Methods and compositions for identifying, diagnosing, and treating neuroblastoma
10017822 ยท 2018-07-10
Assignee
Inventors
- John M. Maris (Penn Valley, PA, US)
- Yael P. Mosse (Penn Valley, PA, US)
- Erica L. Carpenter (Wyndmoor, PA)
Cpc classification
A61K31/4545
HUMAN NECESSITIES
G01N2800/52
PHYSICS
G01N2333/912
PHYSICS
C12Q2600/106
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
International classification
A61K31/00
HUMAN NECESSITIES
A61K39/395
HUMAN NECESSITIES
A61K31/4545
HUMAN NECESSITIES
Abstract
Methods and compositions for identifying, diagnosing, and treating neuroblastoma are disclosed.
Claims
1. A method for treating neuroblastoma in a subject comprising administering at least one composition comprising crizotinib to the subject, wherein said neuroblastoma has an alteration in anaplastic lymphoma kinase (ALK), wherein said alteration is the presence of the R1275Q mutation in ALK.
2. The method of claim 1, further comprising administering at least one chemotherapeutic agent.
3. The method of claim 1, further comprising administering of at least one ALK antibody.
4. The method of claim 1, further comprising determining the ALK alteration present in said subject prior to administration of said composition.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
DETAILED DESCRIPTION OF THE INVENTION
(17) As stated hereinabove, neuroblastoma is a childhood cancer that can be inherited, but the genetic etiology was largely unknown. Here it is shown that germline mutations in the anaplastic lymphoma kinase gene (ALK) explain the majority of hereditary neuroblastomas and that activating mutations can also be somatically acquired. A significant linkage signal at chromosome 2p24-23 was first identified using a whole-genome scan in neuroblastoma pedigrees. Resequencing of regional candidate genes identified three separate germline missense mutations in the tyrosine kinase domain of ALK that segregated with the disease in eight separate families. Resequencing in 194 high-risk neuroblastoma samples showed somatically (only in tumor cells) acquired mutations within the tyrosine kinase domain in 12.4%. Nine of the ten mutations map to critical regions of the kinase domain and were predicted to be oncogenic drivers with high probability. Mutations resulted in constitutive phosphorylation, and targeted knockdown of ALK mRNA resulted in profound growth inhibition of all cell lines harboring mutant or amplified ALK, as well as 2 of 6 wild type for ALK. These results demonstrate that heritable mutations of ALK are the major cause of familial neuroblastoma, and that germline or acquired activation of this cell surface kinase is a tractable therapeutic target for this lethal pediatric malignancy
(18) It has been predicted that neuroblastoma, like the analogous embryonal cancer retinoblastoma, would follow a two-hit model explaining hereditary and sporadic cases (Knudson et al. (1972) Amer. J. Hum. Genet., 24:514-522). This model has proven to be correct for the majority of childhood and adult hereditary cancers and the susceptibility genes are typically tumor suppressors where the two hits are sequential inactivation of both alleles. Discovery of heritable mutations in oncogenes as the etiology of multiple endocrine neoplasia 1 cancers (RET), papillary renal carcinoma (MET) and gastrointestinal stromal tumors (KIT) challenged this paradigm, but it is now clear that somatically acquired duplication or amplification of the mutant allele provides the second hit (Vogelstein et al. (2004) Nat. Med., 10:789-99). It is shown herein that heritable mutations in ALK are the cause of the majority of hereditary neuroblastoma cases, providing the first example of a pediatric cancer arising due to mutations in an oncogene. Taken together with the recent report that common variations at chromosome band 6p22 predispose to the development of sporadic neuroblastoma (Maris et al. (2008) N. Engl. J. Med., 358:2585-93), the genetic etiology of this disease is now being defined. The discovery of highly penetrant heritable ALK mutations as the cause of hereditary neuroblastoma are of immediate relevance to patients with a family history as screening with noninvasive techniques such as ultrasonography and measurement of urinary catecholamine metabolites should likely be implemented for unaffected children carrying an ALK mutation.
(19) ALK is an orphan tyrosine kinase transmembrane receptor with homology to neurotrophin receptors and the MET oncogene. Expression is restricted to the developing nervous system with a postulated role in participating in the regulation of neuronal differentiation (Iwahara et al. (1997) Oncogene, 14:439-49). It is now clear that many human cancers activate ALK signaling by creating unique oncogenic fusions of ALK with a variety of partners through chromosomal translocation events (Chiarle et al. (2008) Nat. Rev. Cancer, 8:11-23). Previous work had shown that a substantial percentage of human-derived neuroblastoma cell lines express ALK transcripts and ALK protein (Lamant et al. (2000) Am. J. Pathol., 156:1711-21), but no definitive role for this oncogene had been proven (Osajima-Hakomori et al. (2005) Am. J. Pathol., 167:213-22; Motegi et al. (2004) J. Cell Sci., 117:3319-29; Miyake et al. (2002) Oncogene, 21:5823-34; Dirks et al. (2002) Int. J. Cancer, 100:49-56). ALK has recently been identified as a molecular target in neuroblastoma through a screen of human cancer cell lines with pharmacologic antagonists of the ALK kinase domain (McDermott et al. (2008) Cancer Res., 68:3389-95). The data herein provides the first evidence for oncogenic activation of ALK via mutation of the kinase domain, and these data provide the genetic basis for the observation of sensitization to ALK kinase inhibition. In addition, the discoveries in neuroblastoma may lead to future resequencing efforts in other malignancies, especially those where oncogenic fusion proteins have recently been discovered. The data presented here clearly establish ALK as critical neuroblastoma oncogene and should increase efforts to identify the ligand for this receptor and understand if ALK-mediated signaling can be activated by mechanisms other than direct mutation and/or amplification of ALK alleles. Finally, receptor tyrosine kinases provide tractable targets for pharmacologic inhibition, and allows for therapeutic strategies aimed at inhibiting ALK-mediated signaling.
(20) In accordance with the instant invention, methods of identifying, determining an increased risk for, diagnosing, and/or prognosing a cancer in a patient are provided, wherein the method comprises determining the level/activity of ALK. In a particular embodiment, the cancer is neuroblastoma. In another embodiment, the cancer has been characterized as having an ALK translocation (e.g., an ALK translocation wherein the resultant ALK fusion protein is constitutively active). Such cancers include, without limitation, lymphomas, non-Hodgkin's lymphoma, anaplasic large cell lymphoma, inflammatory myofibroblastic tumors, and non-small-cell lung cancer. The methods may further comprise obtaining a biological sample from the subject. In a particular embodiment, the biological sample is tumor tissue or blood.
(21) In one embodiment, the method comprises determining the presence of at least one mutation in ALK, particularly one which leads to increased activity of ALK (e.g., increased kinase activity). According to one embodiment, the mutation is within the kinase domain. In another embodiment, at least one amino acid at position P36, P157, V198, G640, L684, G718, D993, L1204, I1170, A1200, L1204, F1245, G1128, R1192, R1275, D1091, M1166, I1171, F1174, F1245, I1250, and those set forth in Tables 2A and 2B (e.g., T1151; L1196, R259, M770, E1407, E1433, R1464, G1494, A1553) is altered (mutated). In another embodiment, at least one amino acid at position G1128, R1192, R1275, D1091, M1166, I1171, F1174, F1245, and I1250 is altered (mutated). In still another embodiment, at least one amino acid at position G1128, R1192, L1204, I1250, R1275, and those set forth in Tables 2A and 2B (e.g., P36, V198, R259, G640, D993, E1407, and A1553); particularly, at least one amino acid at position G1128, R1192, and R1275 is altered (mutated; particularly those set forth below) when the germline is examined (e.g., when the biological sample is not tumor tissue). In one embodiment, at least one amino acid at position P36, P157, V198, G640, L684, G718, D993, L1204, I1170, A1200, L1204, G1128, R1192, R1275, D1091, M1166, I1171, F1174, F1245, I1250 and those set forth in Tables 2A and 2B (e.g., T1151, I1170, L1196, R259, M770, E1407, E1433, R1464, G1494, A1553); particularly, at least one amino acid at position P36, P157, V198, G640, L684, G718, G718, D993, L1204, I1170, A1200, L1204, F1245, R1275, D1091, M1166, I1171, F1174, F1245, and I1250; particularly, at least one amino acid at position R1275, D1091, M1166, I1171, F1174, F1245, and I1250 is altered (mutated; particularly those set forth below) when somatic mutations are examined (e.g., when the biological sample is tumor tissue/cells). In another embodiment, the mutation may be a nonconservative amino acid substitution. In still another embodiment, the ALK comprises at least one mutation selected from the group consisting of P36S, P157S, V198M, G640R, L684M, G718F, G718S, D993G, L1204F, I1170S, A1200V, L1204F, F1245I, G1128A, R1192P, R1275Q, D1091N, M1166R, I1171N, F1174I, F1174L, F1245C, F1245V, I1250T, and those set forth in Tables 2A and 2B (e.g., T1151M, I1170S, F1174C, L1196M, F1245I, R259H, M770I, E1407K, E1433del, R1464G, G1494R, and A1553P). In another embodiment, at least one mutation selected from the group consisting of G1128A, R1192P, R1275Q, D1091N, M1166R, I1171N, F1174I, F1174L, F1245C, F1245V, and I1250T. In yet another embodiment, at least one of the mutations is to amino acid R1275 and/or F1174, particularly at least one of R1275Q, F1174I, and F1174L. The presence of at least one of the above mutations is indicative of neuroblastoma or at least an increased risk of developing neuroblastoma in the patient. The presence of at least one of the above mutations is also indicative of a poor prognosis with increased risk of metastasis and higher risk of death. While the above mutations can be detected by sequencing the ALK protein in a biological sample obtained from a subject, it is preferred that the nucleic acid molecule encoding ALK is examined in the instant methods (after obtaining (e.g., isolating) from a biological sample from a subject). The ability to detect the above mutations in a nucleic acid molecule/protein are well known in the art and include, without limitation, sequencing, PCR (e.g., real time PCR; e.g., with mutation specific primers; optionally with subsequent sequencing or hybridization), hybridization techniques (e.g., with mutation specific probes (probes which specifically bind a mutated ALK to the exclusion of wild-type ALK); e.g., microarrays, Southern, Northern), and antibodies (e.g., those specific for at least one mutant).
