Cytoplasmic male sterile Cichorium plants

Abstract

The present invention relates to cytoplasmic male sterile (CMS) Cichorium plants and especially to cytoplasmic male sterile (CMS) green chicory plants; cytoplasmic male sterile (CMS) radicchio rosso plants; cytoplasmic male sterile (CMS) red leaved chicory plants, cytoplasmic male sterile (CMS) Treviso plants, cytoplasmic male sterile (CMS) white chicory plants, cytoplasmic male sterile (CMS) sugar loaf plants, cytoplasmic male sterile (CMS) Belgian endive plants, cytoplasmic male sterile (CMS) witloof plants, cytoplasmic male sterile (CMS) Catalogna plants, cytoplasmic male sterile (CMS) C. intybus var. foliosum plants, cytoplasmic male sterile (CMS) C. endivia plants and cytoplasmic male sterile (CMS) C. intybus L. var. sativum plants. The present invention further relates to methods for identifying cytoplasmic male sterile (CMS) Cichorium plants and mitochondrial nucleic acid sequences providing cytoplasmic male sterility (CMS) in Cichorium plants.

Claims

1. Cytoplasmic male sterile Cichorium intybus plant comprising Lactuca mitochondria of a plant which was deposited with the NCIMB under accession number NCIMB 41985.

2. Cytoplasmic male sterile Cichorium intybus plant according to claim 1, wherein said cytoplasmic male sterile Cichorium intybus plant is further identifiable by a molecular marker of 1592 bp using nucleic acid amplification primers SEQ ID No. 31 and SEQ ID No. 32.

3. Cytoplasmic male sterile Cichorium intybus plant according to claim 1, wherein said cytoplasmic male sterile Cichorium intybus plant is further identifiable by a molecular marker of 293 bp using nucleic acid amplification markers SEQ ID No. 33 and SEQ ID No. 34.

4. Cytoplasmic male sterile Cichorium intybus plant according to claim 1, wherein said Cichorium intybus plant comprises a cytoplasm of a plant which was deposited with the NCIMB under accession number NCIMB 42125.

Description

(1) Below, the present invention will further be described in examples of preferred embodiments of the present invention. In the examples, reference is made to figures wherein:

(2) FIGS. 1A-1D: show flowcytograms of: Cichorium intybus L. (FIG. 1A); Lactuca sp. (FIG. 1B); Hybrid 1 (according to the present invention; FIG. 1C); and a mixed sample of Cichorium intybus L., Lactuca sp., and Hybrid 1(FIG. 1D);

(3) FIG. 2: shows result of a molecular characterization of nuclear DNA using the RAMP technique. From left lane to right lane, Cichorium intybus (P155); Lactuca sp. (P157); hybrids 1 to 3 (H1-H3, i.e. hybrid plants of a cross between P155 and P157; discriminating bands are indicated;

(4) FIG. 3: shows a graphic representation of pollen size of Cichorium, Lactuca and the selected fusion plant P153. Legend to this graph: X axis: diameter of pollen grains in m2 Y axis: percentage of pollen grains present in the distinct sizes;

(5) FIG. 4: shows TOP: Photograph of a flower of P153, a selected plant from the described fusion products obtained. BOTTOM: detail of the anthers showing (non-functional) pollen grains;

(6) FIG. 5: shows TOP: Photograph of a fertile flower of Cichorium intybus L. BOTTOM: detail of the anthers.

EXAMPLES

Example 1

Sterilization and Sowing of Seeds

(7) Seeds from both the donor (Lactuca sp., deposited on Jun. 1, 2012 at NCIMB Ltd, Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen, AB21 9YA, UK as deposit NCIMB 41985, and the acceptor (Cichorium intybus L.) were sown in vitro. To this end 100 seeds of each species were sterilized by a rinse in 70% ethanol in water, succeeded by a treatment with a bleach solution (1% (w/v) NaOCl+0.01% (v/v) Tween80 in demineralized water). After a thorough rinse with sterile demineralized water, seeds were placed on a suitable medium as MS15 and placed in a growth room at 25 C., 16/24 hrs. light. After 4 weeks plants were suitable for protoplast isolation.

