Male sterility maintainer line plant and use thereof

12127521 ยท 2024-10-29

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided area male sterility maintainer line plant, a method for producing the male sterility maintainer line plant, and use of said plant for propagating a male sterility line plant and the male sterility maintainer line plant. In addition, a nucleic acid molecule, a vector, and a host cell for producing the male sterility maintainer line plant are provided.

Claims

1. An isolated nucleic acid molecule, which comprises a first polynucleotide, a second polynucleotide and a third polynucleotide; wherein the first polynucleotide comprises a nucleotide sequence of a male fertility restoring gene of a plant that has male sterility caused by a male sterility gene; wherein the male sterility gene is a recessive male sterility gene, which causes plant male sterility in a homozygous state; wherein the restoring gene is ms45 and has the nucleotide sequence of SEQ ID NO: 1; wherein the second polynucleotide comprises: (a) a first screening gene that regulates a seed external trait, and (b) a second screening gene that regulates a plant external trait; wherein, (i) the first screening gene is Lc gene, and the second screening gene is Wi2 gene; or (ii) the first screening gene is interfering RNA of CWI-2 gene, and the second screening gene is Le gene; or (iii) the first screening gene is interfering RNA of CWI-2 gene, and the second screening gene is Oy1 gene; wherein the Lc gene has the nucleotide sequence of SEQ ID NO: 4, the Oy1 gene has the nucleotide sequence of SEQ ID NO: 6, the Wi2 gene has the nucleotide sequence of SEQ ID NO: 8, and the nucleotides encoding the interfering RNA of CWI-2 gene has the nucleotide sequence of SEQ ID NO: 18; and wherein the third polynucleotide comprises a nucleotide sequence of a heterologous selective marker gene.

2. The isolated nucleic acid molecule according to claim 1, wherein the second polynucleotide further comprises: an expression regulatory element operably linked to the first or second screening gene.

3. The isolated nucleic acid molecule according to claim 2, wherein: (i) the Lc gene encodes a protein with the amino acid sequence of SEQ ID NO: 5; (ii) the Oy1 gene encodes a protein with the amino acid sequence of SEQ ID NO: 7; (iii) the Wi2 gene encodes a protein with the amino acid sequence of SEQ ID NO: 9; and wherein the expression regulatory element is a promoter selected from the group consisting of: constitutive promoter, inducible promoter, tissue-preferred promoter, tissue-specific promoter, and growth-phase-preferred promoter.

4. The isolated nucleic acid molecule according to claim 1, wherein: (i) the male sterility gene is ms45; (ii) the restoring gene encodes a protein with the amino acid sequence of SEQ ID NO: 2; (iii) the first polynucleotide further comprises: an expression regulatory element operably linked to the restoring gene; (iv) the first polynucleotide sequence comprises SEQ ID NO: 3; (v) the first polynucleotide and the second polynucleotide are covalently ligated between each other with or without a nucleotide linker; (vi) the first polynucleotide and the second polynucleotide are genetically linked.

5. The isolated nucleic acid molecule according to claim 1, wherein: (i) the selective marker gene is an antibiotic resistance gene or a herbicide resistance gene; (ii) the selective marker gene is a bialaphos resistance gene; (iii) the selective marker gene is a bar gene; or (iv) the selective marker gene has the nucleotide sequence of SEQ ID NO: 10; and (v) the nucleotide linker has a length of not more than 10 kb, not more than 5 kb, not more than 1 kb, not more than 500 bp, not more than 100 bp, not more than 50 bp, not more than 10 bp, or not more than 5 bp.

6. A vector comprising the isolated nucleic acid molecule according to claim 1.

7. A host cell comprising the isolated nucleic acid molecule according to claim 1 or a vector comprising the isolated nucleic acid molecule; optionally, the host cell is an Agrobacterium cell or a maize cell.

8. A maize plant or maize seed, wherein the maize plant or maize seed contains in its genome the nucleic acid molecule according to claim 1 and optionally, the male sterility gene.

9. The maize plant or maize seed according to claim 8, wherein the maize plant or maize seed has one or more of the following characteristics: (i) the maize or maize seed further contains the male sterility gene in a homozygous state; (ii) the isolated nucleic acid molecule is integrated in the genome of the maize plant or maize seed; (iii) the isolated nucleic acid molecule is integrated in the genome of the maize or maize seed, and is located on a chromosome different from that of the male sterility gene; (iv) the isolated nucleic acid molecule is present in the genome of the maize plant or maize seed in a heterozygous form; and (v) the maize plant or maize seed is male fertile.

10. A method for obtaining a maize plant, the method comprising: (a) introducing a nucleic acid molecule or a vector comprising the nucleic acid molecule into a maize cell, and (b) cultivating the maize cell into a maize plant; optionally, the maize cell contains the male sterility gene in its genome; wherein the nucleic acid molecule comprises a first polynucleotide and a second polynucleotide, wherein the first polynucleotide comprises a nucleotide sequence of a male fertility restoring gene of a plant that has male sterility caused by a male sterility gene; wherein the male sterility gene is a recessive male sterility gene, which causes plant male sterility in a homozygous state; wherein the male fertility restoring gene is ms45 and has the nucleotide sequence of SEQ ID NO: 1; wherein the second polynucleotide comprises: (a) a first screening gene that regulates a seed external trait, and (b) a second screening gene that regulates a plant external trait; wherein, (i) the first screening gene is Lc gene, and the second screening gene is Wi2 gene; or (ii) the first screening gene is interfering RNA of CWI-2 gene, and the second screening gene is Le gene; or (iii) the first screening gene is interfering RNA of CWI-2 gene, and the second screening gene is Oy1 gene; wherein the Lc gene has the nucleotide sequence of SEQ ID NO: 4, the Oy1 gene has the nucleotide sequence of SEQ ID NO: 6, the Wi2 gene has the nucleotide sequence of SEQ ID NO: 8, and the nucleotides encoding the interfering RNA of CWI-2 gene has the nucleotide sequence of SEQ ID NO: 18.