(22) In yet another embodiment, the methods of the instant invention comprise determining the ALK copy number in the cells of the biological sample obtained from a subject. A gain or amplification in the ALK copy number compared to normal human cells is indicative of neuroblastoma or at least an increased risk of developing neuroblastoma in the patient. The increased ALK copy number is also indicative of a poor prognosis with increased risk of metastasis and higher risk of death.
(23) In still another embodiment, the methods of the instant invention comprise determining if the ALK is phosphorylated. In one embodiment, the ALK is phosphorylated to greater levels than ALK from a normal human (i.e., one that does not have cancer, particularly neuroblastoma). The ALK may be phosphorylated at positions that are not phosphorylated in normal humans and/or phosphorylated to greater levels (greater frequency) than ALK in normal humans. For example, as described hereinbelow, the constitutive phosphorylation (increased levels of phosphorylation compared to normal humans) of tyrosine at position 1604 of ALK is indicative of neuroblastoma or at least an increased risk of developing neuroblastoma in the patient. The increased ALK phosphorylation is also indicative of a poor prognosis with increased risk of metastasis and higher risk of death.
(24) According to another aspect of the instant invention, the above methods for identifying, diagnosing, or prognosing cancer (particularly neuroblastoma) in a patient, further comprises identifying mutations in the phox2B gene/protein (e.g., 676delG) or amplification of the phoX2B gene/protein (see, e.g., Mosse et al. (2004) Am. J. Hum. Genet., 75:727-730; Rabbe et al. (2008) Oncogene 27:469-476).
(25) In accordance with another aspect of the instant invention, methods for treating cancer, particularly a neuroblastoma, in a patient are provided, where the method comprises the administration of a composition comprising at least one ALK inhibitor (e.g., an inhibitor of ALK kinase activity) and at least one pharmaceutically acceptable carrier. The method may further comprise determining the particular ALK alteration of the patient prior to administration (see above) and administering the ALK inhibitor most effective for the ALK alteration identified (see below). Examples of ALK inhibitors include, without limitation, ALK siRNA and/or antisense molecules, small molecule inhibitors, PF-02341066 (Pfizer), TAE684 (Novartis), and CEP-14083 (Cephalon). The methods may also comprise the administration of an antibody (or fragment thereof) specific for ALK (e.g., monoclonal antibodies). In a particular embodiment, the antibodies are specific for the extracellular domain of ALK (e.g., the extracellular domain that remains after proteolytic cleavage from the 220 kDa to 140 kDa species). The antibodies may be administered separately (before, after, or at the same time as the ALK inhibitor) or in the same composition. The methods may also comprise the administration of at least one other chemotherapeutic agent and/or be administered in coordination with another chemotherapeutic agent or therapy (e.g., chemotherapy). The chemotherapeutic agent may be administered separately (before, after, or at the same time as the ALK inhibitor) or in the same composition. The compositions may be administered by any method such as, for example, intravenous injection into the blood stream, oral administration, or by subcutaneous, intramuscular or intraperitoneal injection. As stated hereinabove, the methods may also further comprise first screening the subject to determine the ALK mutation (including amplification of copy number) present in the subject as described hereinabove and selecting the appropriate ALK inhibitor for the identified mutation to administer to the patient (see below).
(26) In accordance with another aspect of the instant invention, methods of identifying an agent which is therapeutic for the treatment of neuroblastoma are provided. In a particular embodiment, the method comprises contacting cells comprising mutations in ALK or an amplification of ALK with at least one agent and determining the ALK activity, wherein a reduction in ALK activity indicates the agent is a therapeutic agent for treating neuroblastoma. In another embodiment, the method comprises contacting cells comprising mutations in ALK or an amplification of ALK with at least one agent and determining the ability of the agent to inhibit proliferation of the cells (e.g., determining IC.sub.50), wherein a reduction in proliferation indicates the agent is a therapeutic agent for treating a neuroblastoma characterized by the ALK mutation of the cells.
(27) In accordance with another aspect of the present invention, microarrays for detecting ALK and/or the ALK mutants described hereinabove are provided. In a particular embodiment, the microarray comprises antibodies specific for ALK and/or the ALK mutants described hereinabove. In a preferred embodiment, the microarray comprises oligonucleotide probes which recognize ALK and/or the ALK mutants described hereinabove. The microarrays may comprise oligonucleotide probes which specifically hybridize with at least 2, at least 5, at least 10, or all of the above ALK mutants. In a particular embodiment, the microarray comprises oligonucleotide probes wherein each probe (or coordinate on the microarray) specifically hybridizes with a single ALK mutant (e.g., a single nucleotide change, a single amino acid change encompassing all codons of the amino acid change, or all changes to a single amino acid position). In a particular embodiment, the oligonucleotide probe is completely complementary to ALK (e.g., SEQ ID NO: 6) except for the mutation. In yet another embodiment, the oligonucleotide is about 10, 15, 20, 25, or 30 to about 40, 50, 75, or 100 nucleotides in length. In a particular embodiment, the oligonucleotide probes span an ALK mutant above, particularly so that the mutation is in the middle of the probe (e.g., within the middle third of the probe). In another embodiment, the microarray further comprises probes specific for wild-type ALK and/or PHOX2B (wild-type and/or mutant). In another embodiment, the microarray is contained within kit further comprising instruction material and, optionally, at least one positive control (a nucleic acid molecule recognized by an oligonucleotide probe of the microarray) and/or at least one negative control (a nucleic acid molecule not recognized by an oligonucleotide probe of the microarray).
Definitions
(28) As used herein, a biological sample refers to a sample of biological material obtained from a subject, preferably a human subject, including a tissue, a tissue sample, a cell sample, a tumor sample, and a biological fluid, e.g., blood or urine. A biological sample may be obtained in the form of, e.g., a tissue biopsy, such as, an aspiration biopsy, a brush biopsy, a surface biopsy, a needle biopsy, a punch biopsy, an excision biopsy, an open biopsy, an incision biopsy and an endoscopic biopsy.
(29) As used herein, diagnose refers to detecting and identifying a disease in a subject. The term may also encompass assessing or evaluating the disease status (progression, regression, stabilization, response to treatment, etc.) in a patient known to have the disease.
(30) As used herein, the term prognosis refers to providing information regarding the impact of the presence of cancer (e.g., as determined by the diagnostic methods of the present invention) on a subject's future health (e.g., expected morbidity or mortality, the likelihood of getting cancer, and the risk of metastasis). In other words, the term prognosis refers to providing a prediction of the probable course and outcome of a cancer or the likelihood of recovery from the cancer.
(31) The term treat as used herein refers to any type of treatment that imparts a benefit to a patient afflicted with a disease, including improvement in the condition of the patient (e.g., in one or more symptoms), delay in the progression of the condition, etc.
(32) The phrase effective amount refers to that amount of therapeutic agent that results in an improvement in the patient's condition.
(33) Pharmaceutically acceptable indicates approval by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.
(34) A carrier refers to, for example, a diluent, adjuvant, preservative (e.g., Thimersol, benzyl alcohol), anti-oxidant (e.g., ascorbic acid, sodium metabisulfite), solubilizer (e.g., Tween 80, Polysorbate 80), emulsifier, buffer (e.g., Tris HCl, acetate, phosphate), water, aqueous solutions, oils, bulking substance (e.g., lactose, mannitol), excipient, auxilliary agent or vehicle with which an active agent of the present invention is administered. Suitable pharmaceutical carriers are described in Remington's Pharmaceutical Sciences by E. W. Martin (Mack Publishing Co., Easton, Pa.); Gennaro, A. R., Remington: The Science and Practice of Pharmacy, 20th Edition, (Lippincott, Williams and Wilkins), 2000; Liberman, et al., Eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, N.Y., 1980; and Kibbe, et al., Eds., Handbook of Pharmaceutical Excipients (3rd Ed.), American Pharmaceutical Association, Washington, 1999.
(35) As used herein, a conservative amino acid substitution/mutation refers to substituting a particular amino acid with an amino acid having a side chain of similar nature (i.e., replacing one amino acid with another amino acid belonging to the same group). A non-conservative amino acid substitution/mutation refers to replacing a particular amino acid with another amino acid having a side chain of different nature (i.e., replacing one amino acid with another amino acid belonging to a different group). Groups of amino acids having a side chain of similar nature are known in the art and include, without limitation, basic amino acids (e.g., lysine, arginine, histidine); acidic amino acids (e.g., aspartic acid, glutamic acid); neutral amino acids (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan); amino acids having a polar side chain (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine); amino acids having a non-polar side chain (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan); amino acids having an aromatic side chain (e.g., phenylalanine, tryptophan, histidine); amino acids having a side chain containing a hydroxyl group (e.g., serine, threonine, tyrosine), and the like.
(36) As used herein, the term amplification when used in reference to copy number refers to the condition in which the copy number of a nucleic acid sequence is greater than the copy number of a control sequence. In other words, amplification indicates that the ratio of a particular nucleic acid sequence is greater than 1:1 when compared to a control sequence (e.g., 1.1:1, 1.2:1, or 1.3:1).
(37) The term probe as used herein refers to an oligonucleotide, polynucleotide or nucleic acid, either RNA or DNA, whether occurring naturally as in a purified restriction enzyme digest or produced synthetically, which is capable of annealing with or specifically hybridizing to a nucleic acid with sequences complementary to the probe. A probe may be either single-stranded or double-stranded. The exact length of the probe will depend upon many factors, including temperature, source of probe and use of the method. For example, for diagnostic applications, depending on the complexity of the target sequence, the oligonucleotide probe typically contains about 10-100, about 10-50, about 15-30, about 15-25, about 20-50, or more nucleotides, although it may contain fewer nucleotides. The probes herein may be selected to be complementary to different strands of a particular target nucleic acid sequence. This means that the probes must be sufficiently complementary so as to be able to specifically hybridize or anneal with their respective target strands under a set of pre-determined conditions. Therefore, the probe sequence need not reflect the exact complementary sequence of the target, although they may. For example, a non-complementary nucleotide fragment may be attached to the 5 or 3 end of the probe, with the remainder of the probe sequence being complementary to the target strand. Alternatively, non-complementary bases or longer sequences can be interspersed into the probe, provided that the probe sequence has sufficient complementarity with the sequence of the target nucleic acid to anneal therewith specifically.
