Products and Methods for Treatment of Amyotrophic Lateral Sclerosis
20240344071 ยท 2024-10-17
Inventors
Cpc classification
C12N7/00
CHEMISTRY; METALLURGY
C12N2750/14143
CHEMISTRY; METALLURGY
C12N2750/14043
CHEMISTRY; METALLURGY
C12N2320/32
CHEMISTRY; METALLURGY
A61K9/0019
HUMAN NECESSITIES
A61P25/28
HUMAN NECESSITIES
A61K31/7105
HUMAN NECESSITIES
International classification
C12N15/113
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
A61K9/00
HUMAN NECESSITIES
A61K31/7105
HUMAN NECESSITIES
Abstract
The present invention relates to RNA-based methods for inhibiting the expression of the superoxide diamutase 1 (SOD-1) gene. Recombinant adeno-associated viruses of the invention deliver DNAs encoding RNAs that knock down the expression of SOD-1. The methods have application in the treatment of amyotrophic lateral sclerosis.
Claims
1. A recombinant adeno-associated virus comprising the superoxide dismutase 1 (SOD1) shRNA-encoding DNA: TABLE-US-00006 GCATCATCAATTTCGAGCAGAAGGAA, GAAGCATTAAAGGACTGACTGAA, CTGACTGAAGGCCTGCATGGATT, CATGGATTCCATGTTCATGA, GCATGGATTCCATGTTCATGA, GGTCTGGCCTATAAAGTAGTC, GGGCATCATCAATTTCGAGCA, GCATCATCAATTTCGAGCAGA, GCCTGCATGGATTCCATGTTC, GGAGGTCTGGCCTATAAAGTA, GATTCCATGTTCATGAGTTTG, GGAGATAATACAGCAGGCTGT, GCTTTAAAGTACCTGTAGTGA, GCATTAAAGGACTGACTGAAG, GCATCATCAATTTCGAGCAGAAGGAA, GAAGCATTAAAGGACTGACTGAA, CTGACTGAAGGCCTGCATGGATT, CATGGATTCCATGTTCATGA, GCATGGATTCCATGTTCATGA, GGTCTGGCCTATAAAGTAGTC, GGGCATCATCAATTTCGAGCA, GCATCATCAATTTCGAGCAGA, GCCTGCATGGATTCCATGTTC, GGAGGTCTGGCCTATAAAGTA, GATTCCATGTTCATGAGTTTG, GGAGATAATACAGCAGGCTGT, GCTTTAAAGTACCTGTAGTGA, GCATTAAAGGACTGACTGAAG, TCATCAATTTCGAGCAGAA, TCGAGCAGAAGGAAAGTAA, GCCTGCATGGATTCCATGT, TCACTCTCAGGAGACCATT,or GCTTTAAAGTACCTGTAGT, wherein the recombinant adeno-associated virus genome lacks rep and cap genes.
2. A composition comprising the recombinant adeno-associated virus of claim 1.
3. A method of inhibiting expression of mutant SOD1 in a cell comprising contacting the cell with a recombinant adeno-associated virus of claim 1.
4. A method of delivering a SOD1 shRNA-encoding DNA to a subject in need thereof, the method comprising administering to the subject a recombinant adeno-associated virus comprising the SOD1 shRNA-encoding DNA, wherein the recombinant adeno-associated virus genome lacks rep and cap genes; wherein the SOD1 shRNA-encoding DNA is one of the following: TABLE-US-00007 (a)GCATCATCAATTTCGAGCAGAAGGAA, (b)GAAGCATTAAAGGACTGACTGAA, (c)CTGACTGAAGGCCTGCATGGATT,or (d)CATGGATTCCATGTTCATGA.
5-7. (canceled)
8. A method of treating amyotrophic lateral sclerosis (ALS) comprising administering a recombinant adeno-associated virus comprising a SOD1 shRNA-encoding DNA, wherein the recombinant adeno-associated virus genome lacks rep and cap genes; wherein the wherein the SOD1 shRNA-encoding DNA is one of the following: TABLE-US-00008 (a)GCATCATCAATTTCGAGCAGAAGGAA, (b)GAAGCATTAAAGGACTGACTGAA, (c)CTGACTGAAGGCCTGCATGGATT,or (d)CATGGATTCCATGTTCATGA.
9-11. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050] Figures S1A-S1F. AAV9-shRNA-SOD1 administration is well tolerated in WT mice. Female and male WT animals were injected with AAV9-SOD1-shRNA at P1 or P21 and monitored up to 6 months of age. (Figure S1A, Figure S1B) Both male and female treated mice showed steady increase in body mass as compared to control animals. (Figure S1C, Figure S1D) Rotarod performance and (Figure S1E, Figure S1F hind limb grip strength were not affected by P1 or P21 treatment in both groups as compared to respective controls. n=5 per group. WT, wild type; P1, postnatal day 1; P21, postnatal day 21.