11. The method according to claim 10, wherein: (i) nucleic acid molecule or the vector comprising the nucleic acid is introduced into the maize cell by an Agrobacterium (ii) the maize cell contains the male sterility gene in a homozygous state in its genome, and is male sterile before introducing the nucleic acid molecule or the vector; (iii) the nucleic acid molecule is integrated into the genome of the maize cell; (iv) the nucleic acid molecule is integrated into the genome of the maize plant, and is located on a chromosome different from that of the male sterility gene; and (v) the maize plant contains the male sterility gene in a homozygous state and the nucleic acid molecule or vector comprising the nucleic acid in a heterozygous form, and it is male fertile.

12. A method for obtaining an offspring maize seed or maize plant of a male sterile line maize and a maintainer line maize, wherein the method comprises: crossing the maize plant according to claim 8 as a male parent with a male sterile maize plant containing the male sterility gene as a female parent, and producing an offspring maize seed or an offspring maize plant.

13. A method for obtaining an offspring maize seed or maize plant of a male sterile line maize and a maintainer line maize, wherein the method comprises: (i) providing a male sterile maize plant containing the male sterility gene as a female parent and the maize plant according to claim 8 as a male parent; (ii) pollinating the female parent with the male parent to produce two offspring seeds; wherein, the first offspring seeds show the seed external trait regulated by the first screening gene; and, the second offspring seeds do not show the seed external trait regulated by the first screening gene; (iii) separating the first and second offspring seeds; and optionally (iv) cultivating the first and second offspring seeds into first and second offspring maize plants; (v) removing from the first offspring maize plants any maize plant that does not show the maize external trait regulated by the second screening gene, so that the remaining first offspring maize plants are male fertile and can be used as maintainer line maize; (vi) removing from the second offspring maize plants any maize plant that shows the maize external trait regulated by the second screening gene, so that the remaining second offspring maize plants are male sterile and can be used as male sterility line maize; and (vii) allowing the remaining first offspring maize plants to pollinate the remaining second offspring maize plants to produce further offspring seeds.

14. A method of preparing a hybrid seed, the method comprising: (i) providing an offspring seed of a male sterility line maize obtained by the method according to claim 12, which does not show the seed external trait regulated by the first screening gene; and providing a seed of a target line maize; (ii) sowing the offspring seed of the male sterility line maize and the seed of the target line maize in a field to obtain the male sterility line maize and the target line maize; (iii) removing from the male sterility line maize a maize that shows the maize external trait regulated by the second screening gene; (iv) pollinating the remaining male sterility line maize with the target line maize; and (v) harvesting a seed from the male sterility line maize, which is the hybrid seed.

15. The method of claim 10, wherein the method further comprises: (c) pollinating a male sterile maize plant containing the male sterility gene with the maize plant of step (b) to produce offspring seeds or offspring maize plants; and (d) screening the offspring seeds or plants showing the external trait regulated by the first and/or second screening gene.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows the male flower phenotypes of male sterile maize plant ms45 (A) and wild-type maize plant Ms45 (B).

(2) FIG. 2 shows the hybrid offspring seeds (A, the seed color is yellow) that do not contain the transgenic element Ms45-Lc and the hybrid offspring seeds (B, the seed color is purple) that contain the transgenic element Ms45-Lc.

(3) FIG. 3 shows the hybrid offspring seedling (which is not purple) that does not contain the transgenic element Ms45-Lc and the hybrid offspring seedlings (which is purple) that contains the transgenic element Ms45-Lc.

(4) FIG. 4 shows a schematic diagram of the structure of pMs45-Lc vector.

(5) FIG. 5 shows the hybrid offspring plant (A, the plant is purple, and is male fertile) that contains the transgenic element Ms45-Lc, and the hybrid offspring plant (B, the plant is non-purple, and is male sterile) that does not contain the transgenic element Ms45-Lc.

(6) FIG. 6 schematically shows the process for selection and breeding of maintainer line plants, sterile plants and their hybrid offsprings.

(7) FIG. 7 shows the hybrid offspring plant (A, the plant is yellow) that contains the transgenic element Ms45Oy1, and the hybrid offspring plant (B, the plant is green) that does not contain the transgenic element Ms45-Oy1.

(8) FIG. 8 shows the hybrid offspring plant (A, the plant appears to be wilting) that contains the transgenic element Ms45-Wi2, and the hybrid offspring plant (B, the plant appears to be normal) that does not contain the transgenic element Ms45-Wi2.

SPECIFIC MODELS FOR CARRYING OUT THE PRESENT INVENTION

(9) The present invention will now be described with reference to the following examples which are intended to illustrate the present invention rather than limit the present invention. If specific conditions are not indicated in the examples, they would be carried out in accordance with the conventional conditions or the conditions recommended by the manufacturer. The reagents or instruments used without the manufacturer's indication were all conventional products that could be purchased commercially. Those skilled in the art know that the examples describe the present invention by way of example, and are not intended to limit the scope sought to be protected by the present invention.

EXAMPLE 1: CONSTRUCTION OF VECTOR

(10) In this example, the male sterility gene ms45 and its restoring gene Ms45 in Table 1 were used for experiments.

1. Amplification of Male Sterility Restoring Gene Ms45

(11) The male sterility restoring gene Ms45 was derived from the maize variety B73, its nucleotide sequence was shown in SEQ ID NO: 1, and the Ms45 protein encoded thereby had an amino acid sequence shown in SEQ ID NO: 2. Using B73 genomic DNA as template and referring to the B73 genomic sequence (www.maizesequence.org), amplification primers were designed to amplify the restoring gene Ms45. The designed primers were as follows:

(12) TABLE-US-00003 Ms45F: (SEQIDNO:11) 5tgaattcTGCTGAGTTCTCCTTGGGTTATCC3, Ms45R: (SEQIDNO:12) 5tcccgggGGTTGCGCATGAAATAGGGGT3.

(13) The designed upstream primer Ms45F contained an EcoRI restriction site at the 5end, and the downstream primer Ms45R contained an SmaI restriction site at the 5end, so as to perform amplification. The amplification reaction system was: 24, of template DNA, 0.54, of primer Ms45F, 0.5 L of primer Ms45R, 1.6 L of dNTP, 2 L of 10Buffer, 0.3 L of high-fidelity taq enzyme, 13.1 L of ddH.sub.2O. The reaction conditions were: denaturation at 95 C. for 5 minutes; 32 cycles (denaturation at 95 C. for 45 s, annealing at 59 C. for 45 s, and extension at 72 C. for 3 minutes); and extension at 72 C. for 10 minutes.