(38) The term primer as used herein refers to an oligonucleotide, either RNA or DNA, either single-stranded or double-stranded, either derived from a biological system, generated by restriction enzyme digestion, or produced synthetically which, when placed in the proper environment, is able to functionally act as an initiator of template-dependent nucleic acid synthesis. When presented with an appropriate nucleic acid template, suitable nucleoside triphosphate precursors of nucleic acids, a polymerase enzyme, suitable cofactors and conditions such as appropriate temperature and pH, the primer may be extended at its 3 terminus by the addition of nucleotides by the action of a polymerase or similar activity to yield a primer extension product. The primer may vary in length depending on the particular conditions and requirement of the application. For example, in diagnostic applications, the oligonucleotide primer is typically about 10-25 or more nucleotides in length. The primer must be of sufficient complementarity to the desired template to prime the synthesis of the desired extension product, that is, to be able to anneal with the desired template strand in a manner sufficient to provide the 3 hydroxyl moiety of the primer in appropriate juxtaposition for use in the initiation of synthesis by a polymerase or similar enzyme. It is not required that the primer sequence represent an exact complement of the desired template. For example, a non-complementary nucleotide sequence may be attached to the 5 end of an otherwise complementary primer. Alternatively, non-complementary bases may be interspersed within the oligonucleotide primer sequence, provided that the primer sequence has sufficient complementarity with the sequence of the desired template strand to functionally provide a template-primer complex for the synthesis of the extension product.
(39) Polymerase chain reaction (PCR) has been described in U.S. Pat. Nos. 4,683,195, 4,800,195, and 4,965,188, the entire disclosures of which are incorporated by reference herein.
(40) With respect to single stranded nucleic acids, particularly oligonucleotides, the term specifically hybridizing refers to the association between two single-stranded nucleotide molecules of sufficiently complementary sequence to permit such hybridization under pre-determined conditions generally used in the art (sometimes termed substantially complementary). In particular, the term refers to hybridization of an oligonucleotide with a substantially complementary sequence contained within a single-stranded DNA molecule of the invention, to the substantial exclusion of hybridization of the oligonucleotide with single-stranded nucleic acids of non-complementary sequence. Appropriate conditions enabling specific hybridization of single stranded nucleic acid molecules of varying complementarity are well known in the art.
(41) For instance, one common formula for calculating the stringency conditions required to achieve hybridization between nucleic acid molecules of a specified sequence homology is set forth below (Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press):
Tm=81.5 C.+16.6 Log [Na+]+0.41(% G+C)0.63(% formamide)600/#bp in duplex
(42) As an illustration of the above formula, using [Na+]=[0.368] and 50% formamide, with GC content of 42% and an average probe size of 200 bases, the Tm is 57 C. The Tm of a DNA duplex decreases by 1-1.5 C. with every 1% decrease in homology. Thus, targets with greater than about 75% sequence identity would be observed using a hybridization temperature of 42 C.
(43) The stringency of the hybridization and wash depend primarily on the salt concentration and temperature of the solutions. In general, to maximize the rate of annealing of the probe with its target, the hybridization is usually carried out at salt and temperature conditions that are 20-25 C. below the calculated Tm of the hybrid. Wash conditions should be as stringent as possible for the degree of identity of the probe for the target. In general, wash conditions are selected to be approximately 12 20 C. below the Tm of the hybrid. In regards to the nucleic acids of the current invention, a moderate stringency hybridization is defined as hybridization in 6SSC, 5Denhardt's solution, 0.5% SDS and 100 g/ml denatured salmon sperm DNA at 42 C., and washed in 2SSC and 0.5% SDS at 55 C. for 15 minutes. A high stringency hybridization is defined as hybridization in 6SSC, 5Denhardt's solution, 0.5% SDS and 100 g/ml denatured salmon sperm DNA at 42 C., and washed in 1SSC and 0.5% SDS at 65 C. for 15 minutes. A very high stringency hybridization is defined as hybridization in 6SSC, 5Denhardt's solution, 0.5% SDS and 100 g/ml denatured salmon sperm DNA at 42 C., and washed in 0.1SSC and 0.5% SDS at 65 C. for 15 minutes.
(44) An antibody or antibody molecule is any immunoglobulin, including antibodies and fragments thereof, that binds to a specific antigen. The term includes polyclonal, monoclonal, chimeric, single domain (Dab) and bispecific antibodies. As used herein, antibody or antibody molecule contemplates recombinantly generated intact immunoglobulin molecules and immunologically active portions of an immunoglobulin molecule such as, without limitation: Fab, Fab, F(ab)2, F(v), scFv, scFv2, scFv-Fc, minibody, diabody, tetrabody, and single variable domain (e.g., variable heavy domain, variable light domain).
(45) The term isolated may refer to a compound or, complex that has been sufficiently separated from other compounds with which it would naturally be associated. Isolated is not meant to exclude artificial or synthetic mixtures with other compounds or materials, or the presence of impurities that do not interfere with fundamental activity or ensuing assays, and that may be present, for example, due to incomplete purification, or the addition of stabilizers.
(46) As used herein, an instructional material includes a publication, a recording, a diagram, or any other medium of expression which can be used to communicate the usefulness of the composition of the invention for performing a method of the invention.
(47) The phrase solid support refers to any solid surface including, without limitation, any chip (for example, silica-based, glass, or gold chip), glass slide, membrane, plate, bead, solid particle (for example, agarose, sepharose, polystyrene or magnetic bead), column (or column material), test tube, or microtiter dish.
(48) As used herein, the term microarray refers to an ordered arrangement of hybridizable array elements. The array elements are arranged so that there are at least one or more different array elements on a solid support. Preferably, the array elements comprise oligonucleotide probes.
(49) The following examples are provided to illustrate certain embodiments of the invention. They are not intended to limit the invention in any way.
Example 1
Methods
(50) Summary
(51) Twenty probands with neuroblastoma and a family history of the disease were identified for study. Eight pedigrees had 3 or more affected individuals; six pedigrees contained only two affected individuals, but of first degree relation; and six pedigrees consisted of only two affected individuals, but of second, third, or >fourth degree relationship. A total of 176 individuals (49 affected with neuroblastoma) were genotyped genome-wide, and two families were excluded due to insufficient DNA for genotyping. Marker data was simulated under a model of genetic homogeneity and autosomal dominant inheritance, and the data was analyzed using an affected-only approach comparable to the model-free approach used in the actual linkage analysis. Genotype data were checked for Mendelian inconsistencies using PEDSTATS (Wigginton et al. (2005) Bioinformatics, 21:3445-7), and analyzed for linkage using MERLIN (Abecasis et al. (2002) Nat. Genet., 30:97-101) and LAMP (Li et al. (2005) Am. J. Hum. Genet., 76:934-49). Regional candidates were re-sequenced using Sanger methodology. Predictions on the probability that DNA sequence alterations encode a mutant protein were performed using a support vector machine-based statistical classifier (Torkamani et al., (2007) Bioinformatics, 23:2918-25; Torkamani et al. (2008) Cancer Res., 68:1675-82). Four-hundred-and-ninety-one primary tumor samples, and 27 cell lines were used for whole genome SNP-array analyses (550K) to determine copy number alterations (Maris et al. (2008) N. Engl. J. Med., 358:2585-93). mRNA knockdown of ALK and control targets was achieved with siRNAs against each target. siRNA knockdown effects on substrate adherent growth was quantified with the RT-CEST microelectronic cell sensor system (ACEA, San Diego, Calif.) (Yu et al. (2006) Anal. Chem., 78:35-43; Cole et al. (2008) Mol. Cancer. Res., 6:735-42). Whole cell lysates were collected from the cell lines and from siALK and siNTC (non targeting control) treated cells after transfection. Proteins were separated by SDS PAGE gels and immunoblotted using ALK and Phospho-ALK antibodies.
(52) Research Subjects and Samples
(53) Families with a history of neuroblastoma in at least one other relative were eligible to participate. Only germline DNA from the neuroblastoma pedigrees was studied, as no tumor tissue was available. Sporadic neuroblastoma tumor samples with matched constitutional DNA were acquired from the Children's Oncology Group Neuroblastoma Tumor Bank. The Children's Hospital of Philadelphia Institutional Review Board approved this research.
(54) Linkage Analysis
(55) A genome-wide linkage scan was done using the Illumina Linkage IVb SNP panel. Genotype data were checked for Mendelian inconsistencies using PEDSTATS (Wigginton et al. (2005) Bioinformatics, 21:3445-7), and analyzed for linkage using MERLIN (Abecasis et al. (2002) Nat. Genet., 30:97-101) and LAMP (Li et al. (2005) Am. J. Hum. Genet., 76:934-49). The genome-wide screen for linkage was performed with both maximum likelihood allele frequency estimates and model-free analyses. Since the pattern of inheritance is complex, a model-free approach was used so as not to assume any specific mode of inheritance. Model-based analyses were performed for all SNPs included in the critical region under a dominant mode of inheritance, assuming four different gene frequencies (0.0001, 0.001, 0.01, and 0.1) and dominant transmission with varying penetrance of the disease across a broad range, from 0.0001 to 0.68. Model-based linkage analysis was also performed using the method implemented in LAMP, assuming a prevalence of the disease of 0.000143 (1/7000), and maximizing the lod-scores over all possible disease models (MOD score analysis). In every analysis, the critical interval was defined as the region with associated lod-scores greater than the maximum lod-score minus 3. Since linkage disequilibrium (LD) among markers is known to inflate the lod-scores from linkage analysis in the presence of missing founders, its impact on the lod-scores was assessed at the chromosome 2p critical interval. To model LD, markers were organized into clusters by means of Merlin, which uses population haplotype frequencies derived from the HapMap project (www.hapmap.org/).
(56) DNA Sequencing
(57) Shotgun resequencing from templates generated by long PCR for an 18 kilobase region surrounding the MYCN locus was performed using a 454 Life Sciences instrument (Branford, Conn.) after bi-directional sequencing of the three coding exons showed no disease causal sequence variations in the pedigrees. Bi-directional sequencing of ALK coding sequence was performed in the following distinct sample sets: 1) constitutional DNA from the proband and an unaffected first degree relative from the twenty neuroblastoma pedigrees, with repeat sequencing of amplicons containing any DNA sequence variations and sequencing of amplicons containing confirmed variations in remaining family members; 2) 27 human neuroblastoma-derived cell line DNAs maintained at the Children's Hospital of Philadelphia; 3) tumor DNA from 167 sporadic neuroblastomas from the Children's Oncology Group tumor bank; and 4) 109 normal constitutional DNAs from the SNP500Cancer Resource panel purchased from the Coriell Institute for Medical Research (Camden, N.J.). In order to verify neuroblastoma cell line integrity, all lines were routinely genotyped (AmpFLSTR Identifier kit; Applied Biosystems, Foster City, Calif.), and mycoplasma tested.
