Quantitative enzyme-linked immunoassay (ELISA) to approximate complement fixing antibody titers in serum from patients with coccidioidomycosis

Abstract

Coccidioidomycosis is most often diagnosed serologically and the quantitative complement-fixing antibody test (CF) is considered prognostically useful. Because CF is complex, labor-intensive, and poorly standardized, an enzyme-linked immunoassay (ELISA) alternative would be attractive. The present invention features an antibody-binding domain that is restricted to a 200 amino acid recombinant peptide of the known antigen responsible for CF activity. Overlapping truncations of this peptide do not bind CF antibodies, suggesting that the responsible epitope(s) are conformational. Further, anchoring the antigenic peptide to the ELISA plate by means of a C-terminal tag instead of allowing the peptide to randomly adhere to the plastic plate improves sensitivity of antibody detection by one to two logs in different sera. The newly developed ELISA shows a significant quantitative correlation with CF. This ELISA shows potential as the basis for a new quantitative assay for coccidioidal antibodies.

Claims

1. An isolated Cts1 peptide having a sequence according to SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, or SEQ ID NO: 12.

2. An assay platform for detecting anti-coccidioidal antibodies, said platform comprising: (a) a solid support; and (b) an isolated Cts1 peptide having a sequence according to SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, or SEQ ID NO: 12, wherein the Cts1 is peptide attached to the solid support.

Description

BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWING(S)

(1) The features and advantages of the present invention will become apparent from a consideration of the following detailed description presented in connection with the accompanying drawings in which:

(2) FIGS. 1A-1B show binding of anti-rCTS1(aa111-310) antibodies to rCTS1(aa111-310) after Ni-NTA affinity purification. FIG. 1A shows an SDS-PAGE rCTS1(aa20-310) (34.7 kDa) and rCTS1(aa111-310) (27.4 kDa). FIG. 1B shows an immunoblot of the same peptides with human CF+ sera. The larger bands are presumably dimers.

(3) FIG. 2 shows an ELISA optical densities for IgG antibodies in human CF+ sera at different dilutions or PBS alone that bind to rCTS1.sub.105-310, four overlapping peptides spanning rCTS1.sub.105-310 (Frag1-Frag4), MBP alone, or PBS. The figure shows evidence of no binding for four subunits of Cts1, whereas CTS.sub.105-310 has complete binding. This may be a prototype for a diagnostic test procedure.

(4) FIG. 3 shows the relationship of anti-rCTS1.sub.105-310 antibody concentrations measured by ELISA to CF antibody titers for 50 individual human CF+ sera. The dotted lines represent the 95% confidence intervals for the slope of the regression line.

(5) FIG. 4 shows the absorption of CF antibodies with increasing concentrations of rCTS1.sub.111-310 (27.4 kDa) eliminates binding of CF antibodies to rCTS1.sub.20-310 (34.7 kDa). The blank lane represents loading control.

(6) FIGS. 5A-5B show the lack of immunoreactivity of rCTS1 fragments 1-4. FIG. 5A shows an SDS PAGE and FIG. 5B shows an immunoblot of rCTS1.sub.105-310, 4 subunits of rCTS1.sub.105-310, and MBP probed with CF antibody-containing human sera. Only subunit #2 is cleaved from MBP.

(7) FIG. 6 shows ELISA and CF activities are comparable. Briefly, microtiter plates were prepared using 100 ng of CTS1 111-310 per well as described above. Human sera with CF titers from undetectable to 1:64 were diluted 1:100 and then proportionally to the CF titer. For example, sera of CF titer of 1:1 were diluted 1:100 and sera of CF titer of 1:64 were diluted 1:6400. Blocking prior to sera application, and enzyme conjugate detection of antibodies and absorbance measurements were conducted as described above.

DETAILED DESCRIPTION OF THE INVENTION

(8) Before the present compounds, compositions, and/or methods are disclosed and described, it is to be understood that this invention is not limited to specific synthetic methods or to specific compositions, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.

(9) The present invention features methods and compositions for detecting coccidioidomycosis. Inventors surprisingly found that all or most of the antibody binding (CF antibody binding) is directed toward amino acids 105-310 or amino acids 111-310. The methods of the present invention allow for a specific detection above non-immune sera at a 1:100 dilution (an increase in sensitivity). The methods and compositions of the present invention will help reduce the non-specific antibody binding unrelated to acquiring a coccidioidal infection. This could provide a more sensitive test for early coccidioidal infection because signals could be distinguished at lower intensity, avoiding confusion with nonspecific antibody binding.

(10) Terms

(11) Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which a disclosed invention belongs. The singular terms “a,” “an,” and “the” include plural referents unless context clearly indicates otherwise. Similarly, the word “or” is intended to include “and” unless the context clearly indicates otherwise. “Comprising” means “including.” Hence “comprising A or B” means “including A” or “including B” or “including A and B.”

(12) Suitable methods and materials for the practice and/or testing of embodiments of the disclosure are described below. Such methods and materials are illustrative only and are not intended to be limiting. Other methods and materials similar or equivalent to those described herein can be used. For example, conventional methods well known in the art to which the disclosure pertains are described in various general and more specific references, including, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2d ed., Cold Spring Harbor Laboratory Press, 1989; Sambrook et al., Molecular Cloning: A Laboratory Manual, 3d ed., Cold Spring Harbor Press, 2001; Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates, 1992 (and Supplements to 2000); Ausubel et al., Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, 4th ed., Wiley & Sons, 1999; Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1990; and Harlow and Lane, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999, the disclosures of which are incorporated in their entirety herein by reference.

(13) All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety.

(14) Although methods and materials similar or equivalent to those described herein can be used to practice or test the disclosed technology, suitable methods and materials are described below. The materials, methods, and examples are illustrative only and not intended to be limiting.

