BIOMARKERS FOR OXYTOCIN RECEPTOR ANTAGONIST THERAPY
20230102503 · 2023-03-30
Inventors
Cpc classification
A61K31/5377
HUMAN NECESSITIES
A61K9/0053
HUMAN NECESSITIES
C12Q2600/106
CHEMISTRY; METALLURGY
A61K31/4025
HUMAN NECESSITIES
A61K38/24
HUMAN NECESSITIES
C12Q1/6883
CHEMISTRY; METALLURGY
International classification
C12Q1/6883
CHEMISTRY; METALLURGY
A61K31/4025
HUMAN NECESSITIES
A61K31/5377
HUMAN NECESSITIES
A61K38/24
HUMAN NECESSITIES
A61K9/00
HUMAN NECESSITIES
Abstract
The disclosure provides compositions and methods for determining the propensity of a subject (e.g., a female human subject) undergoing embryo transfer therapy to benefit from administration of an oxytocin receptor antagonist, as well as for treating such patients accordingly. Using the compositions and methods of the disclosure, a subject undergoing embryo transfer therapy may be selected for treatment with an oxytocin receptor antagonist on the basis of a pre-treatment gene signature. Additionally or alternatively, a subject that is undergoing embryo transfer therapy and that has been administered an oxytocin receptor antagonist may be monitored following treatment to determine whether the subject is responding to the oxytocin receptor antagonist or if subsequent dosing is desirable. Exemplary oxytocin receptor antagonists useful in conjunction with the compositions and methods of the disclosure include pyrrolidin-3-one oxime compounds, such as (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, among others.
Claims
1. A method of treating a subject undergoing an embryo transfer procedure in which one or more embryos are transferred to the uterus of the subject, the method comprising: a) monitoring the subject's expression of one or more of genes Dipeptidyl Peptidase 4 (DPP4), Contactin Associated Protein Like 3 (CNTNAP3), Contactin 4 (CNTN4), C-X-C Motif Chemokine Ligand 12 (CXCL12), and Tenascin XB (TNXB), and, if the subject is determined to exhibit a decrease in expression of the one or more genes relative to a reference expression level of the one or more genes, b) administering to the subject a therapeutically effective amount of an oxytocin receptor antagonist.
2. A method of treating a subject undergoing an embryo transfer procedure in which one or more embryos are transferred to the uterus of the subject, the method comprising administering to the subject a therapeutically effective amount of an oxytocin receptor antagonist, wherein the subject has been determined to exhibit a decrease in expression of one or more of genes DPP4, CNTNAP3, CNTN4, CXCL12, and TNXB relative to a reference expression level of the one or more genes.
3. A method of reducing the likelihood of embryo implantation failure in a subject undergoing an embryo transfer procedure in which one or more embryos are transferred to the uterus of the subject, the method comprising: a) monitoring the subject's expression of one or more of genes DPP4, CNTNAP3, CNTN4, CXCL12, and TNXB, and, if the subject is determined to exhibit a decrease in expression of the one or more genes relative to a reference expression level of the one or more genes, b) administering to the subject a therapeutically effective amount of an oxytocin receptor antagonist.
4. A method of reducing the likelihood of embryo implantation failure in a subject undergoing an embryo transfer procedure in which one or more embryos are transferred to the uterus of the subject, the method comprising administering to the subject a therapeutically effective amount of an oxytocin receptor antagonist, wherein the subject has been determined to exhibit a decrease in expression of one or more of genes DPP4, CNTNAP3, CNTN4, CXCL12, and TNXB relative to a reference expression level of the one or more genes.
5. A method of improving endometrial receptivity in a subject undergoing an embryo transfer procedure in which one or more embryos are transferred to the uterus of the subject, the method comprising: a) monitoring the subject's expression of one or more of genes DPP4, CNTNAP3, CNTN4, CXCL12, and TNXB, and, if the subject is determined to exhibit a decrease in expression of the one or more genes relative to a reference expression level of the one or more genes, b) administering to the subject a therapeutically effective amount of an oxytocin receptor antagonist.
