Compositions and methods for detecting HEV nucleic acid

Abstract

Disclosed are nucleic acid oligomers, including amplification oligomers, capture probes, and detection probes, for detection of Hepatitis E Virus (HEV) nucleic acid. Also disclosed are methods of specific nucleic acid amplification and detection using the disclosed oligomers, as well as corresponding reaction mixtures and kits.

Claims

1. A combination of at least two oligomers for determining the presence or absence of hepatitis E virus (HEV) in a sample, said oligomer combination comprising: at least two amplification oligomers for amplifying a target region of an HEV target nucleic acid, wherein (a) at least one amplification oligomer is selected from the group consisting of (i) an oligomer comprising a target-hybridizing sequence that is from about 14 to about 23 contiguous nucleotides contained in the sequence of SEQ ID NO:63 and that includes at least the sequence of SEQ ID NO:26, including RNA equivalents and DNA/RNA chimerics thereof; and (ii) an oligomer comprising a target-hybridizing sequence consisting of SEQ ID NO:28, including RNA equivalents and DNA/RNA chimerics thereof; and (b) at least one amplification oligomer is a promoter primer comprising a target-hybridizing sequence consisting of SEQ ID NO:24, SEQ ID NO:45, SEQ ID NO:51, or SEQ ID NO:56, including RNA equivalents and DNA/RNA chimerics thereof and further comprising a promoter sequence that is non-complementary to the HEV target nucleic acid joined to the 5′ end of the target-hybridizing sequence of the promoter primer.

2. The combination of at least two oligomers of claim 1, wherein the at least one amplification oligomer of (a) comprises a target-hybridizing sequence consisting of SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:64, SEQ ID NO:65, or SEQ ID NO:66, including RNA equivalents and DNA/RNA chimerics thereof.

3. The combination of at least two oligomers of claim 1, wherein the at least one amplification oligomer of (a) comprises a target-hybridizing sequence consisting of SEQ ID NO:29, SEQ ID NO:30, or SEQ ID NO:31, including RNA equivalents and DNA/RNA chimerics thereof.

4. The combination of at least two oligomers of claim 1, wherein said combination comprises a first amplification oligomer as in (b) and a second amplification oligomer as in (b).

5. The combination of at least two oligomers of claim 1, wherein said combination comprises an amplification oligomer as in (a)(i) and an amplification oligomer as in (a)(ii).

6. The combination of at least two oligomers of claim 1, wherein the promoter sequence is a T7 promoter sequence.

7. The combination of at least two oligomers of claim 1, further comprising at least one detectably labeled detection probe oligomer comprising a target-hybridizing sequence that is from about 14 to about 28 nucleotides in length and is configured to specifically hybridize to a target sequence contained within SEQ ID NO:39 or the complement thereof.

8. The combination of at least two oligomers of claim 7, wherein the detection probe target-hybridizing sequence consists of SEQ ID NO:55 or SEQ ID NO:67, including complements, DNA equivalents, and DNA/RNA chimerics thereof.

9. The combination of at least two oligomers of claim 7, wherein the at least one detection probe oligomer contains a 2′-methoxy backbone at one or more linkages in the nucleic acid backbone.

10. A kit comprising a combination of at least two oligomers for determining the presence or absence of hepatitis E virus (HEV) in a sample, said oligomer combination comprising: at least two amplification oligomers for amplifying a target region of an HEV target nucleic acid, wherein (a) at least one amplification oligomer is selected from the group consisting of (i) an oligomer comprising a target-hybridizing sequence that is from about 14 to about 23 contiguous nucleotides contained in the sequence of SEQ ID NO:63 and that includes at least the sequence of SEQ ID NO:26, including RNA equivalents and DNA/RNA chimerics thereof; and (ii) an oligomer comprising a target-hybridizing sequence consisting of SEQ ID NO:28, including RNA equivalents and DNA/RNA chimerics thereof; and (b) at least one amplification oligomer is a promoter primer comprising a target-hybridizing sequence consisting of SEQ ID NO:24, SEQ ID NO:45, SEQ ID NO:51, or SEQ ID NO:56, including RNA equivalents and DNA/RNA chimerics thereof and further comprising a promoter sequence that is non-complementary to the HEV target nucleic acid joined to the 5′ end of the target-hybridizing sequence of the promoter primer.

11. A method for determining the presence or absence of hepatitis E virus (HEV) in a sample, said method comprising: (1) contacting a sample, said sample suspected of containing HEV, with at least two oligomers for amplifying a target region of an HEV target nucleic acid, said oligomer combination comprising (a) at least one amplification oligomer comprising a target-hybridizing sequence that is from about 14 to about 23 contiguous nucleotides contained in the sequence of SEQ ID NO:63 and that includes at least the sequence of SEQ ID NO:26, including RNA equivalents and DNA/RNA chimerics thereof; and (b) at least one amplification oligomer that is a promoter primer comprising a target-hybridizing sequence consisting of SEQ ID NO:24, SEQ ID NO:45, SEQ ID NO:51, or SEQ ID NO:56, including RNA equivalents and DNA/RNA chimerics thereof and further comprising a promoter sequence that is non-complementary to the HEV target nucleic acid joined to the 5′ end of the target-hybridizing sequence of the promoter primer; (2) performing an in vitro nucleic acid amplification reaction, wherein any HEV target nucleic acid present in the sample is used as a template for generating an amplification product; and (3) contacting the amplification reaction with at least one detectably labeled detection probe oligomer comprising a target-hybridizing sequence that is from about 14 to about 28 nucleotides in length and is configured to specifically hybridize to a target sequence contained within SEQ ID NO:39 or the complement thereof, wherein said contacting is performed under conditions whereby the presence or absence of the amplification product is determined, thereby determining the presence or absence of HEV in the sample.

12. The method of claim 11, wherein the at least one amplification oligomer of (1)(a) comprises a target-hybridizing sequence consisting of SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:64, SEQ ID NO:65, or SEQ ID NO:66, including RNA equivalents and DNA/RNA chimerics thereof.

13. The method of claim 11, wherein the at least one amplification oligomer of (1)(a) comprises a target-hybridizing sequence consisting of SEQ ID NO:29, SEQ ID NO:30, or SEQ ID NO:31, including RNA equivalents and DNA/RNA chimerics thereof.

14. The method of claim 11, wherein the promoter sequence is a T7 promoter sequence.

15. The method of claim 14, wherein the T7 promoter sequence has the sequence shown in SEQ ID NO:73.

16. The method of claim 11, further comprising purifying the HEV target nucleic acid from other components in the sample before step (1), wherein the purifying step comprises contacting the sample with at least one capture probe oligomer comprising a target-hybridizing sequence covalently attached to a sequence or moiety that binds to an immobilized probe, wherein said target-hybridizing sequence consists of SEQ ID NO:4 or SEQ ID NO:42, including complements, DNA equivalents, and DNA/RNA chimerics thereof.

17. The method of claim 11, wherein the detection probe target-hybridizing sequence consists of SEQ ID NO:55 or SEQ ID NO:67, including complements, DNA equivalents, and DNA/RNA chimerics thereof.

18. The method of claim 11, wherein the at least one detection probe oligomer comprises a label selected from the group consisting of (a) a chemiluminescent label; (b) a fluorescent label; (c) a quencher; and (d) a combination of two or more of (a), (b), and (c).

19. The method of claim 18, wherein the detecting step (3) detects hybridization of the at least one labeled detection probe oligomer to the amplification product in a homogeneous detection system.

20. The method of claim 19, wherein the label is a chemiluminescent acridinium ester (AE) compound linked between two nucleobases of the at least one detection probe oligomer.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIGS. 1A-1D illustrate a reference sequence for a hepatitis E virus (HEV) genome (SEQ ID NO:1), complete sequence found at GenBank under accession number AB074918.2 and GI:21218075.

DETAILED DESCRIPTION OF THE INVENTION

(2) The present invention provides compositions, kits, and methods for amplifying and detecting hepatitis C virus (HEV) nucleic acid from a sample. Preferably, the samples are biological samples. The compositions, kits, and methods provide oligonucleotide sequences that recognize target sequences of the HEV genome, including target sequences of HEV genotypes 1, 2, 3, and 4, or their complementary sequences. Such oligonucleotides may be used as amplification oligonucleotides, which may include primers, promoter primers, blocked oligonucleotides, and promoter provider oligonucleotides, whose functions have been described previously (see, e.g., U.S. Pat. Nos. 4,683,195; 4,683,202; 4,800,159; 5,399,491; 5,554,516; 5,824,518; and 7,374,885; each incorporated by reference herein). Other oligonucleotides may be used as probes for detecting amplified sequences of HEV, or for capture of HEV target nucleic acid.

(3) The methods provide for the sensitive and specific detection of HEV nucleic acids. The methods include performing a nucleic acid amplification of an HEV target region and detecting the amplified product by, for example, specifically hybridizing the amplified product with a nucleic acid detection probe that provides a signal to indicate the presence of HEV in the sample. The amplification step includes contacting the sample with one or more amplification oligomers specific for a target sequence in an HEV target nucleic acid to produce an amplified product if HEV nucleic acid is present in the sample. Amplification synthesizes additional copies of the target sequence or its complement by using at least one nucleic acid polymerase and an amplification oligomer to produce the copies from a template strand (e.g., by extending the sequence from a primer using the template strand). One embodiment for detecting the amplified product uses a hybridizing step that includes contacting the amplified product with at least one probe specific for a sequence amplified by the selected amplification oligomers, e.g., a sequence contained in the target sequence flanked by a pair of selected amplification oligomers.

(4) The detection step may be performed using any of a variety of known techniques to detect a signal specifically associated with the amplified target sequence, such as, e.g., by hybridizing the amplification product with a labeled detection probe and detecting a signal resulting from the labeled probe. The detection step may also provide additional information on the amplified sequence, such as, e.g., all or a portion of its nucleic acid base sequence. Detection may be performed after the amplification reaction is completed, or may be performed simultaneously with amplifying the target region, e.g., in real time. In one embodiment, the detection step allows homogeneous detection, e.g., detection of the hybridized probe without removal of unhybridized probe from the mixture (see, e.g., U.S. Pat. Nos. 5,639,604 and 5,283,174, each incorporated by reference herein).

(5) In embodiments that detect the amplified product near or at the end of the amplification step, a linear detection probe may be used to provide a signal to indicate hybridization of the probe to the amplified product. One example of such detection uses a luminescentally labeled probe that hybridizes to target nucleic acid. Luminescent label is then hydrolyzed from non-hybridized probe. Detection is performed by chemiluminescence using a luminometer. (see, e.g., International Patent Application Pub. No. WO 89/002476, incorporated by reference herein). In other embodiments that use real-time detection, the detection probe may be a hairpin probe such as, for example, a molecular beacon, molecular torch, or hybridization switch probe that is labeled with a reporter moiety that is detected when the probe binds to amplified product. Such probes may comprise target-hybridizing sequences and non-target-hybridizing sequences. Various forms of such probes have been described previously (see, e.g., U.S. Pat. Nos. 5,118,801; 5,312,728; 5,925,517; 6,150,097; 6,849,412; 6,835,542; 6,534,274; and 6,361,945; and US Patent Application Pub. Nos. 20060068417A1 and 20060194240A1; each incorporated by reference herein).

(6) Preferred compositions of the instant invention are configured to specifically hybridize to nucleic acid of all four major HEV genotypes (types 1, 2, 3, and 4) with minimal cross-reactivity to other, non-HEV nucleic acids suspected of being in a sample (e.g., other bloodborne pathogens). In certain variations, compositions of the invention further allow detection of sequences that are provisionally designated as belonging to HEV genotype 6. In some aspects, the compositions of the instant invention are configured to specifically hybridize to HEV nucleic acid with minimal cross-reactivity to one or more of hepatitis C virus (HCV), human immunodeficiency virus 1 (HIV 1), hepatitis B virus (HBV), and West Nile virus. In one aspect, the compositions of the instant invention are part of a multiplex system that further includes components and methods for detecting one of more of these organisms.