(15) In order to facilitate review of the various embodiments of the disclosure, the following explanations of specific terms are provided:

(16) Sequence identity: The identity (or similarity) between two or more nucleic acid sequences is expressed in terms of the identity or similarity between the sequences. Sequence identity can be measured in terms of percentage identity; the higher the percentage, the more identical the sequences are. Sequence similarity can be measured in terms of percentage similarity (which takes into account conservative amino acid substitutions); the higher the percentage, the more similar the sequences are. Methods of alignment of sequences for comparison are well known in the art. Various programs and alignment algorithms are described in: Smith & Waterman, Adv. Appl. Math, 2:482, 1981; Needleman & Wunsch, J. Mol. Biol. 48:443, 1970; Pearson & Lipman, Proc. Natl. Acad. Sci. USA 85:2444, 1988; Higgins & Sharp, Gene, 73:237-44, 1988; Higgins & Sharp, CABIOS 5:151-3, 1989; Corpet et al, Nuc. Acids Res, 16:10881-90, 1988; Huang et al. Computer Appls. in the Biosciences 8, 155-65, 1992; and Pearson et al., Meth. Mol. Bic. 24:307-31, 1994. Altschul et al., J. Mol. Biol. 215:403-10, 1990, presents a detailed consideration of sequence alignment methods and homology calculations. The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., J, Mol. Biol. 215:403-10, 1990) is available from several sources, including the National Center for Biotechnology (NCBI, National Library of Medicine, Building 38A, Room 8N805, Bethesda, Md. 20894) and on the Internet, for use in connection with the sequence analysis programs blastp, blastn, blastx, tblastn and tblastx. Additional information can be found at the NCBI web site. BLASTN may be used to compare nucleic acid sequences, while BLASTP may be used to compare amino acid sequences. If the two compared sequences share homology, then the designated output file will present those regions of homology as aligned sequences. If the two compared sequences do not share homology, then the designated output file will not present aligned sequences. The BLAST-like alignment tool (BLAT) may also be used to compare nucleic acid sequences (Kent, Genome Res. 12:656-664, 2002). BLAT is available from several sources, including Kent Informatics (Santa Cruz, Calif.) and on the Internet (genome.ucsc.edu). Once aligned, the number of matches is determined by counting the number of positions where an identical nucleotide or amino acid residue is presented in both sequences. The percent sequence identity is determined by dividing the number of matches either by the length of the sequence set forth in the identified sequence, or by an articulated length (such as 100 consecutive nucleotides or amino acid residues from a sequence set forth in an identified sequence), followed by multiplying the resulting value by 100. For example, a nucleic acid sequence that has 1166 matches when aligned with a test sequence having 1554 nucleotides is 75.0 percent identical to the test sequence (1166÷1554*100=75.0). The percent sequence identity value is rounded to the nearest tenth.

(17) Sample: Any composition containing or presumed to contain a biomarker, or a composition being tested for the presence or absence of a particular biomarker or other biological entity such as an antibody or fragment thereof. Samples may include purified or separated components of cells, tissues, or blood, e.g., DNA, RNA, proteins, cell-free portions, or cell lysates. The sample can also be from a fresh liquid sample or a previously frozen sample. In certain embodiments, the sample is a liquid sample, e.g., blood or a blood component (plasma or serum), urine, semen, saliva, sputum, mucus, semen, tear, lymph, cerebral spinal fluid, material washed from a swab, etc. The sample can also be partially processed from a sample directly obtained from an individual.

(18) Sensitivity: As used herein sensitivity may refer to the ability of a test to detect antibodies that are specifically produced by a patient's response to a coccidioidal infection. In some embodiments being more sensitive is to mean that a test is able to detect specific and therefore diagnostic antibodies than another test.

(19) Referring now to FIGS. 1A-6, in some embodiments, the present invention features the use of a recombinant Cts1 peptide which is utilized in an ELISA assay for the detection of a coccidioidomycosis infection. For reference, the sequence for chitinase (SEQ ID NO: 1; Coccidioides posadasii, GenBank: AAA92643.1) is shown below in Table 1.

(20) In other embodiments, the present invention features an isolated Cts1 peptide having a sequence that is at least 90% identical to SEQ ID NO: 4 and containing at least one substitution relative to SEQ ID NO: 4. Non-limiting embodiments of the isolated Cts1 peptides are shown in Table 1.

