Method for increasing citric acid production by Aspergillus niger fermentation
20180195052 ยท 2018-07-12
Inventors
- Long Liu (Wuxi, CN)
- Jian Chen (Wuxi, CN)
- Guocheng Du (Wuxi, CN)
- Jianghua Li (Wuxi, CN)
- Xian Yin (Wuxi, CN)
- Zhijie Hu (Wuxi, CN)
- Jianwei Jiang (Wuxi, CN)
- Fuxin Sun (Wuxi, CN)
- Sai Jin (Wuxi, CN)
- Cheng Zhang (Wuxi, CN)
- Xiaodong Jiang (Wuxi, CN)
Cpc classification
C12Y102/01076
CHEMISTRY; METALLURGY
C12N9/0008
CHEMISTRY; METALLURGY
International classification
Abstract
The invention discloses a method for improving citric acid production by Aspergillus niger fermentation, which integrates Aspergillus niger GABA pathway succinate semialdehyde dehydrogenase SSD gene into Aspergillus niger genome to obtain recombinant Aspergillus niger strain, and uses recombinant black The Aspergillus strain ferments to produce citric acid; the expression of the succinate semialdehyde dehydrogenase SSD gene is regulated by the Pgas promoter. The method of the invention realizes the expression of succinate semialdehyde dehydrogenase SSD in Aspergillus niger to enhance the GABA pathway so as to strengthen the TCA cycle and promote the synthesis of citric acid.
Claims
1. A reconstructed A. niger with higher citrate production whose genome comprises an inserted Aspergillus niger GABA pathway succinate semialdehyde dehydrogenase SSD gene, which is under control of a promoter Pgas.
2. The reconstructed A. niger in claim 1, wherein a gene sequence of succinate semialdehyde dehydrogenase SSD gene is set forth in SEQ ID NO: 1, with its amino acid sequence set forth in SEQ ID NO: 2.
3. The reconstructed A. niger in claim 1, wherein at least one amino acid of succinate semialdehyde dehydrogenase SSD is replaced or deleted.
4. The reconstructed A. niger in claim 1, wherein the promoter Pgas is a low pH inducible promoter, and a sequence of the promoter Pgas is set forth in SEQ ID NO: 3.
5. An expression cassette of succinate semialdehyde dehydrogenase SSD, comprising a promoter Pgas, a succinate semialdehyde dehydrogenase SSD gene and a terminator trp in order of Pgas-LGT1-trp.
6. The expression cassette in claim 5, wherein a sequence of the promoter Pgas is set forth in SEQ ID NO: 3, an amino acid sequence of succinate semialdehyde dehydrogenase SSD is set forth in SEQ ID NO: 2, and a sequence of terminator trp is set forth in SEQ ID NO: 6.
7. A method for the reconstruction of reconstructed A. niger mentioned in claim 1 contains the following steps: (1) constructing an expression cassette of succinate semialdehyde dehydrogenase with Pgas-SSD-trp; (2) constructing a resistant gene expression cassette gpdA-hph-trp; (3) inserting expression cassettes in step (1) and (2) into A. niger, screening resistant strains and confirming reconstructed strains with PCR.
8. The method in claim 7, wherein a sequence of gpdA promoter in resistant gene cassette is set forth in SEQ ID NO: 4.
9. The method in claim 7, wherein a sequence of resistant gene hph in resistant gene cassette is set forth in SEQ ID NO: 5.
Description
DETAILED DESCRIPTION
Example 1
[0020] (1) Extraction of Aspergillus niger RNA: A. niger spores were inoculated into citric acid fermentation medium and cultured at 35 C. for 250 r/min for 48 h. The spheroids were collected with mirocloth, washed three times with sterile ultrapure water, Rapidly frozen in liquid nitrogen and thoroughly ground with a liquid nitrogen grinding method. The total RNA was extracted from A. niger using the QIAGEN RNeasy Plant Mini Kit, and the cDNA was reverse transcribed into cDNA using TAKARA PrimeScript RT reagent Kit with gDNA Eraser.
[0021] (2) Extraction of A. niger genomic DNA: A. niger spores were inoculated into ME liquid medium (3% malt extract, 0.5% tryptone) and incubated at 35 C. for 250 r/min for 48 h. The spheroids were collected with mirocloth, and the bacteria were washed three times with ultrapure water, drained and quickly frozen in liquid nitrogen. The tissues were thoroughly ground with liquid nitrogen and the filamentous fungus genome was extracted by using DNeasy Plant Mini Kit from QIAGEN.