6. A method of improving endometrial receptivity in a subject undergoing an embryo transfer procedure in which one or more embryos are transferred to the uterus of the subject, the method comprising administering to the subject a therapeutically effective amount of an oxytocin receptor antagonist, wherein the subject has been determined to exhibit a decrease in expression of one or more of genes DPP4, CNTNAP3, CNTN4, CXCL12, and TNXB relative to a reference expression level of the one or more genes.
7. A method of reducing uterine contractility in a subject undergoing an embryo transfer procedure in which one or more embryos are transferred to the uterus of the subject, the method comprising: a) monitoring the subject's expression of one or more of genes DPP4, CNTNAP3, CNTN4, CXCL12, and TNXB, and, if the subject is determined to exhibit a decrease in expression of the one or more genes relative to a reference expression level of the one or more genes, b) administering to the subject a therapeutically effective amount of an oxytocin receptor antagonist.
8. A method of reducing uterine contractility in a subject undergoing an embryo transfer procedure in which one or more embryos are transferred to the uterus of the subject, the method comprising administering to the subject a therapeutically effective amount of an oxytocin receptor antagonist, wherein the subject has been determined to exhibit a decrease in expression of one or more of genes DPP4, CNTNAP3, CNTN4, CXCL12, and TNXB relative to a reference expression level of the one or more genes.
9. The method of any one of claims 1-8, wherein the method comprises transferring the one or more embryos to the uterus of the subject.
10. A method of determining whether a subject undergoing an embryo transfer procedure in which one or more embryos are transferred to the uterus of the subject is likely to benefit from administration of an oxytocin receptor antagonist, the method comprising monitoring the subject's expression of one or more of genes DPP4, CNTNAP3, CNTN4, CXCL12, and TNXB prior to administration of the oxytocin receptor antagonist to the subject, wherein a finding that the subject exhibits a decrease in expression of the one or more genes relative to a reference expression level of the one or more genes identifies the subject as likely to benefit from administration of the oxytocin receptor antagonist.
11. The method of claim 10, wherein the subject is determined to exhibit a decrease in expression of the one or more genes relative to a reference expression level of the one or more genes.
12. The method of claim 11, wherein the method further comprises advising the subject that they have been identified as likely to benefit from administration of the oxytocin receptor antagonist.
13. The method of claim 11 or 12, wherein the method further comprises administering to the subject a therapeutically effective amount of the oxytocin receptor antagonist.
14. The method of any one of claims 11-13, wherein the method further comprises transferring the one or more embryos to the uterus of the subject.
15. The method of any one of claims 1-14, wherein the subject is determined to exhibit a decrease in expression of two or more of genes DPP4, CNTNAP3, CNTN4, CXCL12, and TNXB relative to a reference expression level of the two or more genes.
16. The method of claim 15, wherein the subject is determined to exhibit a decrease in expression of three or more of genes DPP4, CNTNAP3, CNTN4, CXCL12, and TNXB relative to a reference expression level of the three or more genes.
17. The method of claim 16, wherein the subject is determined to exhibit a decrease in expression of four or more of genes DPP4, CNTNAP3, CNTN4, CXCL12, and TNXB relative to a reference expression level of the four or more genes.
18. The method of claim 17, wherein the subject is determined to exhibit a decrease in expression of all five of genes DPP4, CNTNAP3, CNTN4, CXCL12, and TNXB relative to a reference expression level of the genes.
19. The method of any one of claims 1-18, wherein the subject is determined to exhibit a decrease in expression of DPP4 relative to a reference expression level of DPP4.
20. The method of any one of claims 1-19, wherein the subject is determined to exhibit a decrease in expression of CNTNAP3 relative to a reference expression level of CNTNAP3.
21. The method of any one of claims 1-20, wherein the subject is determined to exhibit a decrease in expression of CNTN4 relative to a reference expression level of CNTN4.
22. The method of any one of claims 1-21, wherein the subject is determined to exhibit a decrease in expression of CXCL12 relative to a reference expression level of CXCL12.
23. The method of any one of claims 1-22, wherein the subject is determined to exhibit a decrease in expression of TNXB relative to a reference expression level of TNXB.