(7) In certain aspects of the invention, a combination of at least two oligomers is provided for determining the presence or absence of HEV in a sample. Typically, the oligomer combination includes at least two amplification oligomers for amplifying a target region of an HEV target nucleic acid corresponding to the sequence of SEQ ID NO:1. In such embodiments, at least one amplification oligomer comprises a target-hybridizing sequence in the sense orientation (“sense THS”) and at least one amplification oligomer comprises a target-hybridizing sequence in the antisense orientation (“antisense THS”), where the sense THS and antisense THS are each configured to specifically hybridize to an HEV target sequence corresponding to a sequence contained within SEQ ID NO:1 and where the target-hybridizing sequences are selected such that the HEV sequence targeted by antisense THS is situated downstream of the HEV sequence targeted by the sense THS (i.e., the at least two amplification oligomers are situated such that they flank the target region to be amplified). In some variations, an oligomer combination includes (a)(i) an oligomer comprising a target-hybridizing sequence that is from about 14 to about 23 contiguous nucleotides and substantially corresponding to, or identical to, a sequence that is contained in the sequence of SEQ ID NO:63 and that includes at least the sequence of SEQ ID NO:26, or the complement thereof or an RNA equivalent or DNA/RNA chimeric thereof. In some variations, at least one amplification oligomer is (a)(ii) an oligomer comprising a target-hybridizing sequence that is from about 14 to about 23 contiguous nucleotides and substantially corresponding to, or identical to, a sequence that is contained in the sequence of SEQ ID NO:16, or the complement thereof or an RNA equivalent or DNA/RNA chimeric thereof. In some variations, at least one amplification oligomer is (b) an oligomer comprising a target-hybridizing sequence that is from about 17 to about 28 contiguous nucleotides and substantially corresponding to, or identical to, a sequence that is contained in the sequence of SEQ ID NO:47 and that includes at least the sequence of SEQ ID NO:25, or the complement thereof or an RNA equivalent or DNA/RNA chimeric thereof. In more specific embodiments, the at least one amplification oligomer for detecting HEV includes providing the at least one amplification oligomer in an amplification reaction mixture. In one aspect, each of the at least one amplification oligomers is provided in the amplification reaction mixture at a concentration from about 4 pmoles/reaction to about 12 pmoles/reaction (inclusive of all whole and partial numbers of the range (e.g., 4, 4.5, 5, 6.75, 8, 10, 10.25, 11, 12.01)). In some variations, the at least one amplification oligomer is a plurality of amplification oligomers, each of which are provided in the amplification reaction mixture at equal concentrations. In some variations, the at least one amplification oligomer is a plurality of amplification oligomers, each of which are not necessarily provided in the amplification reaction mixture at equal concentrations (e.g., one amplification oligomer is provided at twice the concentration of another amplification oligomer in an amplification reaction mixture).

(8) In variations comprising an amplification oligomer as in (a)(i), (a)(ii), or (b) above, the oligomer combination includes at least one an amplification oligomer comprising an HEV-specific target-hybridizing sequence of the opposite polarity (sense vs. antisense or vice versa) as the target-hybridizing sequence of the oligomer of (a)(i), (a)(ii), or (b), such that at least two amplification oligomers flank a target region to be amplified. In some such embodiments, an oligomer combination includes at least one oligomer as in (a)(i) and/or (a)(ii), and at least one oligomer as in (b), such that the oligomer(s) of (a)(i) and/or (a)(ii) and the oligomer(s) of (b) flank the target region to be amplified. In some such variations, the oligomer combination includes at least one amplification oligomer as in (a)(i), at least one amplification oligomer as in (a)(ii), and at least one amplification oligomer (e.g., two amplification oligomers) as in (b). In other such variations, the oligomer combination includes at least two amplification oligomers as in (b) and at least one amplification oligomer as in either of (a)(i) or (a)(ii).

(9) In more specific embodiments of the present invention, an oligomer combination for determining the presence or absence of HEV in a sample includes (1) at least one amplification oligomer comprising an HEV target-hybridizing region substantially corresponding to at least one sense oligomer sequence depicted in Table 1 below, and (2) at least one amplification oligomer comprising an HEV target hybridizing region substantially corresponding to at least one antisense oligomer sequence depicted in Table 1. In some such embodiments, the oligomer combination includes at least two amplification oligomers of (1) above and/or at least two amplification oligomers of (2) above. In particular variations, the sense and/or antisense target-hybridizing sequence(s) of an amplification oligomer combination comprises or consists of the sense and/or antisense sequence(s) selected from Table 1.

(10) TABLE-US-00001 TABLE 1 Exemplary Sense and Antisense Amplification Oligomer Target-hybridizing Sequences for Amplification of HEV Target Regions SEQ ID Sense/ NO: Sequence Antisense.sup.1 21 AGGGGTTGGTTGGATGAATATAG Antisense 22 AGGGGTTGGTTGGATGAATATAGG Antisense 23 AGGGGTTGGTTGGATGAATATAGGG Antisense 24 AGGGGTTGGTTGGATGAATATAGGGGA Antisense 28.sup.2 NCGGCGGTGGTTTCTNN Sense 29 CCGGCGGTGGTTTCT Sense 30 CCGGCGGTGGTTTCTG Sense 31 CCGGCGGTGGTTTCTGG Sense 32 CGGCGGTGGTTTCTGG Sense 33 CTATGCTGCCCGCGCC Sense 34 CTATGCTGCCCGCGCCA Sense 35 CTATGCTGCCCGCGCCAC Sense 45 GGCGAAGGGGTTGGTTGGATGAA Antisense 46 GGGCGAAGGGGTTGGTTGGATGAA Antisense 47 GGTTGGTTGGATGAATATAG Antisense 49 GGTTGGTTGGATGAATATAGG Antisense 50 GGTTGGTTGGATGAATATAGGG Antisense 51 GGTTGGTTGGATGAATATAGGGGA Antisense 52 GGTTTCTGGGGTGAC Sense 53 GTGGTTTCTGGGGTGA Sense 54 GTGGTTTCTGGGGTGAC Sense 56 SGGCGAAGGGGTTGGTTGGATGAA Antisense 61 TGCCTATGCTGCCCGCGCCAC Sense 62 TGCTGCCCGCGCCA Sense 64 TGCTGCCCGCGCCAC Sense 65 TGCTGCCCGCGCCACC Sense 66 TGCTGCCCGCGCCACCG Sense .sup.1The Sense/Antisense designation of these sequences is for exemplary purposes only. Such designation does not necessarily limit a sequence to the accompanying designation. .sup.2N at position 1 is C or is absent, N at position 16 is G or is absent, and N at position 17 is G or is absent. In some embodiments, if N at position 16 is G and N at position 17 is absent, then N at position 1 is C.

(11) In certain embodiments, an amplification oligomer as described herein is a promoter primer or promoter provider further comprising a promoter sequence located 5′ to the target-hybridizing sequence and which is non-complementary to the HEV target nucleic acid. For example, in some embodiments of an oligomer combination as described herein for amplification of an HEV target region, an amplification oligomer as described above in (b) (e.g., an amplification oligomer comprising or consisting of an antisense target-hybridizing sequence as shown in Table 1) is a promoter primer further comprising a 5′ promoter sequence. In particular embodiments, the promoter sequence is a T7 RNA polymerase promoter sequence such as, for example, a T7 promoter sequence having the sequence shown in SEQ ID NO:73. In specific variations, the amplification oligomer of (b) is a promoter primer having the sequence shown in SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:18, or SEQ ID NO:20.

(12) In some embodiments, an oligomer combination as described herein further includes a terminating oligonucleotide (also referred to herein as a “blocker” oligonucleotide) comprising comprises a base sequence substantially complementary (e.g., fully complementary) to a sequence contained within the target nucleic acid in the vicinity of the 5′-end of the target region. A terminating oligomer is typically used in combination with, e.g., a promoter provider amplification oligomer, such as, for example, in certain embodiments described herein relating to transcription-mediated amplification (TMA).

(13) In some embodiments, an oligomer combination as described herein further comprises at least one capture probe oligomer comprising a target-hybridizing sequence substantially corresponding to a sequence contained in the complement of SEQ ID NO:1, wherein the target-hybridizing sequence is covalently attached to a sequence or moiety that binds to an immobilized probe. In specific variations, the target-hybridizing sequence comprises or consists of a sequence substantially corresponding to, or identical to, a sequence selected from SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:42, including complements, DNA equivalents, and DNA/RNA chimerics thereof. In more specific variations, the capture probe oligomer has a sequence selected from SEQ ID NO:3, SEQ ID NO:7, and SEQ ID NO:43. An oligomer combination may include at least two (e.g., three) capture probe oligomers as above. In more specific embodiments, the at least one capture probe oligomer includes providing the at least one capture probe oligomer in a target capture reaction mixture. In one aspect, each of the at least one capture probe oligomers is provided in the target capture reaction mixture at a concentration from about 3 pmoles/reaction to about 6 pmoles/reaction (inclusive of all whole and partial numbers of the range (e.g., 4, 4.75, 5.12, 5.98, 6)). When a plurality of at least one capture probe oligomer is used in a target capture reaction the concentration of each capture probe oligomer may be equal to the concentration of the others or there may be varied concentrations, as described herein.

(14) In certain variations, an oligomer combination as described herein further comprises at least one detection probe oligomer configured to specifically hybridize to an HEV target sequence that is amplifiable using the first and second amplification oligomers (e.g., an HEV target sequence that is flanked by the target-hybridizing sequences of the first and second amplification oligomers). In particular embodiments, the detection probe oligomer includes a target-hybridizing sequence that is from about 14 to about 28 nucleotides in length and is configured to specifically hybridize to a target sequence contained within SEQ ID NO:39 or the complement thereof. Particularly suitable detection probe oligomers include, for example, oligomers comprising a target-hybridizing sequence substantially corresponding to, or identical to, a sequence selected from SEQ ID NO:37, SEQ ID NO:55, SEQ ID NO:67, and SEQ ID NO:71, including complements, DNA equivalents, and DNA/RNA chimerics thereof. A detection probe oligomer may contain a 2′-methoxy backbone at one or more linkages in the nucleic acid backbone. In some variations, an oligomer combination includes at least two detection probe oligomers. In more specific embodiments, the at least one detection probe oligomer includes providing the at least one detection probe oligomer in an amplicon detection reaction mixture. In one aspect, each of the at least one detection probe oligomers is provided in the detection reaction mixture at about 2.0 E+06 RLU/reaction to about 6.0 E+06 RLU/reaction (inclusive of all whole and partial numbers of the range (e.g., 2.0 E+06, 2.138 E+06, 3.385 E+06 RLU)). When a plurality of at least one detection probe oligomer is used in a detection reaction the concentration of each detection oligomer may be equal to the concentration of the others or there may be varied concentrations, as described herein.

(15) Typically, a detection probe oligomer in accordance with the present invention further includes a label. Particularly suitable labels include compounds that emit a detectable light signal, e.g., fluorophores or luminescent (e.g., chemiluminescent) compounds that can be detected in a homogeneous mixture. More than one label, and more than one type of label, may be present on a particular probe, or detection may rely on using a mixture of probes in which each probe is labeled with a compound that produces a detectable signal (see, e.g., U.S. Pat. Nos. 6,180,340 and 6,350,579, each incorporated by reference herein). Labels may be attached to a probe by various means including covalent linkages, chelation, and ionic interactions, but preferably the label is covalently attached. For example, in some embodiments, a detection probe has an attached chemiluminescent label such as, e.g., an acridinium ester (AE) compound (see, e.g., U.S. Pat. Nos. 5,185,439; 5,639,604; 5,585,481; and 5,656,744; each incorporated by reference herein), which in typical variations is attached to the probe by a non-nucleotide linker (see, e.g., U.S. Pat. Nos. 5,585,481; 5,656,744; and 5,639,604, particularly at column 10, line 6 to column 11, line 3, and Example 8; each incorporated by reference herein). In other embodiments, a detection probe comprises both a fluorescent label and a quencher, a combination that is particularly useful in fluorescence resonance energy transfer (FRET) assays. Specific variations of such detection probes include, e.g., a TaqMan detection probe (Roche Molecular Diagnostics) and a “molecular beacon” (see, e.g., Tyagi et al., Nature Biotechnol. 16:49-53, 1998; U.S. Pat. Nos. 5,118,801 and 5,312,728; each incorporated by reference herein).

