Mesenchymal stem cell extract and its use
10022313 ยท 2018-07-17
Assignee
Inventors
- Shinn-Zong Ling (Hsinchu County, TW)
- Horng-Jyh Harn (Hsinchu County, TW)
- Tzyy-Wen Chiou (Hsinchu County, TW)
- Po-Cheng Lin (Hsinchu County, TW)
Cpc classification
A61F7/02
HUMAN NECESSITIES
A61K2800/805
HUMAN NECESSITIES
A61K8/64
HUMAN NECESSITIES
International classification
A61K8/64
HUMAN NECESSITIES
Abstract
A mesenchymal stem cell extract and its use are provided, wherein the mesenchymal stem cell extract comprises a trophic factor(s), such as bone morphogenetic protein-7 (BMP-7), stromal cell-derived factor-1 (SDF-1), vascular endothelial growth factor (VEGF), C-X-C chemokine receptor type-4 (CXCR4), brain-derived neurotrophic factor (BDNF), and/or interleukin-17 (IL-17), and wherein the extract is especially suitable for repairing skin aging.
Claims
1. A method for at least one of promoting the expression of hyaluronic acid (HA), elastin, collagen and/or reticulin in the skin, stimulating cell proliferation at the administered region, stimulating cells at the administered region to secrete a trophic factor, and stimulating endogenous hematopoietic progenitor cells (HPC) to gather and proliferate at the administered region in a subject, comprising administering to the subject an effective amount of a mesenchymal stem cell extract, wherein the mesenchymal stern cell extract is a supernatant comprising bone morphogenetic protein-7 (BMP-7), stromal cell-derived factor-1 (SDF- 1), vascular endothelial growth factor (VEGF), C-X-C chemokine receptor type-4 (CXCR4), brain-derived neurotrophic factor (BDNF) and interleukin-17 (IL-17), and the supernatant is provided by the following steps: (1) mixing mesenchymal stem cells separated from an animal fat tissue with a proteolysis buffer containing NP40 lysis buffer, phenylmethanesulfonyl fluoride (PMSF), a protease inhibitor, p-glycerol phosphate and Na3V04, to lyse the cells and provide a cell lysate; and b(2) centrifuging the cell lysate at a temperature of no more than 4 C. to collect the supernatant.
2. The method as claimed in claim 1, which is for repairing skin aging.
3. The method as claimed in claim 2, wherein the mesenchymal stem cell extract is administered as an emulsion, a cream, a gel, a paste, a spray or a solution.
4. The method as claimed in claim 3, wherein the gel is an aquagel, the paste is a dispersing paste or an ointment, and the solution is a washing fluid or a suspension.
5. The method as claimed in claim 2, wherein the mesenchymal stem cell extract is applied to the skin surface of the subject.
6. The method as claimed in claim 2, further comprising heating the skin surface with a heating means simultaneously with or separately from applying the mesenchymal stem cell extract.
7. The method as claimed in claim 6, wherein the heating means is at least one of a contact heating means and a non-contact heating means.
8. The method as claimed in claim 7, wherein the contact heating means is at least one of a facial mask, a heating pack, a hot towel, a heating pad, and a heating plate.
9. The method as claimed in claim 7, wherein the non-contact heating means is at least one of a steam and a heating lamp irradiation.
10. The method as claimed in claim 2, which is further for at least one of reducing hair loss, promoting the activation of hair follicle cells, promoting the proliferation of hair follicle cells, and promoting hair growth.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) The file of this patent contains at least one drawing executed in color. Copies of this patent with color drawings will be provided by the Patent and Trademark Office upon request and payment of the necessary fee.
(2)
(3)
(4)
(5)
(6)
(7)
(8)
DETAILED DESCRIPTION
(9) The following will describe some embodiments of the present invention in detail. However, without departing from the spirit of the present invention, the present invention may be embodied in various embodiments and should not be limited to the embodiments described in the specification. In addition, unless otherwise indicated herein, the expressions a, the, or the like recited in the specification of the present invention (especially in the claims) are intended to include the singular and plural forms. Furthermore, the term effective amount or amount effective for treatment used in this specification refers to the amount of the extract that can at least partially alleviate the condition that is being treated in a suspected subject when administered to the subject. The term subject used in this specification refers to a mammalian, including human and non-human animals.