(58) Mutation Prediction
(59) Cancer mutant predictions and analysis were performed as described (Torkamani et al. (2008) Cancer Res., 68:1675-82). Briefly, a support vector machine was trained upon common SNPs (presumed neutral) and congenital disease causing SNPs characterized by a variety of sequence, structural, and phylogenetic parameters. Training and predictions were performed using somatic mutations occurring within and outside of the kinase catalytic core separately. The support vector machine-based method was then applied to the ALK mutants, and the probability that each mutant is a driver was computed via the support vector machine. The threshold taken for calling a SNP a driver was taken to be 0.49 for catalytic domain mutations, and 0.53 for all other mutations (Torkamani et al. (2007) Bioinformatics, 23:2918-25). For comparison to previously observed cancer mutations, ALK mutants were mapped to positions of a catalytic core alignment generated with characteristic site motifs, and previously observed cancer mutants mapping to the same positions were noted (Torkamani et al. (2008) Cancer Res., 68:1675-82).
(60) Tumor Copy Number Analysis
(61) Tumor samples were assayed on the Illumina Infinium II HumanHap550 BeadChip technology (Illumina, San Diego, Calif.), at the Center for Applied Genomics at the Children's Hospital of Philadelphia. A total of 750 nanograms of genomic DNA was used as input in each case, and the assay was performed and data analyzed following the manufacturers recommendations and as previously described (Maris et al. (2008) N. Engl. J. Med., 358:2585-93).
(62) Quantitative mRNA Expression
(63) Relative ALK expression was determined using the 2-AACt method (Livak et al. (2001) Methods 25:402-8), using GAPDH as the endogenous control and using the second dCT as the lowest expressed cell line, using methods as previously described (Cole et al. (2008) Mol. Cancer. Res., 6:735-42).
(64) ALK siRNA Knockdown in Neuroblastoma Cell Lines
(65) A total of 1-510.sup.4 neuroblastoma cells were plated in triplicate overnight in antibiotic-free complete media in the 96 well RT-CES microelectronic cell sensor system (ACEA, San Diego, Calif.) (Yu et al. (2006) Anal. Chem., 78:35-43; Cole et al. (2008) Mol. Cancer. Res., 6:735-42). The cells were then transiently transfected with 200 L containing 50 nM of pooled siRNAs (four separate siRNAs per transcript targeted) against ALK (catalog #M-003103-02), GAPDH (catalog #D-001140-01-20) negative control, non targeting negative control, or PLK1 (catalog #M-003290-01) positive control (siGENOME SMARTpool siRNA, Dharmacon, Lafayette, Colo.) using 0.1% v/v Dharmafect I, according to the manufacturer's protocol (Dharmacon, Lafayette, Colo.). The four separate ALK-directed siRNA sense direction sequences are:
(66) TABLE-US-00001 ALKJ-003103-10 (SEQIDNO:1) GGGCCUGUAUACCGGAUAAUU ALKJ-003103-11 (SEQIDNO:2) GUGCCAUGCUGCCAGUUAAUU ALKJ-003103-12 (SEQIDNO:3) CCGCUUUGCCGAUAGAAUAUU ALKJ-003103-13 (SEQIDNO:4) GGAGCCACCUACGUAUUUAUU
In brief, 35 L of 1 M siRNA and 35 L of serum-free media were combined with 0.7 L Dharmafect I in 70 L of serum-free media and incubated for 20 minutes at room temperature, and then 560 L of antibiotic-free complete media was added. The culture media was gently removed from the plated cells and replaced by 200 L of fresh media containing the siRNA, mock or complete media. Cell growth was monitored continuously and recorded as a cell index (CI) every 30 minutes for a minimum of 96 hours. The Cell Index (CI) is derived from the change in electrical impedance as the living cells interact with the biocompatible microelectrode surface in the microplate well effectively measuring cell number, shape and adherence. Forty-eight hours after siRNA transfection, total RNA was extracted from the cells that had been plated in a parallel 96-well plate using the Qiagen (Valencia, Calif.) mini extraction kit, with DNAase treatment. Two hundred ng of total RNA was oligodT primed and reverse transcribed using Superscript II reverse transcriptase (Invitrogen, Carlsbad, Calif.). ALK, HPRT, GAPDH and PPIB expression levels were measured by quantitative RT-PCR using Taqman gene expression assays (ABI, Foster City, Calif.), quantified on corresponding standard curves and normalized to the geometric mean of the three housekeeping genes. Two independent experiments were performed in triplicate. Growth inhibition of the neuroblastoma cell lines was determined by comparing the siRNA against ALK growth curve to that against GAPDH at the time of maximum cell index (CI.sub.max): % growth inhibition=(1CI.sub.siALK/CI.sub.siGAPDH)100. ALK and GAPDH knockdown was determined by comparing the relative ALK expression: % knockdown=(1ALK.sub.siALK/ALK.sub.siCONTROL)100. The average % knockdown of ALK across all cell lines was 60% (range 21%-86%). The average % knockdown of GAPDH was 75% (range 61%-95%).
ALK Protein and Phosphoprotein Detection
(67) Neuroblastoma cell lines were grown in T75 flasks under standard cell culturing conditions. For KELLY and SKNDZ lysates collected from the siRNA knockdown experiments, cells were plated in T25s, transfected with 10 nM siRNA (as above) and collected at 24, 48 and 72 hours after transfection. At 60-80% confluency (or the appropriate time point), the cells were collected, pelleted and washed twice with ice cold PBS. Whole cell lysates were extracted with 100 uL Cell Extraction buffer (Invitrogen FNN011) containing protease inhibitors (Sigma, P-2714) and PMSF, briefly sonicated and rotated for 1 hour at 4 C. After a 30 minute centrifugation at 4 C., the supernatant was removed and protein quantification was performed using the Bradford method. Lysates (50 ug for siRNA experiment and 100 ug for native cell lines) were separated on 4-12% Bis-Tris gradient gels and transferred to PVDF membranes. Membranes were then incubated and washed according to the Cell Signaling Western protocol with 1:1000 ALK (Cell Signalling, #3333) and Phospho-ALK (Cell Signalling, #3341) and 1:5000 actin (Santa Cruz, sc-2352).
(68) Results
(69) Identification of Germline ALK Mutations
(70) To identify the location of a hereditary neuroblastoma predisposition gene, a genome-wide scan for linkage at 6000 single nucleotide polymorphisms (SNPs) in 20 neuroblastoma families was performed. Because of the rarity of the condition, the genome-wide scan included pedigrees with varying degrees of confidence of actual heritability. Eight families had three or more affected individuals of close relation (high confidence), whereas 6 families consisted of only two individuals of first-degree relation (moderate confidence), and 6 families also only consisted of two affected individuals, but of more distant relationship (low confidence). A significant linkage signal at chromosome 2p was discovered with a maximum nonparametric LOD score of 4.23 at rs1344063 in 18 of the families (two excluded due to insufficient DNA). This refined a region previously reported for one of the pedigrees studied here (Longo et al. (2007) Hum. Hered., 63:205-11). By mapping informative recombination events, a predisposition locus was defined at chromosome bands 2p23-p24 delimited by SNPs rsl 862110 and rs2008535 with 104 genes including the known neuroblastoma oncogene, MYCN (Schwab et al. (1984) Nature, 308:288-91; Weiss, et al. (1997) EMBO J., 16:2985-2995), and the ALK oncogene located 13.2 Mb centromeric. Despite previous work showing that forced overexpression of MYCN to the murine neural crest causes neuroblastoma (Weiss, et al. (1997) EMBO J., 16:2985-2995), resequencing of the MYCN coding region and 18 Kb of surrounding genomic DNA in probands from each linked family showed no disease-causal sequence variations.
(71) The anaplastic lymphoma kinase gene (ALK) was subsequently studied because ALK had been previously identified as a potential oncogene in neuroblastoma through somatically acquired amplification of the genomic locus (Osajima-Hakomori et al. (2005) Am. J. Pathol., 167:213-22; George et al. (2007) PLoS ONE 2:e255). In addition, oncogenic fusion proteins leading to constitutive activation of the ALK kinase domain occur in many human cancers including anaplastic large cell lymphoma (Morris et al. (1994) Science, 263:1281-4), inflammatory myofibroblastic tumors (Griffin et al. (1999) Cancer Res., 59:2776-80), squamous cell carcinomas (Jazii et al. (2006) World J. Gastroenterol., 12:7104-12), and non-small cell lung cancers (Soda et al. (2007) Nature, 448:561-6; Rikova et al. (2007) Cell, 131:1190-203). ALK is a single chain receptor tyrosine kinase and a member of the insulin receptor superfamily. Expression is normally detected in developing central and peripheral nervous system. Further, ALK is an orphan receptor as its ligand is not known. The normal function of ALK is also not known. Indeed, a murine knockout shows no phenotype. Mutations within ALK have not been previously described as mechanism of oncogenicity.
(72) Resequencing of the 29 ALK coding exons identified three separate single base substitutions within the ALK tyrosine kinase domain in eight of the probands screened (
(73) TABLE-US-00002 TABLE 1 ALK mutations in neuroblastoma. Probability cDNA Type/ Activating Mutation Variation Frequency Region.sup.1 Mutation.sup.2 G1128A c.3383G > C Germline (1/8) P-Loop 0.95 R1192P c.3575G > C Germline (2/8) 4 Strand 0.96 R1275Q c.3824G > A Germline (5/8) Activation 0.91 Somatic (8/24) Loop D1091N c.3271G > A Somatic (1/24) N-Terminal 0.29 M1166R c.3497T > G Somatic (1/24) C-Helix 0.79 I1171N c.3512T > A Somatic (2/24) C-Helix 0.85 F1174I c.3520T > A Somatic (1/24) End of C-Helix 0.92 F1174L c.3522C > A Somatic (8/24) End of C-Helix 0.96 F1245C c.3734T > G Somatic (1/24) Catalytic Loop 0.94 F1245V c.3733T > G Somatic (1/24) Catalytic Loop 0.91 I1250T c.3749T > C Somatic (1/24) Catalytic Loop 0.87 .sup.1The region in which the codon alteration occurs is indicated. Note that the D1091N is immediately adjacent to the tyrosine kinase domain. .sup.2The probability that the amino acid alteration results in oncogenic activation based on the methods of Torkamani and Schork (Torkamani et al. (2007) Bioinformatics, 23: 2918-25).
