PEST CONTROL SYSTEM

Abstract

The invention relates to a genetically transformed or transfected bacterial cell of a gut symbiont of an insect belonging to the Order Thysanoptera wherein said cell is transformed to express double-stranded RNA (dsRNA) active against at least one selected insect gene; a vector for transforming or transfecting said bacterial cell; an insect including said transformed bacterial cell and a method of pest control employing the use of said bacterial cell and/or said insect.

Claims

1. A genetically transformed or transfected bacterial cell wherein said bacteria is a gut symbiont of an insect belonging to the Order Thysanoptera characterised in that said bacterial cell is transformed or transfected with nucleic acid to express dsRNA against at least a part of tubulin gene or at least a part of elongation factor gene of the insect.

2. The genetically transformed or transfected bacterial cell according to claim 1 wherein said dsRNA is against at least a part of tubulin alpha-1 chain gene or at least a part of elongation factor 1-alpha gene of the insect.

3. The genetically transformed or transfected bacterial cell according to claim 1, wherein said dsRNA comprises a strand of RNA that shares 50% complementarity to at least one of said genes.

4. The genetically transformed or transfected bacterial cell according to claim 3, wherein said dsRNA comprises a strand of RNA that shares at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% complementarity to at least one of said genes.

5. The genetically transformed or transfected bacterial cell according to claim 3, wherein said dsRNA active against said tubulin gene or said elongation factor gene of the insect is complementary to at least a part of the sequence of SEQ ID NO: 17 or 18.

6. The genetically transformed or transfected bacterial cell according to claim 3, wherein dsRNA comprises a strand of RNA that shares at least 75% 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% complementarity to ata part of the sequence of SEQ ID NO: 17 or 18.

7. The genetically transformed or transfected bacterial cell of claim 1, wherein said insect belongs to the Thripidae family.

8. The genetically transformed or transfected bacterial cell according to claim 7 wherein said insect belongs to the genus Frankliniella.

9. The genetically transformed or transfected bacterial cell according to claim 8 wherein said insect belongs to the species Frankliniella occidentalis.

10. The genetically transformed or transfected bacterial cell of claim 1, wherein said bacteria is a gut symbiont related to bacteria of the genus Pantoea; or an Erwinia species gut symbiont.

11. The genetically transformed or transfected bacterial cell according to claim 10 wherein said bacteria is BFo2 or BFo1.

12. An expression vector for transforming or transfecting a bacterial cell that is a gut symbiont of an insect belonging to the Order Thysanoptera wherein said vector comprises a nucleic acid sequence that expresses dsRNA against at least a part of tubulin gene or at least a part of elongation factor gene of the insect.

13. The expression vector according to claim 12 wherein said dsRNA is against at least a part of tubulin alpha-1 chain gene or at least a part of elongation factor 1-alpha gene of the insect.

14. The expression vector according to claim 12, wherein said vector comprises at least one constitutive promoter.

15. The expression vector according to claim 14 wherein said constitutive promoter is Ptac.

16. The expression vector according to claim 14, wherein said vector comprises a pair of said promoters.

17. The expression vector according to claim 16 wherein said pair of promoters are configured to drive transcription in a convergent manner.

18. The expression vector according to claim 12, wherein said vector is selected from the group comprising Pex A, pTub3, pElong1, pRN1, and pRN2.

19. An insect belonging to the Order Thysanoptera characterised in that said insect comprises a genetically transformed or transfected bacterial cell wherein said bacteria is a gut symbiont of said insect and is transformed to express dsRNA against at least a part of tubulin gene or at least a part of elongation factor gene of the insect.

20. The insect according to claim 19 wherein said dsRNA is against at least a part of tubulin alpha-1 chain gene or at least a part of elongation factor 1-alpha of the insect.