[0022] (3) Construction of SSD protein expression cassette:
[0023] {circle around (1)} The trp terminator was amplified using pAN7-1 as a template (using the primers trp-F (SEQ ID NO: 7) and trp-R (SEQ ID NO: 8) 6). The sequence contained Pst I and Hin dIII sites upstream and downstream of the sequence, ligated to pMD19, sequenced, digested with the two restriction enzymes, and ligated into the same digested pUC19 to obtain pUC19-trp;
[0024] {circle around (2)} The Pgas promoter was amplified from the A. niger genome using the primers Pgas-F (sequence shown in SEQ ID NO. 9) and Pgas-R (sequence shown in SEQ ID NO. 10) (sequence shown in SEQ ID NO. 3), The two ends of the sequence containing Eco RI and Kpn I restriction sites, digested, the sequence is connected to the same digested pUC19-trp to give pUC-Pgas-trp;
[0025] {circle around (3)} RT-PCR amplification of SSD CDS using primers gas-SSD-F (SEQ ID NO: 11) and Trp-SSD-R (SEQ ID NO: 12). The sequences contained pUC-Pgas-trp about 20 bp homologous sequences at both ends respectively. Homologous recombination was performed using the Vazyme One Step Clone Kit to form a gas-SSD-trp expression cassette to obtain pGSH expression vector;
[0026] The primers used are as follows:
TABLE-US-00001 trp-F: ctgcagGATCCACTTAAACGTTACTGAAATC trp-R: aagcttCTCGAGTGGAGATGTGGAGTGG Pgas-F: gaattcCTGCTCTCTCTCTGCTCTCTTTCT Pgas-R: ggtaccGTGAGGAGGTGAACGAAAGAAGAC Gas-SSD-F: gttcacctcctcacGGTACCATGGGTTACACTGTCCCTCCGC Trp-SSD-R: TAACGTTTAAGTGGATCGGATCCCTACTGAAGAGGCTCAATTCC
[0027] (4) Preparation and transformation of A. niger protoplasts:
[0028] {circle around (1)} Inoculate A. niger spores into PDA liquid medium at a concentration of 310.sup.5/ml and incubate at 200 r/min overnight at 30 C. Collect the fungus spheres with mirocloth and wash the spheroids with sterile water.
[0029] {circle around (2)} Weigh 0.5 g/L lysing enzyme, and dissolved with osmotic pressure stabilizer KMC, sterilized by sterile filter, weighed 0.5 g mycosphere, added to the enzyme solution, 37 C., 100 r/min shaking culture About 3 h until the hypha completely digested as protoplasts, centrifuged at 1000 rpm for 10 min at 4 C., the supernatant was discarded, the same volume of precooled STC was added, and centrifuged at 1000 rpm for 10 min at 4 C. The supernatant was washed twice, and add 100 L STC, mix well to obtain A. niger protoplasm;
[0030] {circle around (3)} Add 10 L linearized nucleic acid fragment and 330 L PEG buffer to 100 L protoplast of A. niger, place on ice for 20 min, add 2 mL PEG, place at room temperature for 10 min, add 4 mL STC and 4 mL at 48 C. Preheated supernatant was plated on the bottom medium containing 180 mg/L hygromycin. Plates are incubated at 35 C. for up to 4-7 days until colonies appear, picking single colonies for generations. Three single spore subcultures per colony.
Control Example 1
[0031] (1) Acquisition of hygromycin resistance expression cassette: The hygromycin-resistant expression cassette was obtained from the plasmid pAN7-GFP by primers gpd-F (sequences shown in SEQ ID NO. 13) and Ttrp-R-2, the expression cassette comprises PgpdA (SEQ ID NO: 4), hph (SEQ ID NO: 5) and trp terminator (SEQ ID NO: 6).
TABLE-US-00002 gpd-F: CAATTCCCTTGTATCTCTACACACAG Ttrp-R-2: CTCGAGTGGAGATGTGGAGTGG
[0032] (2) Preparation and transformation of Aspergillus niger protoplasts:
[0033] {circle around (1)} inoculate A. niger spores into PDA liquid medium at a concentration of 310 5/ml, incubate at 200 r/min overnight at 30 C., collect spheroids with mirocloth, and sterilize the spheroids with sterile water;
[0034] {circle around (2)} Weigh 0.5 g/L lysing enzyme, and dissolved with osmotic pressure stabilizer KMC, sterilized by sterile filter, weighed 0.5 g mycosphere, added to the enzyme solution, 37 C., 100 r/min shaking culture 3 h until the hypha completely digested as protoplasts, centrifuged at 1000 rpm for 10 min at 4 C., the supernatant was discarded, the same volume of precooled STC was added, centrifuged at 1000 rpm for 10 min at 4 C., the supernatant was discarded, washed twice and added with 100 L STC, mixing, preparation of A. niger protoplasts;
[0035] {circle around (3)} Add 10 L linearized nucleic acid fragment and 330 L PEG buffer to 100 L protoplast of A. niger, place on ice for 20 min, add 2 mL PEG, place at room temperature for 10 min, add 4 mL STC and 4 mL at 48 C. The pre-warmed upper culture medium was plated on an underlayer medium containing 180 mg/L hygromycin and the plates were inverted at 35 C. for 4-7 days until colonies appeared, single colonies were picked and subcultured, and each colony was subjected to 3 Sub-single spores sub-generation.