(74) An exemplary full-length ALK sequence is provided in GenBank Accession No. NM_004304.3 (
(75) ALK sequence variations occurred only in the families with high or moderate degrees of confidence for harboring a predisposing allele. Six of the eight families with three or more affected individuals had ALK missense alterations. The two families that did not have ALK sequence alterations identified were each shown to harbor mutations in the sympathicoadrenal lineage specific PHOX2B neurodevelopmental gene (Mosse et al. (2004) Am. J. Hum. Genet., 75:727-30; Raabe et al. (2008) Oncogene 27:469-76). Two of the six families consisting of only two affected individuals, but of first-degree relation, had ALK sequence variations. Each of these families carried the R1275Q alteration, and in FNB12 it is shown that the mutation arose de novo in the affected father, whereas in FNB56 the alteration was inherited from an unaffected father (
(76) Because ALK functions as an oncogene in other human cancers, it was predicted that the sequence variations discovered in the neuroblastoma pedigrees would result in constitutive activation. Therefore, a support vector machine-based statistical classifier was used to map the putative mutations and determine the probability that they would act as drivers of an oncogenic process (Torkamani et al. (2007) Bioinformatics, 23:2918-25; Torkamani et al. (2008) Cancer Res., 68:1675-82). Each of the germline alterations occurred at regions of the ALK kinase domain that have been shown to be major targets for cancer driver mutations in other oncogenic kinases (Table 1,
(77) Identification of Somatic ALK Mutations
(78) Having shown that heritable mutations in the ALK tyrosine kinase domain are associated with a highly penetrant predisposition to develop neuroblastoma, it was determined if ALK activation might also be somatically acquired. A representative set of 491 sporadically occurring primary neuroblastoma samples acquired from children at the time of diagnosis was examined on a 550K SNP-based microarray to assess for genome-wide copy number alterations. A total of 112 cases (22.8%) showed unbalanced gain of a large genomic region at 2p including the ALK locus (partial trisomy), and an additional 16 cases (3.3%) showed high-level focal amplification of ALK (
(79) Because of the association of ALK gain and amplification with high-risk disease features, a subset of 167 tumor samples from high-risk patients, and 27 human neuroblastoma-derived cell lines (all from high-risk patients), was examined for sequence alterations in the ALK tyrosine kinase domain. Fourteen of the 167 tumor (8.4%) and 10 out of 27 cell line (35.7%) samples showed single base substitutions consistent with activating mutations (
(80) Using the same statistical classifier employed for the germline mutations, it was shown that all but one of the sequence variations discovered in the tumor tissues were predicted to be activating mutations (Table 1), and the one that shows a low probability (D1091N) was outside of the core kinase domain. The vast majority of the somatically acquired mutations fell into either the catalytic loop or C-helix kinase domains, both frequent sites for oncogenic activating mutations (
(81) Functional Consequences of ALK Mutations
(82) Various genes are differentially expressed in human primary neuroblastomas, with higher expression sometimes seen in the most aggressive subset of tumors (Wang et al. (2006) Cancer Res., 66:6050-62). It is shown herein ALK is highly expressed in all but one of 20 human neuroblastoma-derived cell lines using quantitative RT-PCR. ALK expression was higher in neuroblastoma cells compared to developing fetal brain, and cell lines harboring ALK mutations (N=6) expressed the mRNA at significantly higher copy number than ALK wild-type cell lines (N=14,
(83) To determine if ALK activation via mutation and/or amplification is functionally relevant in models of high-risk neuroblastoma, and thus be a tractable therapeutic target, the consequences of disrupting ALK signaling via knockdown of messenger RNA was examined. siRNAs directed against ALK (Dharmacon, Lafayette, Colo.) were transiently transfected into 10 neuroblastoma cell lines and screened for inhibition of substrate adherent growth. The knockdown of the mRNA and protein was demonstrated in all lines studied, but showed differential effect on cellular proliferation (
(84) Currently, the frequency of ALK alterations in neuroblastoma are: mutations in the TK domain: 10%, mutations in the extracellular domain: 5%, and amplification: 8%. p-ALK is detectable in 20/134 (15%) of NBL tissue samples.
Example 2
(85) ALK is a tractable target for pharmacologic inhibition, but sensitivity depends on mutation type.
(86)
(87) ALK neuroblastoma mutants can be mapped onto the cMet-PF'1066 crystal structure. ALK R1275Q maps to c-Met R1227 which is not expected to destabilize the conformation of the activation loop residues important for binding PF-1066. ALK F1174L maps to c-Met F1124: This phenylalanine is highly conserved in ALK and sits in a hydrophobic pocket necessary for correctly positioning/stabilizing the conformation of residues 1222-1228. Mutation of this residue is expected to significantly decrease PF-1066 binding. Accordingly, this modeling is consistent with the data provided in
Example 3
(88) Neuroblastoma is a cancer of early childhood that arises from the developing autonomic nervous system. It is the most common malignancy diagnosed in the first year of life and shows a wide range of clinical phenotypes with some patients having tumors that regress spontaneously (D'Angio et al. (1971) Lancet 1:1046-1049), whereas the majority of patients have aggressive metastatic disease (Maris et al. (2007) Lancet 369:2106-2120). Neuroblastoma remains an important clinical problem as it continues to be a leading cause of childhood cancer mortality despite dramatic escalations in dose-intensive chemoradiotherapy, and long-term survivors experience significant treatment related morbidity (Oeffinger et al. (2006) N. Engl. J. Med., 355:1572-1582; Hobbie et al. (2008) Pediatr. Blood Cancer 51:679-683). To improve outcome and make paradigm-shifting advances in this disease, it is necessary to discover the key oncogenic drivers of the malignant process and exploit these therapeutically.
(89) The anaplastic lymphoma kinase (ALK) oncogene is a receptor tyrosine kinase first identified after recurrent t(2;5) translocations in anaplastic large cell lymphoma (ALCL) were shown to fuse the amino terminus of nucleophosmin to a previously unidentified gene at 2p23 (Morris et al. (1994) Science 263:1281-1284). The ALK gene encodes a 1620-amino acid protein that undergoes post-translational N-linked glycosylation, and expression is restricted to the developing central and peripheral nervous system with a postulated role in regulation of neuronal differentiation (Iwahara et al. (1997) Oncogene 14:439-449). It has recently become clear that other human cancers in addition to ALCL activate ALK signaling through unique oncogenic fusions of the ALK gene with a variety of partners, including inflammatory myofibroblastic tumors (Griffin et al. (1999) Cancer Res., 59:2776-2780), squamous cell carcinomas (Jazii et al. (2006) World J. Gastroenterol., 12:7104-7112) and non-small-cell lung cancers (Soda et al. (2007) Nature 448:561-566; Rikova et al. (2007) Cell 131:1190-1203). A recent phase 1 trial of the dual MET/ALK kinase inhibitor PF-02341066 showed safety and significant anti-tumor activity in patients with refractory solid tumors harboring an ALK translocation (Kwak et al. (2009) J. Clin. Oncol., 27:15s (abstr 3509)).
(90) Until recently, somatically acquired chromosomal translocation events were the only known mechanism for constitutively activating the ALK kinase. As explained herein, an unbiased linkage screen in familial neuroblastoma was performed and activating mutations in the tyrosine kinase domain of ALK were identified as the major cause of hereditary disease. Additionally, somatically acquired genomic amplification of ALK and mutations in the kinase domain as presumed oncogenic drivers in sporadic (nonfamilial) disease were also identified (see herein as well as Caren et al. (2008) Biochem. J., 416:153-9; Chen et al. (2008) Nature 455:971-974; George et al. (2008) Nature 455:975-978; Janoueix-Lerosey et al. (2008) Nature 455:967-970). As explained herein, early data obtained with the discovery of oncogenic mutations in this gene indicated that siRNA and pharmacologic inhibition of ALK signaling in cells harboring a mutation resulted in cytotoxicity, further indicating that ALK mutation/amplification acts as a dominant oncogenic driver.
(91) Key to impacting patient outcome with ALK-directed therapy was first to define the cohort of subjects who are most likely to benefit from ALK inhibition, and thus the prior mutation screen restricted to the high-risk subset was extended to cover all neuroblastoma phenotypic subsets. Second, preclinical experiments were performed to prove that the lead pharmacologic ALK-inhibitor showed anti-tumor activity directly due to on-target efficacy. The data presented here led directly to an ongoing pediatric Phase 1/2 trial of the PF-02341066 inhibitor that has shown safety and activity in ALK-activated adult solid malignancies.
(92) Methods
(93) Research Subjects and Samples
(94) Neuroblastoma tumor samples were acquired from the Children's Oncology Group Neuroblastoma Tumor Bank. The Children's Hospital of Philadelphia Institutional Review Board approved this research.
(95) DNA Sequencing
(96) Bidirectional sequencing of the ALK coding sequence was performed by Agencourt Biosciences on tumor DNA from 593 sporadic neuroblastomas from the Children's Oncology Group (COG) tumor bank.
(97) Tumor Copy Number Analysis
(98) Tumor DNA from 591 sporadic neuroblastomas from theChildren's Oncology Group (COG) tumor bank were assayed on the Illumina Infinium II HumanHap550 BeadChip as described above. DNA copy number for each individual tumor was estimated using OverUnder (Attiyeh et al. (2009) Genome Res., 19:276-83). Samples with a relative DNA copy number4.5 over the entire ALK locus were considered amplified, whereas samples with a relative DNA copy number2.3 were defined as having low-level gain of ALK. Tumors harboring low-level gain across90% of chromosome 2 were defined as whole chromosome (WC) gains; all other gains were considered regional. To assess the statistical significance of recurrent regional gain/amplification on chromosome 2, the STAC algorithm (Diskin et al. (2006) Genome Res., 16:1149-1158) was applied using 1,000 random permutations of the regional gains identified in 591 primary tumors. Both the frequency and footprint statistics in STAC were evaluated, and an adjusted p-value0.05 was considered statistically significant.
(99) Tumor Quantitative mRNA Expression
(100) Tumor RNA from 96 sporadic neuroblastomas from the Children's Oncology Group (COG) tumor bank was assayed on the Illumina Expression H6 v2.