Example 2

Isolation of Protoplasts

(8) Young, surface-sterilized leaves of 4 week old plants were collected. These leaves were cut in pieces of 1-2 mm in TC quality petri dishes (Greiner Bio-One, article 664160) in plasmolysing solution WS9M. After collecting all material, this solution was replaced by 20 ml of enzyme solution containing cell wall degrading enzymes like pectinase and/or cellulase. After an overnight incubation (dark, 25 C.) on an orbital shaker with a speed of 30 rpm, material was sieved on respectively a 110 and a 53 m filter; these filters were rinsed twice with 10 ml wash solution.

(9) The collected filtrate was centrifuged for 5 minutes at 60 g. After resuspending the pellet in 10 ml wash solution, this centrifugation step was repeated. Protoplasts were kept on ice until further processing.

Example 3

Viability Control

(10) A check for viability of the isolated protoplasts and pollen grains was performed with FDA. To this end, samples of stained protoplasts, from both donor and acceptor, or pollen grains collected from donor or selected fusion plants, were checked with a fluorescence-microscope using the appropriate filters, magnification 10.

(11) Viable cells can be recognized by a bright yellow-green color, non-viable cells do not fluoresce.

Example 4

Pretreatment of Isolated Protoplasts

(12) Isolated protoplasts from the donor (Lactuca) were treated with a suitable source of ionizing radiation (e.g. a source of Roentgen or gamma radiation). A suitable dose is in the range of 250-500 Gray as measure of absorbed energy. From the protoplasts isolated from the acceptor (Cichorium intybus var. foliosum), cellular organelles were inactivated by a treatment with a final concentration IOA of 10 mM (supplied from a 60 mM IOA stock solution) during 10 minutes at 4 C. After this treatment cells were washed twice with wash solution and centrifuged at 60g during 5 minutes.

(13) Fusion and successive regeneration of the protoplasts obtained can be performed in two alternative ways as described in the examples 5 and 6a (culture in liquid medium) and 5 and 6b (embedded in solid medium using sodium alginate) respectively.

Example 5

Fusion of Protoplasts

(14) Per 10 ml tube (round bottom, Greiner, catalogue number 163189) 110.sup.6 protoplasts (in a ratio of acceptor:donor of 1:1 or 2:1) in wash solution were added.

(15) After centrifugation (5 minutes at 60*g) each pellet was resuspended in 0.3 ml wash solution. Then, 0.4 ml PEG1500 solution per test tube was added by letting separate drops fall into the tubes; no further mixing was allowed here. After standing still for 30 minutes, 0.8 ml PEG diluting solution was added, by slowly flowing down the test tube wall. Without further mixing the cells are left for 10 minutes.

(16) After this, tubes are topped up with CPW-Ca.sup.++ solution to a final volume of 10 ml, without further mixing the cells are centrifuged for 5 minutes at 60*g. After three repetitive washing with CPW-Ca.sup.++ solution pellets were resuspended in PM1 culture medium providing a final density of 20.000 protoplasts/ml.

Example 6

Culture of Fused Protoplasts

Example 6a

Using Liquid Regeneration Media

(17) Culturing was performed in dark at 25 C., every week the culture medium is partly replaced: 6 cm dish: 3 ml (out of 4.5 ml) is replaced by 3 ml fresh PM1 medium 9 cm dish: 5 ml (out of 9 ml) is replaced by 5 ml fresh PM1 medium

(18) As soon as the first cell divisions were observed (2 to 4 cell stage) the culture medium was replaced by PM2 medium, also this medium is partly replaced on a weekly basis as described above.

(19) Calli of 2 mm diameter were placed on solid CRM medium at 1000 lux. As soon as the calli turn green the amount of light was increased to approx. 1700 lux. Calli without shoots were transferred to fresh CRM medium every three weeks.

(20) Emerging shoots were cut from the calli, leaving behind as much callus as possible, and placed on MS30-gelrite medium either in jars or petridishes. To promote rooting, shoots were cutto remove any residual callus- and transferred to fresh MS30-gelrite medium.

Example 6b

Embedded in Alginate

(21) Starting with the fused protoplasts as described in example 5, protoplasts were resuspended in solution A; per tube containing 110.sup.6 protoplasts. To each tube, 2.5 ml solution A was added; after carefully re-suspending the cells, 2.5 ml sodium alginate solution was added. Drops of 1 ml suspension were placed on solid medium B. After 1 hour the solidified medium including the protoplasts were rinsed with PM1 medium and transferred to dishes containing 3 resp. 6 ml PM1 medium (petri dishes of 6 or 9 cm diameter, respectively). Further media changes were similar as described in example 6a.