(10) The present invention provides a mesenchymal stem cell extract, comprising a trophic factor selected from the group consisting of bone morphogenetic protein-7 (BMP-7), stromal cell-derived factor-1 (SDF-1), vascular endothelial growth factor (VEGF), C-X-C chemokine receptor type-4 (CXCR4), brain-derived neurotrophic factor (BDNF), interleukin-17 (IL-17), and combinations thereof.
(11) The mesenchymal stem cell extract of the present invention was obtained by extracting mesenchymal stem cells separated from an animal tissue. That is, the mesenchymal stem cell extract can be provided by directly extracting the mesenchymal stem cells separated from an animal tissue, or be provided by extracting the mesenchymal stem cells generated from the cultivation of the mesenchymal stem cells separated from an animal tissue. Suitable tissues include, for example, umbilical cord, umbilical cord blood, placenta, Wharton's jelly (WJ), bone marrow (BM), blood, muscle, fat, follicle, and combinations thereof. In some embodiments of the present invention, a mesenchymal stem cell extract obtained by extracting mesenchymal stem cells originated from fat tissue was used.
(12) The mesenchymal stem cells directly separated from an animal tissue may be produced autologously, or produced by an exogenous induction. For example, when use mesenchymal stem cells separated from bone marrow or blood, the mesenchymal stem cells may be produced autologously, or induced by a granulocyte colony stimulating factor (GCSF) and/or an interleukin. For example, the GCSF and interleukin used for induction may be an endogenous GCSF and interleukin, synthetic GCSF and interleukin, and/or analogues thereof. In addition, the interleukin used for induction may be interleukin-3 (IL-3) and/or interleukin-6 (IL-6).
(13) The mesenchymal stem cell extract of the present invention can be prepared by any suitable method. For example, the mesenchymal stem cell extract can be provided by extracting mesenchymal stem cells originated from an animal tissue with the use of a proteolysis buffer. In some embodiments of the present invention, the mesenchymal stem cell extract was provided by the following steps:
(14) (1) mixing mesenchymal stem cells with a proteolysis buffer containing NP40 lysis buffer, phenylmethanesulfonyl fluoride (PMSF), a protease inhibitor, -glycerol phosphate and Na.sub.3VO.sub.4, to lyse the cells and provide a cell lysate; and
(15) (2) centrifugating the cell lysate to collect the supernatant (i.e., a mesenchymal stem cell extract), wherein, to avoid the inactivation of effective components in the extract, the centrifugation is preferably performed at a temperature below 4 C. to maintain the stability of the effective components.
(16) Because the mesenchymal stem cell extract of the present invention is extracted from cells, the molecular structure of the effective components (comprising at least one of BMP-7, SDF-1, VEGF, CXCR4, BDNF, and IL-17) in the extract is small, and thus, can easily penetrate the skin while being applied to the skin surface to promote the expression of hyaluronic acid, elastin, collagen and/or reticulin in the skin, stimulate cell proliferation at the administered region, stimulate cells at the administered region to secrete a trophic factor, and/or stimulate endogenous hematopoietic progenitor cells to gather and proliferate at the administered region.
(17) Without being limited by theory, it is believed that the mesenchymal stem cell extract of the present invention is effective in repairing skin aging, which comprises, but are not limited to, promoting wound healing, improving the skin quality (such as the thickness, elasticity, flexibility, fullness and humidity of the skin) and skin flaccidity, reducing skin wrinkles and stripes, improving skin firmness, whitening the skin, and reducing skin darkness and skin spots. In addition, the mesenchymal stem cell extract of the present invention can effectively reduce hair loss, promote the activation of hair follicle cells, promote the proliferation of hair follicle cells, and/or promote hair growth.
(18) The inventors of the present invention found that when the skin surface is heated with a heating means prior to, simultaneously with, and/or after the administration of the mesenchymal stem cell extract of the present invention, the heating operation can open the skin pores and thereby, increase the absorption efficiency, stimulate the release of trophic factors, attract endogenous stem cells to migrate to the administered region, and repair and increase the ECM, so as to achieve the effect of skin rejuvenation.