21. (canceled)

22. (canceled)

23. A method for modulating the expression of a target gene of an insect belonging to the Order Thysanoptera comprising: contaminating a composition to be ingested by the insect with a bacterial cell according to claim 1; whereupon ingestion of said bacterial cell by said insect results in said bacterial cell colonising the gut of said insect wherein it synthesises dsRNA against at least a part of tubulin gene or at least a part of elongation factor gene to modulate said insect gene expression.

24. The method according to claim 23 wherein said dsRNA is against at least a part of tubulin alpha-1 chain gene or at least a part of elongation factor 1-alpha of the insect.

25. The method according to claim 23, wherein said bacterial cell is transformed or genetically modified such that recombinant DNA is stably integrated into the host cell genome.

26. The method of claim 25 wherein said nucleic acid or recombinant DNA is stably integrated in the RNaseIII gene.

27. The method according to claim 23, wherein modulating the expression of a target gene causes insect death, prevents transmission of a pathogenic organism, or both.

28. The method according to claim 27, wherein said insect death occurs at the larval stage.

29. (canceled)

30. The method according to claim 27, wherein said pathogenic organism is a tospovirus.

31. The method according to claim 23, wherein said composition comprises a food source for the insect, a plant, faeces or frass.

32. (canceled)

Description

[0039] The invention will now be described by way of example only with reference to the following figures wherein:

[0040] FIG. 1: shows the configuration of a Thrips cassette. Converging promoters are indicated in red. Notice that Ptac promoters do not contain an operator sequence, therefore are not subject to LacI repression.

[0041] FIG. 2: shows a Pex-A vector map (Eurofins, http://www.operon.com/products/gene-synthesis/ListOfVectors.aspx).

[0042] FIG. 3: shows a Map of the pEX-A-Thrips cassette.

[0043] FIG. 4: shows plasmid maps of pElong1 and pTub3. Red arrows indicate Ptac promoters and blue section indicates position of dsRNA template sequence.

[0044] FIG. 5: shows plasmid maps of pRN1 and pRN2. The rnaseIII gene is shown in green. Light blue boxes indicate T4 transcription terminators and black arrow indicates position of the apramycin resistance gene.

[0045] FIG. 6: shows relative tubulin expression in F. occidentalis normalised to the endogenous control (18S RNA). Bars represent mean relative transcript abundance of tubulin in juvenile insects 48 hours after being fed bacteria (BFo2) expressing double stranded agarose (control) and double stranded tubulin (Tubulin KD). Bars represent mean transcript abundance, error bars represent the standard deviation about the mean. Y axis represent relative tubulin transcript abundance normalised to 18S RNA. Each panel represents a separate experiment using a pool of approximately 22 F. occidentalis insects per treatment.

[0046] FIG. 7: shows upper panel: Composition of F. occindentalis populations following 4 days' oral exposure to modified BFo2 strains expressing control dsRNA or dsTubulin, showing significant a mortality phenotype in the larval and adult stages exposed to dsTubulin. Data compiled from 7 independent experiments; number of fed insects=234 (control), 150 (heat-killed [HK] dsTubulin), 220 (dsTubulin). Note: the pre-pupal and pupal stages of thrips are non-feeding. A highly significant tubulin knockdown mortality phenotype was observed among the thrips larvae, and particularly in the first (L1) larval stage. A small but significant mortality was also observed among the adult F. occidentalis. Heat-killed (HK) BFo2 expressing dsTubulin failed to elicit the mortality phenotype, which highlights the importance of reintroducing live dsRNA-expressing bacteria as opposed simply to pre-synthesized dsRNA. Lower panel: Additional experiments identifying the 1.sup.st larval stage as most susceptible to the mortality phenotype. Data compiled from 4 independent experiments; number of fed insects=134 (control), 95 (HK dsTubulin) & 81 (dsTubulin).