(16) A detection probe oligomer in accordance with the present invention may further include a non-target-hybridizing sequence. Specific embodiments of such detection probes include, for example, probes that form conformations held by intramolecular hybridization, such as conformations generally referred to as hairpins. Particularly suitable hairpin probes include a “molecular torch” (see, e.g., U.S. Pat. Nos. 6,849,412; 6,835,542; 6,534,274; and 6,361,945, each incorporated by reference herein) and a “molecular beacon” (see, e.g., Tyagi et al., supra; U.S. Pat. Nos. 5,118,801 and 5,312,728, supra). Methods for using such hairpin probes are well-known in the art.

(17) In yet other embodiments, a detection probe is a linear oligomers that does not substantially form conformations held by intramolecular bonds. In specific variations, a linear detection probe oligomer includes a chemiluminescent compound as the label, preferably an acridinium ester (AE) compound.

(18) In yet other variations, an oligomer combination for detection of an HEV nucleic acid further comprises a probe protection oligomer substantially complementary to a detection probe oligomer. A probe protection oligomer may be hybridized to a substantially complementary, labeled detection probe oligomer (e.g., a probe labeled with a chemiluminescent compound) to stabilize the labeled probe during storage. In specific embodiments, a probe protection oligomer has a sequence substantially corresponding to, or identical to, a sequence selected from SEQ ID NO:36 and SEQ ID NO:40.

(19) Also provided by the present invention are detection probe oligomers, capture probe oligomers, and probe protection oligomers as described herein.

(20) In another aspect, the present invention provides methods for determining the presence or absence of HEV in a sample using an oligomer combination as described herein. Such a method generally includes (1) contacting the sample with at least two oligomers for amplifying an HEV nucleic acid target region corresponding to an HEV target nucleic acid, where the oligomers include at least two amplification oligomers as described above; (2) performing an in vitro nucleic acid amplification reaction, where any HEV target nucleic acid present in the sample is used as a template for generating an amplification product; and (3) detecting the presence or absence of the amplification product, thereby determining the presence or absence of HEV in the sample. A detection method in accordance with the present invention typically further includes the step of obtaining the sample to be contacted with the at least two oligomers. In certain embodiments, “obtaining” a sample to be used in steps (1)-(3) includes, for example, receiving the sample at a testing facility or other location where one or more steps of the method are performed, and/or retrieving the sample from a location (e.g., from storage or other depository) within a facility where one or more steps of the method are performed.

(21) In certain embodiments, the method further includes purifying the HEV target nucleic acid from other components in the sample before the contacting step. Such purification may include methods of separating and/or concentrating organisms contained in a sample from other sample components. In particular embodiments, purifying the target nucleic acid includes capturing the target nucleic acid to specifically or non-specifically separate the target nucleic acid from other sample components. Non-specific target capture methods may involve selective precipitation of nucleic acids from a substantially aqueous mixture, adherence of nucleic acids to a support that is washed to remove other sample components, or other means of physically separating nucleic acids from a mixture that contains HEV nucleic acid and other sample components.

(22) In some embodiments, an HEV target nucleic is selectively separated from other sample components by specifically hybridizing the HEV target nucleic acid to a capture probe oligomer. The capture probe oligomer comprises a target-hybridizing sequence configured to specifically hybridize to an HEV target sequence so as to form a target-sequence:capture-probe complex that is separated from sample components. Suitable capture probe target-hybridizing sequences include sequences substantially corresponding to, or identical to, a sequence selected from SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, and SEQ ID NO:42, including complements, DNA equivalents, and DNA/RNA chimerics thereof. In a preferred variation, the specific target capture binds the HEV target:capture-probe complex to an immobilized probe to form a target:capture-probe:immobilized-probe complex that is separated from the sample and, optionally, washed to remove non-target sample components (see, e.g., U.S. Pat. Nos. 6,110,678; 6,280,952; and 6,534,273; each incorporated by reference herein). In such variations, the capture probe oligomer further comprises a sequence or moiety that binds attaches the capture probe, with its bound target sequence, to an immobilized probe attached to a solid support, thereby permitting the hybridized target nucleic acid to be separated from other sample components.

(23) In more specific embodiments, the capture probe oligomer includes a tail portion (e.g., a 3′ tail) that is not complementary to the HEV target sequence but that specifically hybridizes to a sequence on the immobilized probe, thereby serving as the moiety allowing the target nucleic acid to be separated from other sample components, such as previously described in, e.g., U.S. Pat. No. 6,110,678, incorporated herein by reference. Any sequence may be used in a tail region, which is generally about 5 to 50 nt long, and preferred embodiments include a substantially homopolymeric tail of about 10 to 40 nt (e.g., A.sub.10 to A.sub.40), more preferably about 14 to 33 nt (e.g., A.sub.14 to A.sub.30 or T.sub.3A.sub.14 to T.sub.3A.sub.30), that bind to a complementary immobilized sequence (e.g., poly-T) attached to a solid support, e.g., a matrix or particle. For example, in specific embodiments of a capture probe comprising a 3′ tail, the capture probe has a sequence selected from SEQ ID NO:3, SEQ ID NO:7, and SEQ ID NO:43.

(24) Target capture typically occurs in a solution phase mixture that contains one or more capture probe oligomers that hybridize specifically to the HEV target sequence under hybridizing conditions, usually at a temperature higher than the T.sub.m of the tail-sequence:immobilized-probe-sequence duplex. For embodiments comprising a capture probe tail, the HEV-target:capture-probe complex is captured by adjusting the hybridization conditions so that the capture probe tail hybridizes to the immobilized probe, and the entire complex on the solid support is then separated from other sample components. The support with the attached immobilized-probe:capture-probe:HEV-target-sequence may be washed one or more times to further remove other sample components. Preferred embodiments use a particulate solid support, such as paramagnetic beads, so that particles with the attached HEV-target:capture-probeimmobilized-probe complex may be suspended in a washing solution and retrieved from the washing solution, preferably by using magnetic attraction. To limit the number of handling steps, the HEV target nucleic acid may be amplified by simply mixing the HEV target sequence in the complex on the support with amplification oligomers and proceeding with amplification steps.

(25) Amplifying an HEV target sequence utilizes an in vitro amplification reaction using at least two amplification oligomers that flank a target region to be amplified. In particular embodiments, the target region to be amplified substantially corresponds to SEQ ID NO:1 from about nucleotide position 5230 to about nucleotide position 5379. Particularly suitable amplification oligomer combinations for amplification of these target regions are described herein. Suitable amplification methods include, for example, replicase-mediated amplification, polymerase chain reaction (PCR), ligase chain reaction (LCR), strand-displacement amplification (SDA), and transcription-mediated or transcription-associated amplification (TMA). Such amplification methods are well-known in the art and are readily used in accordance with the methods of the present invention.

(26) For example, some amplification methods that use TMA amplification include the following steps. Briefly, the target nucleic acid that contains the sequence to be amplified is provided as single-stranded nucleic acid (e.g., ssRNA or ssDNA). Those skilled in the art will appreciate that conventional melting of double stranded nucleic acid (e.g., dsDNA) may be used to provide single-stranded target nucleic acids. A promoter primer binds specifically to the target nucleic acid at its target sequence and a reverse transcriptase (RT) extends the 3′ end of the promoter primer using the target strand as a template to create a cDNA copy of the target sequence strand, resulting in an RNA:DNA duplex. An RNase digests the RNA strand of the RNA:DNA duplex and a second primer binds specifically to its target sequence, which is located on the cDNA strand downstream from the promoter primer end. RT synthesizes a new DNA strand by extending the 3′ end of the second primer using the first cDNA template to create a dsDNA that contains a functional promoter sequence. An RNA polymerase specific for the promoter sequence then initiates transcription to produce RNA transcripts that are about 100 to 1000 amplified copies (“amplicons”) of the initial target strand in the reaction. Amplification continues when the second primer binds specifically to its target sequence in each of the amplicons and RT creates a DNA copy from the amplicon RNA template to produce an RNA:DNA duplex. RNase in the reaction mixture digests the amplicon RNA from the RNA:DNA duplex and the promoter primer binds specifically to its complementary sequence in the newly synthesized DNA. RT extends the 3′ end of the promoter primer to create a dsDNA that contains a functional promoter to which the RNA polymerase binds to transcribe additional amplicons that are complementary to the target strand. The autocatalytic cycles of making more amplicon copies repeat during the course of the reaction resulting in about a billion-fold amplification of the target nucleic acid present in the sample. The amplified products may be detected in real-time during amplification, or at the end of the amplification reaction by using a probe that binds specifically to a target sequence contained in the amplified products. Detection of a signal resulting from the bound probes indicates the presence of the target nucleic acid in the sample.

(27) In some embodiments, the method utilizes a “reverse” TMA reaction. In such variations, the initial or “forward” amplification oligomer is a priming oligonucleotide that hybridizes to the target nucleic acid in the vicinity of the 3′-end of the target region. A reverse transcriptase (RT) synthesizes a cDNA strand by extending the 3′-end of the primer using the target nucleic acid as a template. The second or “reverse” amplification oligomer is a promoter primer or promoter provider having a target-hybridizing sequence configured to hybridize to a target-sequence contained within the synthesized cDNA strand. Where the second amplification oligomer is a promoter primer, RT extends the 3′ end of the promoter primer using the cDNA strand as a template to create a second, cDNA copy of the target sequence strand, thereby creating a dsDNA that contains a functional promoter sequence. Amplification then continues essentially as described above for initiation of transcription from the promoter sequence utilizing an RNA polymerase. Alternatively, where the second amplification oligomer is a promoter provider, a terminating oligonucleotide, which hybridizes to a target sequence that is in the vicinity to the 5′-end of the target region, is typically utilized to terminate extension of the priming oligomer at the 3′-end of the terminating oligonucleotide, thereby providing a defined 3′-end for the initial cDNA strand synthesized by extension from the priming oligomer. The target-hybridizing sequence of the promoter provider then hybridizes to the defined 3′-end of the initial cDNA strand, and the 3′-end of the cDNA strand is extended to add sequence complementary to the promoter sequence of the promoter provider, resulting in the formation of a double-stranded promoter sequence. The initial cDNA strand is then used a template to transcribe multiple RNA transcripts complementary to the initial cDNA strand, not including the promoter portion, using an RNA polymerase that recognizes the double-stranded promoter and initiates transcription therefrom. Each of these RNA transcripts is then available to serve as a template for further amplification from the first priming amplification oligomer.

(28) Detection of the amplified products may be accomplished by a variety of methods. The nucleic acids may be associated with a surface that results in a physical change, such as a detectable electrical change. Amplified nucleic acids may be detected by concentrating them in or on a matrix and detecting the nucleic acids or dyes associated with them (e.g., an intercalating agent such as ethidium bromide or cyber green), or detecting an increase in dye associated with nucleic acid in solution phase. Other methods of detection may use nucleic acid detection probes that are configured to specifically hybridize to a sequence in the amplified product and detecting the presence of the probe:product complex, or by using a complex of probes that may amplify the detectable signal associated with the amplified products (e.g., U.S. Pat. Nos. 5,424,413; 5,451,503; and 5,849,481; each incorporated by reference herein). Directly or indirectly labeled probes that specifically associate with the amplified product provide a detectable signal that indicates the presence of the target nucleic acid in the sample. In particular, the amplified product will contain a target sequence in or complementary to a sequence in the HEV genomic RNA, and a probe will bind directly or indirectly to a sequence contained in the amplified product to indicate the presence of HEV nucleic acid in the tested sample.