(19) Accordingly, the present invention also relates to applications of the mesenchymal stem cell extract for repairing skin aging, including a use of the mesenchymal stem cell extract in the manufacture of a skin care product, a cosmetic or a medicament for repairing skin aging, a kit comprising the mesenchymal stem cell extract and a heating means, and a method for repairing skin aging in a subject in need comprising administering to the subject the mesenchymal stem cell extract.
(20) The skin care products, cosmetics and medicaments of the present invention can be presented in any suitable form without particular limits. For example, the skin care products, cosmetics and medicaments can be in the form of an emulsion, a cream, gel (such as an aquagel), paste (such as a dispersing paste and an ointment), a spray or a solution (such as a washing liquid and a suspension) for external use, but are not limited thereby. The skin care products of the present invention can also be prepared in the form of a food for swallowing or drinking, such as a health food or a beauty drink. In addition, the medicaments of the present invention can be prepared in the form for oral administration or subcutaneous injection.
(21) When the medicament manufactured by using the mesenchymal stem cell extract of the present invention is in the form for oral administration, the medicament may comprise any pharmaceutical acceptable carrier which would not adversely influence the desired activity of the mesenchymal stem cell extract. Examples of a suitable pharmaceutical acceptable carrier include, but are not limited to solvents, oily solvents, diluents, stabilizers, absorption retarders, disintegrants, emulsifiers, antioxidants, adhesives, lubricants, moisture absorbents, etc. Any suitable methods can be used to prepare the medicament in an oral administration form such as a tablet, a capsule, a granule, a powder, a fluid extract, a solution, syrup, a suspension, an emulsion, a tincture, etc.
(22) When the medicament manufactured by using the mesenchymal stem cell extract of the present invention is in the form for subcutaneous injection, the medicament may comprise one or more component(s), such as an isotonic solution, a saline buffer solution (such as a phosphate buffer solution or a citrate buffer solution), a solubilizer, an emulsifier, other carriers, etc., so as to be manufactured as a powder injection, a suspension injection, or a powder-suspension injection.
(23) Optionally, the skin care product, cosmetic, or medicament manufactured by using the mesenchymal stem cell extract of the present invention can further comprise other additives, such as a flavoring agent, a perfume, a toner, or a coloring agent to enhance the taste and visual appeal of the skin care product, cosmetic or medicament. A suitable amount of a preservative, a conservative, an antiseptic, an anti-fungus reagent, and so on, can also be added to improve the storability of the skin care product, cosmetic or medicament. In addition, the skin care product, cosmetic or medicament can be optionally used in combination with one or more other active components to further enhance the efficacy of the skin care product, cosmetic or medicament, or to increase the flexibility for the formulation, as long as the other active components have no adverse effect on the desired effect of the mesenchymal stem cell extract.
(24) For example, when the skin care product, cosmetic or medicament for reducing wrinkles is manufactured, a suitable amount of an emulsifier, a perfume and other active components of reducing wrinkles can be added. The active components can be hyaluronic acid, elastin, collagen, reticulin, and/or trophic factors (such as BMP-7, SDF-1, VEGF, CXCR4, BDNF and IL-17), etc.
(25) When the skin care product, cosmetic or medicament manufactured by the use of the mesenchymal stem cell extract of the present invention is administered to the skin surface in the form for external use, the skin surface can be heated with a heating means prior to, simultaneously with, and/or after the administration of the skin care product, cosmetic or medicament, to increase the skin temperature to a temperature of 38 C. or higher, but not harmful to the skin. For example, (i) the skin care product, cosmetic or medicament of the present invention may be applied or sprayed onto the skin surface and then the skin surface is heated immediately; (ii) the skin care product, cosmetic or medicament of the present invention may be applied or sprayed onto the skin surface for 15 to 30 minutes, and then the skin surface is heated; (iii) the skin surface is heated for 3 to 5 minutes, and then the skin care product, cosmetic or medicament of the present invention is applied or sprayed onto the skin surface; or (iv) the skin surface is heated to appropriately increase the skin surface temperature and maintain at the increased temperature, while the skin care product, cosmetic or medicament of the present invention is applied or sprayed onto the skin surface during the heating period.