24. A method of treating a subject undergoing an embryo transfer procedure in which one or more embryos are transferred to the uterus of the subject, the method comprising: a) monitoring the subject's expression of one or more of genes Cathepsin E (CTSE), Olfactomedin 4 (OLFM4), Keratin 5 (KRT5), Keratin 6A (KRT6A), and Indoleamine 2,3-Dioxygenase 2 (IDO2), and, if the subject is determined to exhibit an increase in expression of the one or more genes relative to a reference expression level of the one or more genes, b) administering to the subject a therapeutically effective amount of an oxytocin receptor antagonist.
25. A method of treating a subject undergoing an embryo transfer procedure in which one or more embryos are transferred to the uterus of the subject, the method comprising administering to the subject a therapeutically effective amount of an oxytocin receptor antagonist, wherein the subject has been determined to exhibit an increase in expression of one or more of genes CTSE, OLFM4, KRT5, KRT6A, and IDO2 relative to a reference expression level of the one or more genes.
26. A method of reducing the likelihood of embryo implantation failure in a subject undergoing an embryo transfer procedure in which one or more embryos are transferred to the uterus of the subject, the method comprising: a) monitoring the subject's expression of one or more of genes CTSE, OLFM4, KRT5, KRT6A, and IDO2, and, if the subject is determined to exhibit an increase in expression of the one or more genes relative to a reference expression level of the one or more genes, b) administering to the subject a therapeutically effective amount of an oxytocin receptor antagonist.
27. A method of reducing the likelihood of embryo implantation failure in a subject undergoing an embryo transfer procedure in which one or more embryos are transferred to the uterus of the subject, the method comprising administering to the subject a therapeutically effective amount of an oxytocin receptor antagonist, wherein the subject has been determined to exhibit an increase in expression of one or more of genes CTSE, OLFM4, KRT5, KRT6A, and IDO2 relative to a reference expression level of the one or more genes.
28. A method of improving endometrial receptivity in a subject undergoing an embryo transfer procedure in which one or more embryos are transferred to the uterus of the subject, the method comprising: a) monitoring the subject's expression of one or more of genes CTSE, OLFM4, KRT5, KRT6A, and IDO2, and, if the subject is determined to exhibit an increase in expression of the one or more genes relative to a reference expression level of the one or more genes, b) administering to the subject a therapeutically effective amount of an oxytocin receptor antagonist.
29. A method of improving endometrial receptivity in a subject undergoing an embryo transfer procedure in which one or more embryos are transferred to the uterus of the subject, the method comprising administering to the subject a therapeutically effective amount of an oxytocin receptor antagonist, wherein the subject has been determined to exhibit an increase in expression of one or more of genes CTSE, OLFM4, KRT5, KRT6A, and IDO2 relative to a reference expression level of the one or more genes.
30. A method of reducing uterine contractility in a subject undergoing an embryo transfer procedure in which one or more embryos are transferred to the uterus of the subject, the method comprising: a) monitoring the subject's expression of one or more of genes CTSE, OLFM4, KRT5, KRT6A, and IDO2, and, if the subject is determined to exhibit an increase in expression of the one or more genes relative to a reference expression level of the one or more genes, b) administering to the subject a therapeutically effective amount of an oxytocin receptor antagonist.
31. A method of reducing uterine contractility in a subject undergoing an embryo transfer procedure in which one or more embryos are transferred to the uterus of the subject, the method comprising administering to the subject a therapeutically effective amount of an oxytocin receptor antagonist, wherein the subject has been determined to exhibit an increase in expression of one or more of genes CTSE, OLFM4, KRT5, KRT6A, and IDO2 relative to a reference expression level of the one or more genes.
32. The method of any one of claims 24-31, wherein the method comprises transferring the one or more embryos to the uterus of the subject.
33. A method of determining whether a subject undergoing an embryo transfer procedure in which one or more embryos are transferred to the uterus of the subject is likely to benefit from administration of an oxytocin receptor antagonist, the method comprising monitoring the subject's expression of one or more of genes CTSE, OLFM4, KRT5, KRT6A, and IDO2 prior to administration of the oxytocin receptor antagonist to the subject, wherein a finding that the subject exhibits an increase in expression of the one or more genes relative to a reference expression level of the one or more genes identifies the subject as likely to benefit from administration of the oxytocin receptor antagonist.