(29) Preferred embodiments of detection probes that hybridize to the complementary amplified sequences may be DNA or RNA oligomers, or oligomers that contain a combination of DNA and RNA nucleotides, or oligomers synthesized with a modified backbone, e.g., an oligomer that includes one or more 2′-methoxy substituted ribonucleotides. Probes used for detection of the amplified HEV sequences may be unlabeled and detected indirectly (e.g., by binding of another binding partner to a moiety on the probe) or may be labeled with a variety of detectable labels. Particular embodiments of detection probes suitable for use in accordance with methods of the present invention are further described herein. In some preferred embodiments of the method for detecting HEV sequences, such as in certain embodiments using transcription-mediated amplification (TMA), the detection probe is a linear chemiluminescently labeled probe, more preferably, a linear acridinium ester (AE) labeled probe.

(30) Oligomers that are not intended to be extended by a nucleic acid polymerase preferably include a blocker group that replaces the 3′ OH to prevent enzyme-mediated extension of the oligomer in an amplification reaction. For example, blocked amplification oligomers and/or detection probes present during amplification preferably do not have a functional 3′ OH and instead include one or more blocking groups located at or near the 3′ end. A blocking group near the 3′ end is preferably within five residues of the 3′ end and is sufficiently large to limit binding of a polymerase to the oligomer, and other preferred embodiments contain a blocking group covalently attached to the 3′ terminus. Many different chemical groups may be used to block the 3′ end, e.g., alkyl groups, non-nucleotide linkers, alkane-diol dideoxynucleotide residues, and cordycepin.

(31) Examples of oligomers that are typically blocked at the 3′ end—and which are particularly suitable in certain embodiments using transcription-mediated amplification—are promoter providers. As described previously, a promoter provider comprises first target-hybridizing region and, situated 5′ to the first region, a second region comprising a promoter sequence for an RNA polymerase. The promoter provider oligonucleotide is modified to prevent the initiation of DNA synthesis from its 3′-terminus, such as by including a blocker group as discussed above.

(32) Another example of typically 3′-blocked oligomers are terminating (“blocker”) oligonucleotides, previously described above. A terminating oligomer is typically used in combination with, e.g., a promoter provider amplification oligomer, such as, for example, in certain embodiments described herein relating to transcription-mediated amplification (TMA). A terminating oligomer hybridizes to a sequence contained within the target nucleic acid in the vicinity of the 5′-end of the target region so as to “terminate” primer extension of a nascent nucleic acid that includes a priming oligonucleotide, thereby providing a defined 3′-end for the nascent nucleic acid strand.

(33) Other embodiments using transcription-mediated amplification utilize a promoter primer, which comprises a first target-hybridizing region and, situated 5′ to the first region, a second region comprising a promoter sequence for an RNA polymerase, but which is not modified to prevent the initiation of DNA synthesis from its 3′-terminus. In some embodiments, a promoter primer for use in accordance with the detection method comprises a target-hybridizing sequence having a sequence substantially corresponding to, or identical to, a sequence selected from SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:56. In certain variations of a promoter primer comprising a target-hybridizing sequence as in SEQ ID NO:56, the nucleobase at position 1 of SEQ ID NO:56 is guanine (G); in other variations, the promoter primer has degeneracy at position 1 of SEQ ID NO:56, such this position is occupied by either cytosine (C) or guanine (G) within a population of oligomers comprising SEQ ID NO:56. In more specific variations, a promoter primer for use in accordance with the detection method has the sequence shown in SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, or SEQ ID NO:20.

(34) Assays for detection of the HEV nucleic acid may optionally include a non-HEV internal control (IC) nucleic acid that is amplified and detected in the same assay reaction mixtures by using amplification and detection oligomers specific for the IC sequence. IC nucleic acid sequences can be RNA template sequences (e.g., and in vitro transcript), synthetic nucleic acid sequences that are spiked into a sample or the IC nucleic acid sequences may be a cellular component. IC nucleic acid sequences that are cellular components can be from exogenous cellular sources or endogenous cellular sources relative to the specimen. In these instances, an internal control nucleic acid is co-amplified with the HEV nucleic acid in the amplification reaction mixtures. The internal control amplification product and the HEV target sequence amplification product can be detected independently. Two different internal control systems were employed in the procedures described below.

(35) A first arrangement for internal control systems was useful for monitoring the integrity of amplification and detection reactions that employ paired sets of primers and an oligonucleotide probe that hybridized amplification product at a position between the primer binding sites, or the complements thereof. This arrangement was used in the assays described under Examples below. In a simple application, the internal control template nucleic acid can be distinguished from the analyte template nucleic acid at the sequence of bases serving as the probe binding site. These bases may be scrambled, replaced by an unrelated base sequence, or simply contain a sufficient number of point mutations to result in differential probe binding. In this way, nucleic acid products resulting from amplification of analyte nucleic acid can be detected by an analyte-specific probe, and not by an internal control-specific probe. Likewise, amplicons resulting from amplification of internal control nucleic acid can be detected by an internal control-specific probe, and not by an analyte-specific probe. This configuration allows that both analyte and internal control nucleic acid templates may be amplified using identical primers, or primer sets.

(36) In certain embodiments, amplification and detection of a signal from the amplified IC sequence demonstrates that the assay reagents, conditions, and performance of assay steps were properly used in the assay if no signal is obtained for the intended target HEV nucleic acid (e.g., samples that test negative for HEV). An IC may also be used as an internal calibrator for the assay when a quantitative result is desired, i.e., the signal obtained from the IC amplification and detection is used to set a parameter used in an algorithm for quantitating the amount of HEV nucleic acid in a sample based on the signal obtained for an amplified HEV target sequence. ICs are also useful for monitoring the integrity of one or more steps in an assay. A preferred embodiment of a synthetic IC nucleic acid sequence is a randomized sequence that has been derived from a naturally occurring source (e.g., an HIV sequence that has been rearranged in a random manner). Another preferred IC nucleic acid sequence may be an RNA transcript isolated from a naturally occurring source or synthesized in vitro, such as by making transcripts from a cloned randomized sequence such that the number of copies of IC included in an assay may be accurately determined. The primers and probe for the IC target sequence are configured and synthesized by using any well-known method provided that the primers and probe function for amplification of the IC target sequence and detection of the amplified IC sequence using substantially the same assay conditions used to amplify and detect the HEV target sequence. In preferred embodiments that include a target capture-based purification step, it is preferred that a target capture probe specific for the IC target be included in the assay in the target capture step so that the IC is treated in the assay in a manner analogous to that for the intended HEV analyte in all of the assay steps.

(37) In certain embodiments of a method for determining the presence or absence of HEV in sample, the method further includes the use of a probe protection oligomer as described herein to adjust assay sensitivity.

(38) Also provided by the subject invention is a reaction mixture for determining the presence or absence of an HEV target nucleic acid in a sample. A reaction mixture in accordance with the present invention at least comprises one or more of the following: an oligomer combination as described herein for amplification of an HEV target nucleic acid; a capture probe oligomer as described herein for purifying the HEV target nucleic acid; a detection probe oligomer as described herein for determining the presence or absence of an HEV amplification product; and a probe protection oligomer as described herein for detuning sensitivity of an assay for detecting the HEV target nucleic acid. The reaction mixture may further include a number of optional components such as, for example, arrays of capture probe nucleic acids. For an amplification reaction mixture, the reaction mixture will typically include other reagents suitable for performing in vitro amplification such as, e.g., buffers, salt solutions, appropriate nucleotide triphosphates (e.g., dATP, dCTP, dGTP, dTTP, ATP, CTP, GTP and UTP), and/or enzymes (e.g., reverse transcriptase, and/or RNA polymerase), and will typically include test sample components, in which an HEV target nucleic acid may or may not be present. In addition, for a reaction mixture that includes a detection probe together with an amplification oligomer combination, selection of amplification oligomers and detection probe oligomers for a reaction mixture are linked by a common target region (i.e., the reaction mixture will include a probe that binds to a sequence amplifiable by an amplification oligomer combination of the reaction mixture).

(39) Also provided by the subject invention are kits for practicing the methods as described herein. A kit in accordance with the present invention at least comprises one or more of the following: an amplification oligomer combination as described herein for amplification of an HEV target nucleic acid; a capture probe oligomer as described herein for purifying the HEV target nucleic acid; a detection probe oligomer as described herein for determining the presence or absence of an HEV amplification product; and a probe protection oligomer as described herein for detuning sensitivity of an assay for detecting the HEV target nucleic acid. The kits may further include a number of optional components such as, for example, arrays of capture probe nucleic acids. Other reagents that may be present in the kits include reagents suitable for performing in vitro amplification such as, e.g., buffers, salt solutions, appropriate nucleotide triphosphates (e.g., dATP, dCTP, dGTP, dTTP, ATP, CTP, GTP and UTP), and/or enzymes (e.g., reverse transcriptase, and/or RNA polymerase). Oligomers as described herein may be packaged in a variety of different embodiments, and those skilled in the art will appreciate that the invention embraces many different kit configurations. For example, a kit may include amplification oligomers for only one target region of an HEV genome, or it may include amplification oligomers for multiple HEV target regions. In addition, for a kit that includes a detection probe together with an amplification oligomer combination, selection of amplification oligomers and detection probe oligomers for a kit are linked by a common target region (i.e., the kit will include a probe that binds to a sequence amplifiable by an amplification oligomer combination of the kit). In certain embodiments, the kit further includes a set of instructions for practicing methods in accordance with the present invention, where the instructions may be associated with a package insert and/or the packaging of the kit or the components thereof.

(40) The invention is further illustrated by the following non-limiting examples.

Example 1

(41) This example describes amplification reactions using various primer sets for amplification of an HEV target region. Table 2 below lists all the amplification oligomers used in this assay.

(42) TABLE-US-00002 TABLE 2 HEV Amplification Oligomers Class SEQ ID NO: nonT7 50 53 52 31 30 29 66 65 64 62 35 34 33 61 T7 17 18 19 20 9 10 11 12 15 14

(43) Each possible combination of the T7 and nonT7 primers listed in Table 2 were tested. Primers were tested in a transcription-mediated amplification (TMA) reaction using an HEV in vitro transcript (IVT) at 15 and 0 copies/reaction. Transcription mediated amplification (TMA) reactions were carried out essentially as described by Kacian et al., in U.S. Pat. No. 5,399,491, the disclosure of this U.S. patent having been incorporated by reference hereinabove. Amplification reactions were conducted for various primer combinations using about 5 to 10 pmoles per reaction of each T7 primer and nonT7 primer. Amplification products were detected by hybridization protection assay (HPA) using an AE-labeled detection probe (having the nucleobase sequence shown in SEQ ID NO:67). Signal-to-noise ratios were calculated for each primer pair by dividing the RLU value observed at 15 copies of HEV IVT by the background RLU value observed at 0 copies of HEV IVT. The results are shown in Table 3 below.