(26) The skin surface can be heated with a contact heating means or a non-contact heating means. For example, a suitable contact heating means includes, but is not limited to applying a facial mask to the skin surface, or placing a heat pack, a hot towel, a heating pad, or a heating plate on the skin surface, to appropriately increase the skin temperature through the use of the facial mask, heating pack, hot towel, heating pad, or a heating plate. A suitable non-contact heating means includes the use of a steam engine (such as beauty making ion steamer) and a heating lamp, to heat the skin surface and increase the skin temperature by hot steam released from a steam machine or light irradiated from a heating lamp.
(27) In some embodiments of the present invention, a heating pad was used to increase the skin surface temperature by a contact heating means. The heating operation shall heat the skin surface to a temperature harmless to the skin, for example, a temperature of about 38 C. or a higher suitable temperature ranging from such as 38 C. to 50 C. In some embodiments of the present invention, the skin surface temperature was increased to about 39 C. and maintained for about 1 to 2 hours.
(28) In the present invention, because the mesenchymal stem cell extract is used and the effective components contained therein are directly utilized to provide the desired effect, the usage amount of the mesenchymal stem cell extract can be controlled more easily, and this is different from the traditional stem cell therapy that provides the desired effect by applying living cells to secrete the effective components in a subject. Depending on the requirements of the subject, the skin care product, cosmetic or medicament manufactured by the mesenchymal stem cell extract of the present invention can be applied with various administration frequencies, such as once a day, several times a day or once for several days, etc. For example, when applying to the skin surface for repairing skin aging, the dosage of the skin care product, cosmetic or medicament may range from about 0.01 ml (as the mesenchymal stem cell extract)/cm.sup.2 to about 1 ml (as the mesenchymal stem cell extract)/cm.sup.2 per day, and preferably from about 0.05 ml (as the mesenchymal stem cell extract)/cm.sup.2 to about 0.5 ml (as the mesenchymal stem cell extract)/cm.sup.2 per day, wherein the unit ml/cm.sup.2 refers to the dosage required per cm.sup.2-surface area of the treated subject. However, for subjects with more severe skin aging conditions, the dosage can be increased to several times or several tens of times, depending on the practical requirements. In an embodiment of using the mesenchymal stem cell extract of the present invention for repairing skin aging, the dosage of the skin care product, cosmetic or medicament is about 0.1 ml (as the mesenchymal stem cell extract)/cm.sup.2 per day.
(29) The present invention also provides a kit, comprising (1) a heating tool, and (2) a mesenchymal stem cell extract. The selection of the heating tool is in line with the above descriptions for heating, and the selection of the mesenchymal stem cell extract and the form and dosage for administering thereof are all in line with the above descriptions.
(30) In addition, the present invention also provides a method for repairing skin aging in a subject in need, comprising administering to the subject an effective amount of a mesenchymal stem cell extract. The selection of the mesenchymal stem cell extract and the form and dosage for administrating thereof are all in line with the above descriptions.
(31) The present invention will be further illustrated in detail with specific examples as follows. However, the following examples are provided only for illustrating the present invention, and the scope of the present invention is not limited thereby.
EXAMPLES
Example 1
Separation and Culture of Mesenchymal Stem Cells
(32) (1) Mesenchymal Stem Cells were Separated from the Tissues
(33) Fat tissues (NR0, NR1, NR2, NR3, NR4, AD03, AD61, BN08 and MS14) separated from different human body were cut into small pieces (about 0.5 cm0.5 cm) by using an operating scissors. The cut fat tissues were placed in a 50 ml tube, washed with 25 ml of 1 phosphate buffered saline (PBS, containing 2% penicillin-streptomycin), and then centrifuged (room temperature, 400 g, 5 minutes). The supernatant was removed. The tissues were washed with 25 ml of 1PBS (containing 2% penicillin-streptomycin) and centrifuged (room temperature, 300 g, 5 minutes). The supernatant was removed and 20 ml of 1PBS (containing 0.4 mg/ml collagenase type IV (Invitrogen)) was added into the tube. The tube was placed into a shaker and shaken for 1 hour (37 C., 40 rpm) until the collagenase type IV reacted completely with the fat tissues, and then the fat tissues were centrifuged (room temperature, 400 g, 5 minutes). The supernatant and the tissue scraps were removed. The remains are stromal vascular fractions (SVFs) that include a great amount of mesenchymal stem cells. The SVF was washed with 20 ml of 1PBS (containing 2% penicillin-streptomycin) and centrifuged (room temperature, 300 g, 5 minutes). The supernatant was removed. The SVF was washed with 10 ml of 1PBS (containing 2% penicillin-streptomycin) and centrifuged (room temperature, 300 g, 5 minutes). The supernatant was removed. The mesenchymal stem cells were collected and cultured by the steps as shown in the following Experiment (2).