(21) TABLE-US-00001 TABLE 1 Chitinase (Cts1) and isolated Cts1 peptide sequences SEQ ID NO: DESCRIPTION SEQUENCE 1 Chitinase (Cts1) MRFLIGALLT LQTLVQASSM SSMPNYYPVP EAPAEGGFRS VVYFVNWAIY GRGHNPQDLK ADQFTHILYA FANIRPSGEV YLSDTWADTD KHYPGDKWDE PGNNVYGCIK QMYLLKKNNR NLKTLLSIGG WTYSPNFKTP ASTEEGRKKF ADTSLKLMKD LGFDGIDIDW EYPEDEKQAN DFVLLLKACR EALDAYSAKH PNGKKFLLTI ASPAGPQNYN KLKLAEMDKY LDFWNLMAYD FSGSWDKVSG HMSNVFPSTT KPESTPFSSD KAVKDYIKAG VPANKIVLGM PLYGRAFAST DGIGTSFNGV GGGSWENGVW DYKDMPQQGA QVTELEDIAA SYSYDKNKRY LISYDTVKIA GKKAEYITKN GMGGGMWWES SSDKTGNESL VGTVVNGLGG TGKLEQRENE LSYPESVYDN LKNGMPS 2 Cts1.sub.20-310 MSSMPNYYPVP EAPAEGGFRS VVYFVNWAIY GRGHNPQDLK ADQFTHILYA FANIRPSGEV YLSDTWADTD KHYPGDKWDE PGNNVYGCIK QMYLLKKNNR NLKTLLSIGG WTYSPNFKTP ASTEEGRKKF ADTSLKLMKD LGFDGIDIDW EYPEDEKQAN DFVLLLKACR EALDAYSAKH PNGKKFLLTI ASPAGPQNYN KLKLAEMDKY LDFWNLMAYD FSGSWDKVSG HMSNVFPSTT KPESTPFSSD KAVKDYIKAG VPANKIVLGM PLYGRAFAST DGIGTSFNGV 3 Cts1.sub.111-310 QMYLLKKNNR NLKTLLSIGG WTYSPNFKTP ASTEEGRKKF ADTSLKLMKD LGFDGIDIDW EYPEDEKQAN DFVLLLKACR EALDAYSAKH PNGKKFLLTI ASPAGPQNYN KLKLAEMDKY LDFWNLMAYD FSGSWDKVSG HMSNVFPSTT KPESTPFSSD KAVKDYIKAG VPANKIVLGM PLYGRAFAST DGIGTSFNGV 4 Cts1.sub.105-310 VYGCIK QMYLLKKNNR NLKTLLSIGG WTYSPNFKTP ASTEEGRKKF ADTSLKLMKD LGFDGIDIDW EYPEDEKQAN DFVLLLKACR EALDAYSAKH PNGKKFLLTI ASPAGPQNYN KLKLAEMDKY LDFWNLMAYD FSGSWDKVSG HMSNVFPSTT KPESTPFSSD KAVKDYIKAG VPANKIVLGM PLYGRAFAST DGIGTSFNGV 5 Modified Cts1.sub.105-310 99% VYGCIK QMYLLKKNNR NLKTLLSIGG identical to SEQ ID NO: WTYSPNFKTP ASTEEGRKKF ADTSLKLMKD 4; bold letters are LGFDGIDIDW EYPEDEKQAN DFVLLLKACR substituted amino acids EAVDAYSAKH PNGKKFLVTI ASPAGPQNYN KLKLAEMDKY LDFWNLMAYD FSGSWDKVSG HMSNVFPSTT KPESTPFSSD KAVKDYIKAG VPANKIVLGM PLYGRAFAST DGIGTSFNGV 6 Modified Cts1.sub.105-310 99% VYGCIK QMYLLKKNNR NLKTLLSIGG identical to SEQ ID NO: WTYSPNFKTP ASTEEGRKKF LDTSLKLMKD 4: bold letters are LGFDGIDIDW EYPDDEKQAN DFVLLLKACR substituted amino acids EALDAYSAKH PNGKKFLLTI ASPAGPQNYN KLKLAEMDKY LDFWNLMAYD FSGSWDKVSG HMSNVFPSTT KPESTPFSSD KAVKDYIKAG VPANKIVLGM PLYGRAFAST DGIGTSFNGV 7 Modified Cts1.sub.105-310 98% VYGCIK QMYLLKKNNR NLKTLLSIGG identical to SEQ ID NO: WTYSPNFKTP ASTEDGRKKF ADTSLKLMKD 4: bold letters are LGFDGIDIDW EYPEDEKQAN DFVLLLKACR substituted amino acids EALDAYSAKH PNGKRFLLTI ASPVGPQNYN KLKLAEMDKY LDFWNLMAYD FSGSWDKVSG HMSNVFPSTT KPESTPFSSD KAVKDYIKAG VPANKIVLGM PLYGRAFAST DGIMTSFNGV 8 Modified Cts1.sub.105-310 98% VYGCIK QMYLLKKNNR NLKTLLSIGG identical to SEQ ID NO: WTYSPNFKTP ASTEEGRKKF IDTSLKLMKD 4; bold letters are LGFDGIDIDW EYPEDEKQAN DFVLLLKACR substituted amino acids DALDAYSAKH PNVKKFLLTI ASPAGPQNYN KLKLAEMDKY LDFWNLMAYD FSGSWDKVSG HMSNVFPSTT KPESTPFSSD KAVKDYIKAG VPANKIVLGM PLYLRAFAST DGIGTSFNGV 9 Modified Cts1.sub.105-310 95% VYGCIK QMYLLHKNNR NLKTLLSIVL identical to SEQ ID NO: WTYSPNFKTP ISTEEGRKKF ADTSLKLMKD 4; bold letters are LGFDGIDIDW EYPDDEKQAN DFVLLLKACR substituted amino acids EALDAYSAKH PNGKRFLLTI ASPAGPQNYN KLRLAEMDKY LDFWNLMAYD FSGSWDKVSG HMSNVFPSTT KPESTPFSSE KAVKDYIKAG VPANKIVLGM PLYGHAFAST EGIGTSFNGV 10 Modified Cts1.sub.105-310 95% VWGCIK QMYLLKKNNR NLKTLLSIGG identical to SEQ ID NO: WTYSPNFKNP ASTEEGRKKF ADTSLKLMKD 4; bold letters are LGFDGIDIDW EYPEEEKQAN DFVMLLKACR substituted amino acids EALDAYSVKH PNGKKYLLTI ASPAGPQNYN KLKLAEMDKY LDFWNLMAYD FSGSWDKVSG HMSQVFPSTT KPESTIFSSD KAVKDYIRAG VPANKIVLAM PLYGRAFAST DGIGTSFNGV 11 Modified Cts1.sub.105-310 90% VYGNIK QMYLLRKNNR NLKTLLSIGG identical to SEQ ID NO: WTYSPNFKTA ASNEEGRKKF ADTSLHLMKD 4: bold letters are LGFEAIDIDW EYPDEDKQAN DWVLLLHACR substituted amino acids EALDAYSAKH PNGKRFLLTI ASPAGPQNYN KLKLAEMDKY LDFWNLMAYD FSGSWDKVSV HMSNVFPSTT RPESTPFTSD KAVKDYIKAG VPANRVVLGM PLYGRLFAST DGIGTTFNGV 12 Modified Cts1.sub.105-310 90% VYGCIR QMYLLKHNNR NLKTLVSIGG identical to SEQ ID NO: WTYSPNFRTP ASTEEGRKKF ADTSLKLMKD 4; bold letters are LGFDGIDIDW EYPDEEKQAN DFVLLVKACK substituted amino acids EVLDAYSAKH PNGHRFLLTI ASPAGPQNYN KLKLAEMDKY LDFWNLMIYD FSGSWDKVTG HMSNVFPSTT RPESTPFTSD KAVKEYIKAG VPLNKIVLGM PLYARAFAST DGIVTSFNMV

(22) In some embodiments, the Cts1 peptide has a sequence that is 100% identical to SEQ ID NO: 4. In some embodiments, the Cts1 peptide has a sequence that is 99% identical to SEQ ID NO: 4. In some embodiments, the Cts1 peptide has a sequence that is 98% identical to SEQ ID NO: 4. In some embodiments, the Cts1 peptide has a sequence that is 97% identical to SEQ ID NO: 4. In some embodiments, the Cts1 peptide has a sequence that is 96% identical to SEQ ID NO: 4. In some embodiments, the Cts1 peptide has a sequence that is 95% identical to SEQ ID NO: 4. In some embodiments, the Cts1 peptide has a sequence that is 90% identical to SEQ ID NO: 4. In some embodiments, the Cts1 peptide has a sequence that is 85% identical to SEQ ID NO: 4. In some embodiments, the Cts1 peptide has a sequence that is 80% identical to SEQ ID NO: 4. In some embodiments, the Cts1 peptide has a sequence that is 75% identical to SEQ ID NO: 4. In some embodiments, the Cts1 peptide has a sequence that is 70% identical to SEQ ID NO: 4. Non-limiting examples of peptides that are similar to SEQ ID NO: 4 are shown in Table 1.