[0047] FIG. 8: shows leaf damage on cucumber seedlings caused by F. occidentalis with and without symbiont-delivered RNAi. Groups of cucumber seedlings were each exposed to WFT larvae and adults that had been orally infected with bacteria (BFo2) expressing dsAgarase RNA (control), or dsTubulin RNA (Tubulin KD). Significantly less damage occurred on plants exposed to F. occidentalis receiving the dsTubulin knockdown compared with the controls.

[0048] FIG. 9: shows the sequence structure of the pEX-A (2450 bp) vector.

[0049] FIG. 10: shows the sequence structure of the Ptac promoter sequence.

[0050] FIG. 11: shows the sequence structure of the Thrips cassette (138 bp, synthetic construct, Ptac sequence underlined).

[0051] FIG. 12: shows the sequence structure of the pEX-A-Thrips cassette (2588 bp).

[0052] FIG. 13: shows the sequence structure of the Tubulin alpha-1 chain gene.

[0053] FIG. 14: shows the sequence structure of the Elongation factor 1-alpha gene.

[0054] FIG. 15: shows the sequence structure of the pTub3 plasmid (2898 bp).

[0055] FIG. 16: shows the sequence structure of the pElong1 plasmid (2982).

[0056] FIG. 17: shows the sequence structure of RNAseIII Bfo2 (PCR amplified).

[0057] FIG. 18: shows the sequence structure of pRNA1 plasmid.

[0058] FIG. 19: shows the sequence structure of pRNA2 plasmid.

EXAMPLE 1

[0059] The method involves establishing symbiont-mediated RNAi as a new, robust and tractable means for systemic prolonged gene silencing, suppression or knockdown in WFT, providing a vital research tool to complement the ongoing WFT genome sequencing project (https://www.hgsc.bcm.edu/western-flower-thrips-genome-project) and a potential innovative biocontrol strategy.

[0060] WFT contain two species of gut bacteria, one belonging to the genus Erwinia, named BFo1, and the second related to the genus Pantoea, named BFo2, which can also grow outside the insect host. The bacteria present in the thrips' gut are transmitted to progeny via the leaves that both adults and larvae eat and defaecate on. In second instar larvae, all thrips are infected with the bacteria, and up to 10.sup.5 bacterial cells are present per thrip. The bacteria attain high populations in larvae, they can be cultured on plates and are tractable for genetic manipulation. The genomes of both BFo1 and BFo2 have been sequenced. Control of transcription is similar to that of E. coli.

[0061] Stable dsRNA synthesis is dependent on (i) inactivating bacterial RNase III, and (ii) integrating the dsRNA expression cassette into the bacterial genome. This is achieved by engineering the expression cassette into a suitable plasmid and deleting the BFo2 RNase III gene. Recombinants are isolated in which the native RNase III gene is deleted and replaced by an apramycin resistance gene. Plasmids are introduced expressing dsRNA (optimised for RNAi) to target the following WFT genes: tubulin alpha-1 chain (accession number GT305545; GenBank, NCBI); or elongation factor 1-alpha (accession number GT303726; GenBank, NCBI). Knockdown of either of the two target genes severely disables larvae and indicates that the technology is effective against WFT. Stable dsRNA synthesis for each cassette is determined for each recombinant bacterial strain by Q-RTPCR.

[0062] Experimental infections were performed in different developmental stages of WFTs by feeding WFTs on recombinant dsRNA-expressing Erwinia TAC strains resuspended in an artificial feeding mixture. Thrips were membrane-fed on this mixture as the only food source for 2-4 days. Dye was included in the mixture to non-invasively identify WFTs that had fed. Bacterial growth and viability in the feeding mixture was confirmed at the beginning and end of each experiment by culturing on selective media. The gut contents of WFTs was also cultured on selective media to verify the viability and population of ingested recombinant BFo2 bacteria. Retention of the symbiotic characteristics of the bacteria was assessed by following WFT development in repopulated insects expressing dsAgarase (negative control) and dsTubulin, correlating these measurements with the presence of recombinant bacteria in the gut and by Q-RTPCR of Tubulin mRNA present in RNA preparations from the insects.