(34) The above manufacturing processes were repeated, but the fat tissue was substituted with umbilical cord or bone marrow, respectively, to obtain a SVF that is separated from umbilical cord or bone marrow.
(35) (2) Culture of Mesenchymal Stem Cells
(36) The keratinocyte-serum free medium (K-SFM, Gibco) was used as a basal medium [added with 5% fetal bovine serum (FBS, Hyclone), 25 mg of bovine pituitary extract (BPE, Gibco), 2.5 g of recombinant epidermal growth factor (Gibco), 2 mM N-acetyl-L-cysteine (Sigma), 0.2 mM L-ascorbic acid 2-phosphate (Sigma), and 1% penecillin-streptomycin (Biowest)] to resuspend the SVF obtained from the Experiment (1) in a flask. Recombinant epidermal growth factor (EGF), B27, biotinylated epithelial growth factor (BEGF) or heparin could be added to the basal medium and then left to sit in an incubator (37 C., 5% CO.sub.2) to amplify the amount of mesenchymal stem cells for use in the following examples.
Example 2
Analysis of the Trophic Factors in Mesenchymal Stem Cells
(37) (1) Preparation of Total RNA of the Mesenchymal Stem Cells
(38) The mesenchymal stem cells provided by Example 1 were washed with 0.1 mM PBS once, completely mixed with 350 l of a RLT buffer (containing 1% -mercaptoethanol, QIAGEN, Calif., USA), and then completely mixed with an equal volume (i.e., 350 l) of 70% alcohol. The mixture was transferred into an RNeasy mini column (QIAGEN, Calif., USA) and centrifuged (12000 rpm, 15 seconds). The supernatant was removed and 700 l of a RW1 buffer (QIAGEN, Calif., USA) was added. The mixture was centrifuged (12000 rpm, 15 seconds). The supernatant was removed and 500 l of a RPE buffer (QIAGEN, Calif., USA) was added. The mixture was centrifuged (12000 rpm, 15 seconds). The supernatant was removed and 500 l of the RPE buffer was added once again. The mixture was centrifuged (12000 rpm, 1 minute) to exclude the residual reagent. The RNeasy mini column was transferred into a 1.5 ml microtube. 30 l RNase free water (QIAGEN, Calif., USA) was added onto the center of the membrane of RNeasy mini column and left to sit for 5 minutes. The RNeasy mini column and 1.5 ml microtube were centrifuged (12000 rpm, 1 minute), and the eluted filtrate (i.e., the total RNA of the mesenchymal stem cells) was collected. Then, the absorbance of the filtrate at a wavelength of 260 nm was determined by a spectrophotometer (DU-800, Beckman) to evaluate the concentration of RNA. Then, the RNA was stored at 80 C. and used for the following revere transcription polymerase chain reaction and gel analysis.