[0051] Figures S2A-S2W. Hematology and Serum Chemistry of AAV9-SOD1-shRNA treated WT animals. (Figure S2A, Figure S2B, Figure S2C, Figure S2D, Figure S2E, Figure S2F, Figure S2G, Figure S2H, Figure S2I, Figure S2J, Figure S2K, Figure S2L, Figure S2M) Blood was collected from P1 (green) or P21 (red) treated and control (gray) WT animals at 150 days of age for hematology studies. No significant differences were observed between treated and control animals. (Figure S2N, Figure S2O, Figure S2P, Figure S2Q, Figure S2R, Figure S2S, Figure S2T, Figure S2U, Figure S2V, Figure S2W) Serum samples collected at 180 days of age from the same mice showed no significant differences in serum chemistry profile. Mean?SEM. n=5 per group. P1, postnatal day 1; P21, postnatal day 21.
[0052]
[0053] Figures S4A-S4B. Intravenous injection of AAV9-SOD1-shRNA efficiently reduces levels of mutant SOD1 protein in spinal cords of SOD1.sup.G37R mice. (Figure S4A) Following disease onset, AAV9-CB-GFP or AAV9-SOD1-shRNA was injected in SOD1.sup.G37R mice and spinal cords were harvested at end stage and analyzed by western blot for human SOD1 protein levels. (Figure S4B) Quantification of a) shows suppression of human SOD1 within the spinal cord of SOD1.sup.G37R mice (n=4 per group). hSOD1, human superoxide dismutase 1; GAPDH, glyceraldehyde 3 phosphate dehydrogenase.
[0054] Figures S5A-S5B shRNA 130 efficiently reduces the levels of monkey SOD1 in vitro. (Figure S5A) Sequence alignment of the region targeted by SOD1 shRNA 130 and a single mismatch with the monkey sequence. Monkey sequence corresponds to SOD1 sequence from Rhesus monkey (NM 001032804.1), Cynomolgus monkey (sequenced in-house) and African green monkey. (Figure S5B) The shRNA 130 expression cassette was cloned into lentiviral vector and used to infect Cos-7 cells. Lysates were analyzed 72 hours post infection by qRT PCR for SOD1. shRNA 130 reduced SOD1 transcript levels by 75% in Cos-7 cells.
EXAMPLES
[0055] The present invention is illustrated by the following examples. While the present invention has been described in terms of various embodiments and examples, it is understood that variations and improvements will occur to those skilled in the art. Therefore, only such limitations as appear in the claims should be placed on the invention.
Example 1
AAV9 Transduction Pattern and Persistence in SOD1.SUP.G93A .Mice
[0056] We first evaluated the efficiency of AAV9 transduction in the SOD1.sup.G93A mouse model that develops fatal paralytic disease. High copy SOD1.sup.G93A mice were obtained from Jackson Laboratories (Bar Harbor, ME) and bred within the Kaspar lab. Animals were genotyped before the treatment to obtain SOD1.sup.G93A expressing mice and their wild type littermates. Only female mice were included in the SOD1.sup.G93A experiments. Animals were injected intravenously at postnatal day 1 or day 21 (to be referred to as P1 and P21, respectively) with self-complementary AAV9 expressing GFP from the CMV enhancer/beta-actin (CB) promoter (AAV9-CB-GFP) (n=3 per group). Three weeks post-injection, animals were sacrificed, and spinal cords examined for GFP expression (
[0057] All procedures with animals described herein were performed in accordance with the NIH Guidelines and approved by the Research Institute at Nationwide Children's Hospital (Columbus, OH), University of California (San Diego, CA) or Mannheimer Foundation (Homestead, FL) Institutional Animal Care and Use Committees.
[0058] Transduction efficiency was high in SOD1.sup.G93A astrocytes with GFP expressed in 34?2% and 54?3%, respectively, of P1 and P21 injected spinal grey matter astrocytes (defined by immunoreactivity for GFAP). This efficiency was similar to our previous report of 64?1% in P21 injected wild type animals.sup.18. Motor neurons were a prominent cell type transduced at all levels of the spinal cords of P1 injected SOD1.sup.G93A animals (62?1%), compared with significantly lower targeting to motor neurons in P21 injected animals (8?1%).
[0059] Although we have previously reported that transduced astrocytes in wild type spinal cords persist with continued GFP accumulation for at least 7 weeks post injection.sup.18, longevity of mutant SOD1 astrocytes (and their continued synthesis of genes encoded by the AAV9 episome) during active ALS-like disease was untested. Therefore, SOD1.sup.G93A mice were injected at P1 and P21 with AAV9-CB-GFP and followed to end-stage (?P130, n=3 per group) (
[0060] Further, recognizing that SOD1 mutant mediated damage, including astrocytic and microglial activation and early changes in the blood brain barrier develop during disease in mice in SOD1 mutant mice.sup.20, we tested if this damage affected AAV9 transduction. SOD1.sup.G93A mice were injected at P85 with AAV9-CB-GFP and sacrificed at endstage (n=3) (
Example 2
Development of an shRNA Sequence Specific for Human SOD1
[0061] To specifically target the human SOD1 mRNA, four shRNA constructs targeting human SOD1 were generated and obtained from the Life Technologies design tool. The constructs that had a minimum of four base mismatches compared to the mouse mRNA sequence (
[0062] shRNA130 was selected for further experiments because it produced the most consistent knockdown across three separate transfection experiments. It was cloned into a self-complementary AAV9 vector that also contained a GFP gene whose expression would identify transduced cells (referred to as AAV9-SOD1-shRNA). Self-complementary AAV9-SOD1-shRNA was produced by transient transfection procedures using a double-stranded AAV2-ITR-based CB-GFP vector, with a plasmid encoding Rep2Cap9 sequence as previously described along with an adenoviral helper plasmid pHelper (Stratagene, Santa Clara, CA) in 293 cells.sup.18.