(14) Experimental results: The amplified target product had a total length of about 3500 bp. It was recovered and ligated to the T-easy sequencing vector, and then used for transformation and sequencing. Sequencing results confirmed that the amplification product was a 3518 bp DNA fragment composed of EcoRI restriction site, the sequence shown in SEQ ID NO: 3, and SmaI restriction site, which was used as the Ms45 gene construct. The sequence shown in SEQ ID NO: 3 contained a nucleotide sequence of the promoter (SEQ ID NO: 15) and coding region of the Ms45 gene.

2. Amplification of Related Genes for Regulating Seed Color, Plant Color and Plant Wilting

1) Amplification of Lc Gene

(15) The Lc gene had a nucleotide sequence shown in SEQ ID NO: 4, and the Lc protein encoded thereby had an amino acid sequence shown in SEQ ID NO: 5. For SEQ ID NO: 4, NcoI restriction site and protective base were added to the 5 end, BstEII restriction site and protective base were added to the 3 end, and this sequence was artificially synthesized and used as a Lc gene construct.

2) Amplification of Oy1 Gene

(16) The Oy1 gene had a nucleotide sequence shown in SEQ ID NO: 6, and the Oy1 protein encoded thereby had an amino acid sequence shown in SEQ ID NO: 7. For SEQ ID NO: 6, NcoI restriction site and protective base were added to the 5 end, BstEII restriction site and protective base were added to the 3 end, and this sequence was artificially synthesized and used as an Oy1 gene construct.

3) Synthesis of Wi2 Gene for Regulating Plant Wilting

(17) Wi2 gene can regulate root suberin, and its expression can affect the water transport of the plant and make the plant be easier to wilt. The Wi2 gene had a nucleotide sequence shown in SEQ ID NO: 8, and the Wi2 protein encoded thereby had an amino acid sequence shown in SEQ ID NO: 9. For SEQ ID NO: 8, NcoI restriction site and protective base were added to the 5 end, BstEII restriction site and protective base were added to the 3 end, and this sequence was artificially synthesized and used as a Wi2 gene construct.

3. Construction of Recombinant Agrobacterium

(18) Plasmid pCAMBAI3301 (International Agricultural Molecular Biology Application Center, CAMBIA, Australia) was used to construct the following recombinant expression vectors, and the plasmid contained a selective marker gene bar (which nucleotide sequence was shown in SEQ ID NO: 10).

1) Vector pMs45-Lc

(19) By double-enzyme digestion of the gene construct and plasmid, the Lc gene construct was cloned between the BstEII and NcoI restriction sites of the pCAMBAI3301 plasmid, and the Ms45 gene construct was cloned between the EcoRI and SmaI restriction sites of the pCAMBAI3301 plasmid. The constructed vector was named pMs45-Lc. The schematic structure diagram of the vector was shown in FIG. 4, and the vector contained the Ms45 gene, the Lc gene and the selective marker gene bar of the vector itself.

2) Vector pMs45-Oy1

(20) By double-enzyme digestion of the gene construct and plasmid, the Oy1 gene construct was cloned between the BstEII and NcoI restriction sites of the pCAMBAI3301 plasmid, and the Ms45 gene construct was cloned between the EcoRI and SmaI restriction sites of the pCAMBAI3301 plasmid. The constructed vector was named pMs45-Oy1. The vector contained the Ms45 gene, the Oy1 gene and the selection marker gene bar of the vector itself.

3) Vector pMs45-Wi2

(21) By double digestion of the gene construct and plasmid, the Wi2 gene construct was cloned between the BstEII and NcoI restriction sites of the pCAMBAI3301 plasmid, and the Ms45 gene construct was cloned between the EcoRI and SmaI restriction sites of the pCAMBAI3301 plasmid. The constructed vector was named pMs45-Wi2. The vector contained the Ms45 gene, the Wi2 gene and the selection marker gene bar of the vector itself.

(22) The vectors pMs45-Lc, pMs45-Oy1 and pMs45-Wi2 obtained above were respectively transformed into Agrobacterium EHA105 to obtain recombinant Agrobacterium strains EHA105/pMs45-Lc, EHA105/pMs45-Oy1 and EHA105/pMs45-Wi2.

(23) In addition, the vectors pMs45-Oy1-CWI-2 (which carried the Ms45 gene, the Oy1 gene, the nucleotides (SEQ ID NO: 18) encoding the interfering RNA of CWI-2 gene, and the selective marker gene bar of the vector itself) and pMs45-Lc-CWI-2 (which carried the Ms45 gene, the Lc gene, the nucleotides (SEQ ID NO: 18) encoding the interfering RNA of CWI-2 gene, and the selective marker gene bar of the vector itself) were prepared by similar methods, and the recombinant Agrobacterium strains EHA105/pMs45-Oy1-CWI-2 and EHA105/pMs45 -Lc-CWI-2 were prepared.

EXAMPLE 2: ACQUISITION OF TRANSGENIC MAIZE

(24) The maize varieties HiIIA and HiIIB (Armstrong C L, Green C E and Phillips R L. Development and availability of germplasm with high Type II culture formation response. Maize Genetics Cooperation News Letter, 1991, 65:92-93) were planted in the field. They are separately bagged, pollinated, and hybridized when dispersing pollen. Two hybridization methods were used: HiIIA as the female parent and HiIIB as the male parent; or, HiIIA as the male parent and HiIIB as the female parent. 9 to 11 days after the pollination, the immature hybrid embryos were taken from the pollinated ear kernels, and the obtained recombinant Agrobacterium strains EHA105/pMs45-Lc, EHA105/pMs45-Lc and EHA105/pMs45-Wi2 were used to infect the maize immature embryos respectively. The infected immature embryos were placed on a selection medium for multiple screenings to obtain resistant calli, and the resistant calli were regenerated into seedlings to obtain transgenic T0 generation plants. After obtaining the transgenic T0 generation, the pollens of the T0 generation transgenic plants were used to pollinate the breeding female parents HiIIA and HiIIB and the ms45 male sterile materials (obtained from Maize Genetics Cooperation Stock Center, 905I), and their phenotypes were observed.