(39) (2) Reverse Transcription Polymerase Chain Reaction (RT-PCR)
(40) The total RNA provided by the above experiment (1) was reverse transcribed into cDNA. 2.5 l of each primer (10 pM) shown in Table 1A, 7.5 l ddH.sub.2O, and 12.5 l of EconoTaq PLUS GREEN 2X Master Mix (Lucigen, Middleton, Wis., USA) were mixed with 2.5 l of the cDNA. The mixture was placed in a RT-PCR machine. The reaction conditions were set as follows: i) 94 C. for 30 seconds, 55 C. for 30 seconds, and 94 C. for 60 seconds, with 30 cycles of the aforesaid steps; ii) 72 C. for 10 minutes; and iii) cooling to 4 C. to stop the reaction. The obtained RT-PCR product was analyzed by electrophoresis for 30 minutes through a 1.5% agarose gel (voltage: 100 volt (V)). Then, the gel was placed in and stained with ethidium bromide for 10 minutes, and photographed by a gel image capture system (DOC PRINT DP-001 FDC, VilberLourmat France). The results are shown in
(41) TABLE-US-00001 TABLE1A Numberof Name Nucleicacidsequenceofprimer sequence BMP-7 Forward:GGCTGGCAGCACTGGATCAT 1 Reverse:ACCAGCGTCTGCACGATGGC 2 SDF1 Forward:ATGAACGCCAAGGTCGTGGTC 3 Reverse:CTTGTTTAAAGCTTTCTCCAGGTACT 4 CXCR4 Forward:GGCCCTCAAGACCACAGTCA 5 Reverse:TTAGCTGGAGTGAAAACTTGAAG 6 IL-17 Forward:TCCACCGCAATGAGGACCCTG 7 Reverse:TGACACAGGTGCAGCCCACG 8 - Forward:CGCCAACCGCGAGAAGAT 9 actin Reverse:CGTCACCGGGAGTCCATCA 10
(42) TABLE-US-00002 TABLE 1B BMP-7 SDF1 CXCR4 IL-17 -actin NR0 6481.154 6602.347 6299.083 6995.619 8781.548 NR1 6070.497 3925.376 7827.69 7670.841 8680.669 NR2 2733.012 4615.518 3772.983 5141.184 8319.719 NR3 3047.426 4496.962 7202.548 7364.548 11040.55 NR4 3650.841 5452.154 8289.619 7027.841 10298.08 BMSC 3380.013 7032.962 5809.719 5499.376 11278.72 WJ 158.092 7183.376 2600.719 2794.355 8377.79 AD03 8368.326 6174.083 8144.962 7924.719 9489.376 AD61 2632.376 4142.912 4682.77 4944.598 9732.719 BN08 3286.619 3696.912 7450.548 7189.669 10796.48 MS14 3567.719 5559.489 6064.012 6903.782 10801.45
(43) As shown in
Example 3
Preparation of Mesenchymal Stem Cell Extract
(44) Mesenchymal stem cells provided by Example 1 were resuspended with typsin-EDTA. The suspension was transferred into a microtube and centrifuged (room temperature, 400 g, 5 minutes). The supernatant was removed. The previously prepared proteolysis buffer [comprising a NP40 lysis buffer (iNtron biotechnology, Korea), PMSF, a protease inhibitor, -glycerol phosphate, and Na.sub.3VO.sub.4, at a ratio of 96:1:1:1:1] was added into the microtube, and then pipetted to lyse the cells. The suspension was shaken at 4 C. for 20 minutes and centrifuged (4 C., 12000 to 13000 rpm, 10 minutes). The supernatant (i.e., mesenchymal stem cell extract) was collected and used in the following examples.
Example 4
Administration of Mesenchymal Stem Cell Extract
(45) F344 rats were separated into 3 groups with 3 rats for each group. In one group, the F344 rats were subcutaneously injected with granulocyte colony stimulating factor (GCSF) (50 g/kg) for 3 consecutive days. The hair on the skin area to be biopsied of the rats was cut. Then, the skin area to be biopsied was heated with a heating pad to increase the temperature of the skin surface to about 39 C. and maintained for 1 hour. The mesenchymal stem cell extracts provided by the above Example 3 was applied uniformly on the skin area to be biopsied by a dosage of 0.1 ml per 1 cm square. The heating and application steps were repeated every two days for 7 consecutive days, that is called as a heating+MSC extract group. In another group, the same steps of the above group were carried out but only heated for 1 hour without the MSC extract; this group was called the heating group. The group without any treatment was called as the control group.