(22) As soon as the calli reach a diameter of 2 mm, the alginate matrix was dissolved by replacing the culture medium by 50 mM sodium citrate solution. Each alginate disc was cut in 8 pieces and the dishes are placed on an orbital shaker for 2 hours (30 rpm).

(23) Microcalli were collected using a pipette and transferred to a test tube. To this tube PM2 medium was added to a final volume of 10 ml and then the tube is centrifuged for 5 minutes at 60*g.

(24) After washing with PM2 medium twice, calli were placed on CRM medium at 1000 lux; calli which turned green were grown further at 1700 lux. Calli were kept on this medium and transferred, if necessary, to fresh CRM medium every three weeks.

(25) Shoots which emerged on these calli were cut from the callus and placed on MS30-gelrite medium, either in petri dishes or glass jars, shoots were transferred on fresh medium of the same composition until roots were formed. Rooted plants were placed on MS30 medium.

Example 7

Determination of Ploidy Level

(26) From plants resulting from cell fusion or crosses between Cichorium and Lactuca plants, the relative ploidy level was determined. To this end, a small piece of leaf tissue 1 cm.sup.2 was taken from the plants examined and chopped with a razor blade in CyStain UV Ploidy buffer (Partec, Munster, Germany).

(27) After filtration, the ploidy level of the sample was determined using a Partec PA flow cytometer and compared to the result of samples from Cichorium and Lactuca plants. Only diploid plants, resulting from cell fusion were retained.

(28) Plants resulting from crosses between Cichorium and Lactuca sp. possess a ploidy level intermediate between Cichorium and Lactuca sp. (FIGS. 1A-1D).

Example 8

Molecular Characterization Genomic DNA

(29) Resulting from the cross between Cichorium (ID=P155) and Lactuca (ID=P157), several seeds were harvested, of which three germinated seeds were analyzed as described in example 7 and identified as hybrid plants. To further characterize these plants, a molecular analysis was performed.

(30) From these putative hybrid plants and both parents DNA was isolated, following a standard isolation procedure, starting with leaf explants of 0.3 cm.sup.2.

(31) On this isolated DNA, a RAMP analysis was performed with two primers generating polymorphisms between Cichorium and Lactuca. The result showed unequivocally that the hybrid plant harbored genomic DNA of both parents, thus demonstrating this plant was indeed a genomic hybrid between Cichorium and Lactuca.

(32) Primers used for the reaction were:

(33) TABLE-US-00001 (SEQIDNo.37;RAPDprimer) Bejop09631 AGTCGGGTGG (SEQIDNo.38;iSSRprimer) Bejop01751 CCAGGTGTGTGTGTGT
PCR conditions: 2 minutes 93 C. 40 cycles of: 30 s. 93 C.-30 s. 35 C.-90 s. 72 C. 5 minutes 72 C. Heating is performed with 0.3 C./sec.

Example 9

Polyacrylamide Gel Electrophoresis

(34) To analyze the RAMP patterns a Gene ReadIR 4200 DNA analyzer (Licor Inc.) was used. Based on an optimal concentration of 6.5% acrylamide DNA fragments differing 1 base pair in size can be separated. To envisage these fragments labeled (IRDye labels) primers were used, one third of the amount of forward primer was replaced by a labeled, identical primer.

(35) The result showed unequivocally that the obtained plants harbored genomic DNA of both parents, thus demonstrating these three plants (H1 to H3) were indeed hybrids between Cichorium and Lactuca (FIG. 2).

Example 10

Characterization of Mitochondrial DNA of the Selected Fusion Plant

(36) Mitochondrial DNA was characterized to demonstrate that indeed the cytoplasm of Cichorium was replaced by the Lactuca cytoplasm.

(37) Buffers used were essentially as described. However, some buffers were adjusted as denoted in the section Solutions and chemicals. All experimental steps were performed with precooled buffers and at 4 C., unless stated otherwise.

(38) 100 grams of fresh leaves were homogenized on ice with a blender in 250 ml GB buffer. The homogenate was vacuum filtered on 4 layers of cheesecloth and 2 layers of nylon mesh (75 m). The residue was homogenized further using a precooled mortar and pestle and subsequently filtered as described.

(39) Filtrates were pooled and centrifuged for 10 minutes at 1.000g; the supernatant was re-centrifuged at 2.000g. Finally mitochondria were collected by centrifugation at 16.000g. The resulting pellet was resuspended using a paint brush in 10 ml DNAse storage buffer.