(25) The Specific Implementation Steps were as Follows

1. Obtaining Maize Immature Embryos

(26) 1) About 1 cm top ears of the HiIIA and HiIIB hybrid F1 generation plants were cut, and tweezers were inserted from top into the ears. Then ears were placed into a beaker containing a disinfectant. According to the actual needs, 4 to 6 ears could be placed in the same beaker.

(27) 2) About 700 ml of disinfectant (50% bleach or 5.25% sodium hypochlorite, and added with a drop of Tween-20) was added to the beaker to immerse the ears. During the disinfection process of about 20 minutes, the ears were rotated from time to time while gently tapping the beaker to drive out bubbles on the surface of the kernels, so as to achieve the best disinfection effect. After disinfection, the ears were taken out and put in a beaker filled with sterilized water, washed in water 3 times, and then prepared to peel off the embryos.

(28) 3) The sterilized ears were placed on a large petri dish, and a large scalpel used to cut off the top of the kernels (1.5 to 1.8 mm).

(29) 4) The tip of a knife for peeling embryo was inserted between the embryo and the endosperm, then the immature embryo was gently pried up, the embryo was gently lifted by the tip of a small scalpel to ensure that the embryo did not suffer any damage, the embryonal axis surface of the embryo was closely attached to N6E medium with filter paper, and the density of embryo was about 22cm (30 pcs/dish).

(30) 5) The petri dish was sealed with parafilm and incubated in the dark at 28 C. for 2 to 3 days.

2. Agrobacterium Infiltration

(31) 1) The recombinant Agrobacterium strains EHA105/pMs45-Lc, EHA105/pMs45-Oy1 and EHA105/pMs45-Wi2 were cultured on YEP medium (containing Kana33 mg/L and Str100 mg/L antibiotics) one week in advance.

(32) 2) The above-cultured recombinant Agrobacterium strains were transferred to fresh YEP medium (containing Kana33 mg/L, Str50 mg/L) and cultured at 19 C. for 3 days.

(33) 3) After 3 days, the recombinant Agrobacterium was picked and put into a 50 ml centrifuge tube containing 5 mL of infection medium, and 100 uM AS (inf+AS) was added at the same time, and the incubation was performed at room temperature (25 C.) at 75 rpm for 2 to 4 hours.

(34) 4) The immature embryos were infected, in which the newly separated immature embryos were placed into a centrifuge tube containing inf+AS liquid medium (2 ml), about 20 to 100 immature embryos were placed in each tube, washing was performed twice with this medium, and then 1 to 1.5 ml of Agrobacterium with a specific concentration (OD550=0.3 to 0.4) was added, the centrifuge tube was gently inverted 20 times, and then placed upright in the dark box for 5 minutes, it should be ensured that the immature embryos were all immersed in the Agrobacterium liquid, and vortexing and oscillation should be avoided during the whole process.

3. Co-Cultivation

(35) 1) After the infection, the infected maize immature embryos were transferred to a co-cultivation medium (which had solute shown in Table 3, and the solvent was water), so that the embryonal axis of the immature embryo was in contact with the surface of the medium, and the excess Agrobacterium on the surface of the medium was removed.

(36) 2) The petri dish was sealed with parafilm and incubated in the dark at 20 C. for 3 days.

4. Resting Culture

(37) 1) After 3 days of the co-cultivation, the immature embryos were transferred to a resting medium (which solute was shown in Table 3, the solvent was water), and the petri dish was sealed with a parafilm at the same time, and cultivation was performed in the dark at 28 C. for 7 days.

5. Selection

(38) 1) After 7 days, all the immature embryos were transferred to the selection medium (which solute was shown in Table 3, the solvent was water) (35 immature embryos/each dish) and cultured for two weeks. The selection medium contained 1.5 mg/L of bialaphos. After two weeks, subculture was then performed, in which the concentration of bialaphos could be increased to 3 mg/L.

(39) 2) About 5 weeks after the infection, the cells containing the transformants would grow into visible type II calli.

6. Regeneration of Transgenic Plants

(40) 1) The calli grew on Regeneration medium I (which solute was shown in Table 3, and the solvent was water) for 3 weeks, and then germinated on Regeneration medium II (which solute was shown in Table 3, and the solvent was water) (placed in a light culture room) to obtain T0 generation transgenic pMs45-Lc maize, pMs45-Oy1 maize and pMs45-Wi2 maize.

(41) 2) When 3 to 4 leaves were grown, they were transferred to the greenhouse respectively, and when they grew to the silking and pollination stage, they were pollinated separately.

7. Analysis of the Obtained Transgenic Plants

(42) The obtained T0 generation transgenic pMs45-Lc maize, pMs45-Oy1 maize and pMs45-Wi2 maize and their offsprings were evaluated for the overall plant morphology (for example, pollen, plant and kernel phenotype). The above-mentioned transgenic maizes were crossed with ms45 homozygous recessive male sterile material (obtained from Maize Genetics Cooperation Stock Center, 905I) respectively to obtain hybrid offsprings.

1) Genotype Detection of Hybrid Offsprings

(43) The bar gene was detected to determine whether the hybrid offsprings contained the transgenic elements Ms45-Lc, Ms45-Oy1 or Ms45-Wi2. The bar gene detection method comprised: the following primers Bar669F (SEQ ID NO: 13) and Bar669R (SEQ ID NO: 14) were used to perform PCR amplification of the genomes of the hybrid offsprings, if the amplification product contained a target fragment with a size of about 669 bp, then the hybrid offspring were the offspring that contained the transgenic element; if the amplification product did not contain the 669 bp target fragment, the hybrid offspring were the hybrid offspring that did not contain the transgenic element.

(44) The sequences of the primers Bar669F and Bar669R were as follows:

(45) TABLE-US-00004 Bar669F: (SEQIDNO:13) 5TCTCGGTGACGGGCAGGAC3; Bar669R: (SEQIDNO:14) 5TGACGCACAATCCCACTATCCTT3.

(46) After the verification by PCR and sequencing, the hybrid offspring containing the transgenic element Ms45-Lc, the hybrid offspring containing the transgenic element Ms45-Oy1 and the hybrid offspring containing the transgenic element Ms45-Wi2 were obtained respectively.