[0063] To confirm that the shRNA could suppress accumulation of human SOD1, SOD1.sup.G93A mice (n=3) were injected intravenously with AAV9-SOD1-shRNA at either P1 or P21. For neonatal mouse injections, postnatal day 1-2 SOD1.sup.G93A pups were utilized. Total volume of 50 ?l containing 5?10.sup.11 DNAse resistant viral particles of AAV9-SOD1-shRNA (Virapur LLC, San Diego, CA) was injected via temporal vein as previously described.sup.18. A correct injection was verified by noting blanching of the vein. After the injection, pups were returned to their cage. Animals were euthanized three weeks post injection and the spinal cords were harvested and analyzed by immunoblotting for both human (mutant) and murine (wild-type) SOD1 protein. P1 and P21 injected spinal cords showed 60% and 45% reductions in mutant SOD1 protein, respectively (
Example 3
AAV9-SOD1-shRNA is Safe and Well Tolerated in Wild Type Mice
[0064] To determine whether high dose AAV9-SOD1-shRNA would be safe, normal mice of both sexes were intravenously injected at P1 or P21 (P1=5 males, 5 females at 5?10.sup.11vg; P21=5 males, 5 females at 2?10.sup.12 vector genomes (vg)) and then monitored up to 6 months of age. Both P1 and P21 injected mice showed a steady increase in body mass similar to untreated mice (Figures S1A-S1F). Weekly behavioral tests observed no significant differences between injected and control groups in motor skills (measured by rotarod) as well as in hind limb grip strength. At 150 and 180 days of age, blood samples were collected. Complete and differential blood counts of both treated and untreated groups showed similar blood chemistry parameters (Figure S2). Serum samples from both groups showed no significant differences in the levels of alkaline phosphatase, creatinine, blood urea nitrogen, potassium, sodium and chloride. Finally, all the animals were sacrificed at the age of 180 days. Histopathological analyses by a pathologist blinded to treatment group revealed no significant alterations in the AAV9-SOD1-shRNA treated animals compared to uninjected controls (data not shown). We conclude that both administration of AAV9 and sustained shRNA expression were apparently safe and well tolerated.
Example 4
Extended Survival of SOD1.SUP.G93A .Mice from AAV9 Mediated Reduction in Mutant SOD1 Even when Initiated Mid-Disease
[0065] To test the efficacy of AAV9-mediated SOD1 reduction, we treated cohorts of SOD1.sup.G93A mice with a single intravenous injection of AAV9-SOD1-shRNA before (P1, 5?10.sup.11vg, n=6 and P21, 2?10.sup.12vg, n=9) or after (P85, 3?10.sup.12vg, n=5) onset, recognizing that many astrocytes, but few motor neurons, would be transduced at the two later time points. For adult tail vein injections, animals were placed in a restraint that positioned the mouse tail in a lighted, heated groove. The tail was swabbed with alcohol then injected intravenously with AAV9-SOD1-shRNA.
[0066] Onset of disease (measured by weight loss from denervation-induced muscle atrophy) was significantly delayed by a median of 39.5 days (
Example 5
Reduction of Mutant SOD1 in AAV9 Infected Cells in Treated SOD1.SUP.G93A .Mice
[0067] Indirect immunofluorescence with an antibody that recognizes human, but not mouse SOD1, was used to determine accumulated mutant SOD1 levels in end-stage spinal cords of treated and control mice. Human SOD1 levels in end-stage spinal cord sections inversely correlated with increased survival (
Example 6
Therapeutic Slowing of Disease Progression with Peripheral Injection of AAV9 after Onset
[0068] To determine if AAV9-mediated mutant SOD1 reduction would slow disease progression, a cohort of SOD1.sup.G37R mice.sup.6 were injected intravenously with AAV9-SOD1-shRNA after disease onset (average age at treatment=215d versus median onset of 197d in treated animals; Log Rank Test p=0.46;
[0069] Post hoc analysis showed no differences between GFP and uninjected animals, therefore the groups were compiled as control in
[0070] Histological examination of end-stage SOD1.sup.G37R treated animals revealed similar levels of intraspinal cell transduction in animals treated with AAV9-SOD1-shRNA or AAV9-GFP (
Example 7
AAV9 Mediated Suppression of SOD1 in Non-Human Primates
[0071] To test whether SOD1 levels could be efficiently lowered using AAV9 in the non-human primate spinal cord, AAV9 was injected intrathecally via lumbar puncture. This method was chosen over systemic delivery to decrease the amount of virus required and to minimize any effects from reduction of SOD1 in peripheral tissues. One year old cynomolgus macaques (Macaca fascicularis) with average body weight of 2 kg were used for this study at the Mannheimer Foundation. Regular monitoring of overall health and body weight was performed prior and after the injections to assess the welfare of the animals.