34. The method of claim 33, wherein the subject is determined to exhibit an increase in expression of the one or more genes relative to a reference expression level of the one or more genes.
35. The method of claim 34, wherein the method further comprises advising the subject that they have been identified as likely to benefit from administration of the oxytocin receptor antagonist.
36. The method of claim 34 or 35, wherein the method further comprises administering to the subject a therapeutically effective amount of the oxytocin receptor antagonist.
37. The method of any one of claims 34-36, wherein the method further comprises transferring the one or more embryos to the uterus of the subject.
38. The method of any one of claims 24-37, wherein the subject is determined to exhibit an increase in expression of two or more of genes CTSE, OLFM4, KRT5, KRT6A, and IDO2 relative to a reference expression level of the two or more genes.
39. The method of claim 38, wherein the subject is determined to exhibit an increase in expression of three or more of genes CTSE, OLFM4, KRT5, KRT6A, and IDO2 relative to a reference expression level of the three or more genes.
40. The method of claim 39, wherein the subject is determined to exhibit an increase in expression of four or more of genes CTSE, OLFM4, KRT5, KRT6A, and IDO2 relative to a reference expression level of the four or more genes.
41. The method of claim 40, wherein the subject is determined to exhibit an increase in expression of all five of genes CTSE, OLFM4, KRT5, KRT6A, and IDO2 relative to a reference expression level of the genes.
42. The method of any one of claims 24-41, wherein the subject is determined to exhibit an increase in expression of CTSE relative to a reference expression level of CTSE.
43. The method of any one of claims 24-42, wherein the subject is determined to exhibit an increase in expression of OLFM4 relative to a reference expression level of OLFM4.
44. The method of any one of claims 24-43, wherein the subject is determined to exhibit an increase in expression of KRT5 relative to a reference expression level of KRT5.
45. The method of any one of claims 24-44, wherein the subject is determined to exhibit an increase in expression of KRT6A relative to a reference expression level of KRT6A.
46. The method of any one of claims 24-45, wherein the subject is determined to exhibit an increase in expression of IDO2 relative to a reference expression level of IDO2.
47. The method of any one of claims 1-46, wherein the subject's expression of the one or more genes is determined by analyzing an endometrial tissue sample obtained from the subject.
48. The method of any one of claims 1-47, wherein the subject's expression of the one or more genes is determined one or more hours prior to administration of the oxytocin receptor antagonist to the subject, optionally wherein the subject's expression of the one or more genes is determined from about 1 hour to about 24 hours prior to administration of the oxytocin receptor antagonist to the subject.
49. The method of any one of claims 1-47, wherein the subject's expression of the one or more genes is determined one or more days prior to administration of the oxytocin receptor antagonist to the subject, optionally wherein the subject's expression of the one or more genes is determined from about 1 day to about 7 days prior to administration of the oxytocin receptor antagonist to the subject.
50. The method of any one of claims 1-47, wherein the subject's expression of the one or more genes is determined one or more weeks prior to administration of the oxytocin receptor antagonist to the subject, optionally wherein the subject's expression of the one or more genes is determined from about 1 week to about 12 weeks prior to administration of the oxytocin receptor antagonist to the subject.
51. The method of any one of claims 1-47, wherein the subject's expression of the one or more genes is determined within about 24 hours of retrieving one or more oocytes (e.g., mature oocytes) from the subject.
52. The method of any one of claims 1-47, wherein the subject's expression of the one or more genes is determined within about 24 hours of commencement of a luteal phase support regimen, optionally wherein the luteal phase support regimen comprises periodically administering progesterone to the subject.
53. The method of any one of claims 1-47, wherein the subject's expression of the one or more genes is determined within about 24 hours of inducing final follicular maturation in the subject, optionally wherein the inducing of final follicular maturation comprises administering human chorionic gonadotropin (hCG) to the subject.
54. A method of treating a subject undergoing an embryo transfer procedure, the method comprising: a) administering to the subject an oxytocin receptor antagonist, b) monitoring the subject's expression of one or more of genes DPP4, CNTNAP3, CNTN4, CXCL12, and TNXB after administration of the oxytocin receptor antagonist to the subject, and, if the subject is determined to exhibit an increase in expression of the one or more genes after administration of the oxytocin receptor antagonist relative to a measurement of the subject's expression of the one or more genes obtained prior to administration of the oxytocin receptor antagonist, c) transferring one or more embryos to the uterus of the subject.