[0063] Insects populated with BFo2 strains expressing dsRNA targeting the insect tubulin genes were compared with the insects populated with bacteria expressing the negative control dsRNA. Data for insect mortality was determined in each case. These data were correlated with Q-RTPCR assays to measure the abundance of m RNA of the respective target genes.

[0064] This novel RNAi strategy can prevent infection of plants by tospoviruses (by killing juvenile insects before they can fly, by targeting vector competence genes of the insect, for example encoding an attachment protein for the virus [Kikkert M., Meurs C., van de Wetering F., Dormller S., Peters D., Kormelink R., Goldbach R., 1998. Phytopathology 88: 63-69] and/or viral gene expression), and provide a platform for devising an effective crop protection strategy using the recombinant bacteria as a biopesticide.

[0065] Bacteria typically express an enzyme, RNaseIII, which specifically degrades dsRNA. Indeed we have established that dsRNA is unstable after it is expressed in BFo2. To circumvent this problem, we have engineered a BFo2 mutant strain in which the gene encoding RNaseIII is disrupted and which stably expresses dsRNA.

Materials and Procedure

Bacterial Strains and Media

[0066] Cloning procedures were performed in E. coli JM109. Disruption of the RNaseIII gene was performed in BFo2 containing pIJ790 to allow Lambda red-mediated recombination (Gust B, Challis G L, Fowler K, Kieser T, Chater K F (2003) Proc Natl Acad Sci USA. February 18; 100(4):1541-6)). Culturing of E. coli strains was as recommended (Sambrook and Russell (2001). Molecular Cloning: A Laboratory Manual (3rd ed.). Cold Spring Harbor Laboratory Press. ISBN 978-0-87969-577-4). BFo2 was grown at 30 C. in liquid culture (LB, with shaking) and on the surface of L agar plates. The identity of the RNaseIII disruption mutant was confirmed by PCR.

dsRNA Expression System

Construction of Expression Vector to Drive Constitutive Expression of Double Stranded RNA in Bfo2.

[0067] A 138 bp synthetic expression cassette (Eurofins), containing several restriction sites flanked by two copies of the modified constitutive promoter Ptac was used. The promoter sequences were designed to drive transcription in a convergent manner (FIG. 1), to ensure transcription from both complementary strands of DNA fragments sub-cloned in the MC site. The synthetic expression cassette was cloned between the Notl sites of the ampicillin resistant plasmid pEX-A (Eurofins, FIG. 2), generating plasmid pEX-A-Thrips cassette.

[0068] Deqor (Henschel et al, 2004, Nucleic Acids Research, 32 (Web Server issue): W113-20) was used to help predict F. occidentalis genes used as target candidates for double stranded RNA mediated interference. The sequences deemed suitable candidates were obtained by synthesis (Eurofins), flanked by Xbal sites. These DNA fragments were provided as inserts cloned in pEX-A or pCR2 vectors (Table 2).

[0069] The DNA fragments to be used as templates for dsRNA synthesis were sub-cloned into the Xbal site of pEX-A-Thrips cassette, and therefore flanked by convergent Ptac promoters to ensure constitutive transcription of two complementary RNA strands that would hybridise to generate the desired double stranded RNA. The resulting in plasmids were pElong1 and pTub3. These constructs were verified by restriction and DNA sequencing (FIG. 4).

Generation of a BFo2 Disruption Mutant.