2) Detection of Representative Type after Hybridization

(1) Detection of Hybrid Offspring Containing the Transgenic Element Ms45-Lc

(47) The phenotypes of the hybrid offsprings cultivated in the field were observed, and the plant colors of the hybrid offsprings were shown in FIG. 5, in which the hybrid offspring containing the transgenic element Ms45-Lc was shown in FIG. 5A, and the plant was purple (detected to be fertile); and the hybrid offspring without transgenic element of Ms45-Lc was shown in FIG. 5B, and the plant was not purple (detected to be sterile). The results of the seed color of the hybrid offsprings were shown in FIG. 2, in which FIG. 2B showed the hybrid offspring seed containing the transgenic element Ms45-Lc, the seed color was purple (detected to be fertile), and FIG. 2A showed the hybrid offspring seed without the transgenic element Ms45-Lc, the seed color was yellow (not purple, detected to be sterile). The results of the seedling colors of the hybrid offsprings were shown in FIG. 3, in which the hybrid offspring seedling containing the transgenic element Ms45-Lc was purple (detected to be fertile), and the hybrid offspring seedling without the transgenic element Ms45-Lc was not purple (detected to be sterile).

(48) The above detection results indicated that the expression of the Ms45 gene in the plants rescued the male sterility phenotype caused by the recessive homozygous ms45 gene. At the same time, the transgenic plants or seeds containing Ms45-Lc were purple. This indicated that the Lc gene could function normally in the transgenic plants. The purple seeds and non-purple (yellow) seeds obtained above were sown in the field, and these seeds were able to germinate normally, and there was no significant difference in the germination rate. In addition, the purple seeds and plants can still grow normally under the selection of bialaphos. The above results showed that the selection marker gene bar, the Ms45 gene and the Lc gene could all function normally, and these three genes were linked in inheritance. In the offspring produced by crossing the T0 generation transgenic plant with the male sterility line plant ms45, the ratio of normal seed to purple seed was 1:1, and the purple seed offsprings were all purple seedlings.

(2) Detection of Hybrid Offspring Containing the Transgenic Element Ms45-Oy1

(49) The phenotypes of the hybrid offsprings cultivated in the field were observed, and the plant colors of the hybrid offsprings were shown in FIG. 7, in which the hybrid offspring containing the transgenic element Ms45-Oy1 was shown in FIG. 7A, and the plant was yellow (detected to be fertile); while the hybrid offspring without the transgenic element Ms45-Oy1 was shown in FIG. 7B, and the plant was green (detected to be sterile).

(3) Detection of Hybrid Offspring Containing the Transgenic Element Ms45-Wi2

(50) The phenotypes of the hybrid offsprings cultivated in the field were observed, and the plant wilting degrees of the hybrid offsprings were shown in FIG. 8, in which the hybrid offspring containing the transgenic element Ms45-Wi2 was shown in FIG. 8A, and the plant was wilting (detected to be fertile); and the hybrid offspring plant without the transgenic element Ms45-Wi2 was shown in FIG. 8B, and the plant was normal (detected to be sterile).

(51) TABLE-US-00005 TABLE 3 Solutes and concentrations for culture media Type AS(inf + Co-cultivation Resting Selection Regeneration Regeneration ingredient AS) Medium medium medium medium I medium II MS salt 2.16 g/L 4.33 g/L 4.33 g/L 4.33 g/L 4.33 g/L 2.16 g/L Sucrose 68.5 g/L 30 g/L 30 g/L 30 g/L 30 g/L 30 g/L Glucose 30 g/L L-proline 0.115 g/L 1.38 g/L 1.38 g/L 1.38 g/L 1.38 g/L Vitamin B.sub.1 0.5 mg/L 0.5 mg/L 0.5 mg/L 0.5 mg/L 2,4-D 5 mg/L 5 mg/L 5 mg/L 6-BA 0.01 mg/L 0.01 mg/L 0.01 mg/L 3.5 mg/L IBA 0.75 mg/L NAA 0.5 mg/L 4-amino-3,5,6- 1 mg/L trichloropyridinecarb oxylic acid (picloram) Timentin 100 mg/L 100 mg/L 100 mg/L Bialaphos 3 mg/L 3 mg/L 3 mg/L Agar 6 g/L phytagel 3 g/L 3 g/L 3 g/L 3 g/L pH 5.7 5.7 5.7 5.7 5.7 5.7 AgNO.sub.3 3.4 mg/L 3.4 mg/L 3.4 mg/L Acetosyringone 200 mol/L 200 mol/L 200 mol/L

(52) In the above table, MS salt was purchased from Phyto Technology Laboratories, and the article number was M524.

(53) In addition, by a method similar to the above, the recombinant Agrobacterium strains EHA105/pMs45-Oy1-CWI-2 and EHA105/pMs45-Lc-CWI-2 were used to prepare transgenic pMs45-Oy1-CWI-2 maize (which contained the transgenic element Ms45-Oy1-CWI-2) and transgenic pMs45-Lc-CWI-2 maize (which contained the transgenic element Ms45-Lc-CWI-2).

EXAMPLE 3. LARGE-SCALE EXPANSION OF MALE STERILITY LINES USING MALE STERILE MAINTAINER LINES

1. Preparation of Male Sterility Lines

(54) The ms45 homozygous recessive mutant (Maize Genetics Cooperation Stock Center, 9051) was used as female parent and crossed with Zheng58 (Food Crops Research Institute, Henan Academy of Agricultural Sciences), and the obtained F1 continued to be backcrossed with the maize inbred line Zheng58. Genotype analysis was performed on the obtained BC1 (backcross generation) population, and the plants that were heterozygous at the Ms45 locus were screened and continued to be backcrossed with Zheng58. After 5 to 6 generations of such backcrossing, the individual plants with heterozygous Ms45 locus and agronomic traits similar to Zheng58 were screened by molecular markers and selfed to obtain ms45 homozygous recessive inbred line Zheng58 (ms45ms45), and the inbred line could be used as a male sterility line plant.

(55) The method for screening the Ms45 locus genotype was as follows: the following primers Ms45F1 (SEQ ID NO: 16) and Ms45R1 (SEQ ID NO: 17) were used to perform PCR amplification of the plant genome, and the amplification products were sequenced. The Ms45 target fragment had a size of 859bp, and the ms45 target fragment had a size of 811bp. If the amplification product contained both the 859bp and 811bp target fragments, the genotype of the locus was heterozygous Ms45/ms45; if the amplification product did not contain the 811bp fragment, the genotype of the locus was dominant homozygous Ms45/Ms45; if the amplification product did not contain the 859 bp target fragment, the genotype of the locus was recessive homozygous ms45/ms45.