(23) In other embodiments, the present invention also features peptides that are similar to SEQ ID NO: 4, e.g., peptides wherein one amino acid is different, two amino acids are different, three amino acids are different, four amino acids are different, five amino acids are different, six amino acids are different, seven amino acids are different, eight amino acids are different, nine amino acids are different, ten amino acids are different, more than 10 amino acids are different, more than 20 amino acids are different, more than 30 amino acids are different, 20-30 amino acids are different, 1-10 amino acids are different, 10-20 amino acids are different, 30-40 amino acids are different, 40-50 amino acids are different, etc. Non-limiting examples of peptides that are similar to SEQ ID NO: 4 are shown in Table 1.

(24) In some embodiments, the present invention provides an isolated peptide according to SEQ ID NO: 3. The present invention also feature peptides that are similar to SEQ ID NO: 3, e.g., peptides wherein one amino acid is different, two amino acids are different, three amino acids are different, four amino acids are different, five amino acids are different, six amino acids are different, seven amino acids are different, eight amino acids are different, nine amino acids are different, ten amino acids are different, more than 10 amino acids are different, more than 20 amino acids are different, more than 30 amino acids are different, 20-30 amino acids are different, 1-10 amino acids are different, 10-20 amino acids are different, 30-40 amino acids are different, 40-50 amino acids are different, etc. Stated differently, in some embodiments, the peptide is at least 75% identical to SEQ ID NO: 3. In some embodiments, the peptide is at least 80% identical to SEQ ID NO: 3. In some embodiments, the peptide is at least 85% identical to SEQ ID NO: 3. In some embodiments, the peptide is at least 90% identical to SEQ ID NO: 3. In some embodiments, the peptide is at least 95% identical to SEQ ID NO: 3. In some embodiments, the peptide is at least 96% identical to SEQ ID NO: 3. In some embodiments, the peptide is at least 97% identical to SEQ ID NO: 3. In some embodiments, the peptide is at least 98% identical to SEQ ID NO: 3. In some embodiments, the peptide is at least 99% identical to SEQ ID NO: 3. In some embodiments, the peptide is at least 100% identical to SEQ ID NO: 3.

(25) In some embodiments, the isolated Cts1 peptide has a sequence according to SEQ ID NO: 5. In some embodiments, the isolated Cts1 peptide has a sequence according to SEQ ID NO: 6. In some embodiments, the isolated Cts1 peptide has a sequence according to SEQ ID NO: 7. In some embodiments, the isolated Cts1 peptide has a sequence according to SEQ ID NO: 8. In some embodiments, the isolated Cts1 peptide has a sequence according to SEQ ID NO: 9. In some embodiments, the isolated Cts1 peptide has a sequence according to SEQ ID NO: 10. In some embodiments, the isolated Cts1 peptide has a sequence according to SEQ ID NO: 11. In some embodiments, the isolated Cts1 peptide has a sequence according to SEQ ID NO: 12.

(26) In some embodiments, the Cts1 peptide having a sequence of the above-mentioned mentioned sequences has a sequence that is at least 100% identical to the aforementioned sequences. In some embodiments, the Cts1 peptide having a sequence of the above-mentioned sequences has a sequence that is at least 99% identical to the aforementioned sequences. In some embodiments, the Cts1 peptide having a sequence of the above-mentioned sequences has a sequence that is at least 98% identical to the aforementioned sequences. In some embodiments, the Cts1 peptide having a sequence of the above-mentioned sequences has a sequence that is at least 97% identical to the aforementioned sequences. In some embodiments, the Cts1 peptide having a sequence of the above-mentioned sequences has a sequence that is at least 96% identical to the aforementioned sequences. In some embodiments, the Cts1 peptide having a sequence of the above-mentioned sequences has a sequence that is at least 95% identical to the aforementioned sequences. In some embodiments, the Cts1 peptide having a sequence of the above-mentioned sequences has a sequence that is at least 90% identical to the aforementioned sequences. In some embodiments, the Cts1 peptide having a sequence of the above-mentioned sequences has a sequence that is at least 85% identical to the aforementioned sequences. In some embodiments, the Cts1 peptide having a sequence of the above-mentioned sequences has a sequence that is at least 80% identical to the aforementioned sequences. In some embodiments, the Cts1 peptide of having a sequence of the above-mentioned sequences has a sequence that is at least 75% identical to the aforementioned sequences.

(27) The present invention may also feature peptides that are similar to the aforementioned sequences, e.g., peptides wherein one amino acid is different, two amino acids are different, three amino acids are different, four amino acids are different, five amino acids are different, six amino acids are different, seven amino acids are different, eight amino acids are different, nine amino acids are different, ten amino acids are different, more than 10 amino acids are different, more than 20 amino acids are different, more than 30 amino acids are different, 20-30 amino acids are different, 1-10 amino acids are different, 10-20 amino acids are different, 30-40 amino acids are different, 40-50 amino acids are different, etc.

(28) The present invention also features nucleic acids that encode any of the peptides disclosed herein (e.g., nucleic acids that encode SEQ ID NO: 3, SEQ ID NO: 4, a peptide similar thereto, etc.).

(29) The present invention also provides expression vectors that can produce any of the peptides disclosed herein.

(30) The present invention also provides peptide constructs comprising one of the peptides disclosed herein (e.g., SEQ ID NO: 4, SEQ ID NO: 3, etc.) attached to or linked (directly or indirectly) to a component used to bind the peptide to a solid support. Methods and reagents used for linking or binding a peptide to a solid support are well known to one of ordinary skill in the art.

(31) In some embodiments, the Cts1 peptide is attached to a solid support. In some embodiments, the Cts1 peptide is covalently bound to a solid support. In other embodiments, the Cts1 peptide is non-covalently bound to a solid support. In some embodiments, a solid support may include but is not limited to solid surface, plastic, or streptavidin-coated plate.

(32) In some embodiments, the Cts1 peptide is covalently attached to a component. In some embodiments, the Cts1 peptide is covalently bound to a component. In some embodiments, the Cts1 peptide is non-covalently attached to a component. In some embodiments, the Cts1 peptide is non-covalently bound to a component. In some embodiments, the component attaches the Cts1 peptide to a peptide that is on a solid support. Non-limiting examples of the component may include but are not limited to biotin, a biotin mimic (SEQ ID NO: 27), a linker (SEQ ID NO: 26) or a peptide sequence that comprises SEQ ID NO: 26 followed by SEQ ID NO: 27. In other embodiments, a component may include additional amino acid sequences that bind to streptavidin like biotin does.