55. The method of claim 54, wherein the method comprises re-administering the oxytocin receptor antagonist to the subject, optionally at an elevated dosage, if, in (b), the subject is not determined to exhibit an increase in expression of the one or more genes after administration of the oxytocin receptor antagonist relative to a measurement of the subject's expression of the one or more genes obtained prior to administration of the oxytocin receptor antagonist.
56. The method of claim 55, wherein the method comprises transferring one or more embryos to the uterus of the subject following re-administration of the oxytocin receptor antagonist to the subject.
57. A method of treating a subject undergoing an embryo transfer procedure, the method comprising transferring one or more embryos to the uterus of the subject, wherein the subject has previously been administered an oxytocin receptor antagonist, and, following administration of the oxytocin receptor antagonist, the subject has been determined to exhibit an increase in expression of one or more of genes DPP4, CNTNAP3, CNTN4, CXCL12, TNXB relative to a measurement of the subject's expression of the one or more genes obtained prior to administration of the oxytocin receptor antagonist.
58. A method of reducing the likelihood of embryo implantation failure in a subject undergoing an embryo transfer procedure, the method comprising: a) administering to the subject an oxytocin receptor antagonist, b) monitoring the subject's expression of one or more of genes DPP4, CNTNAP3, CNTN4, CXCL12, and TNXB after administration of the oxytocin receptor antagonist to the subject, and, if the subject is determined to exhibit an increase in expression of the one or more genes after administration of the oxytocin receptor antagonist relative to a measurement of the subject's expression of the one or more genes obtained prior to administration of the oxytocin receptor antagonist, c) transferring one or more embryos to the uterus of the subject.
59. The method of claim 58, wherein the method comprises re-administering the oxytocin receptor antagonist to the subject, optionally at an elevated dosage, if, in (b), the subject is not determined to exhibit an increase in expression of the one or more genes after administration of the oxytocin receptor antagonist relative to a measurement of the subject's expression of the one or more genes obtained prior to administration of the oxytocin receptor antagonist.
60. The method of claim 59, wherein the method comprises transferring one or more embryos to the uterus of the subject following re-administration of the oxytocin receptor antagonist to the subject.
61. A method of reducing the likelihood of embryo implantation failure in a subject undergoing an embryo transfer procedure, the method comprising transferring one or more embryos to the uterus of the subject, wherein the subject has previously been administered an oxytocin receptor antagonist, and, following administration of the oxytocin receptor antagonist, the subject has been determined to exhibit an increase in expression of one or more of genes DPP4, CNTNAP3, CNTN4, CXCL12, TNXB relative to a measurement of the subject's expression of the one or more genes obtained prior to administration of the oxytocin receptor antagonist.
62. A method of improving endometrial receptivity in a subject undergoing an embryo transfer procedure, the method comprising: a) administering to the subject an oxytocin receptor antagonist, b) monitoring the subject's expression of one or more of genes DPP4, CNTNAP3, CNTN4, CXCL12, and TNXB after administration of the oxytocin receptor antagonist to the subject, and, if the subject is determined to exhibit an increase in expression of the one or more genes after administration of the oxytocin receptor antagonist relative to a measurement of the subject's expression of the one or more genes obtained prior to administration of the oxytocin receptor antagonist, c) transferring one or more embryos to the uterus of the subject.
63. The method of claim 62, wherein the method comprises re-administering the oxytocin receptor antagonist to the subject, optionally at an elevated dosage, if, in (b), the subject is not determined to exhibit an increase in expression of the one or more genes after administration of the oxytocin receptor antagonist relative to a measurement of the subject's expression of the one or more genes obtained prior to administration of the oxytocin receptor antagonist.
64. The method of claim 63, wherein the method comprises transferring one or more embryos to the uterus of the subject following re-administration of the oxytocin receptor antagonist to the subject.