(56) TABLE-US-00006 Ms45F1: (SEQIDNO:16) 5CTTGAGCGACAGCGGGAACT3; Ms45R1: (SEQIDNO:17) 5TGTTGTTTCTTGGCAAAGGTCAG3.

2. Preparation of Maintainer Lines

(1) Preparation of Maintainer Liner Plants with Heterozygous Ms45-Lc and Homozygous ms45

(57) The T0 generation transgenic pMs45-Lc maize in Example 2 was used as male parent, and crossed with the above-obtained Zheng58 (ms45ms45) as female parent. The purple seeds were selected from the hybrid offspring, sown in the field and then sprayed with 200 mM bialaphos. The surviving plants were continued to backcross with the female parent Zheng58. In the process of backcrossing, purple seeds and plants were always selected to cross with the female parent. After 5 to 6 generations of backcrossing, the transgenic loci (Ms45-Lc) of purple seeds and plants in the offspring were all heterozygous. When pollens of purple seeds and plants were used to pollinate the female parent, if the normal seeds (yellow seeds) or normal plants (green plants) obtained were all sterile, the pollen-providing plants had heterozygous Ms45-lc transgenic locus and recessive homozygous ms45 locus, that was, they were maintainer line plants.

(2) Preparation of Maintainer Line Plants with Heterozygous Ms45-Oy1 and Homozygous ms45

(58) The T0 generation transgenic pMs45-Oy1 maize in Example 2 was used as male parent, and crossed with the above-obtained Zheng58 (ms45ms45) as female parent. The yellow plants were selected from the hybrid offspring, sown in the field and then sprayed with 200 mM bialaphos. The surviving plants were continued to backcross with the female parent Zheng58. In the process of backcrossing, yellow plants were always selected to cross with the female parent. After 5 to 6 generations of backcrossing, the transgenic loci (Ms45-Oy1) of yellow plants in the offspring were all heterozygous. When pollens of yellow plants were used to pollinate the female parent, if the normal plants (green plants) obtained were all sterile, the pollen-providing plants had heterozygous Ms45-Oy1 transgenic locus and recessive homozygous ms45 locus, that was, they were maintainer line plants.

(3) Preparation of Maintainer Line Plants with Heterozygous Ms45-Wi2 and Homozygous ms45

(59) The T0 generation transgenic pMs45-Wi2 maize in Example 2 was used as male parent, and crossed with the above-obtained Zheng58 (ms45ms45) as female parent. The wilted plants (which wilting degrees were shown in FIG. 8A, and mainly presented curl heart leaves) were selected from the hybrid offspring, sown in the field and then sprayed with 200 mM bialaphos. The surviving plants were continued to backcross with the female parent. In the process of backcrossing, wilted plants were always selected to cross with the female parent. After 5 to 6 generations of backcrossing, the transgenic loci (Ms45-Wi2) of wilted plants in the offspring were all heterozygous. When pollens of wilted plants were used to pollinate the female parent, if the normal plants (green plants) obtained were all sterile, the pollen-providing plants had heterozygous Ms45-Wi2 transgenic locus and recessive homozygous ms45 locus, that was, they were maintainer line plants.

3. Acquisition of Maintainer Lines

(60) The obtained maintainer line plants (Ms45-Lc heterozygous and ms45ms45) were used as male parent and crossed with Zheng58 as the female parent. The offsprings produced not only had male sterility line (ms45ms45), but also had maintainer line (Ms45-Lc heterozygous and ms45ms45). In addition, the seeds of the male sterility line (ms45ms45) were normal, while the seeds of the maintainer line (Ms45-Lc heterozygous and ms45ms45) were purple (the seeds shown in FIG. 2B). See FIG. 6 for the specific breeding process.

(61) The obtained maintainer line plants (Ms45-Oy1 heterozygous and ms45ms45) were used as male parent and crossed with Zheng58 as female parent. The offsprings produced not only had male sterility line (ms45ms45), but also maintainer line (Ms45-Oy1 heterozygous and ms45ms45). In addition, the male sterility line plants (ms45ms45) were normal and show green color (as shown in FIG. 7B), while the maintainer line plants (Ms45-Oy1 heterozygous and ms45ms45) were yellow.

(62) The obtained maintainer line plants (Ms45-Wi2 heterozygous and homozygous ms45) were used as male parent and crossed with Zheng58 as female parent. The offsprings produced not only had male sterility line (ms45ms45), but also maintainer line (Ms45-Wi2 heterozygous and ms45ms45). In addition, the male sterility line plants (ms45ms45) were normal (as shown in FIG. 8B), while the maintainer line plants (Ms45-Wi2 heterozygous and ms45ms45) showed a wilting state.

4. Large-Scale Expansion of Male Sterility Lines Using Male Sterile Maintainer Lines

(63) Taking the Zheng58 inbred line as an example, the obtained male sterility line Zheng58 (ms45ms45) was sown in combination with the above-obtained maintainer lines (Ms45-Lc heterozygous and ms45ms45, Ms45-Oy1 heterozygous and ms45ms45, and Ms45-Wi2 heterozygous and ms45ms45), respectively. The two materials were sown separately, in which when each row of maintainer line was sown, 5 rows of sterile line were correspondingly sown, and it was ensured that no other maize was sown within 300 meters around the breeding field, so that the sterile line and the maintainer line were naturally pollinated in the field.

(64) The maintainer line could only accept its own pollen and would produce two kinds of offspring. One was the offspring that exhibited the external traits of transgenic elements (for example, purple seeds and purple plants, yellow plants, wilted plants). The transgenic elements of these offspring may be homozygous or heterozygous, making it difficult to distinguish. Therefore, these seeds or plants were discarded. The other one was the offspring with normal external traits, did not contain transgenic elements, and could be used as the sterile line offspring and retained.