(40) Following centrifugation at 2.000g, the resulting supernatant was pipetted to a centrifuge tube, 50 l 2M MgCl.sub.2 and 200 l 5 mg/ml DNAse were added. After incubation for one hour, 20 ml of shelf buffer was pipetted under this mixture.

(41) After centrifugation at 14.000g, the resulting pellet was resuspended in 10 ml shelf buffer. The suspension was centrifuged for 10 minutes at 16.000g, the pellet was dissolved in 600 l Lysis Buffer and transferred to a 1.5 ml Eppendorf test tube. In this lysate, containing the mitochondrial DNA, 1 mg proteinase K is dissolved and 10 l RNAse-A solution was added. Incubation was first 60 minutes at 37 C. followed by 30 minutes incubation at 65 C.

(42) After this incubation, DNA was precipitated by adding 200 l 5 M KAc and mixed by turning over the test tube, leaving it then for maximum 15 minutes on ice. Next is a centrifugation during 10 minutes at 20.000g at room temperature. Finally, the DNA is subsequently extracted with phenol/chloroform/isoamylalcohol and chloroform/isoamylalcohol. The remaining water phase was mixed with 400 l isopropanol and 27 l 7.5 M ammoniumacetate.

(43) After centrifugation for 10 minutes at 20.000g (20 C.) the remaining pellet was washed with 500 l 70% ethanol in water and re-centrifuged for 2 minutes at 20.000g (20 C.) After drying the resulting DNA is dissolved in 200 l TE buffer.

(44) A second DNA precipitation was performed by adding 20 l 7.5 M Na-Acetate and 150 l isopropanol, the mixture was mixed gently for a few seconds.

(45) The next centrifugation is 10 minutes at 20.000g (20 C.). The pellet was washed with 500 l 70% ethanol in water and re-centrifuged shortly (2 minutes at 20.000g (20 C.). The pellet was dried and dissolved in 22 l sterile ultrapure water. Storage was at 4 C.

(46) Purity and concentration of the DNA was determined using a Nanodrop 2000 Spectrophotometer, a Qubit 2.0 Fluorometer and standard agarose gel electrophoresis techniques.

(47) The sequence of the isolated mitochondrial DNA was determined by Next Generation sequencing using sequencing techniques generally known to the person skilled in the art.

(48) This sequencing resulted in the identification of several regions where the mitochondrial DNA (mtDNA) of the selected CMS Cichorium plant equals either the original fertile Cichorium plant or the Lactuca donor, proving the mitochondrial DNA of the selected CMS Cichorium plant to be a rearrangement of the mtDNA of both the original fertile Cichorium plant and the Lactuca donor.

(49) To this end, 4 sets of PCR primers were developed to identify the unique rearranged mtDNA of the selected fusion plant leading to the CMS phenotype. Also a set of 17 SNPs were developed as a further characterization of the selected fusion product (Table 2). From this data it is concluded that the selected CMS Cichorium plant contains an unique rearranged mitochondrial DNA with fragments of both parent lines being responsible for the CMS character of the described plant. Experimental details are shown in the tables mentioned above.

(50) TABLE-US-00002 TABLE1 DataforPCRreactionsdiscriminatingbetweenbothfusion parentsandtheselectedCMSCichorium Primer Forward Reverse combi- primer primer Fertile CMS Fragment nation sequence sequence Lactuca Cichorium Cichorium size 1 SEQID29 SEQID30 + + 611bp 2 SEQID31 SEQID32 + + 1592bp 3 SEQID33 SEQID34 + + 293bp 4 SEQID35 SEQID36 + + 107bp SEQ ID 29: GCCTCCAGGGTATGATCCTTAA SEQ ID 30: CGAGCACTTATTTGACCTGTGT SEQ ID 31: TGCTAACGAGGTTCAATGATG SEQ ID 32: TTCGATTCAGGATCAAGCCCAG SEQ ID 33: TCGATATTCTTTTCGCGACAGG SEQ ID 34: TTAGGTTATTTCGTTGGTCGCC SEQ ID 35: TTTATAGACAGCGACTCCCTCC SEQ ID 36: ACCTGAAGGGAGTTATGGCATT
PCR conditions for this reaction were as follows: total DNA was isolated from young leaf tissue as described and treated with RNAseA/T1. DNA integrity was confirmed by agarose gel electrophoresis. DNA from all samples was diluted to 15 ng/l for PCR reactions. The amount of template DNA was 15 ng per PCR reaction. PCR for both marker combinations was carried out using Biomix Red (GC Biotech) in 20 l reactions with 10 pmol of each primer mentioned above. PCR parameters were: 1 minute 94 C. 30 cycles of: 15 s. 94 C.; 15 s. 58 C.; 1 minute 72 C.) 5 minutes 72 C. Store at 4 C.