[0072] Sequencing of cDNA copied from mRNA isolated from African Green Monkey (COS cells) and the Cynomolgus macaque verified that the 130 shRNA had a single base mismatch to either sequence (Figure S5A-S5B). The 130 shRNA expression cassette was inserted into a lentiviral vector which was then used to transduce COS cells. Cos-7 cells were maintained in DMEM with 10% FBS and 1% penicillin/streptomycin. Cells were infected with a lentiviral vector expressing SOD1 shRNA 130 under the H1 promoter and RFP under CMV promoter. RNA was extracted from infected and non-infected cells 72 hours post infection using an RNeasy Kit (Qiagen). cDNA was prepared using RT.sup.2 First strand synthesis kit (SABiosciences). SOD1 transcript levels were analyzed by qRT-PCR which revealed that the monkey SOD1 mRNA was reduced by ?75% in 130 shRNA transduced cells compared to mock transduced control cells (Figure S5A-S5B).
[0073] The AAV9-SOD1-shRNA virus (1?10.sup.13 vg/kg) was infused along with contrast agent via lumbar puncture into the subarachnoid space of three male cynomolgus macaques and one control subject was injected with AAV9-CB-GFP (1?10.sup.13 vg/kg) (
[0074] No side effects from the treatments were identified. Two weeks post injection, the spinal cords were harvested for analysis of GFP expression and SOD1 RNA levels. GFP expression was seen broadly in neuronal and astrocytic cells throughout the grey and white matter of the lumbar spinal cord, the area closest to the site of injection (
[0075] Next we examined the level of cell transduction throughout the spinal cord including cervical, thoracic and lumbar segments. GFP was found to be expressed broadly within all sections analyzed (
Discussion
[0076] The examples above show that intravenous administration of AAV9-SOD1-shRNA is safe and well tolerated in wild type mice, with the absence of adverse effects after long-term assessment. This approach have achieved one of the longest extensions in survival ever reported in the rapidly progressive SOD1.sup.G93A mouse model of ALS (increasing survival by 39% when treatment is initiated at birth). Even more encouraging, markedly slowed disease progression is seen even when AAV9 therapy to reduce mutant SOD1 synthesis is applied after disease onset in SOD1.sup.G37R mice, thereby significantly extending survival. Thus, the vascular delivery paradigm in mice represents a proof of concept that mutant SOD1 knockdown after disease onset can be beneficial in both rapid and more slowly progressive models of ALS at clinically relevant points in disease. Together, these data show that robust targeting and suppression of SOD1 levels via AAV9-mediated delivery of shRNA is effective in slowing disease progression in mouse models of ALS, critically even when treatment is initiated after onset.
[0077] Multiple recent studies have brought forward the hypothesis that wild-type SOD1 may contribute through misfolding to the pathogenic mechanism(s) that underlie sporadic ALS through a pathway similar to that triggered by mutant SOD1.sup.14, 30-32. Included in this body of evidence is our own demonstration that astrocytes produced from sporadic ALS patients are toxic to co-cultured motor neurons and that toxicity is alleviated by siRNA-mediated reduction in wild type SOD1.sup.30. This evidence creates the potential that a proportion of sporadic ALS patients could also benefit from an AAV9-mediated SOD1 reduction approach that we have demonstrated to be effective in slowing disease progression in mice that develop fatal, ALS-like disease from expressing ALS-causing mutations in SOD1.
[0078] Finally, for translation of an AAV9-mediated suppression of SOD1 synthesis to the human setting, we have determined that infusion directly into the CSF at the lumbar level in a non-human primate produce substantial SOD1 reduction by targeting both motor neurons and non-neuronal cells. This outcome provides strong support for extending these efforts to an adult human by direct injection into CSF, as previously proposed.sup.33, 34, so as to 1) limit the cost of viral production, 2) reduce the possibility that chronic suppression of SOD1 in the periphery may have deleterious consequences, and 3) reduce viral exposure to the peripheral immune system.sup.33. These data strongly indicate AAV9-SOD1-shRNA as a treatment for ALS.
Techniques/Methods Used in Examples 1-7
[0079] Perfusion and Tissue Processing. Control and treated SOD1.sup.G93A mice were sacrificed at either 21 days post injection or at endstage for immunohistochemical analysis. Animals were anesthetized with xylazene/ketamine cocktail, transcardially perfused with 0.9% saline, followed by 4% paraformaldehyde. Spinal cords were harvested, cut into blocks of tissue 5-6 mm in length, and then cut into 40 ?m thick transverse sections on a vibratome (Leica, Bannockburn, IL). Serial sections were kept in a 96-well plate that contained 4% paraformaldehyde and were stored at 4? C. End stage loxSOD1.sup.G37R mice were anesthetized using isoflurane and perfused with 4% paraformaldehyde. Spinal cord segments, including cervical, thoracic and lumbar segments were dissected. Following cryoprotection with 20% sucrose/4% paraformaldehyde overnight, spinal cords were frozen in isopentane at ?65? C., and serial 30 ?m coronal sections were collected free floating using sliding microtome.
[0080] For safety studies, P1, P21 treated and control wild type mice were sacrificed at 180 days of age. Animals were anesthetized using xylazene/ketamine cocktail and perfused with 0.9% saline. Different tissues were removed and stored in 10% buffered formalin. These tissues were further processed, blocked and mounted for hematoxilin & cosin staining by the Nationwide Children's Hospital Morphology Core.