(44) TABLE-US-00003 TABLE 3 Signal-to-Noise Ratio of HEV T7/nonT7 Primer Pairs nonT7† 66 65 64 62 61 53 52 50 35 34 33 31 30 29 T7† 9 898.1 896.5 487 802.2 599.2 1.6 0.9 75 916.5 361.1 956.7 910 943.3 1010 10 1183.7 974.4 1078.3 1023.6 1097.1 5.2 2.9 289.1 994.3 971.8 282.3 1102.3 22.9 907 11 1252.1 1286.2 933.6 1023 709.5 12 4 314.6 1013.3 1139.3 1044.1 308 14.9 906.3 12 944.6 980.1 1007.9 1061.4 595.1 675.9 26 1026.2 966.6 942.8 927.6 945.7 953.4 854.5 14 3204.9 3120.2 2855.6 2919.1 2576.4 1001.5 1.6 891.9 2282.4 2574.2 2809.9 1800.1 227.1 679.9 15 1545.2 2074.8 2578.8 1361.2 2639.7 252.3 2.4 433.5 1253.3 2690.7 2161.8 313.7 1782.1 1058.6 17 273.8 429.2 498 220.6 281.2 0.7 3.3 8.5 135.4 222.5 65.9 201.8 1.7 233.9 18 914 445.7 896.2 906.3 780 0.9 0.9 1.1 809.1 716 171.2 1377.4 3 1191.2 19 406.4 983.8 1135.8 750.1 703.8 1.1 1 1.6 981.4 836.6 496.4 1512.5 135.6 1075 20 1225.7 1048.4 898.3 752.8 786.5 124.9 1 345.5 886.1 892.5 737.5 1249.7 932.2 1197.9 †NonT7 primer designations are the SEQ ID NOs, as listed in Table 2, supra. Similarly, T7 primer designations are the SEQ ID NOs, as listed in Table 2, supra.

(45) Primer pairs that demonstrated a signal-to-background ratio of at least 10 or more were considered to be successful for amplification of HEV target nucleic acid to at least as low as 15 copies per reaction, while those pairs demonstrating a ratio of below 10 were considered to be unsuccessful. Ratios over 10 are shown in bold in Table 3.

Example 2

(46) This example describes HEV amplification and detection assays performed using different oligomer combinations. Reagents, oligonucleotides, and samples used in these experiments are listed in Tables 4-6 below.

(47) TABLE-US-00004 TABLE 4 HEV Assay Reagents Reagent Name Description Internal Control Reagent A HEPES buffered solution containing detergent and an RNA transcript. Target Capture Reagent A HEPES buffered solution containing detergent, capture oligonucleotides and magnetic microparticles. Amplification Reagent Primers, dNTPs, NTPs and co-factors in TRIS buffered solution containing ProClin 300 as preservative. Enzyme Reagent MMLV Reverse Transcriptase and T7 RNA Polymerase in HEPES/TRIS buffered solution containing 0.05% sodium azide as preservative. Probe Reagent Chemiluminescent oligonucleotide probes in succinate buffered solution containing detergent. HEV Negative Calibrator A HEPES buffered solution containing detergent. HEV Positive Calibrator A HEPES buffered solution containing detergent and an HEV RNA transcript.

(48) TABLE-US-00005 TABLE 5 HEV-specific Oligonucleotides Class SEQ ID NO: Target Capture 74 Oligo Target Capture 76 Oligo Target Capture 43 Oligo Target Capture 3 Oligo Target Capture 7 Oligo Non-T7 Primer 29 Non-T7 Primer 66 Non-T7 Primer 65 Non-T7 Primer 64 Non-T7 Primer 62 T7 Primer 12 T7 Primer 15 AE Labeled 67 Probe AE Labeled 55 Probe AE Labeled 55 Probe AE Labeled 55 Probe

(49) TABLE-US-00006 TABLE 6 Samples Tested Sample Description Positive Sample HEV In Vitro Transcript (IVT) in IC buffer Negative Sample HEV negative serum
Steps Performed
Principles of the Procedure

(50) The HEV assay involved three main steps, which take place in a single tube: sample preparation; HEV RNA target amplification by Transcription-Mediated Amplification (TMA); and detection of the amplification products (amplicon) by the Hybridization Protection Assay (HPA).

(51) During sample preparation, RNA was isolated from specimens via the use of target capture. The specimen was treated with a detergent to solubilize the viral particles, denature proteins and release viral genomic RNA. Oligonucleotides (“capture oligonucleotides”) that are homologous to highly conserved regions of HEV were hybridized to the HEV RNA target, if present, in the test specimen. The hybridized target was then captured onto magnetic microparticles that were separated from the specimen in a magnetic field. Wash steps were utilized to remove extraneous components from the reaction tube. Magnetic separation and wash steps were performed with a target capture system.

(52) Target amplification occurred via TMA, which is a transcription-based nucleic acid amplification method that utilizes two enzymes, MMLV reverse transcriptase and T7 RNA polymerase. The reverse transcriptase was used to generate a DNA copy (containing a promoter sequence for T7 RNA polymerase) of the target RNA sequence. The T7 RNA polymerase produces multiple copies of RNA amplicon from the DNA copy template. The HEV assay utilized the TMA method to amplify regions of HEV RNA.

(53) Detection was achieved by HPA using single-stranded nucleic acid probes with chemiluminescent labels that are complementary to the amplicon. The labeled nucleic acid probes hybridize specifically to the amplicon. The Selection Reagent differentiated between hybridized and unhybridized probes by inactivating the label on unhybridized probes. During the detection step, the chemiluminescent signal produced by the hybridized probe was measured by a luminometer and was reported as Relative Light Units (RLU).

(54) Internal Control was added to each test specimen and assay calibrator via the working Target Capture Reagent. The Internal Control (IC) in the HEV assay controlled for specimen processing, amplification and detection steps. Internal Control signal was discriminated from the HEV signal by the differential kinetics of light emission from probes with different labels. Internal Control-specific amplicon was detected using a probe with rapid emission of light (flasher signal). Amplicon specific to HEV was detected using probes with relatively slower kinetics of light emission (glower signal). The Dual Kinetic Assay (DKA) is a method used to differentiate between the signals from flasher and glower labels.

(55) Order of Steps

(56) Target Capture: Nucleic acids underwent specimen processing and target capture prior to amplification essentially according to the procedures disclosed in published International Patent Application No. PCT/US2000/18685, except that templates were captured using Hepatitis E virus target capture oligonucleotides having the sequences given herein. Notably, capture oligonucleotides do not participate in the amplification or detection reactions of the assay. Virus-containing samples were combined with a target capture reagent to facilitate nucleic acid release and hybridization to capture oligonucleotides disposed on magnetic beads. Incubation were performed to capture HEV nucleic acids from the sample. Following the incubation, the magnetic beads and any capture target nucleic acids were transferred to a magnetic wash station for 10-20 min. for a wash step. Captured target nucleic acids were then assayed in an amplification reaction.

(57) Transcription mediated amplification (TMA) reactions were carried out essentially as described in Example 1. Isolated target nucleic acids were combined with primers in amplification reagent (Table 2) heated to 60° C. for 10 minutes and then cooled to 42° C. to facilitate primer annealing. Enzyme reagent was then added to the mixtures and the amplification reactions were carried out, as will be familiar to those having an ordinary level of skill in the art.

(58) Detection: After a one hour incubation at 42° C., the amplification reaction volumes were subjected to hybridization assays employing probes internally labeled with a chemiluminescent compound using techniques familiar to those having an ordinary level of skill in the art, and then used in amounts equivalent to about 2 E+06 to about 6 E+06 RLU for each probe in the hybridization reaction. (See e.g., U.S. Pat. Nos. 5,585,481 and 5,639,604, the disclosures of these patents are incorporated by reference). Hybridization reactions were followed by addition of an aliquot of 0.15 M sodium tetraborate (pH 8.5), and 1% TRITON X-100 (Union Carbide Corporation; Danbury, Conn.). These mixtures were first incubated at 60° C. for 10 minutes to inactivate the chemiluminescent label linked to unhybridized probe, and cooled briefly to room temperature (i.e., 15-30° C.) prior to reading the hybridization signal. Chemiluminescence due to hybridized probe in each sample was assayed using commercially available instrumentation (Gen-Probe Incorporated; San Diego, Calif.) configured for injection of 1 mM nitric acid and 0.1% (v/v) hydrogen peroxide, followed by injection of a solution containing 1 N sodium hydroxide. Results for the chemiluminescent reactions were measured in relative light units (RLU). In this procedure, the signal/noise value corresponded to the chemiluminescent signal (measured in RLU) generated by label associated with specifically hybridized probe divided by a background signal measured in the absence of a target nucleic acid.

Results and Discussion

Experiment I—Combining Amplification Systems

(59) The objective was to test pairs of T7 and non-T7, as well as some individually, in order to confirm which of the different primer combinations exhibited better performance and which individual primers functionally performed the best. Target capture reactions were performed using SEQ ID NO:76 as a target capture oligomer. Detection reactions were performed using SEQ ID NO:67 as an AE-labeled detection probe oligomer. Amplification oligomer combinations are shown in Table 7, below. After determining SEQ ID NO:29+SEQ ID NO:65 and SEQ ID NO:12 primers work best in previous experiments, much of this experiment focused on these particular primers. Increasing the concentrations of some primers were also tested to evaluate performance and function in the system. Panels at 20 copies/mL HEV IVT (8 replicates) and BI0052 negative serum (2 replicates) were tested for each amplification system.

(60) TABLE-US-00007 TABLE 7 Experimental Design for Experiment I Amp* Non-T7 Primer T7 Primer Amp Systems (SEQ ID NO) (SEQ ID NO) 1 29 12 2 65 12 3 29 + 65 12 4 29 + 65 15 5 29 + 65 12 + 15 6 29 + 65 12 + 15 7 29 + 65 12 + 15 8 29 + 65 12 + 15 9 29 + 65 12 + 15 10 29 12 + 15 11 66 12 + 15 12 65 12 + 15 13 64 12 + 15 14 62 12 + 15 15 65 15 16 65 15 17 65 15 *In all Amp Systems except for 6, 7, 8, 9, 16 & 17, the Non-T7 Primers and the T7 Primers were used at roughly the same concentrations to one another. In Amp Systems 6, 7, 8, 9, 16 & 17 the following primer members were used at twice the concentration of the other primers in the reaction; 65, 29, 12, 15, 65 and 15, respectively.

(61) Table 8 shows a summary for Experiment I. When paired with SEQ ID NO:12, SEQ ID NO:65 performed better than SEQ ID NO:29, as shown in the higher mean RLU and lower % CV values (Amp systems 1 and 2). When paired with SEQ ID NO:29+SEQ ID NO:65, SEQ ID NO:12 performed better than SEQ ID NO:15, as shown in the higher mean RLU and lower % CV values (Amp systems 3 and 4). As seen with Amp system 5, adding SEQ ID NO:15 improved RLU signal compared to Amp system 3. Keeping SEQ ID NO:29+SEQ ID NO:65 both at 5 pmol/reaction showed better RLU and % CV performance (Amp system 5) than increasing SEQ ID NO:65 to 10 pmol/reaction in Amp system 6. When comparing Amp systems 8 and 9, increasing SEQ ID NO:12 from 5 to 10 pmol/reaction showed better performance than increasing SEQ ID NO:15. Amp systems 10 through 14 compared which non-T7 would perform with higher RLUs and low % CVs. Based on the criteria, SEQ ID NO:66 and SEQ ID NO:64 showed the highest RLUs and lowest % CVs. Amp systems 15 through 17 increased the concentration from 5 to 10 pmol/reaction of either the non-T7 or T7 in the system. Comparing Amp systems 15 and 16 these data show that increasing SEQ ID NO:65 improved performance (Amp system 16) while, on the other hand, increasing SEQ ID NO:15 decreased performance (Amp system 17).