(51) Five l of the PCR reactions were loaded on a 1% agarose gel and separated using standard techniques, known to the person skilled in the art.

(52) TABLE-US-00003 TABLE2 Sequenceofthe17SNPmarkersdevelopedtodiscriminate betweenbothfusionparentsandtheselectedfusionplant. Denotedarethesequencesusedandbetweenbrackets([N/N] ) isthesinglenucleotidedifferingbetweentheplantsas elucidatedinthethreecolumnsrightofthissequence. AnalysiswasperformedbpLGCGenomics,see www.lgcgenomics.com SNP Fertile CMS SEQID Sequence Lactuca Cichorium Cichorium 1 CCGAACCGCGCGAAATGGTCGCCTATTACACGGCTCACTAACTCTGCCTG[G/T] G T G AGTGGTGGTACCTATTATTCGTCGGCGGGGGCGGTCCGGCGATAC 2 CICTTAAGGTTAGTTCTATGCCTCACAACAACTACCTCATAGGTGATTCT[A/C] A C A AATCCGTCTTTAGATCAGAAGTAGATGCCTCTTCCAGGGCTCTGT 3 GTACCAAATGCTTGGCAATCCTTGGTAGAGCTTATTTATGATTTCGTGCT[G/T] T G T AACCTGGTAAACGAACAAATAGGGGGICTTTCCGGAAATGTTAAA 4 TATTGATTACACTCCTTCTCCTACTGCTTCTCCTTATACCCACTAATGTT[A/C] C A C TTCTTCGTCCTACCTTGACTATTGGGAAATTTCCATTCGAGAAAG 5 TGCAGCGTAAACTCCTGCTAAATGAATGCCTTTGCTTTGGCTTTGAAATT[A/C] A C A TGTTCCTGATTCAACTCCTTCATGCCATTGATTGATGCAAGTCTT 6 CTGAATGACCTCTCTCATCTAATCGATCGGTGAAGGATGTCTTTGAAGAT[A/C] A C A ATCTGGTCTGGCTCGTTACCATTAGTTCCTCTCTCTATAGTCGAG 7 CTCTTGTTCTCTTTTCTTAGTTAGGCCCAAGAAAGTACAAGATATAGCTT[G/T] G T G ACTAATATACTAAGATGATAGCTAGAGACTAGAGATGAGAGTGCA 8 TIGGATATTGTACGACAGGATCCCCATCCGTGTTTTCGTTTCGCTAACGA[G/T] G T G AAAGGCCGGAAAGCGTGGGACCTATTTAAGTGACCTGGCCGATGG 9 TTTTTCGTTCCTTCTCTTCGATAAGAATATCGATTTGAAATGATAAAAAT[G/T] G T G CCTCTTTATTCTCTTGTGCTCAGCGAAAGAACTGCCTAAGCATAC 10 GTCCGATCGTCGCTAGAGGCCCGTCGACTATAATACACTGTTCGAAATTT[A/C] A C A TTCGTTTCTGCCGAAACAAAACGGGATTGGCTATCTTAACCTTAG 11 AAGGAAATGATCTTTACATGGAAATGAAAGAATCTGGAGTAATTAATGAA[A/C] A C C AAAATATTCCAGAATCAAAAGTAGCTCTAGTTTACGGTCAGATGA 12 GGGGCGTCCAAAGAGTCGATCATTTCTGCATGATTTTTTTCTCGTGCACT[A/G] A G G CCCCTTCCAATGGGTTTCGAAGATAAAAATCCTTTATTGGCCCAT 13 CATACGCTAAAATTTGTCCCTTTTTAATGCATTTACCCCGCTGAACCTGG[A/G] G A A GTTITTGATGCATACAAGTATTTTTGTTGGAACGTTGATACATAA 14 AGATAAAAATAACAAGGAATAGAATTTGATTAGTTGGTATTCAAAATATA[C/T] T C C GATTCAAGTAGTCAAGTCGAGAAAGAGATGGTTGAATCAAAATAA 15 TAAGCAATATATTGATTTTCTTCTCCAGGAACAGGCTCGATTCCATAGCA[G/T] T G G CGCCCTTTGTAACGATCAAGGCTCGTAAGTCCATCGGICCACACA 16 ACTTTTTATTGGCATTGGAAGCACATTACATTATGGCAGGGTAATGTTTC[A/G] G A A CAGTTTAATGAATCTTCCACTTATTTGATGGGCTGGTTAAGAGAT 17 GGTATGAATAGTTTATCAGTCTGGGCATGGATGTTTTTATTTGGACATCT[G/T] G T T GTTTGGGCTACTGGATTTATGTTTTTAATTTCCTGGCGTGGATAT