[0070] The RNaseIII gene was PCR amplified from wild-type BFo2 using primers RIIIBfo2F1 and RIIIBfo2R1 (Table 1). The product (759 bp in length) was digested with EcoRI/HindIII and ligated into pIJ2925 previously digested with EcoRI/HindIII generating plasmid pRNA1. Disruption of this copy of the RNaseIII gene was achieved by EcoRV digestion of pRNA1 and insertion of the apramycin resistance gene (flanked by T4 transcription terminators) excised from plasmid pQM5062 by HindIII restriction digest and blunt ending using T4 DNA polymerase in the presence of 1 mM dNTPs giving rise to pRNA2 (FIG. 5). To facilitate lambda-red mediated transformation, electrocompetent BFo2 cells were created as recommended for E. coli (Sambrook and Russell (2001). Molecular Cloning: A Laboratory Manual (3rd ed.). Cold Spring Harbor Laboratory Press. ISBN 978-0-87969-577-4) and transformed by electroporation with plasmid pIJ790 (Gust B, Challis G L, Fowler K, Kieser T, Chater K F (2003) Proc Natl Acad Sci USA. February 18; 100(4):1541-6))creating strain BFo2/pIJ790. The disrupted RNaseIII gene was excised from pRNA2 by digesting BglII and, after gel purification was introduced into electrocompetant BFo2/pIJ790 by electroporation. Double cross-over transformants were selected by replica plating on selective media containing ampicillin or apramycin. Viable colonies were tested for the presence of the disruption by colony PCR using the primers BFo2RNasetestF and BFo2RNasetestR. All plasmids were confirmed by restriction digestion and sequencing.

Testing Functionality of dsRNA Expression System

[0071] Overnight cultures of BFo2 containing the dsRNA expression plasmids were pelleted by centrifugation (13,000g for 10 min) and mixed with equal volumes of RNA protect (Qiagen). Total RNA was isolated using the RNeasy mini RNA isolation kit (Qiagen). Genomic DNA was digested using on-column DNAse I treatment for 45 minutes at room temperature. Strand specific reverse transcription was performed on 1 ug of total RNA using the iscript select reverse transcription kit (Biorad) including the gene specific primer enhancer (GSP) and one of the following gene specific primer pairs: tubulinTubFoF1 and TubFoR1, elongation factorEFFoF1 and EFFoR1, (sequences shown in table 3). cDNAs were diluted 1/3 in nuclease free water (supplier). Strand-specific Real Time amplification was performed in triplicate using Sybr-Green Supermix (Biorad) and both gene specific primers listed in table 1. No template controls (NTC, non-reverse transcription) were used to assess the extent of genomic DNA carry over.

Infection of Thrips with BFo2 Strains

[0072] Overnight cultures of BFo2 containing the dsRNA expression plasmids were pelleted by centrifugation (3,000g for 2 min) and washed by resuspension in Luria broth, then resuspended to 510.sup.6/ml in an artificial feeding mixture (20% (v/v) Luria broth, 2.4% (w/v) sucrose, 0.32% (w/v) NaCl and 0.03% (w/v) methylene blue). Franliniella occidentalis of all developmental stages were membrane-fed on the feeding mixture as the only food source for 2-4 days from an inverted Bijou bottle reservoir covered by stretched Parafilm. Methylene blue was included to non-invasively identify WFTs that had fed (the blue colour in the gut being visible through the insect cuticle under low-power magnification in WFTs anaesthetised by CO.sub.2). Bacterial growth and viability in the feeding mixture was confirmed at the beginning and end of each experiment by culturing on LB agar supplemented with 1.5% (w/v) sucrose and the appropriate selective antibiotic (apramycin for BFo2 expressing dsAgarase; apramycin and ampicillin for BFo2 expressing dsTubulin). The dyed gut contents of randomly-selected, surface-sterilized WFTs were also cultured on selective media to verify the viability and population of ingested BFo2 strains. Additional controls were prepared using overnight cultures of BFo2 expressing dsTubulin, which were heat-killed by incubation at 65 C. for 20 mins prior to incorporation into feeding mixtures as above.