(101) Cell Line Quantitative mRNA Expression
(102) Total RNA was isolated from cell lines according to QIAGEN's miRNeasy protocol. Real-time PCR using TaqMan Gene Expression Assays was performed according to the manufacturer's instructions (Applied Biosystems). All primer/probe sets spanned exon boundaries to assure specificity for cDNA. Relative expression of anaplastic lymphoma kinase (ALK) was determined by normalization to the geomean of peptidyl-prolyl cis-trans isomerase B (PPIB) and hypoxanthine phosphoribosyl-transferase (HPRT1) using a standard curve method. All RTPCR experiments included a non-template control and were done in triplicate.
(103) MET siRNA Knockdown in Neuroblastoma Cell Lines
(104) This was performed in 4 cell lines using the 96-well RT-CES microelectronic cell sensor system as described above.
(105) DNA Constructs and Retrovirus Production
(106) Four sequence variants were introduced into the full-length ALK cDNA using site-directed mutagenesis (Origene Technologies, Rockville, Md.). All mutations and overall cDNA integrity were confirmed by sequencing of the entire ALK open reading frame. The mutant cDNAs, as well as NPM-ALK and wild-type ALK cDNAs, were cloned into the pCMV-XLS vector and subcloned into pIRES-EGFP. Infection of retinal pigment epithelial cells that express telomerase (HTERT-RPE 1) was performed as follows: Phoenix Ampho cells (Oribigen-RVC-10001) were plated 500,000 cells in a 6 well plate in DMEM media with 10% FBS, 1% Pen/Strep, Gentamicin. Twenty-four hours after plating (50% confluent), Phoenix cells were transfected (Fugene) with retroviral vector MigR1 containing the ALK constructs following the Fugene protocol (using 6:1 dilution of Fugene:plasmid DNA). HTERT-RPE1 cells were plated, 500,000 cells per well of 6 well plate, and then harvested virus-containing media 48 hours post transfection. Media was removed from Phoenix cells and filtered through 0.45 m syringe. Growth media on HTERT-RPE1 cells was replaced with virus cocktail (2 ml growth media, 1 ml filtered viral media, 4 g/ml Polybrene (Santa Cruz)) and incubated overnight. Viral media on HTERT-RPE1 cells was replaced on day 5 with fresh growth media and incubated 48 hours. HTERT-RPE1 cells then sorted in cell sorter for GFP positive cells.
(107) In Vitro Tumor Growth Inhibition
(108) In vitro activity of PF-02341066 (Pfizer) dissolved in dimethyl sulfoxide (DMSO) was evaluated in 18 neuroblastoma cell lines using the RT-CES system (ACEA Biosciences, San Diego, Calif.) that measures electrical impedance of adherent cells, providing real-time quantification of cell proliferation. Cell lines were plated at a range of 5,000 to 30,000 cells per well depending on growth kinetics and drug was added 24 hours later across a 4-log dose range (1-10,000 nM) in triplicate. The IC50 was calculated from the cell index after 72 hours of incubation using a variable slope (Graph pad Prism Version 5.0). Growth inhibition at 333 nM PF-02341066 was calculated using the formula: % Inhibition=100*(Cell index controlcell index treatment)/Cell index control. Due to non-comparable maximum growth inhibition depending on ALK status, we analyzed growth inhibition at a single pharmacologically relevant dose. To verify cell line integrity, all lines were routinely genotyped (AmpFLSTR Identifier kit; Applied Biosystems) and mycoplasma tested.
(109) In Vitro Protein and Phosphoprotein Detection
(110) Each neuroblastoma cell line was cultured in ten T75 flasks under standard cell culture conditions. At 70-80% confluence PF-02341066 was added to cell culture medium to achieve a designated final concentration at one of ten doses ranging from 0 nM to 10,000 nM. Cells were incubated for 2 hours with drug, then collected, pelleted, and washed twice with ice cold PBS. Whole cell lysates were then harvested, separated and immunoblotted as described herein. The following antibodies were used according to manufacturers' instructions: anti-ALK (1:1,000; Cell Signaling, 3333), anti-phospho-ALK Tyr 1604 (1:1,000, Cell Signaling, 3341), anti-STAT3 (1:1,000; Cell Signaling, 9132), antiphospho-STAT3 Tyr 705 (1:1,000; Cell Signaling, 9145), anti-AKT (1:1,000; Cell Signaling, 9272), anti-phospho-AKT Ser 473 (1:1,000; Invitrogen, 44-621G), anti-p44/42 MAPK (ERK1/2) (1:1,000; Cell Signaling, 4695), anti-phospho-p44/42 MAPK (ERK 1/2) (1:1,000; Cell Signaling, 9101), anti-actin (1:2,000; Santa Cruz, sc-1616).
(111) In Vivo Tumor Growth Inhibition
(112) CB 17 scid female mice (Taconic Farms, NY) were used to propagate subcutaneously implanted neuroblastoma tumors. Tumor diameters were measured twice per week using electronic calipers. Tumor volumes were calculated using the spheroid formula, (/6)*d.sup.3, where d represents the mean diameter. Once tumor volume exceeded 200 mm.sup.3 mice were randomized (n=10 per arm) to receive PF-02341066 100 mg/kg/dose or vehicle (acidified water) daily by oral gavage for four weeks. Mice were maintained under the protocols and conditions approved by our institutional animal care and use committee. Mice were sacrificed when tumors were greater than 1500 mm.sub.3.
(113) In Vivo Protein and Phosphoprotein Detection
(114) CB 17 scid female mice (Taconic Farms, NY) were used to propagate subcutaneously implanted NB 1643 neuroblastoma tumors. Once tumor volume exceeded 300 mm.sup.3 mice were randomized (n=3 per arm) to receive PF-02341066 100 mg/kg/dose or vehicle (acidified water) daily by oral gavage for 2 days. Mice were sacrificed 4 hours after the final dose to harvest xenografts, which were immediately snap frozen in liquid nitrogen. Frozen xenografts were pulverized and whole cell lysates were extracted using 100 L extraction buffer (FNN011, Invitrogen) containing protease inhibitor (P-2714, Sigma), phosphatase inhibitors (P-5726, Sigma) and phenylmethyl sulphonyl fluoride. Lysates were sonicated, and rotated for 1 hour at 4 C. Following centrifugation at 4 C. for 30 minutes, the supernatant was removed, and protein quantification was performed using the Bradford method. Lysates (200 g) were separated on 4%-12% Bis-Tris gradient gels and transferred to PVDF membranes which were immunoblotted according to manufacturers' instructions: anti-ALK (1:1,000; Cell Signaling, 3333), anti-phospho-ALK Tyr 1604 (1:1,000, Cell Signaling, 3341), and anti-actin (1:5,000; Santa Cruz, sc-2352).
(115) Homology Modeling
(116) The wild-type ALK sequence alignment to c-Met was performed in the PRIME suite within Maestro 8.5 (Schrdinger LLC, New York). Using the full-length ALK sequence and the sequence derived from the crystal structure of the kinase domain of c-Met with PF-02341066 (PDB entry=2WGJ), the sequences were aligned automatically followed by manual editing of gap areas. The final sequence alignment is shown in
(117) Statistical Analysis
(118) Associations of ALK mutation status and ALK amplification status with accepted neuroblastoma risk factors were tested using a Fisher's Exact Test (Table 2). Mixed-effects linear model was used to test tumor volume over time between treatment and vehicle groups controlling for tumor size at enrollment. The tumor size was transferred by logarithm before data analysis. Survival analysis was performed using the Log-Rank test with progression defined as tumor volume exceeding 1500 mm.sup.3 or treatment related death. A P-value of 0.05 or less was considered to indicate statistical significance. All data analyses were conducted with the use of SAS.
(119) Results
(120) ALK Mutations are Restricted to the Tyrosine Kinase Domain and Occur in all Phenotypic Subsets
(121) Comprehensive re-sequencing of all 29 ALK coding exons and 500 base pairs of flanking sequence was performed in 188 high-risk diagnostic primary neuroblastoma tumors as part of the NBL-TARGET initiative (Neuroblastoma-Therapeutically Applicable Research to Generate Effective Treatments; target.cancer.gov/). The prior work presented the results from 167 of these samples restricted to the kinase domain only and it was sought to determine if non-kinase domain sequence alterations were putatively pathogenic. In the extracellular domain, seven nonsynonymous sequence variations were discovered and validated that were not reported in any of the SNP databases (Table 2). Only one of these was somatic (M770I), whereas five showed the same alteration in the germline DNA (one sample did not have matched germline DNA available). Five nonsynonymous sequence variations were found in the 3 untranslated portion of the gene, but 3/3 with matched germline DNA showed the same sequence variation in the constitutional DNA. Taken together, these data indicate that somatically acquired sequenced variations outside of the ALK tyrosine kinase domain are uncommon in neuroblastoma.
(122) TABLE-US-00003 TABLE 2A Nonsynonomous sequence variations within the ALK tyrosine kinase domain (N = 594). DNA Number with sequence Protein coding alteration in variation variation Frequency germline DNA c.3452C > T T1151M 1 (2%) N/A c.3497T > G M1166R 1 (2%) 0/1 c.3509T > G I1170S 1 (2%) 0/1 c.3512T > A I1171N 2 (5%) 0/2 c.3521T > G F1174C 1 (2%) 0/1 c.3520T > A F1174I 1 (2%) 0/1 c.3522C > A F1174L 7 (16%) 0/4 c.3586C > A L1196M 1 (2%) N/A c.3599C > T A1200V 1 (2%) N/A c.3610C > T L1204F 1 (2%) 1/1 c.3734T > G F1245C 2 (5%) 0/1 c.3733T > A F1245I 1 (2%) 0/1 c.3733T > G F1245V 2 (5%) 0/2 c.3749T > C I1250T 1 (2%) 1/1 c.3824G > A R1275Q 20 (47%) 0/17
(123) TABLE-US-00004 TABLE 2B Nonsynonomous sequence variations outside of the ALK tyrosine kinase domain (N = 167). Number with Protein alteration DNA sequence coding in germline variation variation Frequency DNA c.106C > T P36S 1 (1%) 1/1 c.469C > T P157S 1 (1%) N/A c.592G > A V198M 1 (1%) 1/1 c.776G > A R259H 1 (1%) 1/1 c.1918G > A G640R 1 (1%) 1/1 c.2310G > T M770I 1 (1%) 0/1 c.2978A > G D993G 1 (1%) 1/1 c.3271G > A D1091N 1 (1%) N/A c.4219G > A E1407K 1 (1%) 1/1 c.4297_4299delGAG E1433del 1 (1%) N/A c.4390C > G R1464G 1 (1%) N/A c.4480G > A G1494R 1 (1%) N/A c.4657G > C A1553P 1 (1%) 1/1
(124) It was then sought to define the spectrum and frequency of somatic ALK mutations across all neuroblastoma phenotypic subsets. A representative set was identified of 594 primary neuroblastomas obtained at diagnosis for sequence analysis restricted to eight amplicons covering the entire tyrosine kinase domain. In total, nonsynonymous sequence variations were identified in 7.2% of samples (43/594), which were grouped into four hotspots within the kinase domain (Table 2). All putative mutations in the ALK tyrosine kinase domain were not present in the single nucleotide polymorphism database (dbSNP; www.ncbi.nlm.nih.gov/projects/SNP/), and were not detected in direct sequencing of the ALK tyrosine kinase domain in 218 normal control alleles. The most prevalent mutation resulted in an arginine to glutamine substitution at amino acid position 1275 (R1275Q) and occurred in 20/43 tumors with mutations (47%). This was also the most common germline mutation discovered in hereditary neuroblastoma pedigrees, but was acquired in all 17 sporadic cases here where matched germline DNA was available. The second most common mutation resulted in a phenyalanine to leucine substitution at amino acid position 1174 (F1174L), occurring in 7/43 tumors harboring any sequence variation. In addition, the 1174 phenylalanine codon was mutated to isoleucine or cysteine in one case each, so that this codon was altered in 21% of tumors with a tyrosine kinase mutation. Of the 43 kinase domain mutations discovered in tumor tissues, constitutional DNA was available for 32 patients, and the majority were somatically acquired with 6.3% of cases (2/32) showing the same alteration in the germline (L1204F and I1250T; Table 2).