(33) In some embodiments, the isolated Cts1 peptide is covalently attached to a component, wherein the component attaches to a peptide that is on a solid support.

(34) In some embodiments, the isolated Cts1 peptide maintains its conformational shape. In other embodiments, the isolated Cts1 peptide maintains its conformational shape while attached to a component. In other embodiments, the isolated Cts1 peptide maintains its conformational shape while covalently attached to a component. In other embodiments, the isolated Cts1 peptide maintains its conformational shape while non-covalently attached to a component. In some embodiments, the isolated Cts1 peptide maintains its conformational shape while bound to a component. In other embodiments, the isolated Cts1 peptide maintains its conformational shape while covalently bound to a component. In other embodiments, the isolated Cts1 peptide maintains its conformational shape while non-covalently bound to a component.

(35) The present invention may feature an assay platform for detecting anti-coccidioidal antibodies. In some embodiments, the platform comprises a solid support. In other embodiments the platform comprises an isolated Cts1 peptide having a sequence according to SEQ ID NO: 4 and containing at least one substitution modification relative to SEQ ID NO: 4, wherein the Cts1 peptide is attached to the solid support.

(36) In some embodiments, the isolated Cts1 peptide has a sequence according to SEQ ID NO: 5. In some embodiments, the isolated Cts1 peptide has a sequence according to SEQ ID NO: 6. In some embodiments, the isolated Cts1 peptide has a sequence according to SEQ ID NO: 7. In some embodiments, the isolated Cts1 peptide has a sequence according to SEQ ID NO: 8. In some embodiments, the isolated Cts1 peptide has a sequence according to SEQ ID NO: 9. In some embodiments, the isolated Cts1 peptide has a sequence according to SEQ ID NO: 10. In some embodiments, the isolated Cts1 peptide has a sequence according to SEQ ID NO: 11. In some embodiments, the isolated Cts1 peptide has a sequence according to SEQ ID NO: 12.

(37) Without wishing to limit the invention to any theory or mechanism, it is believed that the substitution modification helps improve sensitivity and/or helps eliminate cross reactivity.

(38) In some embodiments, the assay platform is for an ELISA assay. In some embodiments, the platform is for a complement fixation assay.

(39) In some embodiments, the solid support is a well. In some embodiments, the well is a part of a microwell plate. In some embodiments, the solid support is a microwell. In other embodiments, the solid support is a microwell plate. In other embodiments, the solid support is a solid surface. In some embodiments, the solid support is plastic. In some embodiments, the solid support is a streptavidin-coated plate.

(40) In some embodiments, the isolated Cts1 peptide is covalently attached to a component. In some embodiments, the component attaches to a peptide that is on a solid support. In some embodiments, the isolated Cts1 peptide maintains its conformational shape. In other embodiments, the isolated Cts1 peptide maintains its conformational shape while attached to the platform. In some embodiments, the isolated Cts1 peptide maintains its conformational shape while attached to a solid support. Non-limiting examples of the component may include but are not limited to biotin, a biotin mimic (SEQ ID NO: 27), a linker (SEQ ID NO: 26) or a peptide sequence that comprises SEQ ID NO: 26 followed by SEQ ID NO: 27.

(41) Additionally, the present invention may feature an isolated Cts1 peptide having a sequence that is at least 90% identical to SEQ ID NO: 4, wherein the Cts1 peptide is covalently attached to a component, wherein the component attaches to a peptide that is coated onto a solid support. In some embodiments, the isolated Cts1 peptide maintains its conformational shape.

(42) The present invention also provides assay platforms for detecting anti-coccidioidal antibodies. For example, the assay platform may comprise a surface, such as a well, wherein a peptide of the present invention (e.g., SEQ ID NO: 4) is bound to the surface. A sample may be introduced to the assay platform, wherein the sample is contacted with the peptide bound to the surface. Assays such as this may be similar to an ELISA.

(43) In some embodiments, the surface the peptide is bound to may include but is not limited to a solid support, a solid surface, plastic, or streptavidin-coated plate. In other embodiments, the peptide may be attached to the surface by, but not limited to, biotin, a biotin mimic (SEQ ID NO: 27), a linker (SEQ ID NO: 26) or a peptide sequence that comprises SEQ ID NO: 26 followed by SEQ ID NO: 27. In other embodiments, the peptide may be attached to the surface by other amino acid sequences that bind to streptavidin like biotin does.

EXAMPLE

(44) The following is a non-limiting example of the present invention. It is to be understood that said example is not intended to limit the present invention in any way. Equivalents or substitutes are within the scope of the present invention.

(45) Methods:

(46) Human sera. A serum library composed of remnant specimens tested for anti-coccidioidal antibodies by immunodiffusion at the Southern Arizona Veterans Health Care System Medical Center was used for these studies. All specimens were de-identified, and the University of Arizona Institutional Review Board has determined that their use was not human experimentation. For some studies, a serum pool was created from portions of 50 separate sera. The calculated geometric mean CF titer for the sum of the individual sera was 1:12, and when the pool was tested directly by quantitative immunodiffusion, the titer was 1.8.

(47) Recombinant antigen preparation. Full-length (FL) CTS1 was produced by FOR from a cDNA library (Dugger K O, Villareal K M, Nguyen A, Zimmermann C R, Law J H, Galgiani J N. Cloning and sequence analysis of the cDNA for a protein from Coccidioides posadasii with immunogenic potential. BiochemBiophysResCommun 1996; 218(2): 485-9) using primers shown in Table 2. Sequence for this amplimer matched that submitted to Genbank (U60807) (Zimmermann C R, Johnson S M, Martens G W, White A G, Pappagianis D. Cloning and expression of the complement fixation antigen-chitinase of Coccidioides immitis. Infect Immun 1996; 64(12): 4967-75). Truncations of and modifications of rCTS1 were prepared by PCR using primers also shown in Table 2.

