Mol Biol, 2013. 425(20): p. 3811-23. 22. Opoku-Temeng, C., et al., Cyclic dinucleotide (c-di-GMP, c-di-AMP, and cGAMP) signalings have come of age to be inhibited by small molecules. Chem Commun (Camb), 2016. 52(60): p. 9327-42. 23. Koonin, E. V. and K. S. Makarova, CRISPR-Cas: evolution of an RNA-based adaptive immunity system in prokaryotes. RNA Biol, 2013. 10(5): p. 679-86. 24. Makarova, K. S., et al., Unification of Cas protein families and a simple scenario for the origin and evolution of CRISPR-Cas systems. Biol Direct, 2011. 6: p. 38. 25. Makarova, K. S., et al., A putative RNA-interference-based immune system in prokaryotes: computational analysis of the predicted enzymatic machinery, functional analogies with eukaryotic RNAi, and hypothetical mechanisms of action. Biol Direct, 2006. 1: p. 7. 26. Makarova, K. S., et al., Evolution and classification of the CRISPR-Cas systems. Nat Rev Microbiol, 2011. 9(6): p. 467-77. 27. Wiedenheft, B., S. H. Sternberg, and J. A. Doudna, RNA-guided genetic silencing systems in bacteria and archaea. Nature, 2012. 482(7385): p. 331-8. 28. Kim, Y. K., Y. G. Kim, and B. H. Oh, Crystal structure and nucleic acid-binding activity of the CRISPR-associated protein Csx1 of Pyrococcus furiosus. Proteins, 2013. 81(2): p. 261-70. 29. Niewoehner, O. and M. Jinek, Structural basis for the endoribonuclease activity of the type III-A CRISPR-associated protein Csm6. RNA, 2016. 22(3): p. 318-29. 30. Anantharaman, V., et al., Comprehensive analysis of the HEPN superfamily: identification of novel roles in intra-genomic conflicts, defense, pathogenesis and RNA processing. Biol Direct, 2013. 8: p. 15. 31. Jiang, W., P. Samai, and L. A. Marraffini, Degradation of Phage Transcripts by CRISPR-Associated RNases Enables Type III CRISPR-Cas Immunity. Cell, 2016. 164(4): p. 710-21. 32. Xiao, T. S. and K. A. Fitzgerald, The cGAS-STING pathway for DNA sensing. Mol Cell, 2013. 51(2): p. 135-9. 33. Danilchanka, O. and J. J. Mekalanos, Cyclic dinucleotides and the innate immune response. Cell, 2013. 154(5): p. 962-70. 34. Corrigan, R. M. and A. Grundling, Cyclic di-AMP: another second messenger enters the fray. Nat Rev Microbiol, 2013. 11(8): p. 513-24. 35. Silverman, R. N., A scientific journey through the 2-5A/RNase L system. Cytokine Growth Factor Rev, 2007. 18(5-6): p. 381-8. 36. Gootenberg, J. S., et al., Nucleic acid detection with CRISPR-Cas13a/C2c2. Science, 2017. 37. Zheng, L., U. Baumann, and J. L. Reymond, An efficient one-step site-directed and site-saturation mutagenesis protocol. Nucleic Acids Res, 2004. 32(14): p. e115. 38. Zhang, B. Z., et al., An easy-to-use site-directed mutagenesis method with a designed restriction site for convenient and reliable mutant screening. J Zhejiang Univ Sci B, 2009. 10(6): p. 479-82. 39. Yoshioka, K., KyPlotA User-oriented Tool for Statistical Data Analysis and Visualization. CompStat, 2002. 17(3): p. 425-437. 40. Sheppard et al. The CRISPR-associated Csx1 protein of Pyrococcus furiosus is an adenosine-specific endoribonuclease, RNA, 22 (2016) p. 216-224 41. Lintner, N. G., Frankel, K. A., Tsutakawa, S. E., Alsbury, D. L., Copie, V, Young, M. J., Tainer, J. A., Lawrence, C. M., The structure of the CRISPR-associated protein Csa3 provides insight into the regulation of the CRISPR/Cas system, 2011. 42. Engl C, Schaefer J, Kotta-Loizou I, Buck M., Cellular and molecular phenotypes depending upon the RNA repair system RtcAB of Escherichia coli, 2016 43. Tanaka N, Meineke B, Shuman S., RtcB, a novel RNA ligase, can catalyze tRNA splicing and HAC1 mRNA splicing in vivo, 2011 44. Chakravarty A. K., Subbotin R., Chait B. T. and Shuman, S., RNA ligase RtcB splices 3-phosphate and 5-OH ends via covalent RtcB-(histidinyl)-GMP and polynucleotide-(3)pp(5)G intermediates, 2012 45. Genschik P., Drabikowski, K., and Filipowicz, W., Characterization of the Escherichia coli RNA 3-terminal phosphate cyclase and its sigma 54-regulated operon, 1998.
(119) The embodiments shown and described in the specification are only specific embodiments of inventors who are skilled in the art and are not limiting in any way. Therefore, various changes, modifications, or alterations to those embodiments may be made without departing from the spirit of the invention in the scope of the following claims.