Example 11

Characterization of Pollen Grains

(53) To illustrate the difference between the original fertile chicory plant and the selected fusion plant, a study was made of the available pollen grains. Studying the selected fusion plant P153, putative pollen grains were visible, however, both an attempted self-fertilization and a stain with FDA (Example 3) showed this putative pollen was not functional.

(54) Further testing of the pollen of Cichorium and the selected fusion plant learned that from the latter pollen grains were significantly smaller. Pollen grains, suspended in WS9M, were imaged using regular bright field techniques on an inverted microscope with a 10 objective lens and recorded with a 3 MB CCD camera. Digital images of pollen grains were processed and analyzed using ImageJ software (Rasband, W. S., ImageJ, U. S. National Institutes of Health, Bethesda, Md., USA, http://imagej.nih.gov/ij/, 1997-2012).

(55) Images were converted into 8-bit binary images. Holes were closed, dark outliers were removed (radius=10 pixels), and pollen grain projections touching each other were separated using the watershed command. The resulting images were analyzed with the analyze particles command to obtain the surface areas of the pollen grain projections. Objects touching the edge of the image were excluded. Using Microsoft Excel statistical functions, the measurements were converted into m.sup.2 and averaged.

(56) For the selected fusion plants pollen surface varied between 1150 and 1850 m.sup.2 (SD=180), for the original Cichorium plant pollen grains, the determined surface was between 1550 and 2550 m.sup.2 (SD=226). Furthermore, student T-test analysis indicated that the chance that both populations of pollen grains are equal is below 0.01 (FIG. 3).

(57) TABLE-US-00004 Solutions and chemicals. Unless stated otherwise all solutions were autoclaved (20 minutes at 120 C.) 1/2 MS15 MS30 MS30-gelrite 1/2 MS medium Duchefa; M0233 2.28 g/l MS medium Duchefa; M0222 4.40 g/l 4.40 g/l Sucrose 15 g/l 30 g/l 30 g/l Agar Duchefa; M1002 7 g/l 7 g/l Gelrite Duchefa; G1101 7.5 g/l pH 5.8 5.8 5.8

(58) TABLE-US-00005 WS9M medium KH.sub.2PO.sub.4 0.20 mM CaCl.sub.22H.sub.2O 10 mM KNO.sub.3 1 mM MgSO.sub.47H.sub.2O 1 mM MES (monohydrate) 2.8 mM Mannitol 0.5M pH 5.6; 580 mOsm/kg

(59) TABLE-US-00006 enzyme solution: WS9M medium supplemented with: Yakult Cellulase Onozuka R10 0.2% (w/v) Pectinase (Sigma, P4300) 0.2% (w/v) pH 5.6-5.7, filter sterile

(60) TABLE-US-00007 wash solution: CaCl.sub.22H.sub.2O 13.6 mM KCl 0.34M MES (monohydrate) 2.8 mM pH 5.8; 640 mOsm/kg

(61) TABLE-US-00008 60 mM IOA stock solution: 0.222 g IOA per 20 ml wash solution

(62) TABLE-US-00009 PEG1500 solution: PEG1500 40% (w/v) Glucose anhydrous (w/v) 0.3M CaCl.sub.22H.sub.2O 50 mM filter sterile

(63) TABLE-US-00010 PEG diluting solution Glycine 50 mM glucose anhydrous 0.3M CaCl.sub.22H.sub.2O 50 mM pH 10.5; 520 mOsm/kg; filter sterile