(62) TABLE-US-00008 TABLE 8 Summary of Results for Experiment I RLU RLU RLU System Panel Mean SD % CV S/CO % R Amp 1 20 c/mL 1,035,254 60,059 5.80 105.76 100 Amp 2 20 c/mL 1,367,829 17,738 1.30 139.73 100 Amp 3 20 c/mL 1,265,443 40,365 3.19 129.27 100 Amp 4 20 c/mL 354,741 412,106 116.17 36.24 100 Amp 5 20 c/mL 1,307,112 39,148 2.99 133.53 100 Amp 6 20 c/mL 1,138,545 346,932 30.47 116.31 100 Amp 7 20 c/mL 1,157,461 23,540 2.03 118.24 100 Amp 8 20 c/mL 1,315,063 11,663 0.89 134.34 100 Amp 9 20 c/mL 993,828 353,189 35.54 101.53 100 Amp 10 20 c/mL 1,110,792 102,117 9.19 113.47 100 Amp 11 20 c/mL 1,377,343 45,052 3.27 140.70 100 Amp 12 20 c/mL 1,343,435 66,431 4.94 137.24 100 Amp 13 20 c/mL 1,372,134 48,909 3.56 140.17 100 Amp 14 20 c/mL 1,342,071 92,993 6.93 137.10 100 Amp 15 20 c/mL 606,324 424,338 69.99 61.94 100 Amp 16 20 c/mL 1,089,242 259,106 23.79 111.27 100 Amp 17 20 c/mL 395,478 164,783 41.67 40.40 100 RLU = Relative Light Units; SD = Standard Deviation; CV = Coefficient of Variation; S/CO = Signal to Cutoff Ratio; % R = % Reactivity.

Experiment II—Confirming the Best Performing Primer Pair Combination

(63) The objective was to test pairs of T7 and non-T7 and different primer combinations in the amplification reagent. Panel at 20 c/mL HEV IVT was tested in 5 replicates for each amplification system.

(64) Table 9 shows the experimental design. All conditions stayed the same except for the amplification systems tested. Target capture was performed using SEQ ID NO:76 and detection was performed using an AE-labeled SEQ ID NO:67 as a detection probe. As shown in Experiment I, Amp system 1 showed good performance, and that was set as a control. Amp systems 2 through 4 tested how each non-T7 compared to each other when only paired with SEQ ID NO:15. Since SEQ ID NO:66, SEQ ID NO:64, and SEQ ID NO:62 showed good RLU and % CV performance in Experiment I, each these non-T7s were tested in the primer pairing combinations shown in Amp systems 5 through 7.

(65) TABLE-US-00009 TABLE 9 Experimental Design for Experiment II Amp* Amp Non-T7 T7 Systems (SEQ ID NO) (SEQ ID NO) 1 29 + 65 12 + 15 2 66 15 3 64 15 4 62 15 5 29 + 66 12 + 15 6 29 + 64 12 + 15 7 29 + 62 12 + 15

(66) Table 10 shows a summary for Experiment II. When comparing Amp systems 2 through 4, SEQ ID NO:64 showed best performance in higher mean RLU compared to SEQ ID NO:66 and SEQ ID NO:62. When comparing Amp systems 1 and 6, SEQ ID NO:29 paired with SEQ ID NO:64 performed better than SEQ ID NO:29+SEQ ID NO:65. Even though Amp system 5 showed the highest RLU performance when compared with Amp systems 6 and 7, Amp system 6 was chosen for further study based on sequence alignment.

(67) TABLE-US-00010 TABLE 10 Summary of Results for Experiment II RLU RLU RLU System Panel Mean SD % CV S/CO % R Amp 1 20 c/mL 1,054,954 455,280 43.16 107.77 100 Amp 2 20 c/mL 108,457 79,457 73.26 11.08 100 Amp 3 20 c/mL 386,281 308,958 79.98 39.46 100 Amp 4 20 c/mL 166,652 96,680 58.01 17.02 100 Amp 5 20 c/mL 1,251,195 73,533 5.88 127.82 100 Amp 6 20 c/mL 1,219,780 130,591 10.71 124.61 100 Amp 7 20 c/mL 1,242,616 54,910 4.42 126.94 100 RLU = Relative Light Units; SD = Standard Deviation; CV = Coefficient of Variation; S/CO = Signal to Cutoff Ratio; % R = % Reactivity.

Experiment III—Screening New Probe Pairs

(68) The objective was to test new probe oligo pairs and evaluate the performance. Each of the probes was also tested individually to evaluate performance. Panel at 0 (IC buffer only) and 1,000 copies/mL HEV IVT were tested as negative and positive calibrators, respectively, of the assay. Panel at 20 copies/mL of HEV IVT and BI0052 negative serum were tested as samples at 7 replicates each. Each panel type was tested for each probe condition.

(69) Table 11 shows the experimental design. All conditions stayed the same except for the 7 probe systems tested. Internal control (IC) probe was also added to each of the 7 probes listed in the table.

(70) TABLE-US-00011 TABLE 11 Experiments Design for Experiment III Probe Probe# Probe‡ (RLU/rxn) TCOs in TCR Primers in Amp* Probe 1 SEQ ID NO: 67 2.00E+06 SEQ ID NO: 43 SEQ ID SEQ ID Probe 2 SEQ ID NO: 55 [8, 9] 3.00E+06 SEQ ID NO: 3  NO: 29 + NO: 12 + Probe 3 SEQ ID NO: 55 [10, 11] 3.00E+06 SEQ ID NO: 7  SEQ ID NO: 64 SEQ ID NO: 15 Probe 4 SEQ ID NO: 55 [12, 13] 6.00E+06 Probe 5 SEQ ID NO: 67 2.00E+06 SEQ ID NO: 55 [12, 13] 6.00E+06 Probe 6 SEQ ID NO: 55 [8, 9] 3.00E+06 SEQ ID NO: 55 [12, 13] 6.00E+06 Probe 7 SEQ ID NO: 55 [10, 11] 3.00E+06 SEQ ID NO: 55 [12, 13] 6.00E+06 IC Probe SEQ ID NO: 78-PPO 1.00E+06 added to Hybrid Probes #1-7 ‡The [#, #] designation refers to the nucleobase residues (counting from 5′ to 3′) between which a chemiluminescent label was located for SEO ID NO: 55. *SEQ ID NO: 64 was tested at 2X the concentration per reaction compared to each of SEQ ID NOs: 12, 15 & 29.

(71) Table 12 shows a summary for Experiment III. When looking at the probe reagents containing probe pairs (Probes 5, 6, and 7), probes 5 and 6 showed low background (low analyte RLU in the Negative Calibrator and BI0052 negative serum), and high analyte RLU signal in the Positive Calibrator and HEV IVT at 20 c/mL. Probe 7 also showed a similar result. Of the three probes (Probes 5, 6, and 7), Probe 5 had the highest analyte RLU signal in the positive samples. For the individual probe performance (Probes 1 through 4), SEQ ID NO:67 showed the highest analyte RLU signal in the positive samples, which relatively high background signal in the negative samples.

(72) TABLE-US-00012 TABLE 12 Summary of Results for Experiment III - IC RLU and analyte RLU IC RLU Analyte RLU Condition Panel Mean SD % CV 95% CI Mean SD % CV 95% CI Probe1 Neg Cal 134,234 6,423 4.78 454 468 103.06 Probe1 Pos Cal 1k c/mL 134,264 22,989 17 1,207,525 10,587 0.88 Probe1 20 c/mL HEV IVT 134,667 25,652 19.05 19,003 1,129,086 121,191 10.73 89,778 Probe1 BI0052 BN 140,531 12,824 9.13 9,500 626 756 120.61 560 593600 Probe2 Neg Cal 130,780 3,363 2.57 595 217 36.46 Probe2 Pos Cal 1k c/mL 130,740 12,322 9 1,209,761 16,267 1.34 Probe2 20 c/mL HEV IVT 178,999 26,435 14.77 19,583 855,109 371,340 43.43 275,087 Probe2 BI0052 BN 126,281 9,860 7.81 7,304 916 265 28.93 196 593600 Probe3 Neg Cal 134,046 4,495 3.35 144 250 173.21 Probe3 Pos Cal 1k c/mL 134,061 9,411 7 854,435 10,650 1.25 Probe3 20 c/mL HEV IVT 132,559 18,420 13.90 13,645 649,395 287,954 44.34 213,316 Probe3 BI0052 BN 134,791 9,170 6.80 6,793 432 609 140.93 451 593600 Probe4 Neg Cal 127,697 7,878 6.17 4,580 376 8.21 Probe4 Pos Cal 1k c/mL 127,584 1,216 1 379,813 8,359 2.20 Probe4 20 c/mL HEV IVT 135,488 2,617 1.93 1,939 160,017 74,978 46.86 55,543 Probe4 BI0052 BN 129,564 5,516 4.26 4,086 4,189 461 11.01 342 593600 Probe5 Neg Cal 135,336 2,380 1.76 5,778 1,312 22.70 Probe5 Pos Cal 1k c/mL 135,756 5,561 4 1,585,647 9,575 0.60 Probe5 20 c/mL HEV IVT 136,693 9,838 7.20 7,288 1,131,831 490,936 43.38 363,684 Probe5 BI0052 BN 129,554 10,328 7.97 7,651 6,440 1,997 31.01 1,479 593600 Probe6 Neg Cal 135,671 4,178 3.08 6,024 488 8.11 Probe6 Pos Cal 1k c/mL 135,139 8,626 6 1,468,351 32,266 2.20 Probe6 20 c/mL HEV IVT 169,229 32,044 18.94 23,738 787,965 610,399 77.47 452,181 Probe6 BI0052 BN 141,381 6,476 4.58 4,797 5,965 901 15.11 668 593600 Probe7 Neg Cal 131,353 1,086 0.83 6,194 415 6.71 Probe7 Pos Cal 1k c/mL 131,669 15,624 12 1,200,190 17,730 1.48 Probe7 20 c/mL HEV IVT 189,382 12,230 6.46 9,060 1,062,012 44,717 4.21 33,126 Probe7 BI0052 BN 139,499 9,591 6.88 7,105 5,746 694 12.09 514 593600 RLU = Relative Light Units; SD = Standard Deviation; CV = Coefficient of Variation; CI = Confidence Interval

(73) Table 13 shows a summary of the mean analyte S/CO values, including the reactivity, and validity, for Experiment III.

(74) TABLE-US-00013 TABLE 13 Summary of Results for Experiment III - Analyte S/CO, Reactivity, and Validity Analyte S/CO Condition Panel Mean SD % CV 95% CI NR R Invalid Valid % R Probe1 Neg Cal 0.01 0.01 103.06 0 Probe1 Pos Cal 1k c/mL 32.92 0.29 0.88 0 Probe1 20 c/mL HEV IVT 30.78 3.30 10.73 2.45 0 7 0 7 100 Probe1 BI0052 BN 0.02 0.02 120.61 0.02 7 0 0 7 0 593600 Probe2 Neg Cal 0.02 0.01 36.46 0 Probe2 Pos Cal 1k c/mL 32.80 0.44 1.34 0 Probe2 20 c/mL HEV IVT 23.18 10.07 43.43 7.46 1 6 0 7 86 Probe2 BI0052 BN 0.02 0.01 28.93 0.01 7 0 0 7 0 593600 Probe3 Neg Cal 0.01 0.01 173.21 0 Probe3 Pos Cal 1k c/mL 33.15 0.41 1.25 0 Probe3 20 c/mL HEV IVT 25.19 11.17 44.34 8.28 1 6 0 7 86 Probe3 BI0052 BN 0.02 0.02 140.93 0.02 7 0 0 7 0 593600 Probe4 Neg Cal 1.00 0.08 8.21 3 Probe4 Pos Cal 1k c/mL 82.93 1.83 2.20 3 Probe4 20 c/mL HEV IVT 34.94 16.37 46.86 12.13 0 0 7 0 #DIV/0! Probe4 BI0052 BN 0.91 0.10 11.01 0.07 0 0 7 0 #DIV/0! 593600 Probe5 Neg Cal 0.11 0.02 22.70 0 Probe5 Pos Cal 1k c/mL 29.72 0.18 0.60 0 Probe5 20 c/mL HEV IVT 21.22 9.20 43.38 6.82 0 7 0 7 100 Probe5 BI0052 BN 0.12 0.04 31.01 0.03 7 0 0 7 0 593600 Probe6 Neg Cal 0.12 0.01 8.11 0 Probe6 Pos Cal 1k c/mL 29.32 0.64 2.20 0 Probe6 20 c/mL HEV IVT 15.74 12.19 77.47 9.03 1 6 0 7 86 Probe6 BI0052 BN 0.12 0.02 15.11 0.01 7 0 0 7 0 593600 Probe7 Neg Cal 0.15 0.01 6.71 0 Probe7 Pos Cal 1k c/mL 28.44 0.42 1.48 0 Probe7 20 c/mL HEV IVT 25.17 1.06 4.21 0.78 0 7 0 7 100 Probe7 BI0052 BN 0.14 0.02 12.09 0.01 7 0 0 7 0 593600 S/CO = Signal to cutoff ratio; SD = Standard Deviation; CV = Coefficient of Variation; CI = Confidence Interval; NR = Non-Reactive; R = Reactive; % R = % Reactivity

Example 3

(75) This example describes evaluation of analytical sensitivity, cross-reactivity, specificity, and further probe formulation for an HEV amplification and detection assay. Reagents are as previously described in Example 2. Oligonucleotides and samples used in these experiments are listed in Tables 14 and 15 below.