(65) The sterile line material received the pollen from the maintainer line and produced two kinds of offspring. One was the offspring that exhibited the external traits of transgenic elements (for example, purple seeds and purple plants, yellow plants, wilted plants). The transgenic elements of these offspring were heterozygous, and thus they could be used as the maintainer line offspring and retained. The other one was the offspring with normal external traits (for example, yellow seeds, green plants, non-wilted plants), which did not contain transgenic elements, and could be used as the sterile line offspring and retained. The maintainer line could be used in the next year to continue the expansion of the sterile line and the maintainer line, while most of the sterile line was used to produce commercial seeds, and the remaining small part was used in the next year to continue the expansion of the sterile line and the maintainer line. The production process was shown in FIG. 6.

(66) In addition, by a method similar to the above, the maintainer line plants with heterozygous Ms45-Oy1-CWI-2 and homozygous ms45 were obtained, and the maintainer line plants with heterozygous Ms45-Lc-CWI-2 and homozygous ms45 were obtained, and both of them could be used for large-scale expansion of male sterility lines (ms45ms45).

EXAMPLE 4. LARGE-SCALE PRODUCTION OF HYBRIDS USING MALE STERILITY LINES

(67) The sterile lines produced in Example 3 were recessive homozygous sterile lines controlled by nucleus, and the sterile lines could be restored to fertility by any wild-type plant (Ms45Ms45). Therefore, as long as an inbred line (for example, Chang 7-2) with high combining ability with the male sterility lines (for example, Zheng58) was selected, hybrids with excellent agronomic traits would be produced.

(68) In order to achieve the above objects, Zheng58 and Chang 7-2 were subjected to alternate-row-seeding in the field, and no other maize was sown within 300 meters around the breeding field. Thus, the ears of the sterile lines could only accept the pollens of the wild-type inbred line, while the wild-type inbred line could only be selfed. In this way, the seeds produced on the ears of the sterile lines were dominant hybrids.

EXAMPLE 5: QUALITY ASSESSMENT OF HYBRIDS BRED BY STERILE LINES

(69) Previously, the inventors of the present application had used a vector containing both Ms45 and mn1 RNAi (Chinese Patent ZL201210406155.6) to create a male sterile maintainer line that was marked by seed size. However, due to the existence of heterofertilization (the embryo and endosperm of the same seed were fertilized by sperms formed by two different male gametophytes in the double fertilization process), the male sterility line offspring population produced by this type of male sterile maintainer line could not achieve 100% sterility. Specifically, we used the method described in Chinese patent ZL201210406155.6 to expand and multiply and prepare a large number of sterile maize seeds; subsequently, they were sown in the field, and the number of pollen-dispersal plants was observed and recorded during the pollinating period. The results showed that a total of 320 pollen-dispersal plants (such plants contained transgenic components derived from the maintainer line) were observed in 100,000 plants. This indicated that a small number of male fertile individuals were mixed in the sterile line seeds obtained (accounting for about 3.2 of the sterile line offspring population produced). Further, the sterile line plant population mixed with male fertile individuals (i.e., maintainer line individuals) was crossed with a target maize line (for example, Chang 7-2) plants to produce hybrids. Then, the produced hybrids were sown in the field, and 10,000 plants were randomly selected for genetic testing. The results showed that there were 210 hybrids containing the transgenic components derived from the maintainer line, accounting for 2.1%. This result indicated that the seed purity of the produced hybrids should still be improved and could not fully meet the production requirements. This had brought adverse effects and potential risks to the marketization of hybrids.

(70) In this example, the Lc gene was used to double-mark the plants (seed color and plant color), which solved the problem caused by heterofertilization and significantly improved the seed purity of the hybrids produced (to 100%).

(71) In short, the maintainer line plants (transgenic pMs45-Lc/ms45ms45 maize) and the sterile line plants (ms45ms45 maize) obtained in the above examples were sown separately, in which when one row of the maintainer line was sown, 5 rows of sterile line were sown correspondingly, and it was ensured that no other maize was sown within 300 meters around the breeding field, so that the sterile line plants and maintainer lines were allowed to be pollinated naturally in the field. The offspring seeds of the sterile line plants were collected, and the first screening was performed according to the color of the seeds, that was, the offspring of the sterile line (the seeds were yellow) and the offspring of the maintainer line (the seeds were purple) were distinguished.

(72) Then, the obtained sterile line seeds (as the female parent) and the target maize line seeds (as the male parent, Chang 7-2 inbred line) were subjected to alternate-row-seeding, in which when one row of the target maize line seeds was sown, 5 rows of the sterile line seeds were sown correspondingly, and it was ensured that no other maize was sown within 300 meters around the breeding field. In the seedling stage of maize growth, the external traits of the sterile line plants were observed, and the plants showing the purple plant color were removed from the sterile line plants. According to statistics, among 100,000 sterile plants, 290 purple seedlings were removed, that was, the purity of the expanded sterile line was 99.71%.

(73) After screening, the sterile line plants and the target maize line plants were allowed to be naturally pollinated in the field. The hybrid seeds produced on the sterile line plants were collected. Then, the produced hybrid seeds were sown in the field, and 10,000 plants were randomly selected for genetic testing to determine the proportion of hybrid seeds containing the transgenic components (pMs45-Lc) derived from the maintainer line, and to evaluate the quality of hybrid seeds (purity). The experimental results showed that after double screening by using seed color and plant color, the purity of the hybrid seeds produced reached 100%, that was, all hybrid seeds did not contain transgenic components derived from the maintainer line (pMs45-Lc).

(74) Based on this result, it could be determined that by using the male sterile maintainer line of the present invention, with the aid of double screening (seed screening and seedling stage screening), both the progeny sterile line plants and the progeny maintainer line plants could achieve a purity of 100% at the seedling stage. The male sterile maintainer line and the seed breeding method of the present invention could be used to produce high-purity sterile line offspring seeds and high-purity hybrid seeds.

EXAMPLE 6: QUALITY ASSESSMENT OF HYBRIDS BRED BY STERILE LINES

(75) In this example, the present inventors used the two traits of seed size (interfering RNA of CWI-2 gene) and plant color (Oy1 gene) to mark the plants. Therefore, during the seed production process, the fertile maintainer line (i.e., yellow seedlings; about 3) produced by heterofertilization in the plot of female parent sterile line was removed at the seedling stage, so as to ensure 100% male sterility of all female parents during the pollen-dispersal period, thereby improving and ensuring the purity of the hybrids produced, and satisfying the needs of production well.