65. A method of improving endometrial receptivity in a subject undergoing an embryo transfer procedure, the method comprising transferring one or more embryos to the uterus of the subject, wherein the subject has previously been administered an oxytocin receptor antagonist, and, following administration of the oxytocin receptor antagonist, the subject has been determined to exhibit an increase in expression of one or more of genes DPP4, CNTNAP3, CNTN4, CXCL12, TNXB relative to a measurement of the subject's expression of the one or more genes obtained prior to administration of the oxytocin receptor antagonist.
66. A method of reducing uterine contractility in a subject undergoing an embryo transfer procedure, the method comprising: a) administering to the subject an oxytocin receptor antagonist, b) monitoring the subject's expression of one or more of genes DPP4, CNTNAP3, CNTN4, CXCL12, and TNXB after administration of the oxytocin receptor antagonist to the subject, and, if the subject is determined to exhibit an increase in expression of the one or more genes after administration of the oxytocin receptor antagonist relative to a measurement of the subject's expression of the one or more genes obtained prior to administration of the oxytocin receptor antagonist, c) transferring one or more embryos to the uterus of the subject.
67. The method of claim 66, wherein the method comprises re-administering the oxytocin receptor antagonist to the subject, optionally at an elevated dosage, if, in (b), the subject is not determined to exhibit an increase in expression of the one or more genes after administration of the oxytocin receptor antagonist relative to a measurement of the subject's expression of the one or more genes obtained prior to administration of the oxytocin receptor antagonist.
68. The method of claim 67, wherein the method comprises transferring one or more embryos to the uterus of the subject following re-administration of the oxytocin receptor antagonist to the subject.
69. A method of reducing uterine contractility in a subject undergoing an embryo transfer procedure, the method comprising transferring one or more embryos to the uterus of the subject, wherein the subject has previously been administered an oxytocin receptor antagonist, and, following administration of the oxytocin receptor antagonist, the subject has been determined to exhibit an increase in expression of one or more of genes DPP4, CNTNAP3, CNTN4, CXCL12, TNXB relative to a measurement of the subject's expression of the one or more genes obtained prior to administration of the oxytocin receptor antagonist.
70. The method of any one of claims 54-69, wherein the subject is determined to exhibit an increase in expression of two or more of genes DPP4, CNTNAP3, CNTN4, CXCL12, and TNXB relative to a measurement of the subject's expression of the two or more genes obtained prior to administration of the oxytocin receptor antagonist.
71. The method of claim 70, wherein the subject is determined to exhibit an increase in expression of three or more of genes DPP4, CNTNAP3, CNTN4, CXCL12, and TNXB relative to a measurement of the subject's expression of the three or more genes obtained prior to administration of the oxytocin receptor antagonist.
72. The method of claim 71, wherein the subject is determined to exhibit an increase in expression of four or more of genes DPP4, CNTNAP3, CNTN4, CXCL12, and TNXB relative to a measurement of the subject's expression of the four or more genes obtained prior to administration of the oxytocin receptor antagonist.
73. The method of claim 72, wherein the subject is determined to exhibit an increase in expression of all five of genes DPP4, CNTNAP3, CNTN4, CXCL12, and TNXB relative to a measurement of the subject's expression of the genes obtained prior to administration of the oxytocin receptor antagonist.
74. The method of any one of claims 54-73, wherein the subject is determined to exhibit an increase in expression of DPP4 relative to a measurement of the subject's expression of DPP4 obtained prior to administration of the oxytocin receptor antagonist.
75. The method of any one of claims 54-74, wherein the subject is determined to exhibit an increase in expression of CNTNAP3 relative to a measurement of the subject's expression of CNTNAP3 obtained prior to administration of the oxytocin receptor antagonist.
76. The method of any one of claims 54-75, wherein the subject is determined to exhibit an increase in expression of CNTN4 relative to a measurement of the subject's expression of CNTN4 obtained prior to administration of the oxytocin receptor antagonist.
77. The method of any one of claims 54-76, wherein the subject is determined to exhibit an increase in expression of CXCL12 relative to a measurement of the subject's expression of CXCL12 obtained prior to administration of the oxytocin receptor antagonist.
78. The method of any one of claims 54-77, wherein the subject is determined to exhibit an increase in expression of TNXB relative to a measurement of the subject's expression of TNXB obtained prior to administration of the oxytocin receptor antagonist.