(64) TABLE-US-00011 CPW-Ca.sup.++ solution 200 ml 10 CPW salts stock (ref. 3) 20 ml CaCl.sub.22H.sub.2O 50 mM Mannitol 0.365M pH 5.7; 530 mOsm/kg; filter sterile

(65) TABLE-US-00012 Culture media PM1 PM2 KNO.sub.3 7.42 mM MgSO.sub.47H.sub.2O 0.69 mM 0.69 mM CaCl.sub.22H.sub.2O 1.5 mM 1.5 mM KH.sub.2PO.sub.4 0.62 mM 0.62 mM KCl 5 mM Gamborg.sup.4 B5 micro 100x stock 5 ml/l 5 ml/l KI 0.73 M 0.73 M FeNaEDTA 0.11 mM 0.11 mM Gamborg B5 vitamins 11.2 mgram/l 11.2 mgram/l (Duchefa; G0415) Glutamine 2.57 mM 5.14 mM Sucrose 14.6 mM 14.6 mM Mannitol 0.41M 0.30M NAA 10.2 M 2.5 M BA 4.44 M Caseinehydrolysate 150 mgram/l (Duchefa; C1301) pH 5.5-5.6 5.5-5.6 osmolarity 530 mOsm/kg 400 mOsm/kg filtersterile filtersterile

(66) TABLE-US-00013 CRM medium MS medium (Duchefa; M0222) 4.40 gram Sucrose 30 mM Zeatin 4.56 M BA 2.22 M caseinhydrolysate (Duchefa; C1301) 300 mgram/l agar (Duchefa; M1002) 8 gram/l pH 5.7
Sodium Citrate 50 mM:
Solution A, Sodium Alginate Solution, Medium B: Ref. 5
Gamborg B5 Media:

(67) TABLE-US-00014 PCR mix: Tris-HCl (pH 8.8) 75 mM NH.sub.4SO.sub.4 20 mM Tween20 0.01% (v/v) MgCl.sub.2 2.8 mM dNTPs 0.25 mM forward primer 0.15 M reverse primer 0.2 M Red Hot DNA Polymerase 0.04 units/l (ABgene, Epsom U.K.) genomic plant DNA ~0.2 ng/l

(68) TABLE-US-00015 GB (Grinding buffer) sorbitol 0.35M mannitol 0.1M Tris-HCl pH 7.6 50 mM Na.sub.2-EDTA 5 mM BSA 0.2% (w/v) PVP 1.0% (w/v) spermidine 0.025% (w/v) mercaptoethanol 0.125% (v/v) DIECA 10 mM

(69) TABLE-US-00016 DNase storage buffer: Sodiumacetate 5M CaCl.sub.22H.sub.2O 1M pH 4.5 using acetic acid; prior to use, an equal volume glycerol is added

(70) TABLE-US-00017 DNase Buffer (DB) (4 C.) DIECA (add just prior to use) 10 mM

(71) TABLE-US-00018 Shelf Buffer (SB) Sucrose 0.6M Tris HCl pH 7.2 10 mM Na.sub.2-EDTA 20 mM DIECA (add just prior to use) 10 mM

(72) TABLE-US-00019 TE buffer Tris-HCl pH 7.5 50 mM Na.sub.2-EDTA 10 mM 5 mg/ml DNase in DNase storage buffer 2M MgCl.sub.2 Proteinase K RnaseA solution: Thermo Scientific productnr. EN0551 5M KAc Phenol/chloroform/isoamylalcohol (25:24:1) chloroform/isoamylalcohol (24:1) 7.5M NH.sub.4-Acetate 7.5M Na-Acetate pH 4.5-5.2

ABBREVIATIONS

(73) BA 6 benzylaminopurine bp basepairs BSA bovine serum albumin CMS cytoplasmic male sterile cytoplasmic male sterility DIECA Na-diethyldithiocarbamate EDTA ethylene diaminetetra acetic acid FDA fluorescein diacetate IOA iodoacetamide IA iodoacetate MES 2-(N-morpholino)ethanesulfonic acid mtDNA mitochondrial DNA NAA 1-naphthaleneacetic acid ng nanogram PCR polymerase chain reaction PEG polyethylene glycol PVP polyvinylpyrrolidone RAMP Random Amplified Microsatellite Polymorphism SD standard deviation SNP single nucleotide polymorphism K G or T) M A or C) nucleotide ambiguity codes R G or A) according to the rules of IUPAC Y T or C)