(48) TABLE-US-00002 TABLE 2 Primers used to produce rCTS1 and its truncations. SEQ Amino ID # Name Acid DNA Sequence NO.: FL CF-1 1-*** GGATCCCCGAATTCATGAGGTTCCTT 13 ATTGGCTTTACTTACTTACTCTC FL CF-427 ***-427 CGGGATCCATGATGATGATGATGATG 14 ACTTGGCATCCCATTCTTCTTGAG 1 20-Fw 20-*** TACTTCCAATCCAATGCGATGTCAAG 15 TATGCCCAATTATTATCCAG 2a 111-Fw 111-** TACTTCCAATCCAATGCGCAAATGTA 16 CTTGCTCAAGAAGAACAACCGGAAC 3 310-Rv ***-310 TTATCCACTTCCAATGCGCTAAACAC 17 CGTTGAAGCTAGTGCCGATCCCATC 3a 310_BMP_ ***-310 TTATCCACTTCCAATGCGCTACCACC 18 Rv GAACTGCGGGTGACGCCAAGCGGAG CTGGCGCTGGCGCCGCCGCCAACAC CGTTGAAGCTAGT 2b Frag1_ 105-*** TACTTCCAATCCAATGCGGTTTACGG 19 105_Fw CTGTATCAAGCAAATGTACTTGCTCA AGAAG 4 Frag1_ ***-164 TTATCCACTTCCAATGCGCTAATCAAA 20 164_Rv GCCAAGGTCCTTCATCAACTTCAGAG ATGTG 5 Frag2_ 154--** TACTTCCAATCCAATGCGTCTCTGAA 21 154_Fw GTTGATGAAGGACCTTGGCTTTGATG G 6 Frag2_ ***-212 TTATCCACTTCCAATGCGCTATGAAG 22 212_Rv CAATAGTGAGCAAGAATTTCTTGCCA TTCGGG 7 Frag3_ 202-*** TACTTCCAATCCAATGCGAATGGCAA 23 202_Fw GAAATTCTTGCTCACTATTGCTTCACC GG 8 Frag3_ ***-252 TTATCCACTTCCAATGCGCTACATGT 24 252_Rv GGCCAGACACTTTGTCCCAGCTG 9 Frag4_ 240-*** TACTTCCAATCCAATGCGGACTTCAG 25 240_Fw CGGCAGCTGGGACAAAGTG

(49) For initial studies with rCTS1.sub.20-310 (SEQ ID NO: 2) and rCTS1.sub.111-310 (SEQ ID NO: 3) were expressed in Escherichia coil BL21 DE3 gold and extracted with 8M urea buffers and disrupted by ultrasound treatment at room temperature for 1 hour. The purification was accomplished by affinity binding to nickel-NTA column. After collecting and pooling eluate fractions containing the expressed peptide as judged by SDS-PAGE and immunoblot, the pool was placed in dialysis tubing, and the urea was slowly removed by making twice daily 1-liter changes of the renaturation buffer (150 mM of Sodium Chloride (NaCl), 1 mM of Ethylenediaminetetraacetic acid (EDTA), 5 mM of Glutathione reduced (GSH), 0.5 mM of Glutathione oxidized (GSSG), 20 mM of Tris pH9.5 and 10% of Glycerol). The stepwise gradient of urea was 6.5, 5, 3.5, 1, and 0 M. Following renaturation (e.g., dialyze to PBS), gel-filtration was conducted with a P100 fine (Bio-Rad) 50 ml packed in an adaptor column 2.0+20 cm at a flow rate of 0.1 ml/min, Proteins were analyzed by PAGE and subsequent immunoblotting, for example, FIG. 1B shows SDS PAGE of E. coli-expressed rCTS1 truncations after Ni-NTA affinity purification. FIG. 1A shows an immunoblot of E. coli-expressed rCTS1 truncations with CF+ human serum.

(50) For subsequent studies, amplimers were cloned into Ligation Independent

(51) Cloning Vectors pMCSG7 that contained a T7 promoter and N-terminal His-tag, as described Eschenfeldt et al 2009 (Eschenfeldt W H, Lucy 5, Millard C S, Joachimiak A, Mark I D. A family of LIC vectors for high-throughput cloning and purification of proteins. Methods Mol Biol 2009; 498; 105-15) and confirmed by sequencing. The rCTS1.sub.105-310 truncation was soluble upon E. coli lysis, and thus, did not need to be refolded as a step of collection. Further, it gave significantly higher yield per gram of bacterial pellet than the rCTS1.sub.105-310 truncation. Thus, the rCTS1.sub.105-310 truncation was used in place of the rCTS1.sub.111-310 truncation. An additional construct of rCTS1.sub.105-310 involved creating a biotin mimetic protein tag at the C-terminal end of the aa105-310 truncation by adding a linker region GGGASAS (SEQ ID NO: 26) followed by the decapeptide, SAWRHPQFGG (SEQ ID NO: 27) via PCR.

(52) Vectors for the various rCTS1 constructs were cloned into Escherichia coli BL21 DE3 gold cells and purified as in Neubert et al. 2017 (Neubert M J, Dahlmann E A, Ambrose A, Johnson M D L. Copper Chaperone CupA and Zinc Control CopY Regulation of the Pneumococcal cop Operon. mSphere 2017; 2(5)) with modifications. After initial purification using immobilized nickel-affinity chromatography (IMAC) (HisTrap FF, GE Healthcare), protein was further purified by size-exclusion chromatography (SEC) (Superdex 200, GE Healthcare) using a buffer of 20 mM Tris pH 8, 200 mM NaCl, and 5% glycerol. Additionally, using the primers shown in Table 2, four fragments were made of the aa105-310 truncation: Fragment 1 (aa105-164), Fragment 2 (aa154-212), Fragment 3 (aa202-252), and Fragment 4 (aa240-310). Based on either no peak or observable band on a gel from the nickel elution, fragments #1, 3, and 4 were determined to be insoluble. To resolve this, truncations for these fragments were cloned into pMCSG9 that contained a maltose binding protein (MBP) linker to increase solubility, and the growth and purification process repeated. SEC peaks containing pure rCTS1 truncation fragments (as determined by SDS-PAGE), with (fragments #1, 3, 4) or without (fragment #2) MBP were concentrated if necessary (i.e. Amicon® Ultra Centrifugal Filters with molecular weight cutoffs) and concentration was determined by absorbance at 280 nm using molecular weight and extinction coefficient. Samples at >10 μM were aliquoted into thin-walled FOR tubes, and flash-frozen using liquid N.sub.2

(53) Immunoblot analysis. All expression products were analyzed on standard SDS PAGE. Because truncations differed in size, peptides were calculated in molarity and approximately 200 um/lane of each soluble peptide was loaded equally on 4-20% Ready GEL (Bio-Rad, Cat #4561093), and subsequently the gels were stained with Coomassie. Separated proteins were transferred from the gel to a nitrocellulose membrane, rinsed with Tris-buffered saline containing 0.05% Tween-20 (TBST) before blocking with 5% normal goat sera (NGS) in TBS-T for either one hour at room temperature or overnight at 4° C. Two identical immunoblots were performed, one with sera from the serum bank (CF=1:128) and the other with normal human serum. The sera were diluted 1:1000. Immunoblots were then washed, stained with alkaline phosphatase-conjugated goat anti-human IgG antibody, washed again, and immunoreactive bands visualized with colorimetric alkaline phosphatase substrate reagents.