[0081] Cynomolgus monkeys injected with virus were euthanized 2 weeks post injection. Animals were anesthetized with sodium pentobarbital at the dose of 80-100 mg/kg intravenously and perfused with saline solution. Brain and spinal cord dissection were performed immediately and tissues were processed either for nucleic acid isolation (snap frozen) or post-fixed in 4% paraformaldehyde and subsequently cryoprotected with 30% sucrose and frozen in isopentane at ?65? C. 12 ?m coronal sections were collected from lumbar cord using a cryostat for free floating immunostaining.
[0082] Immunohistochemistry. Mouse spinal cords were stained as floating sections. Tissues were washed three-times for 10 minutes each in TBS, then blocked in a solution containing 10% donkey serum, 1% Triton X-100 and 1% penicillin/streptomycin for two hours at room temperature. All the antibodies were diluted with the blocking solution. Primary antibodies used were as follows: rabbit anti-GFP (1:400, Invitrogen, Carlsbad, CA), rabbit anti-SOD1 (1:200, Cell signaling, Danvers, MA), goat anti-ChAT (1:50 Millipore, Billerica, MA), mouse anti-GFAP (1:200, Millipore, Billerica, MA), chicken anti GFAP (1:400, Abcam, Cambridge, MA), and rabbit anti-Iba1 (1:400, Wako, Richmond VA). Tissues were incubated in primary antibody at 4? C. for 48-72 hours then washed three times with TBS. After washing, tissues were incubated for 2 hours at room temperature in the appropriate FITC-, Cy3-, or Cy5-conjugated secondary antibodies (1:200 Jackson Immunoresearch, Westgrove, PA) and DAP1 (1:1000, Invitrogen, Carlsbad, CA). Tissues were then washed three times with TBS, mounted onto slides then coverslipped with PVA-DABCO. All images were captured on a Zeiss-laser-scanning confocal microscope.
[0083] For DAB staining, monkey spinal cord sections were washed three times in TBS, blocked for 2 h at RT in 10% donkey serum and 1% Triton X-100. Sections were then incubated overnight at 4? C. with rabbit anti-GFP primary antibody (1:1000 Invitrogen, Carlsbad, CA) diluted in blocking buffer. The following day, tissues were washed with TBS 3 times, incubated with biotinylated secondary antibody anti-rabbit (1:200 Jackson Immunoresearch, Westgrove, PA) in blocking buffer for 30 min at RT, washed 3 times in TBS and incubated for 30 min at RT with ABC (Vector, Burlingame, CA). Sections were then washed for 3 times in TBS and incubated for 2 min with DAB solution at RT and washed with distilled water. These were then mounted onto slides and covered with coverslips in mounting medium. All images were captured with the Zeiss Axioscope.
[0084] Motor neuron and astrocyte quantification. For MN quantification, serial 40 ?m thick lumbar spinal cord sections, each separated by 480 ?m, were labeled as described for GFP and ChAT expression. Stained sections were serially mounted on slides from rostral to caudal, then coverslipped. Sections were evaluated using confocal microscopy (Zeiss) with a 40? objective and simultaneous FITC and Cy3 filters. The total number of ChAT positive cells found in the ventral horns with defined soma was tallied by careful examination through the entire z-extent of the section. GFP labeled cells were quantified in the same manner, while checking for co-localization with ChAT. For astrocyte quantification, as with MNs, serial sections were stained for GFP, GFAP and then mounted. Using confocal microscopy with a 63? objective and simultaneous FITC and Cy5 filters, random fields in the ventral horns of lumbar spinal cord sections from tail vein injected animals were selected. The total numbers of GFP and GFAP positive cells were counted from a minimum of at least 24-fields per animal while focusing through the entire z extent of the section. Spinal cord sections of 3 animals per group were examined for MN and astrocyte quantification.
[0085] Immunoblot analysis. Spinal cords were harvested from P1, P21 injected and control SOD1.sup.G93A mice 21 days post injection and from treated and control monkeys 2 weeks post injection of AAV9-SOD1-shRNA. Spinal cords were homogenized and protein lysates were prepared using T-Per (Pierce) with protease inhibitor cocktail. Samples were resolved on SDS-PAGE according to manufacturer's instructions. Primary antibodies used were rabbit anti-SOD1 (1:750, Cell signaling, Danvers, MA) mouse anti-SOD1 (1:750, Millipore, Billerica, MA), rabbit anti-SOD1 (1:1000, Abcam, Cambridge, MA), rabbit anti-Actin (1:1000, Abcam, Cambridge, MA) and mouse anti-GAPDH (1:1000, Millipore, Billerica, MA). Secondary antibodies used were anti-rabbit HRP (1:10000-1:50000) and anti-mouse HRP (1:10000). Densitometric analysis was performed using Image J software.
[0086] Laser Capture Microdissection. 12 m lumbar spinal cord frozen sections were collected onto PEN membrane slides (Zeiss, Munich, Germany) and stained with 1% Cresyl violet (Sigma, St. Louis, MO) in methanol. Sections were air dried and stored at ?80? C. After thawing, motor neurons were collected within 30 min from staining using the laser capture microdissector PALM Robo3 Zeiss) using the following settings: Cut energy: 48, LPC energy: 20, Cut focus: 80/81, LPC focus: 1, Position speed: 100, Cut speed: 50. About 500 MNs were collected per animal. Non-neuronal cells from the ventral horn were collected from the same sections after collecting the motor neurons.