79. A method of treating a subject undergoing an embryo transfer procedure, the method comprising: a) administering to the subject an oxytocin receptor antagonist, b) monitoring the subject's expression of one or more of genes CTSE, OLFM4, KRT5, KRT6A, and IDO2 after administration of the oxytocin receptor antagonist to the subject, and, if the subject is determined to exhibit a decrease in expression of the one or more genes after administration of the oxytocin receptor antagonist relative to a measurement of the subject's expression of the one or more genes obtained prior to administration of the oxytocin receptor antagonist, c) transferring one or more embryos to the uterus of the subject.
80. The method of claim 79, wherein the method comprises re-administering the oxytocin receptor antagonist to the subject, optionally at an elevated dosage, if, in (b), the subject is not determined to exhibit a decrease in expression of the one or more genes after administration of the oxytocin receptor antagonist relative to a measurement of the subject's expression of the one or more genes obtained prior to administration of the oxytocin receptor antagonist.
81. The method of claim 80, wherein the method comprises transferring one or more embryos to the uterus of the subject following re-administration of the oxytocin receptor antagonist to the subject.
82. A method of treating a subject undergoing an embryo transfer procedure, the method comprising transferring one or more embryos to the uterus of the subject, wherein the subject has previously been administered an oxytocin receptor antagonist, and, following administration of the oxytocin receptor antagonist, the subject has been determined to exhibit a decrease in expression of one or more of genes CTSE, OLFM4, KRT5, KRT6A, and IDO2 relative to a measurement of the subject's expression of the one or more genes obtained prior to administration of the oxytocin receptor antagonist.
83. A method of reducing the likelihood of embryo implantation failure in a subject undergoing an embryo transfer procedure, the method comprising: a) administering to the subject an oxytocin receptor antagonist, b) monitoring the subject's expression of one or more of genes CTSE, OLFM4, KRT5, KRT6A, and IDO2 after administration of the oxytocin receptor antagonist to the subject, and, if the subject is determined to exhibit a decrease in expression of the one or more genes after administration of the oxytocin receptor antagonist relative to a measurement of the subject's expression of the one or more genes obtained prior to administration of the oxytocin receptor antagonist, c) transferring one or more embryos to the uterus of the subject.
84. The method of claim 83, wherein the method comprises re-administering the oxytocin receptor antagonist to the subject, optionally at an elevated dosage, if, in (b), the subject is not determined to exhibit a decrease in expression of the one or more genes after administration of the oxytocin receptor antagonist relative to a measurement of the subject's expression of the one or more genes obtained prior to administration of the oxytocin receptor antagonist.
85. The method of claim 84, wherein the method comprises transferring one or more embryos to the uterus of the subject following re-administration of the oxytocin receptor antagonist to the subject.
86. A method of reducing the likelihood of embryo implantation failure in a subject undergoing an embryo transfer procedure, the method comprising transferring one or more embryos to the uterus of the subject, wherein the subject has previously been administered an oxytocin receptor antagonist, and, following administration of the oxytocin receptor antagonist, the subject has been determined to exhibit a decrease in expression of one or more of genes CTSE, OLFM4, KRT5, KRT6A, and IDO2 relative to a measurement of the subject's expression of the one or more genes obtained prior to administration of the oxytocin receptor antagonist.
87. A method of improving endometrial receptivity in a subject undergoing an embryo transfer procedure, the method comprising: a) administering to the subject an oxytocin receptor antagonist, b) monitoring the subject's expression of one or more of genes CTSE, OLFM4, KRT5, KRT6A, and IDO2 after administration of the oxytocin receptor antagonist to the subject, and, if the subject is determined to exhibit a decrease in expression of the one or more genes after administration of the oxytocin receptor antagonist relative to a measurement of the subject's expression of the one or more genes obtained prior to administration of the oxytocin receptor antagonist, c) transferring one or more embryos to the uterus of the subject.
88. The method of claim 87, wherein the method comprises re-administering the oxytocin receptor antagonist to the subject, optionally at an elevated dosage, if, in (b), the subject is not determined to exhibit a decrease in expression of the one or more genes after administration of the oxytocin receptor antagonist relative to a measurement of the subject's expression of the one or more genes obtained prior to administration of the oxytocin receptor antagonist.