(54) As indicated in the results, for one competition study, a truncation (rCTS1.sub.111-310) was mixed with the CF+ sera at 1 mM or 10 mM (5× or 50× the amount that was loaded to the gel) prior to application to the membrane and resulting binding to rCTS1(aa20-310) was assessed.

(55) Immunoblots demonstrated that both the a.a. 20-310 (Cts1.sub.20-310; SEQ ID NO: 2) and the a.a. 111-310 (Cts1.sub.111-310; SEQ ID NO: 3) recombinant peptides reacted to sera from patients with coccidioidomycosis that contained CF antibodies but did not react with sera from uninfected patients. Absorption of CF positive sera with a.a. 111-310 (Cts1.sub.111-310; SEQ ID NO: 3) eliminated immunoblot binding of the sera to a.a. 20-310 (Cts1.sub.20-310; SEQ ID NO; 2) (data not shown).

(56) ELISA. Initial studies were carried out by coating standard plastic 96-well microplates (Thermo Scientific, Cat, #80040E0910) with 100 ng/well of recombinant peptides at 4° C. for overnight. Preliminary studies demonstrated that his amount of peptide per well was not rate-limiting. After triplicate washing with PBST, coated wells were blocked with 5% milk in PBST at room temperature for 30 min, excess was removed, and 100 μl of the serum pool, or individual human CF+ sera used to prepare the pool were added to duplicate wells at various dilutions. Duplicate wells filled with PBS were also included. After incubation at room temperature for 1 hour, wells were washed 3 times with PBST. Then, affinity-purified peroxidase-labeled goat anti-human IgG antibodies (KPL, Cat. #474-1006, diluted 1:10,000) was added and left at room temperature for 1 h, after which the wells were washed 3 times with PBST. Finally, SuperBlue TMB Microwell Peroxidase Substrate (KPL Cat. #52-00-02) was added and 10 min later 1N HCl stop solution is added. Optical densities (OD) were read at 450 nm, Same-day standard ELISA curves were produced by coating wells with goat anti-human antibody (IgG) or PBS and incubated with human immunoglobulin at concentrations from 2-14 ng/ml. Experimental OD measurements minus background were plotted on the standard curves within the OD range of 0.10 to 0.80, multiplied by the serum dilution factor and expressed as μg/ml of IgG.

(57) For later studies, Pierce Streptavidin coated high binding capacity 96-well plates (Thermo Scientific, Cat. #1550) were used for studies with the biotin mimic-tagged peptides. The rest of the procedure was formed identically to that described above except that tris-buffer saline, 0.1% BSA, 0.05% Tween-20 were used as the wash buffer instead of PBST, and the standard curve was constructed with whole molecule biotin conjugated to human IgG (Rockland, Cat, #009-0602) at concentrations of 2.5 to 10.0 ηg/ml.

(58) Statistical Analysis. The correlation of CF antibody titers with ELISA results was estimated as the significance of the slope of the linear regression paired results as being non-zero.

(59) Anti-coccidioidal antibody binding is restricted to rCTS1.sub.111-310, but not to smaller rCTS truncations.

(60) Initial studies focused on the rCTS1.sub.111-310 and compared it to rCTS1.sub.20-310. As shown in FIGS. 1A-1B, the shorter truncation (27.4 kDa) demonstrates at least as much binding as the previously published rCTS1.sub.20-310 (34.7 kDa). Further, adding increasing concentrations of rCTS.sub.111-310 to antisera used to perform immunoblotting of rCTS1.sub.20-310 virtually blocked all antibody binding to the membrane-bound peptide. This indicates that antibody binding to rCTS1.sub.111-310 accounted for nearly all of the binding to rCTS1.sub.20-310 (FIG. 4).

(61) Next, four overlapping truncations (rCTS1.sub.105-164, rCTS1.sub.154-212, rCTS1.sub.202-252, and rCTS1.sub.240-310) were produced as shown in FIGS. 1A-1B. Each truncation overlapped by at least 11 residues. For these and future studies, rCTS1.sub.105-310 (SEQ ID NO: 4; Table 1) was substituted for rCTS1.sub.111-310 because this slightly larger truncation produced a several-fold greater yield of expression product and did not require denaturation and refolding to remain soluble. Of these truncations, only subunit #2 was soluble without MBP, and only subunit #3 (rCTS1.sub.202-252) was soluble when the MBP was cleaved from the expression product. Of the four soluble truncations, western blots failed to show any significant binding to any of the subunits (FIGS. 5A & 5B). Also, comparing ELISA results when rCTS1.sub.105-310 (SEQ ID NO: 4) or each of the four subunit peptides, or MBP alone, found virtually no binding by CF positive serum (FIG. 2). These unexpected findings suggested that most if not all of the binding of serum antibodies to rCTS1.sub.105-310 was directed at conformational or discontinuous epitopes rather than epitopes of a primary amino acid sequence. Without wishing to limit the present invention to any theory or mechanism, it is believed that a similar assay may be used as a diagnostic test procedure.

(62) Sensitivity and reproducibility of antibody binding to rCTS.sub.105-310 is improved by tag-binding the peptide to the ELISA well.

(63) Preliminary quantitative ELISA studies were performed using rCTS1.sub.105-310 absorbed directly to plastic microtiter wells. However, day to day replication of binding of a pool created from CF antibody positive patient sera (CF titer of the pool was 1:8) resulted in unsatisfactory variability. Because the epitope mapping suggested that conformation of the peptide was critical, it was postulated that adhering the peptide directly to the plastic might result in steric distortion in an uncontrolled manner. Moreover, anchoring the antigen uniformly to the well by means of a terminal tag might result in the anchored antigen retaining its fluid phase conformation such as is the case in both classic CF antibody and immunodiffusion assays. To study this, an amino acid sequence mimic of biotin, SAWRHPQFGG (SEQ ID NO: 27), was cloned to the C-terminal of rCTS1.sub.105-310. The biotin mimic sequence readily binds to streptavidin-coated plates to low μM affinity. Using this reconfigured assay, the quantitative ELISA results of replicates on 12 separate days ranged from 92 μg/ml to 174 μg/ml (average=112 μg/ml, sem±25).