[0087] qRT-PCR. RNA from laser captured cells or whole spinal cord sections from the cervical, thoracic and lumbar segments was isolated using the RNaqueous Micro Kit (Ambion, Grand Island, NY) according to manufacturer's instructions. RNA was then reverse-transcribed into cDNA using the RT.sup.2 HT First Strand Kit (SABiosciences, Valencia, CA). 12.5 ng RNA were used in each Q-PCR reaction using SyBR Green (Invitrogen, Carlsbad, CA) to establish the relative quantity of endogenous monkey SOD1 transcript in animals who had received the AAV9-SOD1-shRNA compared to animals who had received only AAV9-GFP. Each sample was run in triplicate and relative concentration calculated using the ddCt values normalized to endogenous actin transcript.
[0088] Behavior and Survival Analysis. Treated and control SOD1.sup.G93A mice were monitored for changes in body mass twice a week. loxSOD1.sup.G37R mice were weighed on a weekly basis. Motor coordination was recorded using a rotarod instrument (Columbus Instruments, Columbus, OH). Each weekly session consisted of three trials on the accelerating rotarod beginning at 5 rpm/min. The time each mouse remained on the rod was registered. Both SOD1.sup.G93A and loxSOD1.sup.G37R mice were subjected to weekly assessment of hindlimb grip strength using a grip strength meter (Columbus Instruments, Columbus, OH). Each weekly session consisted of 3 (SOD1.sup.G93A mice) or 5 (loxSOD1.sup.G37R mice) tests per animal. Survival analysis was performed using Kaplan-Meier survival analysis. End stage was defined as an artificial death point when animals could no longer right themselves within 30 sec after being placed on its back. Onset and disease progression were determined from retrospective analysis of the data. Disease onset is defined as the age at which the animal reached its peak weight. Disease duration is defined as the time period between disease onset and end stage. Early disease duration is the period between peak weight and loss of 10% of body weight while late disease duration is defined as the period between 10% loss of body weight until disease end stage. Due to shorter life span of SOD1.sup.G93A animals, we did not assess the distinction between the early and late progression.
[0089] For toxicity analysis following injection at P1 or P21, treated and control WT mice were subjected to behavioral analysis starting at ?30 days of age and monitored up to 6 months. Body mass was recorded weekly while rotarod performance and hindlimb grip strength were recorded biweekly.
[0090] Hematology and Serum Studies. Blood samples were collected in (K2) EDTA microtainer tubes (BD) from treated and control WT mice at 150 days of age by mandibular vein puncture. The same animals were bled at 180 days of age and blood was collected in serum separator microtainer tubes. The blood was allowed to clot for an hour and was then centrifuged at 10,000 rpm for 5 minutes. The clear upper phase (serum) was collected and frozen at ?80? C. Hematological and serum analysis were conducted by Ani Lytics Inc, Gaithersburg, MD.
[0091] Statistical analysis. All statistical tests were performed using the GraphPad Prism (San Diego, CA) software package. Kaplan Meier survival analyses were analyzed by the Log Rank Test. Comparisons of median disease durations and survival times were analyzed by the Wilcoxon Signed Rank Test.
Example 8
Development of a Clinical SOD1 shRNA Construct
[0092] The AAV SOD1 shRNA vector described in Example 2 carries shRNA against human SOD1 sequence under the H1 promoter (
[0093] To date, none of the FDA approved stuffer sequences are readily available. There are, however, several plasmid backbones that are approved by FDA for the human administration. Small DNA fragments were picked from these plasmids which do not correspond to any essential DNA sequences necessary for selection and replication of the plasmid or the elements of the transcriptional units. The plasmid backbones are listed in Table 1. The DNA elements from different plasmids were arranged in tandem to generate a complete, 1607 bp stuffer sequence (SEQ ID NO: 22). Finally, a DNA construct containing the SOD1 shRNA expression cassette, followed by the stuffer sequence was synthesized from Genscript.
TABLE-US-00005 TABLE 1 Plasmid ClinicalTrials.gov Backbone Condition Intervention Phase Identifier pVax1 Early Stage Non- Recombinant DNA- 1 NCT00062907 Small Cell pVAX/L523S Lung Cancer pCDNA3 Chronic Hepatitis B DNA vaccine 1, 2 NCT00536627 pCMVS2.S pUCMV3 Stage III Ovarian pUMVC3-hIGFBP-2 1 NCT01322802 Epithelial Cancer multi-epitope plasmid Stage III Ovarian DNA vaccine Germ Cell Tumor Stage IV Ovarian Epithelial Cancer Stage IV Ovarian Germ Cell Tumor pBK- Prostate Cancer NY-ESO-1 plasmid 1 NCT00199849 CMV Bladder Cancer DNA Cancer Vaccine Non-Small Cell Lung Cancer Esophageal Cancer Sarcoma pGA2 HIV Infections pGA2/JS2 Plasmid 1 NCT00043511 DNA Vaccine
[0094] Clinical SOD1 shRNA construct has shRNA against human SOD1 under H1 promoter which is followed by the non-coding stuffer sequence. This construct is designed in such a way that multiple shRNA expression cassettes can be added to the final vector by simultaneous removal of the stuffer sequence. Restriction endonuclease sites have been added to the stuffer sequence so that a part of the stuffer can be removed when another shRNA expression cassette is added (
[0095] Clinical SOD1 shRNA construct from Genscript was cloned into pJet1.2 shuttle vector via EcoRV. This parental clone was screened using various restriction endonucleases designed within the construct to confirm the correct clone. Kpn1/Sph1 double digestion of pJet SOD1 shRNA confirmed the presence of the complete construct (2023 bp) while Xba1 digestion confirmed the presence of SOD1 shRNA expression cassette (414 bp) and the stuffer element, along with pJet backbone (?3000 bp). EcoRV/Pme1 double digestion also revealed the presence of stuffer element.