Efficacy of RNAi in Infected Insects

[0073] Juvenile thrips (1.sup.st and 2.sup.nd instar) were sampled 48 hours after infection with recombinant BFo2, RNA extracted and levels of tubulin alpha1 mRNA quantified (FIG. 6). Total RNA was isolated from pools of approximately 22 juvenile insects using the ZR Tissue and insect RNA microprep kit (Zymo Research). On-column DNase treatment was performed at room temperature using RNase free DNAse (Qiagen). For each isolation, 500 ng of RNA was reverse transcribed using the iscript select synthesis kit and oligodT primers (BioRad). Q RT-PCRs were performed in triplicate using Sybr Green Supermix (BioRad). Serial dilutions of pooled cDNA were performed in duplicate and used to generate standard curves and to test the efficiency of the q RT PCR reaction. Relative transcript abundance of alpha tubulin was calculated by normalising to 18S. All Q RT PCR primers are listed in table 3.

Mortality of Infected Insects

[0074] Frankliniella occidentalis populations were reared on chrysanthemum plants and runner beans ad libitum at 70-80% relative humidity, 26-27 C., with a light:dark cycle of 14:10 hours respectively. Sample WFT populations containing all developmental stages of F. occidentalis were orally infected with recombinant BFo2 expressing dsAgarose RNA (control) and dsTubulin, and monitored for a knockdown phenotype after 4 days. An additional control was included which involved feeding of heat-killed BFo2 expressing dsTubulin.

Plant Protection

[0075] Groups of three 15-day-old cucumber seedlings were each exposed to 50 larvae and 15 adult female F. occidentalis that had been orally infected with BFo2 expressing dsAgarase RNA (control), or dsTubulin RNA (Tubulin KD). After 5 days, the percentage of the leaf surface that was covered with lesions was assessed by Assess 2.0 image analysis software for plant disease quantification (Lamari, Amer Phytopathological Society; 2008; http://www.apsnet.org/press/assess); (FIG. 5).

TABLE-US-00001 TABLE 1 Strains and plasmids. genotype/comments Source Strains E. coli FtraD36 proA.sup.+B.sup.+laclq(lacZ)M15/ Yanish-Perron et al., JM109 (lac-proAB) glnV44 e14-gyrA96 1985 recA1relA1endA1 thi hsdR17 Plasmids pIJ2925 bla, lacZ Kieser et al., 2000 pRNA1 pIJ2925 containing ~759 bp BFo2 This study rnaseIII PCR product pRNA2 pIJ2925 containing apramycin disrupted This study BFo2 rnaseIII PCR product pIJ790 -RED (gam, bet, exo), cat, araC, Gust et al., 2003 rep101ts pQM5062 pMOD + Tn5062, Ampicillin.sup.R and Bishop et al., 2004 Apramycin.sup.R

TABLE-US-00002 TABLE 2 Gene targets used to generate synthetic DNA fragments to be used as template for dsRNA synthesis. Length of synthetic Target gene (Genebank) Plasmid name sequence Elongation factor 1A pEX-A-Elongation factor 1A 400 bp (GT303726.1) Tubulin Alpha-1 chain pEX-A-tubulin alpha-1 316 bp (GT305545.1)

TABLE-US-00003 TABLE3 OligonucleotidesusedforPCRandQRT-PCR. Oligo- nucleotides RIIIBfo2F1 TTAGAATTCGTTGATACAGCCCTGTTTCATGTGC RIIIBfo2R1 TTTAAGCTTTTAGTCAGTGCTTGCTCTGCAGC BFo2RNasetestf AGCGGATACCGTAGAAGCAC BFo2RNasetestR TAGGCCGGTAACGGTAAGTG TubFoF1 AGGATGCTGCTAACAACTA TubFoR1 GATGCGGTCCAATACAAG EFFoF1 CTCCAGGTCACAGAGATT EFFoR1 CACCAATGATGAGGATAGC Fo18SF GAAGGATTGACAGATTGA Fo18SR TAGAGTCTCGTTCGTTAT FoTubF TTGAAGAAGCATCCTAAC FoTubR TTGAGAAGTAGTTGAGAT