(125) ALK Amplification and Regional Gain of the ALK Locus are Associated with Increased ALK Expression
(126) To define ALK allelic status, an overlapping set of 591 primary neuroblastoma tumors was characterized on the Illumina Human Hap550K SNP microarray. High-level amplification of ALK was detected in 2.4% of tumors (Table 3), defined as copy number >4.5 of the entire ALK gene relative to the chromosome 2 copy-number. Additional tumor DNA was available for 10 of these cases, and none showed an ALK mutation suggesting that mutation and gene amplification may be mutually exclusive genomic events. All tumors with ALK amplification also harbored MYCN amplification, but intervening sequence between these two genes located 13 Mb apart often was not co-amplified (
(127) TABLE-US-00005 TABLE 3 Frequency of ALK mutation and amplification in diagnostic primary neuroblastomas. Mutation Status (N = 593) Amplification Status (N = 591) All Patients Mutation + Mutation P-value* Amplification + Amplification P-value* All Patients 867 43 (7%) 550 (93%) 14 577 Age 0.6871 0.6036 <365 days 283 (33%) 15 (35%) 179 (33%) 4 (29%) 169 (29%) >365 days 580 (67%) 28 (65%) 370 (67%) 10 (71%) 405 (971%) Unknown 4 0 1 0 3 INSS Tumor 0.2541 0.0786 Stage 1 171 (20%) 7 (16%) 138 (25%) 0 (0%) 75 (13%) 2 119 (14%) 8 (19%) 79 (14%) 0 (0%) 48 (8%) 3 123 (14%) 6 (14%) 80 (15%) 2 (14%) 85 (15%) 4 390 (45%) 20 (47%) 220 (40%) 11 (79%) 321 (56%) 4S 56 (7%) 2 (4%) 31 (6%) 1 (7%) 42 (8%) Unknown 8 0 2 0 6 MYCN Status 0.2452 <0.0001 Not Amplified 710 (83%) 33 (79%) 456 (84%) 2 (14%) 459 (81%) Amplified 143 (17%) 9 (21%) 88 (16%) 12 (86%) 108 (19%) Unknown 14 1 6 0 10 Shimoda 0.7606 0.0502 Histopathology Favorable 398 (49%) 22 (54%) 254 (49%) 2 (15%) 224 (41%) Unfavorable 414 (51%) 19 (46%) 262 (51%) 11 (85%) 318 (59%) Unknown 55 2 34 1 35 DNA ploidy 0.6653 0.0127 Hyperdiploid 517 (65%) 28 (68%) 355 (66%) 3 (27%) 331 (65%) Diploid 275 (35%) 13 (32%) 181 (34%) 8 (73%) 176 (35%) Unknown 75 2 14 3 71 COG Risk 0.5217 0.0009 Group Low 327 (38%) 17 (40%) 237 (43%) 0 (0%) 151 (26%) Intermediate 124 (15%) 7 (16%) 72 (14%) 0 (0%) 78 (14%) High 406 (47%) 19 (44%) 237 (43%) 14 (100%) 342 (60%) Unknown, 10 0 4 0 6 *p-values from Fisher's Exact Test.
ALK Mutations Occur in all Phenotypic Subsets, but Amplification is Restricted to the Most Aggressive Cases
(128) Neuroblastoma is a diverse neoplasm and can behave in either a very benign fashion, or an extremely malignant one, based on a variety of clinical and biological factors (Maris et al. (2007) Lancet 369:2106-2120). Three risk groups are defined, with low-, intermediate- and high-risk cases having cure rates of >97%, >90% and 40-50%, respectively (Maris et al. (2007) Lancet 369:2106-2120). These cure rates are achieved with no chemotherapy in the low-risk group, moderate dose intensity chemotherapy in the intermediate-risk patients, and highly intensive multimodal chemoradiotherapy for the high-risk patients. Prior published studies had focused on the ALK status in the high-risk group of patients, and here it was determined if ALK aberrations occurred in the more benign subset of cases as well. As shown in Table 3, ALK mutations occurred in all phenotypic subsets, including all disease stages and risk groups. Mutations were seen in the very benign state 1 low-risk tumors as well as Stage 4S cases, that show spontaneous complete regression without cytotoxic therapy (D'Angio et al. (1971) Lancet 1:1046-1049). In contrast, ALK amplification events were restricted to the high-risk group of patients only. Thus, the likelihood of an ALK aberration at diagnosis in diagnostic high-risk neuroblastic tissues, where novel therapeutic approaches are needed, is approximately 11.3%.
(129) ALK R1275Q, R1192P, G1128A, and F1174L are gain-of-function mutations that induce differential constitutive kinase activation
(130) To determine the functional consequences of common germline and somatic mutations, human ALK cDNAs were engineered harboring the three most common germline mutations (R1275Q, R1192P, G1128A), and the F1174L mutation that was only seen in tumor tissue. Next these cDNAs, as well as NPM-ALK and wild-type ALK, were stably overexpressed in retinal pigment epithelial cells immortalized with telomerase reverse transcriptase (hTERT-RPE1) via retroviral infection. hTERT-RPE1 cells were chosen for these experiments because they are human neural crest-derived, as are neuroblastomas, and do not express detectable levels of ALK by quantitative RT-PCR.
(131) Cytotoxicity to Pharmacological ALK Inhibition In Vitro is Dependent Upon ALK Genomic Status
(132) It has been shown that mRNA knockdown of ALK in neuroblastoma cell lines with mutation or amplification is cytotoxic, and thus ALK inhibition might offer a tractable therapeutic target. In addition, it has been shown herein that pharmacologic inhibition of ALK kinase activity had an anti-proliferative effect in ALK mutated cell lines (see also Chen et al. (2008) Nature 455:971-974; George et al. (2008) Nature 455:975-978; Janoueix-Lerosey et al. (2008) Nature 455:967-970). In order to translate these findings to the clinic as quickly as possible, the sensitivity of neuroblastoma was determined in in vitro and in vivo models to PF-02341066, an ATP-competitive, orally bioavailable small molecule inhibitor of ALK and MET, that has shown safety in early phase clinical trials (Kwak et al. (2009) J. Clin. Oncol., 27:15s (abstr 3509)). A panel of eighteen human neuroblastoma-derived cell lines, chosen to be representative of ALK genomic status in primary tumors, was utilized to determine the IC.sub.50 of PF-02341066 by concentration-response curves across a 4-log dose range (1-10,000 nM). Inhibition of substrate adherent growth was screened in a real-time electrical impedance monitoring system (Yu et al. (2006) Anal. Chem., 78:35-43; Atienza et al. (2006) J. Biomol. Screen 11:634-643). Cell lines harboring an ALK aberration (mutations or amplification) displayed significantly superior inhibition of growth than cell lines with wild-type ALK status (P=0.0004,
(133) To demonstrate that cytotoxicity with PF-02341066 is mediated through ALK inhibition, it was shown that phospho-ALK correlated with ALK genomic status (
(134) Cytotoxicity In Vitro Correlates with Abrogation of Phospho-ALK and Differential Inhibition of Downstream Signaling Pathways
(135) To correlate the phenotypic effect seen in vitro to degree of inhibition of constitutive kinase activation and to elucidate potential mechanisms underlying differential sensitivity to PF-02341066, dose dependent inhibition of phosphoprotein signaling was determined in three cell lines, selected to be representative of ALK genomic status observed in patient samples. The dose that first corresponded with inhibition of cell growth was correlated to abrogation of ALK tyr1604 phosphorylation in all three-cell lines (
(136) In NB1 cells, abrogation of phospho-ALK occurred in parallel with abrogation of phosphoprotein signaling in pathways known to be important in lymphoma models of NPM-ALK mediated transformation: pSTAT3, pAKT, and pERK (
(137) Pharmacologic Inhibition with PF-02341066 Shows Potent Anti-Tumor Activity In Vivo
(138) It was then determined if pharmacologic ALK inhibition resulted in anti-tumor activity in xenograft models of neuroblastoma. A pharmacologically relevant dose of PF-02341066 at 100 mg/kg/day for 4 weeks was tested against serially passaged human neuroblastoma xenografted in the flank of CB17 immunodeficient mice (Zou et al. (2007) Cancer Res., 67:4408-4417; Christensen et al. (2007) Mol. Cancer. Ther., 6:3314-3322). PF-03241066 caused regression of all NB1643 xenografts (R1275Q) within three weeks, and complete regression was sustained over the fourth week of dosing (P<0.0001,
(139) As cell line protein lysates and archival tumor specimens can demonstrate phospho-ALK staining in the absence of genomic ALK aberrations, in vivo activity of PF-02341066 was compared against two xenografts with diploid copy number and wild type ALK sequence but with differing levels of ALK expression and phospho-ALK activation. NB-EBc1 xenografts (previously shown to have weak phospho-ALK staining), treated with drug demonstrated significant tumor growth delay (p<0.0001,
(140) Homology Modeling Predicts a Structural Basis for Differential Activity Against R1275Q and F1174L Mutations
(141) A computational homology model of PF-02341066 bound to ALK was derived from the available co-crystal structure of PF-02341066 bound to the kinase domain of c-Met. Modeling was possible due to the high sequence homology of the kinase domains in the areas near the inhibitor-binding site. This model predicts that PF-02341066 binds very similarly to both ALK and c-Met, with nearly all of the major protein inhibitor interactions being conserved. In the PF-02341066 bound conformation of wild-type ALK, residues D1270 through Y1278 of the kinase activation loop form a bend. This bend creates one end of the inhibitor-binding site and positions the side chain of Y1278 to enable a key binding interaction with the fluorodichlorophenyl group of PF-02341066 (
(142) The ALK homology model predicts that a R1275Q mutant is likely to have the same PF-02341066 bound activation loop conformation as wild-type ALK and c-Met. The side chain of R1275 points out towards solvent and does not appear to make interactions critical for stabilizing the PF-02341066 bound activation loop conformation (
(143) In contrast, the F1174L mutation is predicted to result in an activation loop conformation that significantly decreases binding of PF-02341066. The side chain of F1174 is situated in a cluster of three phenylalanines (F1174, F1245, and F1271) in attractive van der Waals contact with each other. The three phenylalanines appear to form an aromatic center that is part of a larger hydrophobic core. This hydrophobic core is likely important for stabilizing the particular activation loop conformation necessary to make key binding interactions with PF-02341066 (
(144) As shown in
(145) The recent discovery of germline and somatic gain of function mutations in the receptor tyrosine kinase ALK provides a tractable therapeutic target for new drug development in neuroblastoma. Here, the frequency and spectrum of ALK gene mutations and amplification events was determined in a representative series of diagnostic primary neuroblastomas. The instant results demonstrate that ALK mutations are detected in 7% of cases and are found primarily in the tyrosine kinase domain. Other kinases such as EGFR (Lee et al. (2006) PLoS Med 3:e485), KIT (Gari et al. (1999) Br. J. Haematol., 105:894-900), and FLT3 (Frohling et al. (2007) Cancer Cell 12:501-513) show activating mutations in both the intra- and extracellular and juxta-membrane domains. Accordingly, it is clear that sequence alteration outside the kinase domain may be functionally relevant, but it is clear from the data presented herein that the majority of ALK mutations occur in the kinase domain.