(76) TABLE-US-00014 TABLE 14 HEV-specific Oligonucleotides and Internal Control Flasher Probe and PPO SEQ ID NO Class.sup.1 Sequence (5′-3′) 64 Non-T7 TGCTGCCCGCGCCAC Primers 29 Non-T7 CCGGCGGTGGTTTCT Primers 37 AE Labeled gaccggguugauucuC Probes 67 AE Labeled ugauucucagcccuucgC Probes 71 AE Labeled ugauugucagcccuucgC Probes 36 Probe GAAGGGCTGAGAATCA Protection Oligos 40 Probe GAGAATCAACCCGGT Protection Oligos 12 T7 Promoter AATTTAATACGACTCACTATAGGGAG Primers AAGGGGTTGGTTGGATGAATATAGGG GA 15 T7 Promoter AATTTAATACGACTCACTATAGGGAG Primers AGGGCGAAGGGGTTGGTTGGATGAA  3 Capture aagacauguuauucauuccacccTTTAA Oligos AAAAAAAAAAAAAAAAAAAAAAAAAAAA  7 Capture aagacauguuauucauucuacccTTTAA Oligos AAAAAAAAAAAAAAAAAAAAAAAAAAAA 43 Capture gaggggcgcugggacuggucgTTTAAAA Oligos AAAAAAAAAAAAAAAAAAAAAAAAAA 78 AE Labeled ccacaagcuuagaagauagagagG Probes 79 Probe CTATCTTCTAAGCTTG Protection Oligos .sup.1Lower case = methoxy RNA; Upper case = DNA

(77) TABLE-US-00015 TABLE 15 Samples Tested Sample Description Source Matrix REV Standard 1st World Health Organization PEI (Paul Ehrlich Lyophilized (6329/10) International Standard for Hepatitis E Institute) plasma Virus RNA Nucleic Acid Amplification Techniques (NAT)-Based Assays HEV RNA HEV genotypes 1-4 In-house IC buffer transcripts REV negative Frozen plasma, 2100 unique donors BocaBiolistics plasma plasma

(78) Steps Performed

(79) Assay steps were performed as described in Example 2.

(80) Results and Discussion

(81) Analytical Sensitivity

(82) Analytical sensitivity of the HEV assay on was determined using the 1st World Health Organization (WHO) International Standard (IS) for HEV RNA Nucleic Acid Amplification Techniques (NAT)-Based Assays (PEI code 6329/10). The WHO IS is based on HEV genotype 3a derived from a clinical isolate (GenBank accession number AB630970) first obtained by the Paul Ehrlich Institute (Langen, Germany) from the Hokkaido Red Cross [part of The Japanese Red Cross (JRC)].

(83) The sensitivity was determined to be 8.4 International Unit (IU)/mL at 95% detection level for HEV WHO IS.

(84) TABLE-US-00016 TABLE 16 Analytical Sensitivity with the WHO Standard for HEV Percent Reactivity of International Units/mL (n = 81) HEV WHO IS 90 100 30 100 10 91  3 52  1 22  0 0 Detection Limit of Detection Probability by Probit Analysis* in IU/mL 95% LOD (95% fiducial limits) 8.4 (6.3-12.8) 50% LOD (95% fiducial limits) 1.7 (1.4-2.1)  *Using SAS 9.2 Probit normal model

(85) Analytical sensitivity of HEV Assay among various HEV genotype IVTs. RNA IVTs were prepared for each of the major known HEV genotypes 1-4, including three sub-genotypes for HEV-3, namely HEV-3a, HEV-3b and HEV-3f. HEV-3a IVT is used as the HEV assay Positive Calibrator. In addition, RNA IVT was also made for a putative HEV genotype 6. The sensitivity for each of the major HEV genotype/subgenotype IVT was determined to be in the range of 10-19 c/mL at 95% detection level. The exception is with the putative HEV genotype 6 in which the sensitivity of the HEV Assay is about 5 times lower compared to the average sensitivity of HEV genotype 1-4 IVTs. The lower detection of the putative HEV genotype 6 strain in the HEV assay is mitigated by the fact that there is only one strain (wbJOY_06; GenBank accession number AB602441) associated with the putative genotype 6, that it was found in a single wild boar in Japan, and that it has not been associated with any known human HEV cases (Takahashi M et al., J. Gen. Virol. 92:902-908, 2011).

(86) TABLE-US-00017 TABLE 17 Analytical Sensitivity among HEV Genotype IVTs Copies/mL Percent Reactivity of Genotype.sup.a IVTs (n = 81) 1 2 3a 3b 3f 4c 6.sup.b 90 100 100 100 100 100 100 98 30 100 100 100 99 100 98 88 10 94 94 91 94 95 90 46 3 44 49 52 42 60 42 16 1 17 25 22 17 21 21 7 0 0 0 0 0 0 0 0 Detection Probability by Probit Analysis.sup.c Limit of Detection (LOD) in Copies/mL 95% LOD 12.7 13.0 13.7 14.6 10.2 18.9 69.6 (95% fiducial limits)  (9.6-18.6)  (9.6-19.7) (10.1-20.7)   (11-21.5)  (7.7-15.2) (13.9-28.8) (35.3-256.7) 50% LOD  2.8  2.4  2.5  2.9  2.2  2.9  9.0 (95% fiducial limits) (2.4-3.3) (2.0-2.9) (2.0-3.0) (2.4-3.5) (1.8-2.6) (2.4-3.6) (5.5-14.8) .sup.aBased on GenBank accession numbers NC001434 (1), M74506 (2), AB630970 (3a), AB630971 (3b), FJ956757 (3f), AB161717 (4c) and AB602441 (6) .sup.bPutative HEV genotype .sup.cUsing SAS 9.2 PROBIT normal model
Cross-Reactivity

(87) In silico BLAST analysis of the HEV-specific oligos did not show sequence matches to other blood borne pathogens except hepatitis C virus (HCV). The HEV oligo SEQ ID NO:64 showed 100% identity to part of the HCV envelope gene (positions 199-213 in GenBank accession number JQ063881). It is expected that this will not cause any false positivity issue because all the rest of the HEV-specific oligo sequences (whole or in part) are not found in the HCV genomic sequence. This is supported by testing of HCV-positive samples which showed non-reactivity in the HEV assay. Other bloodborne viruses (human immunodeficiency virus 1, hepatitis B virus, and West Nile virus) tested were also non-reactive for the HEV assay.

(88) TABLE-US-00018 TABLE 18 HEV Cross-reactivity with Bloodborne Pathogens Condition Blood Borne Viruses Added Level n Mean S/CO* % Reactivity HEV Positive HIV-1 Type B (IIIB) 100 c/mL 8 23.57 100% (30 IU/mL HIV-1 Group O 100 c/mL 9 27.95 100% WHO IS HCV 1A 100 c/mL 9 28.34 100% added) HCV 2B ~300 c/mL 9 28.32 100% HBV ~32 IU/mL 8 25.84 100% WNV Sample 022 3,000 c/mL 9 28.74 100% WNV Sample 688 3,000 c/mL 9 28.15 100% WNV Sample 630 3,000 c/mL 9 22.64 100% HEV HIV-1 Type B (IIIB) 100 c/mL 9 0.01  0% Negative HIV-1 Group O 100 c/mL 9 0.02  0% HCV 1A 100 c/mL 9 0.02  0% HCV 2B ~300 c/mL 8 0.03  0% HBV ~32 IU/mL 9 0.02  0% WNV Sample 022 3,000 c/mL 9 0.01  0% WNV Sample 688 3,000 c/mL 9 0.03  0% WNV Sample 630 3,000 c/mL 9 0.02  0% *S/CO (Signal to Cutoff) > or = 1.0 considered reactive
Specificity

(89) The specificity of the HEV assay on was determined to be 99.95% (95% Score CI: 99.73%-99.99%) for 2,100 unlinked, frozen plasma specimens. The data showed excellent specificity of the HEV assay in frozen plasma specimens.

(90) TABLE-US-00019 TABLE 19 HEV Specificity on Frozen Plasma Specimens N % Specimens Tested 2,100 100 Valid Results 2,100 100 Initial Reactive 1 0.05 Repeat Reactive 0 0 Specificity (95% CI)* 99.95% (99.73-99.99) *CI = Confidence Interval using Score method
Probe Design

(91) HEV probe oligo SEQ ID NO:71 showed an increased detection signal for HEV-3f relative to SEQ ID NO:55 [12,13], increasing the HEV 3f sensitivity from an 95% LOD of 12.4 c/mL to 10.2 c/mL and the RLU signal to a level more comparable to the other HEV genotypes tested.

Example 4

(92) This example describes the determination of HEV RNA prevalence in blood donors and the performance characteristics of an HEV amplification and detection assay using oligonucleotides as described above.

(93) Methods

(94) Studies were conducted to show the analytical sensitivity to the HEV WHO International Standard (Paul Ehrlich Institute (PEI) code 6329/10) and RNA transcripts of all four clinically relevant HEV genotypes (1-4), and clinical specificity of the HEV assay described above (“the HEV assay”). Plasma (for nucleic acid testing) was collected from ˜10,000 unlinked, volunteer whole blood donors. Samples were tested for HEV RNA using the HEV assay on the automated Panther system (Hologic, Inc., cat. no. 303095). Samples that were repeatedly reactive using TMA were confirmed by PCR and sequence analysis.

(95) Results

(96) The HEV assay showed a 95% limit of detection (LOD) of 7.9 IU/mL using the WHO Standard and 14.4 copies/mL using HEV 3a RNA transcript that had the same sequence as the HEV WHO Standard (see Tables 20 and 21). The assay detected all four HEV genotypes with a 95% LOD ranging from 7.9 to 17.7 copies/mL using RNA transcripts for HEV 1, 2, 3a, 3b, 3f and 4c (see Table 23). A total of 9,998 blood donations were screened for HEV RNA using the TMA assay. Three TMA repeat reactive donations were identified and confirmed positive by testing independent aliquots with PCR. One sample was determined to be genotype 3f by sequence analysis. Based on this study, HEV RNA prevalence rate in these blood donations was estimated to be 1 in 3,333 or 0.03% and the clinical specificity of the HEV assay was determined to be 99.99% (see Table 22 and Table 24).