Example 5
Preparation and Biopsy of Skin Tissue
(46) The tissue of the (i) control group, (ii) heating group and (iii) heating+MSC extract group provided by Example 4 were treated by the following steps. The hair on the skin area to be biopsied of the F344 rats was cut by an electric shaver. The surgical region was disinfected by 75% alcohol, and 1 cm square pieces of the skin tissue was biopsied (the biopsying depth was about 8 mm until the fat layer was reached). The biopsied sample was soaked in a fixing solution, 10% formalin solution (neutral buffered formalin, Surgipath) to keep the initial state of the proteins in the tissue, and was dehydrated by a tissue dehydration machine (Leica TP1020). First, a cassette comprising the skin tissue was put into the tissue dehydration machine, and the tissue was sequentially processed by fixation, dehydration, washing, and rinsing (irrigation of wax). The water in the tissue was replaced by paraffin after such treatment. The treating steps were as follows: treated with a 10% formalin solution for 1 hour (fixation); treated with double distilled water for 30 minutes (rinsing); treated with 80% alcohol for 1 hour (dehydration); treated with 95% alcohol for 1 hour (dehydration); treated with 95% alcohol for 1 hour (dehydration); treated with 100% alcohol for 1 hour (dehydration); treated with 100% alcohol for 1 hour (dehydration); treated with 100% alcohol for 2 hours (dehydration); treated with xylene for 1 hour (washing); treated with xylene for 2 hours (washing); treated with paraffin wax for 1 hour (rinsing); and treated with paraffin wax for 2 hours (rinsing). The dehydrated tissue was embedded with paraffin (tissue block system TBS 88, Medite) into a paraffin block and sectioned by a hand-cranked paraffin section machine (Shandon AS325, Leica, Germany). The thickness of each section ranged from 3 m to 5 m.
Example 6
Skin Tissue Stain and Analysis
(47) The sections of (i) control group, (ii) heating group and (iii) heating+MSC extract group provided by Example 5 were stained and analyzed as follows.
(48) (1) Immunohistochemistry (IHC)
(49) Immunofluorescence (IF) stain was utilized to detect the expression of specific antigens in the tissues. The staining steps were as follows: the skin tissues were biopsied (3 m/section); heated at 55 C. for 30 minutes; dewaxed in xylene and rehydrated in alcohol; and heated in an antigen recovery buffer solution at 121 C. for 10 minutes; the tissues were circled by a DAKO pen; soaked in a 1PBS solution (containing 3% hydrogen peroxide) at room temperature for 10 minutes to inactivate the intrinsic reductase; washed by a rinse buffer (1PBS+0.3% TritonX-100) once, treated with a 1PBS solution (containing 5% FBS) for 30 minutes to block non-specific binding; washed with a rinse buffer (1PBS+0.05% TritonX-100) once; the primary antibodies (bromodeoxyuridine (BrdU), hyaluronic acid and CD44, Abcam) diluted in an appropriate fold (1:100 to 1:200) were added to the tissue samples, and the reaction was conducted at room temperature for 2 hours or at 4 C. overnight; the tissues were washed with a rinse buffer (1PBS+0.05% TritonX-100) 3 times; the secondary antibody diluted in an appropriate fold (1:5000) was added to the tissue samples, and the reaction was conducted at room temperature for 1 hour; the tissues were washed with a rinse buffer (1PBS+0.05% TritonX-100) 3 times; a DAB color reagent (3,3-Diaminobenzidine, LSAB2 Kit, DAKO, Calif., USA) was added to the tissue samples for 10 minutes. A red-brown color represents a positive result, while no color represents a negative result. Then, the tissues were counter stained with a hematoxylin solution for 1 minute. Excessive hematoxylin was washed out. The tissues were soaked in tap water for 10 minutes, and dehydrated in alcohol and mounted by the mounting medium.
(50) Then, the samples were dried in a hood, observed under a microscope, and recorded by a CCD digital camera system (OLYMPUS, DP70). The results are shown in
(51) (2) Masson's Trichrome Stain/Gelatinous Fiber Stain
(52) Masson's trichrome stain/gelatinous fiber stain is a histochemistry stain, which can be used to identify collagen fiber. In an acidic environment, it can selectively stain collagen fibers and muscle fibers. After the collagen fiber was treated by an acid, the Biobrich Scarlet leaked out from collagen and turned into blue when stained with aniline blue. The staining steps were as follows: the sections were dewaxed, soaked in a Bouin's solution at 56 C. for 1 hour, stained in a hematoxylin solution for 5 minutes (nucleus staining); washed by running water for 15 minutes and sequentially stained with Biebrich Scarlet-Acid fuchsin (Sigma, HT15-1) for 15 minutes, stained with phosphomolybdic acid-phosphotungstic acid (Sigma, P7390 and P4006) for 15 minutes, stained with aniline blue for 5 minutes, soaked in 1% ice-cold acetic acid for 5 minutes, and dehydrated in alcohol and mounted by a mounting medium.