(146) High-level amplification of ALK was detected in another 2.4% of tumors, so that about 10% of neuroblastomas have genomic evidence for ALK activation at diagnosis. Unlike sequence variation mutations, high-level ALK amplification was restricted to the high-risk group of tumors with concomitant MYCN amplification. These data indicate that in the setting of genomic instability, ALK can be a target for amplification events that presumably lead to pathway activation due to homodimerization of overexpressed ALK protein. Notably, 19% of tumors show unbalanced gain of 2p including the ALK locus. Some of these are focal, suggesting a tandem duplication event targeting the ALK locus, but the majority of these are very large, often involving the majority of the short arm. The unbalanced gains in 2p may correlate with pathway activation and/or sensitivity to targeted interruption of ALK signaling.
(147) The two most commonly observed mutations resulted in robust constitutive phosphorylation of the ALK kinase, whereas the rare germline mutation G1128A, which has not been observed somatically, resulted in only weak activation, similar to the amount seen with forced overexpression of wild-type protein. While these data are semiquantitative, the magnitude of difference is clear and consistent with the observation that heritable G1128A mutations resulted in low tumor penetrance, compared to the families with R1275Q germline mutations, each showing near complete tumor penetrance in at risk carriers. The hTERT-rRPE1 assay provides complimentary information to forced overexpression in other systems, such as BAF3 (George et al. (2008) Nature 455:975-978) or NIH-3T3 cells (Janoueix-Lerosey et al. (2008) Nature 455:967-970), but the instant system offers advantages for further functional analysis of mutations as they are discovered to determine their potential as an oncogenic driver in an appropriate cellular context. Cellular context is important and the use of this system to understand the functional consequences of all sequence variations identified may be used to dissect the oncogenic potency of the various mutations discovered.
(148) The data clearly demonstrate that cytotoxicity to PF-02341066 is highly associated with ALK genomic status and evidence for constitutive activation. It is also evident that some neuroblastomas may somatically activate ALK signaling in the absence of mutation or amplification.
(149) PF-02341066 has already demonstrated safety and tolerability in humans, as well as dramatic reductions in tumor volumes and disease stabilization for non-small cell lung cancers with activated ALK via translocation events. This drug is robustly cytotoxic in vitro and in vivo in cells with the most common mutation (R1275Q) and in wild-type cells with high-level ALK amplification (p<0.0004), and it is shown herein that this is not an effect of c-Met inhibition. F1174L models also show growth inhibition with PF-02341066, though not nearly as potently; and there are models without evidence for ALK mutation, but with constitutive activation that show growth inhibition, suggesting that several subsets of patients may benefit from ALK inhibition therapy. It is evident that phospho-ALK is an appropriate surrogate biomarker of response and that abrogation of phospho-ALK can be highly correlated with response to pharmacologic inhibition.
(150) In NPM-ALK driven lymphoma models, it has been shown that several canonical signaling pathways are activated, including STAT3, AKT/PI3K, and RAS/ERK, thus influencing cell proliferation and survival (Zamo et al. (2002) Oncogene 21:1038-1047; Chiarle et al. (2005) Nat. Med., 11:623-629; Lim et al. (2009) Blood 114:1585-1595). However, the situation appears to be more complex in neuroblastoma. The NB 1 model with wild type, amplified ALK, shows constitutive activation of each of these pathways, with dose-dependant abrogation of signaling paralleling diminution of phosphorylated ALK and cytotoxicity. However, the NB1643 cells harboring an R1275Q mutation are equally sensitive to PF-02341066, show the same pattern of diminution of phospho-ALK staining, but do not likewise abolish phosphorylated proteins in the STAT3, AKT/PI3K, and RAS/ERK until much higher doses. SY5Y cells, which are relatively resistant to PF-02341066, also do not abolish STAT3, AKT/PI3K, and RAS/ERK signaling even at the higher dose levels where cytotoxicity (and diminished phosphorylated ALK) was seen. Without being bound by theory, these datataken togetherindicate that ALK mutations may exert their oncogenic effect through other pathways.
(151) The data presented herein show that mutations in ALK are present across all neuroblastoma disease subsets, both benign and malignant forms, consistent with acquired ALK activation being an early event in tumorigenesis. ALK amplification, however, is strongly associated with the high-risk subset (P<0.001) and MYCN amplification (P<0.001), so that approximately 11% of all newly diagnosed high-risk neuroblastoma patients harbor genetic evidence for ALK activation and can be expected to potentially benefit from ALK inhibition therapy. In the instant dataset, mutations and amplifications of ALK are mutually exclusive, suggesting these modes of genomic dysregulation do not co-occur in sporadic neuroblastoma. Mutations in ALK are significantly more frequent in human neuroblastoma-derived cell lines. Without being bound by theory, this may occur through selection of rare clones that are present in diagnostic tissues and emerge during therapy, as has been shown in chronic myeloid leukemias harboring a BCR-ABL gene translocation, mutation or amplification (Gorre et al. (2001) Science 293:876-880).
(152) As the crystal structure for the ALK kinase domain has not been solved, in silico techniques were used to explore the observed differentially cytotoxicity of PF-02341066 against the two most common mutations observed in patient samples. Structural modeling predicted that the phenylalanine to leucine substitution at codon 1174 (F1174L) results in destabilization of the PF-02341066 binding site, whereas the R1275Q mutation has no predicted effect on this small molecule binding and thus competing with ATP.
(153) Taken together, these data provide strong rationale for the clinical use of PF-02341066 for patients with neuroblastoma. This represents the first therapy for neuroblastoma specifically developed for a mutated oncogenic driver.
Example 4
(154) Table 4 provides the frequency and spectrum of ALK mutation in diagnostic primary neuroblastomas (n=1148), as described hereinabove. Table 5 provides the frequency of mutations in various subsets of the population based on risk, as described hereinabove.
(155) TABLE-US-00006 TABLE 4 Frequency and spectrum of ALK mutations in diagnostic primary neuroblastomas. All Patients Mutation + All Patients 1148 84 (7.3%) Age <365 days 438 (38%) 29 (6.6%) >365 days 709 (62%) 55 (7.8%) >3650 days 36 (3%) 6 (17%) INSS Tumor Stage 1 288 (25%) 14 (4.9%) 2 211 (18%) 21 (10%) 3 172 (15%) 10 (5.8%) 4 401 (35%) 36 (9%) 4S 76 (7%) 3 (4%) MYCN Status Not Amplified 984 (86%) 65 (6.6%) Amplified 156 (14%) 18 (11.5%) Shimada Histopathology Favorable 629 (55%) 43 (6.8%) Unfavorable 466 (41%) 37 (7.9%) DNA Ploidy Diploid 377 (33%) 31 (8.2%) Hyperdiploid 729 (64%) 51 (7%) COG Risk Group Low 548 (48%) 35 (6.4%) Intermediate 203 (18%) 14 (6.9%) High 397 (34%) 35 (8.8%)
(156) TABLE-US-00007 TABLE 5 Frequency of mutations in low risk, intermediate risk, and high risk samples. SAMPLE TOTAL SET MUTATIONS R1275 F1174 F1245 LOW RISK 35/548 (6.4%) 16/36 (44%) 7/23 (30%) 6/11 (55%) (N = 548) INT RISK 14/203 (6.9%) 6/36 (17%) 6/23 (26%) 1/11 (10%) (N = 203) HIGH RISK 35/397 (8.8%) 14/36 (39%) 10/23 (43%) 4/11 (36%) (N = 397) ALL 84/1148 (7.3%) 36/84 (43%) 23/84 (27%) 11/84 (13%) TUMORS (N = 1148)
Example 5
(157) The co-administration of ALK antibodies with a tyrosine kinase inhibitor induces cell death in cells that were less sensitive to the tyrosine kinase inhibitor alone.
(158) While certain of the preferred embodiments of the present invention have been described and specifically exemplified above, it is not intended that the invention be limited to such embodiments. Various modifications may be made thereto without departing from the scope and spirit of the present invention, as set forth in the following claims.