Example 9
Clinical SOD1 shRNA Efficiently Reduces Human SOD1 Protein Levels In Vitro
[0096] To determine the efficacy of the de novo synthesized SOD1 shRNA construct to downregulate SOD1 levels, HEK293 cells were transfected with pJet SOD1 shRNA plasmid using Calcium Phosphate method. AAV SOD1 shRNA plasmid was used as a positive control. Immunofluorescence analysis of HEK293 cells, 72 hrs post transfection revealed the lack of native GFP fluorescence from pJet SOD1 shRNA transfected cells as compared to AAV9 SOD1 shRNA transfected cells. Immunoblot analysis of cell lysates from these cells further confirmed the successful replacement of GFP from pJet SOD1 shRNA plasmid. Importantly, pJet SOD1 shRNA resulted in efficient downregulation of SOD1 protein levels (>50%), similar to AAV SOD1 shRNA plasmid. See
Example 10
Generation of Clinical AAV SOD1 shRNA
[0097] Clinical SOD1 shRNA construct was further cloned into an AAV.CB.MCS vector using Kpn1/Sph1 sites to generate clinical AAV SOD1 shRNA plasmid (
[0098] Clinical AAV SOD1 shRNA plasmid was screened with restriction endonucleases to confirm the presence of SOD1 shRNA expression cassette (Xba1 digest), stuffer sequence (EcoRV/Pme1 double digest) and also intact ITR sequences (Sma1 digest).
Example 11
Clinical AAV SOD1 shRNA Efficiently Reduces Human SOD1 Protein Levels In Vitro
[0099] Clinical AAV SOD1 shRNA plasmid was transfected in HEK293 cells to determine its knockdown efficiency. Similar to the pJet SOD1 shRNA plasmid, clinical AAV SOD1 shRNA transfected cells were devoid of any GFP expression as evident by immunofluorescence (
DOCUMENTS REFERENCED
[0100] 1. Da Cruz, S. & Cleveland, D. W. Understanding the role of TDP-43 and FUS/TLS in ALS and beyond. Curr Opin Neurobiol 21, 904-919 (2011). [0101] 2. Rosen, D. R. et al. Mutations in Cu/Zn superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis. Nature 362, 59-62 (1993). [0102] 3. Ilieva, H., Polymenidou, M. & Cleveland, D. W. Non-cell autonomous toxicity in neurodegenerative disorders: ALS and beyond. The Journal of cell biology 187, 761-772 (2009). [0103] 4. Chattopadhyay, M. & Valentine, J. S. Aggregation of copper-zinc superoxide dismutase in familial and sporadic ALS. Antioxidants & redox signaling 11, 1603-1614 (2009). [0104] 5. Prudencio, M., Hart, P. J., Borchelt, D. R. & Andersen, P. M. Variation in aggregation propensities among ALS-associated variants of SOD1: correlation to human disease. Human molecular genetics 18, 3217-3226 (2009). [0105] 6. Boillee, S. et al. Onset and progression in inherited ALS determined by motor neurons and microglia. Science 312, 1389-1392 (2006). [0106] 7. Kang, S. H. et al. Degeneration and impaired regeneration of gray matter oligodendrocytes in amyotrophic lateral sclerosis. Nature neuroscience 16, 571-579 (2013). [0107] 8. Yamanaka, K. et al. Astrocytes as determinants of disease progression in inherited amyotrophic lateral sclerosis. Nature neuroscience 11, 251-253 (2008). [0108] 9. Di Giorgio, F. P., Boulting, G. L., Bobrowicz, S. & Eggan, K. C. Human embryonic stem cell-derived motor neurons are sensitive to the toxic effect of glial cells carrying an ALS-causing mutation. Cell Stem Cell 3, 637-648 (2008). [0109] 10. Di Giorgio, F. P., Carrasco, M. A., Siao, M. C., Maniatis, T. & Eggan, K. Non-cell autonomous effect of glia on motor neurons in an embryonic stem cell-based ALS model. Nature neuroscience 10, 608-614 (2007). [0110] 11. Marchetto, M. C. et al. Non-cell-autonomous effect of human SOD1 G37R astrocytes on motor neurons derived from human embryonic stem cells. Cell Stem Cell 3, 649-657 (2008). [0111] 12. Haidet-Phillips, A. M. et al. Astrocytes from familial and sporadic ALS patients are toxic to motor neurons. Nat Biotechnol 29, 824-828 (2011). [0112] 13. Bosco, D. A. et al. Wild-type and mutant SOD1 share an aberrant conformation and a common pathogenic pathway in ALS. Nature neuroscience 13, 1396-1403 (2010). [0113] 14. Pokrishevsky, E. et al. Aberrant localization of FUS and TDP43 is associated with misfolding of SOD1 in amyotrophic lateral sclerosis. PloS one 7, e35050 (2012). [0114] 15. Forsberg, K. et al. Novel antibodies reveal inclusions containing non-native