(53) Then, the samples were dried in a hood for 1 day, observed under a microscope, and recorded by a CCD digital camera system (OLYMPUS, DP70). The results are shown in
(54) (3) Elastic Stain (Modified Verhoff's) and Reticular Stain
(55) This staining method is utilized to identify elastin and reticulin, wherein the stained elastin and reticulin turn into blue-black. The staining steps are as follows: the skin tissue was biopsied (3 m/section); heated at 55 C. for 30 minutes; dewaxed in xylene and rehydrated in alcohol; stained with a working elastic stain solution for 15 minutes; washed by running water for 1 minute; stained with a 2% Ferric chloride differentiating solution for 20 seconds; washed by running water for 1 minute; stained with a 5% sodium thiosulfate solution for 1 minute; washed by running water for 1 minute; stained with a Van Gieson's solution for 3 minutes; and dehydrated in alcohol and mounted by a mounting medium.
(56) Then, the samples were dried in a hood for 1 day, observed under a microscope, and recorded by a CCD digital camera system (OLYMPUS, DP70). The results are shown in
(57) (4) The results
(58) (4-1) Mesenchymal Stem Cell Extract can Stimulate Cell Proliferation at the Administered Region and Stimulate Endogenous Hematopoietic Progenitor Cells to Gather and Proliferate at the Administered Region
(59)
(60) TABLE-US-00003 TABLE 2A BrdU Heating + Control group Heating group ESC extract Average score 21.95 73.12 121.64 (0 to 300)
(61) TABLE-US-00004 TABLE 2B CD34 Heating + Control group Heating group ESC extract Average score 27.12 38.67 133.43 (0 to 300)
(62) In
(63) It also been observed in
(64) As shown in
(65) (4-2) Mesenchymal Stem Cell Extract can Promote the Expression of Hyaluronic Acid (HA), Elastin, Collagen, and Reticulin
(66)
(67) TABLE-US-00005 TABLE 3A Hyaluronic acid Heating + Control group Heating group ESC extract Average score 24.19 45.98 108.73 (0 to 300)
(68) As shown in
(69)
(70) TABLE-US-00006 TABLE 3B Collagen Heating + Control group Heating group ESC extract Average score 147.76 153.52 218.01 (0 to 300)
(71) As shown in
(72)
(73) TABLE-US-00007 TABLE 3C Elastin Heating + Control group Heating group ESC extract Average score 37.00 51.33 97.67 (0 to 300)
(74) As shown in
(75)
(76) TABLE-US-00008 TABLE 3D reticulin Heating + Control group Heating group ESC extract Average score 44.33 44.33 68.67 (0 to 300)
(77) As shown in
(78) The above examples show that in respect to the biochemical function, the mesenchymal stem cell extract of the present invention can promote the expression of hyaluronic acid, elastin, collagen and/or reticulin in the skin. In respect to the physiological effect, it can improve skin firmness, improve skin fullness, promote skin metabolism, and improve skin structure (including thinning the skin epidermis and increasing the elasticity of the dermis). Through the aforesaid mechanisms, the mesenchymal stem cell extract of the present invention can achieve the effects of repairing skin aging, such as reducing the stripes on the skin, reducing wrinkles, preventing wrinkles, reducing the discoloration of skin, thereby, improving the appearance of the skin, etc.
(79) The above examples are used to illustrate the principle and efficacy of the present invention but not used to limit to the present invention. People skilled in this field may proceed with a variety of modifications and replacements based on the disclosures and suggestions of the invention as described without departing from the technical principle and spirit thereof. Therefore, the scope of protection of the present invention is that as defined in the claims as appended.