[0036] Tests
[0037] The A. niger obtained in the examples and the control examples, the commonly used A. niger Co82 and the Aspergillus nigerTN-A09 were respectively inoculated on PDA medium (malt extract 30 g/L, tryptone 5 g/L) Spores were scraped at 35 C. for 7 days, spores were harvested and seeded in seed culture medium (cornstarch medium, total sugar content 10%, total nitrogen content 0.2%) at 10.sup.6/mL inoculum, 37 C., 250 r/min culture 24 h. The fermentation medium was transferred to 1/10 inoculum and fermented at 35 C. and 250 r/min for 72 h. The fermentation broth was centrifuged to remove the bacteria and diluted 10-fold. The content of citric acid was determined by HPLC after filtration through the membrane. The test data is shown in Table 1.
TABLE-US-00003 TABLE 1 Citric acid content Conversion rate Fermentation (g/100 mL) (%) cycle (h) Implementation 17.6 98 55 example Cotrol example 13.4 92 60 A. niger Co82 13 92 60 A. niger TN-A09 12.5 92 60 Note: citric acid content detection using Agilent 1200 HPLC (with UV-visible detector, differential detector and workstation); chromatographic conditions: HPX87 H column (4.6 250 mm, 5 m), the mobile phase of 5 mM sulfuric acid solution, The flow rate of 0.6 mL/min, the injection volume of 10 L, the column temperature of 30 C., 210 nm wavelength UV detection.
[0038] It can be seen from Table 1 that the strains prepared in the examples of the present invention have short fermentation time and better citric acid yield and conversion rate than the control and the existing A. niger strains.
[0039] (2) The A. niger obtained in the examples and the comparative examples was inoculated into the 35 C. spore culture 7 on the ME medium (malt extract 30 g/L, tryptone 5 g/L) with the commonly used A. niger zjs-8 The spores were scraped and inoculated into seed medium (cornstarch medium, total sugar content 10%, total nitrogen content 0.2%) at 10.sup.6/mL inoculum, cultured at 37 C. and 250 r/min for 24 h, 10 inoculum transfer fermentation medium, 42 C., 250 r/min fermentation 72 h. The fermentation broth was centrifuged to remove the bacteria, diluted 10 times, and the citric acid content was detected by HPLC after being filtered through a membrane filter. The test results are shown in Table 2.
TABLE-US-00004 TABLE 2 Citric acid content Conversion rate Fermentation (g/100 mL) (%) cycle (h) Implementation 16.5 97 60 example Control example 10.7 66.8 70 A. niger zjs-8 10 61.83 60
[0040] As can be seen from the data in Table 2, the A. niger strains prepared in the examples of the present invention have good high temperature resistance, and citric acid yield and conversion rate are still higher than those of the existing A. niger zjs-8 under the condition of increasing temperature.
[0041] (3) A. niger and A. niger Co82 obtained in the examples and the control examples were respectively inoculated on ME medium (malt extract 30 g/L, tryptone 5 g/L) for 35 days at 35 C. for 7 days to sporulate the spores, The inoculation amount of 10.sup.6/mL was inoculated into the seed medium (corn starch medium, the total sugar content of 10%, the total nitrogen content of 0.2%, pH 3.5), 37 C., 250 r/min culture 24 h, Transfer fermentation medium (pH 2.0), 42 C., 250 r/min fermentation 72 h. The fermentation broth was centrifuged to remove the bacteria, diluted 10 times, and the citric acid content was detected by HPLC after being filtered through a membrane filter. The test results are shown in Table 3.
TABLE-US-00005 TABLE 3 Citric acid content Conversion Fermentation (g/100 mL) rate (%) cycle (h) Implementation 18.3 99 60 example Comparative example 14 93 60 Aspergillus niger 13 93 65 Co82
[0042] It can be seen from Table 3 that the strains obtained in the examples of the present invention still have better citric acid yield and conversion under more severe acidic conditions and relatively short fermentation cycles. The recombinant strains of the present invention have better Acid resistance.