(76) In short, according to the experimental method described in the above example, the Ms45 gene (SEQ ID NO: 1), Oy1 gene (SEQ ID NO: 6) and the nucleotides (SEQ ID NO: 18) encoding the interfering RNA of CWI-2 gene were constructed into a vector, and a maintainer line plant was produced, that was, a transgenic maize plant pMs45-Oy1-CW1-2/ms45ms45, which could express Ms45 protein, Oy 1 protein, and interfering RNA that inhibited CWI-2 gene. The obtained maintainer line plants (pMs45-Oy1-CW1-2/ms45ms45) and the sterile plants (ms45ms45 maize) were subjected to alternate-row-seeding, in which when one row of the maintainer line was sown, 5 rows of the sterile lines were sown correspondingly, and it was ensured that no other maize was sown within 300 meters around the breeding field, so that the sterile line plants and the maintainer line plants were allowed to be naturally pollinated in the field. The offspring seeds of the sterile line plants were collected, and the first screening was performed according to the size of the seeds, that was, the offspring of the sterile line (the seed size was normal) and the offspring of the maintainer line (the seed size was small) were distinguished.

(77) Then, the obtained sterile line seeds (as the female parent, the seed size was normal) and the target maize line seeds (as the male parent, Chang 7-2 inbred line, the seed size was normal) were sown separately, in which when one row of the target maize line seeds was sown, 5 rows of the sterile line seeds were sown accordingly, and it was ensured that no other maize was sown within 300 meters around the breeding field. In the seedling stage of maize growth, the external traits of the sterile line plants were observed, and the plants showing the yellow plant color were removed from the sterile line plants. According to statistics, 310 yellow seedlings out of 100,000 sterile line plants were removed, that was, the purity of the expanded sterile line was 99.69%.

(78) After screening, the sterile line plants and the target maize line plants were allowed to be naturally pollinated in the field. The hybrid seeds produced on the sterile plants were collected. Then, the produced hybrid seeds were sown in the field, and 10,000 plants were randomly selected for genetic testing to determine the proportion of hybrid seeds containing the transgenic components derived from the maintainer line (pMs45-Oy1-CWI-2) and evaluate the quality (purity) of the hybrid seeds. The experimental results showed that after double screening by using seed color and plant color, the purity of the hybrid seeds produced reached 100%, that was, all hybrid seeds did not contain the transgenic components derived from the maintainer line (pMs45-Oy1-CWI-2).

(79) Based on this result, it could be determined that by using the male sterile maintainer line of the present invention, with the aid of double screening (seed screening and seedling stage screening), the progeny sterile line plants and the progeny maintainer line plants could achieve a purity of 100% at the seedling stage. The male sterile maintainer line and the seed breeding method of the present invention could be used to produce high-purity sterile line offspring seeds and high-purity hybrid seeds.

EXAMPLE 7: QUALITY ASSESSMENT OF HYBRIDS BRED BY STERILE LINES

(80) In this example, the present inventors used the two traits of seed size (interfering RNA of CWI-2 gene) and plant color (Lc gene) to mark the plants. Therefore, in the seed production process, the fertile maintainer line (i.e., purple seedlings; about 3) produced by heterofertilization in the plot of female parent sterile line was removed at the seedling stage, so as to ensure 100% male sterility of all female parents during the pollen-dispersal period, thereby improving and ensuring the purity of the hybrids produced, and satisfying the needs of production well.

(81) In short, according to the experimental method described in the above examples, the Ms45 gene (SEQ ID NO: 1), Lc gene (SEQ ID NO: 4) and nucleotide (SEQ ID NO: 18) encoding the interfering RNA of CWI-2 gene were constructed into a vector, and a maintainer line plant was produced, namely the transgenic maize plant pMs45-Lc-CWI-2/ms45ms45 maize, which could express Ms45 protein, Lc protein, and inhibit the interfering RNA of CWI-2 gene. The obtained maintainer line plants (pMs45-Lc-CWI-2/ms45ms45 maize) and sterile line plants (ms45ms45 maize) were sown separately, in which when one row of the maintainer line was sown, 5 rows of sterile line were sown accordingly, and it was ensured that no other maize was sown within 300 meters around the breeding field, so that the sterile line plants and the maintainer line plants were allowed to be naturally pollinated in the field. The offspring seeds of the sterile line plants were collected, and the first screening was performed according to the size of the seeds, that was, the offspring of the sterile line (the seed size was normal) and the offspring of the maintainer line (the seed size was small) were distinguished.

(82) Then, the obtained sterile line seeds (as the female parent, the seed size was normal) and the target maize line seeds (as the male parent, Chang 7-2 inbred line, the seed size was normal) were sown separately, in which when one row of the target maize line seeds was sown, 5 rows of the sterile line seeds were sown accordingly, and it was ensured that no other maize was sown within 300 meters around the breeding field. In the seedling stage of maize growth, the external traits of the sterile line plants were observed, and the plants showing the purple plant color were removed from the sterile line plants. According to statistics, 305 purple seedlings out of 100,000 sterile line plants were removed, that was, the purity of the expanded sterile line was 99.695%.

(83) After screening, the sterile line plants and the target maize line plants were allowed to be naturally pollinated in the field. The hybrid seeds produced on sterile plants were collected. Then, the produced hybrid seeds were sown in the field, and 10,000 plants were randomly selected for genetic testing to determine the proportion of hybrid seeds containing the transgenic components (pMs45-Lc-CWI-2) derived from the maintainer line and evaluate the quality (purity) of the hybrid seeds. The experimental results showed that after double screening by using seed color and plant color, the purity of the hybrid seeds produced reached 100%, that was, all hybrid seeds did not contain the transgenic components (pMs45-Lc-CWI-2) derived from the maintainer line.

(84) Based on this result, it could be determined that by using the male sterile maintainer line of the present invention, with the aid of double screening (seed screening and seedling stage screening), the progeny of sterile line plants and the progeny of maintainer line plants could achieve a purity of 100% at the seedling stage. The male sterile maintainer line and the seed breeding method of the present invention could be used to produce high-purity sterile line offspring seeds and high-purity hybrid seeds.