(64) The quantitative antibody detection by ELISA performed was compared with rCTS1.sub.105-310 absorbed directly to the well of uncoated plastic plates and with the biotin-mimic tag bound to streptavidin coated plates. As shown in Table 5, results with the mimic-tagged peptide uniformly detected more antibodies than did the peptide absorbed directly to the plastic with detection ratios ranging from 19- to 193-fold greater. Using the tag-bound rCTS.sub.105-310 peptide, the 50 sera used to construct the serum pool individually were assayed, and the results are shown in FIG. 3. There is a significant relationship between the ELISA-measured anti-rCTS1.sub.105-310 IgG concentration and the CF titer (p=0.0085) although the r.sup.2 is only 0.14.

(65) TABLE-US-00003 TABLE 3 Difference of results between quantitative ELISA results from 11 individual human sera using different methods of binding the antigen to the well of the plates. Antibody binding (ug/ml) to rCTS1.sub.105-310 IDCF Protein directly Protein with biotin mimic bound Ratio of biotin liter to the plastic to Streptavidin-coated wells mimic:plastic 2 0.096 14.00 146 2 0.491 12.80 26 2 0.023 4.45 193 2 1.437 78.75 55 4 0.454 8.50 19 4 1.525 55.38 36 4 0.149 16.45 110 8 0.566 34.69 61 8 0.218 6.95 33 16 1.028 24.60 24 16 0.08 14.40 180 Average fold difference 79

(66) The present absorption studies where rCTS1.sub.111-310 was mixed with CF-positive serum virtually eliminated any binding to rCTS1.sub.20-310 on the nitrocellulose membrane. However, none of four smaller, overlapping truncations of this region showed any appreciable antibody binding. The simplest explanation for this unexpected finding is that antibody binding to Coccidioides-specific epitope(s) depends upon conformation(s) present CTS1.sub.111-310 that is lost with the individual smaller peptides. The expression of rCTS1.sub.105-311 was found to be achieved in abundant quantities for serologic purposes.

(67) Although the exact structure of the Coccidioides-specific conformational epitopes has not been identified, the present findings do suggest a possible reason why a recombinant CTS1 has not yet been used to develop an ELISA to mimic the quantitative CF antibody assay. An ELISA configuration with rCTS1 absorbed directly to the plastic well might well distort the protein's conformation in unpredictable ways and reduce its antibody binding. As found to be the case for CTS1.sub.105-310 when compared to results with an ELISA where the peptide used a biotin-mimic tag sequence for oriented binding to streptavidin-coated wells (Table 3). Thus, using a biotin-mimic tag may offer a technical modification to improve a quantitative ELISA.

(68) A general correlation between CF titer and ug/ml of antibody binding to CTS1.sub.105-310 was observed (FIG. 3). The use of a standard curve to quantitate antibody binding has the advantage of allowing results from sequential specimens over time to be compared without running two specimens at the same time as has been recommended for optimal CF antibody titer comparisons. The correlation not being better than what was observed could be due to several factors. ELISA measures antibody binding to monomeric antigens which is influenced by the distribution of antibody avidities in different patient sera whereas CF antibody assays are based upon antigen-specific immune-complex formation. The relationship of these two dependencies is likely not uniform in different patients' sera. It is possible that better agreement between ELISA and CF results might be achieved using different conditions for antigen-antibody binding than those that were reused in the present studies. For example, if low-avidity antibodies in some specimens variably contributed to ELISA results, then adding urea might provide more stringency for antibodies binding to the plate and improve agreement.

(69) The CF antibody assay titers have prognostic importance that was described in the 1950s. It should be noted that those pioneering studies were conducted by a single research laboratory, focused upon CM and before there were any effective therapies for this disease. Currently, CF antibody tests are provided for patient care by several reference laboratories. That antifungal therapy might alter the prognostic relationships noted earlier has recently been raised. The difference in individual sera between the present quantitative ELISA and CF antibody titers provides an opportunity in future studies to determine whether one or the other provide more precise prognostic information to clinicians.

(70) Even if a quantitative ELISA is no more useful than CF antibody test results, it offers several practical advantages. ELISA is less complex than the CF test. ELISA reagents are readily available, and the format is familiar to most clinical laboratories. Also, ELISA is less labor intensive and can be automated. For all of these reasons, the present studies reported herein will provide further incentive for the development of a standardized quantitative ELISA as an alternative to the CF antibody assay.

(71) The present invention describes isolated peptides of Cts1 that retain affinity for CF antibodies. These results help provide the basis for a reference enzyme-linked immunoassay to mimic quantitative results currently produced by the originally described CF antibody detection assay. FIG. 6 demonstrates that absorbance resulting from enzyme conjugate detection of antibodies is proportional to the CF titers. Therefore, measurement of absorbance of several different dilutions of a patient serum or other bodily fluid will result in absorbance curves that are proportional to the amount of CF antibody activity in the specimen. Using specimens of known CF antibody titers, a final protocol could determine the absorbance threshold at which the CF titer would correspond to a specific specimen dilution.

(72) Various modifications of the invention, in addition to those described herein, will be apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims. Each reference cited in the present application is incorporated herein by reference in its entirety.

(73) As used herein, the term “about” refers to plus or minus 10% of the referenced number.

(74) Although there has been shown and described the preferred embodiment of the present invention, it will be readily apparent to those skilled in the art that modifications may be made thereto which do not exceed the scope of the appended claims. Therefore, the scope of the invention is only to be limited by the following claims. In some embodiments, the figures presented in this patent application are drawn to scale, including the angles, ratios of dimensions, etc. In some embodiments, the figures are representative only and the claims are not limited by the dimensions of the figures. In some embodiments, descriptions of the inventions described herein using the phrase “comprising” includes embodiments that could be described as “consisting essentially of” or “consisting of”, and as such the written description requirement for claiming one or more embodiments of the present invention using the phrase “consisting essentially of” or “consisting of” is met.