SOD1 in sporadic ALS patients. PLOS One 5, e11552 (2010). [0115] 16. Aggarwal, S. & Cudkowicz, M. ALS drug development: reflections from the past and a way forward. Neurotherapeutics: the journal of the American Society for Experimental NeuroTherapeutics 5, 516-527 (2008). [0116] 17. Gurney, M. E. et al. Benefit of vitamin E, riluzole, and gabapentin in a transgenic model of familial amyotrophic lateral sclerosis. Ann Neurol 39, 147-157 (1996). [0117] 18. Foust, K. D. et al. Intravascular AAV9 preferentially targets neonatal neurons and adult astrocytes. Nature biotechnology 27, 59-65 (2009). [0118] 19. Duque, S. et al. Intravenous administration of self-complementary AAV9 enables transgene delivery to adult motor neurons. Mol Ther 17, 1187-1196 (2009). [0119] 20. Zhong, Z. et al. ALS-causing SOD1 mutants generate vascular changes prior to motor neuron degeneration. Nature neuroscience 11, 420-422 (2008). [0120] 21. Miller, R. G., Mitchell, J. D. & Moore, D. H. Riluzole for amyotrophic lateral sclerosis (ALS)/motor neuron disease (MND). Cochrane Database Syst Rev 3, CD001447 (2012). [0121] 22. Smith, R. A. et al. Antisense oligonucleotide therapy for neurodegenerative disease. The Journal of clinical investigation 116, 2290-2296 (2006). [0122] 23. Raoul, C. et al. Lentiviral-mediated silencing of SOD1 through RNA interference retards disease onset and progression in a mouse model of ALS. Nat Med 11, 423-428 (2005). [0123] 24. Ralph, G. S. et al. Silencing mutant SOD1 using RNAi protects against neurodegeneration and extends survival in an ALS model. Nat Med 11, 429-433 (2005). [0124] 25. Miller, T. M. et al. Virus-delivered small RNA silencing sustains strength in amyotrophic lateral sclerosis. Annals of neurology 57, 773-776 (2005). [0125] 26. Miller, T. M. et al. An antisense oligonucleotide against SOD1 delivered intrathecally for patients with SOD1 familial amyotrophic lateral sclerosis: a phase 1, randomised, first-in-man study. Lancet neurology 12, 435-442 (2013). [0126] 27. Towne, C., Raoul, C., Schneider, B. L. & Aebischer, P. Systemic AAV6 delivery mediating RNA interference against SOD1: neuromuscular transduction does not alter disease progression in fALS mice. Mol Ther 16, 1018-1025 (2008). [0127] 28. Towne, C., Setola, V., Schneider, B. L. & Aebischer, P. Neuroprotection by gene therapy targeting mutant SOD1 in individual pools of motor neurons does not translate into therapeutic benefit in fALS mice. Mol Ther 19, 274-283 (2011). [0128] 29. Mandel, R. J., Lowenstein, P. R. & Byrne, B. J. AAV6-mediated gene silencing fALS short. Mol Ther 19, 231-233 (2011). [0129] 30. Synofzik, M. et al. Mutant superoxide dismutase-1 indistinguishable from wild-type causes ALS. Human molecular genetics 21, 3568-3574 (2012). [0130] 31. Guareschi, S. et al. An over-oxidized form of superoxide dismutase found in sporadic amyotrophic lateral sclerosis with bulbar onset shares a toxic mechanism with mutant SOD1. Proc Natl Acad Sci USA 109, 5074-5079 (2012). [0131] 32. Haidet-Phillips, A. M. et al. Astrocytes from familial and sporadic ALS patients are toxic to motor neurons. Nat Biotechnol 29, 824-828 (2011). [0132] 33. Bevan, A. K. et al. Systemic gene delivery in large species for targeting spinal cord, brain, and peripheral tissues for pediatric disorders. Mol Ther 19, 1971-1980 (2011). [0133] 34. Gray, S. J. et al. Preclinical differences of intravascular AAV9 delivery to neurons and glia: a comparative study of adult mice and nonhuman primates. Mol Ther 19, 1058-1069 (2011). [0134] 35. Lioy, D. T. et al. A role for glia in the progression of Rett's syndrome. Nature 475, 497-500 (2011). [0135] 36. Miranda, C. J. et al. Aging brain microenvironment decreases hippocampal neurogenesis through Wnt-mediated survivin signaling. Aging Cell 11, 542-552 (2012). [0136] 37. Yamanaka, K. et al. Mutant SOD1 in cell types other than motor neurons and oligodendrocytes accelerates onset of disease in ALS mice. Proc Natl Acad Sci USA 105, 7594-7599 (2008).
[0137] All documents referred to in this application, including priority documents, are hereby incorporated by reference in their entirety with particular attention to the content for which they are referred.