(97) TABLE-US-00020 TABLE 20 Analytical Sensitivity to HEV WHO International Standard (PEI) code 6329/10 % Reactivity (95% CI) 90.sup.† 30 10 3 1 0 HEV WHO 100 100 98 67 27 0 IU/mL (98-100) (98-100) (94-99) (60-74) (20-34) (0-5) (95% CI) HEV3a IVT 100 100 88 38 20 0 c/mL (95-100) (95-100) (71-93) (28-49) (14-31) (0-5) (95% CI) WHO, n = 162, In Vitro Transcript (IVT) & negative, n = 81 .sup.†The values 90, 30, 10, 3, 1 and 0 in the row above the percent reactivity results refer to IU/mL in the TMA reaction for the HEV WHO standard, and refer to copies/mL in the TMA reaction for the HEV3a IVT.

(98) TABLE-US-00021 TABLE 21 Analytical Sensitivity to HEV WHO International Standard (PEI) code 6329/10 Detection HEV WHO Std IU/mL HEV3a IVT, c/mL Probability (95% Fiducial Limits) (95% Fiducial Limits) 95% 7.89 (6.63-9.83) 14.40 (11.28-20.14) 50% 2.02 (1.71-2.32) 3.63 (2.92-4.37) 

(99) TABLE-US-00022 TABLE 22 HEV RNA Prevalence Among Blood Donations n HEV RNA Prevalence (Rate) 9,998 3 or 1 in 3,333 (0.03%; 95% CI: 0.01%-0.09%)

(100) TABLE-US-00023 TABLE 23 Analytical Sensitivity to HEV Genotype 1-4 In Vitro Transcripts Copies/mL Percent Reactivity of Genotype.sup.1 IVTs (n = 81) HEV1 HEV2 HEV3a HEV3b HEV3f HEV4c 90 100 100 100 100 100 100 30 100 100 100 100 100 100 10 96 95 88 86 98 80 3 77 42 38 46 59 36 1 31 27 20 12 20 19 0 0 0 0 0 0 0 Detection Probability.sup.2 Limit of Detection in Copies/mL 95% LOD 7.88 11.32 14.40 13.72 8.26 17.66 (95% fiducial limits)  6.11-11.26  8.83-16.03 11.28-20.14 10.89-18.78  6.65-11.11 13.77-24.74 50% LOD 1.64  2.84  3.63  3.74 2.48  4.16 (95% fiducial limits) 1.21-2.06 2.26-3.44 2.92-4.37 3.03-4.47 2.01-2.96 3.34-5.03 .sup.1Based on GenBank accession numbers NC001434 (1), M74506 (2), AB630970 (3a), AB630971 (3b), FJ956757 (3f), AB161717 (4c) .sup.2SAS Enterprise Guide 5.1 Probit Analysis using Gompertz model

(101) TABLE-US-00024 TABLE 24 HEV Assay Specificity Testing Results of Blood Donations n % #Unique Donations Tested 9,998 100.00 #Valid Nonreactive Retest Results 9,995 99.97 #Initial Reactives 4 0.04 #Repeat Reactives 3 0.03 Specificity Rate 99.99% (95% CI: 99.94%-100.00%)

DISCUSSION/CONCLUSION

(102) Results showed that the HEV assay was sensitive and specific, and detected all four clinically relevant HEV genotypes. Testing of nearly 10,000 individual blood donors for this study yielded three HEV RNA confirmed positive donations resulting in an HEV RNA prevalence rate of 0.03%. Based on the performance demonstrated in this study, the HEV assay may be useful for screening blood donations for HEV RNA.

Sequences

(103) TABLE-US-00025 TABLE 25 Exemplary Oligomer Sequences, Reference Sequences, and Regions SEQ ID NO: Oligonucleotide Sequence Oligonucleotide Description  1 Accession No. AB074918.2 HEV reference sequence GI: 21218075  2 aagacauguuauucauuccaccc Target-hybridizing sequence of SEQ ID NO: 2  3 aagacauguuauucauuccacccTTTAAAAA Target capture oligo AAAAAAAAAAAAAAAAAAAAAAAAA  4 aagacauguuauucauucYWccc  Target-hybridizing sequence of target capture oligo  5 TgaTTgTcagcccTTcgC Probe  6 aagacauguuauucauucuaccc Target-hybridizing sequence of SEQ ID NO: 7  7 aagacauguuauucauucuacccTTTAAAAA Target capture oligo AAAAAAAAAAAAAAAAAAAAAAAAA  8 aagacauguuauucauucYWcccTTTAAAAA Target capture oligo AAAAAAAAAAAAAAAAAAAAAAAAA  9 AATTTAATACGACTCACTATAGGGAGAAGGG T7 amp oligo GTTGGTTGGATGAATATAG 10 AATTTAATACGACTCACTATAGGGAGAAGGG T7 amp oligo GTTGGTTGGATGAATATAGG 11 AATTTAATACGACTCACTATAGGGAGAAGGG T7 amp oligo GTTGGTTGGATGAATATAGGG 12 AATTTAATACGACTCACTATAGGGAGAAGGG T7 amp oligo GTTGGTTGGATGAATATAGGGGA 13 ctatgctgcccgcgccaccg Amp oligo hybridizing region 14 AATTTAATACGACTCACTATAGGGAGAGGCG T7 amp oligo AAGGGGTTGGTTGGATGAA 15 AATTTAATACGACTCACTATAGGGAGAGGGC T7 amp oligo GAAGGGGTTGGTTGGATGAA 16 ccggcggtggtttctggggtgac Amp oligo hybridizing region 17 AATTTAATACGACTCACTATAGGGAGAGGTT T7 amp oligo GGTTGGATGAATATAG 18 AATTTAATACGACTCACTATAGGGAGAGGTT T7 amp oligo GGTTGGATGAATATAGG 19 AATTTAATACGACTCACTATAGGGAGAGGTT T7 amp oligo GGTTGGATGAATATAGGG 20 AATTTAATACGACTCACTATAGGGAGAGGTT T7 amp oligo GGTTGGATGAATATAGGGGA 21 AGGGGTTGGTTGGATGAATATAG Target-hybridizing sequence of SEQ ID NO: 9 22 AGGGGTTGGTTGGATGAATATAGG Target-hybridizing sequence of SEQ ID NO: 10 23 AGGGGTTGGTTGGATGAATATAGGG Target-hybridizing sequence of SEQ ID NO: 11 24 AGGGGTTGGTTGGATGAATATAGGGGA Target-hybridizing sequence of SEQ ID NO: 12 25 GGTTGGTTGGATGAA Amp oligo core sequence 26 tgctgcccgcgcc Amp oligo core sequence 27 CGGCGGTGGTTTCT Amp oligo core sequence 28.sup.1 NCGGCGGTGGTTTCTNN Non-T7 amp oligo 29 CCGGCGGTGGTTTCT Non-T7 amp oligo 30 CCGGCGGTGGTTTCTG Non-T7 amp oligo 31 CCGGCGGTGGTTTCTGG Non-T7 amp oligo 32 CGGCGGTGGTTTCTGG Non-T7 amp oligo 33 CTATGCTGCCCGCGCC Non-T7 amp oligo 34 CTATGCTGCCCGCGCCA Non-T7 amp oligo 35 CTATGCTGCCCGCGCCAC Non-T7 amp oligo 36 GAAGGGCTGAGAATCA Probe protection oligo 37 gaccggguugauucuC Probe 38 gaccggguugauucu Probe 39 gacagggttgattctcagcccttcgccc Probe target region 40 GAGAATCAACCCGGT Probe protection oligo 41 gaccgggTTgaTTcTC Probe 42 gaggggcgcugggacuggucg Target-hybridizing sequence of SEQ ID NO: 43 43 gaggggcgcugggacuggucgTTTAAAAAAA Target capture oligo AAAAAAAAAAAAAAAAAAAAAAA 44 tgcctatgctgcccgcgccaccggccggtca Amp oligo hybridizing region gccgtctggccgtcgccgtgggcggcgcagc ggcggtgccggcggtggtttctggggtgac 45 GGCGAAGGGGTTGGTTGGATGAA Target-hybridizing sequence of SEQ ID NO: 14 46 GGGCGAAGGGGTTGGTTGGATGAA Target-hybridizing sequence of SEQ ID NO: 15 47 SGGCGAAGGGGTTGGTTGGATGAATATAGGG Amp oligo hybridizing region GA 48 GGTTGGTTGGATGAATATAG Target-hybridizing sequence of SEQ ID NO: 17 49 GGTTGGTTGGATGAATATAGG Target-hybridizing sequence of SEQ ID NO: 18 50 GGTTGGTTGGATGAATATAGGG Target-hybridizing sequence of SEQ ID NO: 19 51 GGTTGGTTGGATGAATATAGGGGA Target-hybridizing sequence of SEQ ID NO: 20 52 GGTTTCTGGGGTGAC Non-T7 amp oligo 53 GTGGTTTCTGGGGTGA Non-T7 amp oligo 54 GTGGTTTCTGGGGTGAC Non-T7 amp oligo 55 GUUGAUUCUCAGCCCUUCGCCC Probe 56 SGGCGAAGGGGTTGGTTGGATGAA Target-hybridizing sequence of SEQ ID NO: 57 57 AATTTAATACGACTCACTATAGGGAGAsGGC T7 amp oligo GAAGGGGTTGGTTGGATGAA 58 acagggttgattctcagcccttcgccctccc Partial amplicon ctatattcatccaaccaaccccttcgccs 59 ccggcggtggtttctggggtgacagggttga Partial amplicon ttctcagcccttcgccc 60 tatgctgcccgcgccaccggccggtcagccg Partial amplicon tctggccgtcgccgtgggcggcgcagcggcg gtgccggcggtggtttctggggtgacagggt tgattct 61 TGCCTATGCTGCCCGCGCCAC Non-T7 amp oligo 62 TGCTGCCCGCGCCA Non-T7 amp oligo 63 tgcctatgctgcccgcgccaccg Amp oligo hybridizing region 64 TGCTGCCCGCGCCAC Non-T7 amp oligo 65 TGCTGCCCGCGCCACC Non-T7 amp oligo 66 TGCTGCCCGCGCCACCG Non-T7 amp oligo 67 ugauucucagcccuucgC Probe 68 agggttgattctcagcccttcgccc Probe target region 69 gccggtcagccgtctggccgtcgccgtgggc Probe target region ggcgcagcggcggtgccggcggtggtttctg gggtgacagggttgattctcagcccttcgcc c 70 tgcctatgctgcccgcgccaccggccggtca Amplicon gccgtctggccgtcgccgtgggcggcgcagc ggcggtgccggcggtggtttctggggtgaca gggttgattctcagcccttcgccctccccta tattcatccaaccaaccccttcgccg 71 ugauugucagcccuucgC Probe 72 ugauugucagcccuucg Probe 73 AATTTAATACGACTCACTATAGGGAGA T7 promoter sequence 74 accgccgcugcgccgcccacggcgTTTAAAA Target capture oligo AAAAAAAAAAAAAAAAAAAAAAAAAA 75 accgccgcugcgccgcccacggcg Target-hybridizing sequence of SEQ ID NO: 74 76 agcggcggggcgcugggccuggucTTTAAAA Target capture oligo AAAAAAAAAAAAAAAAAAAAAAAAAA 77 agcggcggggcgcugggccugguc Target-hybridizing sequence of SEQ ID NO: 76 78 ccacaagcuuagaagauagagagG Internal control probe 79 CTATCTTCTAAGCTTG Probe protection oligo Note that the amplicon and partial amplicon sequences are illustrated herein and in the Sequence Listing as DNA, however, ordinarily skilled artisans understand that amplification products generated during TMA reactions are either RNA or DNA, depending upon the stage in the amplification cycle. DNA designation is provided herein only for convenience, and not limitation. .sup.1N at position 1 is C or is absent, N at position 16 is G or is absent, and N at position 17 is G or is absent. In some embodiments, if N at position 16 is G and N at position 17 is absent, then N at position 1 is C.

(104) From the foregoing, it will be appreciated that, although specific embodiments of the invention have been described herein for purposes of illustration, various modifications may be made without deviating from the spirit and scope of the invention. Accordingly, the invention is not limited except as by the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entireties for all purposes.