89. The method of claim 88, wherein the method comprises transferring one or more embryos to the uterus of the subject following re-administration of the oxytocin receptor antagonist to the subject.
90. A method of improving endometrial receptivity in a subject undergoing an embryo transfer procedure, the method comprising transferring one or more embryos to the uterus of the subject, wherein the subject has previously been administered an oxytocin receptor antagonist, and, following administration of the oxytocin receptor antagonist, the subject has been determined to exhibit a decrease in expression of one or more of genes CTSE, OLFM4, KRT5, KRT6A, and IDO2 relative to a measurement of the subject's expression of the one or more genes obtained prior to administration of the oxytocin receptor antagonist.
91. A method of reducing uterine contractility in a subject undergoing an embryo transfer procedure, the method comprising: a) administering to the subject an oxytocin receptor antagonist, b) monitoring the subject's expression of one or more of genes CTSE, OLFM4, KRT5, KRT6A, and IDO2 after administration of the oxytocin receptor antagonist to the subject, and, if the subject is determined to exhibit a decrease in expression of the one or more genes after administration of the oxytocin receptor antagonist relative to a measurement of the subject's expression of the one or more genes obtained prior to administration of the oxytocin receptor antagonist, c) transferring one or more embryos to the uterus of the subject.
92. The method of claim 91, wherein the method comprises re-administering the oxytocin receptor antagonist to the subject, optionally at an elevated dosage, if, in (b), the subject is not determined to exhibit a decrease in expression of the one or more genes after administration of the oxytocin receptor antagonist relative to a measurement of the subject's expression of the one or more genes obtained prior to administration of the oxytocin receptor antagonist.
93. The method of claim 92, wherein the method comprises transferring one or more embryos to the uterus of the subject following re-administration of the oxytocin receptor antagonist to the subject.
94. A method of reducing uterine contractility in a subject undergoing an embryo transfer procedure, the method comprising transferring one or more embryos to the uterus of the subject, wherein the subject has previously been administered an oxytocin receptor antagonist, and, following administration of the oxytocin receptor antagonist, the subject has been determined to exhibit a decrease in expression of one or more of genes CTSE, OLFM4, KRT5, KRT6A, and IDO2 relative to a measurement of the subject's expression of the one or more genes obtained prior to administration of the oxytocin receptor antagonist.
95. The method of any one of claims 79-94, wherein the subject is determined to exhibit a decrease in expression of two or more of genes CTSE, OLFM4, KRT5, KRT6A, and IDO2 relative to a measurement of the subject's expression of the two or more genes obtained prior to administration of the oxytocin receptor antagonist.
96. The method of claim 95, wherein the subject is determined to exhibit a decrease in expression of three or more of genes CTSE, OLFM4, KRT5, KRT6A, and IDO2 relative to a measurement of the subject's expression of the three or more genes obtained prior to administration of the oxytocin receptor antagonist.
97. The method of claim 96, wherein the subject is determined to exhibit a decrease in expression of four or more of genes CTSE, OLFM4, KRT5, KRT6A, and IDO2 relative to a measurement of the subject's expression of the four or more genes obtained prior to administration of the oxytocin receptor antagonist.
98. The method of claim 97, wherein the subject is determined to exhibit a decrease in expression of all five of genes CTSE, OLFM4, KRT5, KRT6A, and IDO2 relative to a measurement of the subject's expression of the genes obtained prior to administration of the oxytocin receptor antagonist.
99. The method of any one of claims 79-98, wherein the subject is determined to exhibit a decrease in expression of CTSE relative to a measurement of the subject's expression of CTSE obtained prior to administration of the oxytocin receptor antagonist.
100. The method of any one of claims 79-99, wherein the subject is determined to exhibit a decrease in expression of OLFM4 relative to a measurement of the subject's expression of OLFM4 obtained prior to administration of the oxytocin receptor antagonist.
101. The method of any one of claims 79-100, wherein the subject is determined to exhibit a decrease in expression of KRT5 relative to a measurement of the subject's expression of KRT5 obtained prior to administration of the oxytocin receptor antagonist.
102. The method of any one of claims 79-101, wherein the subject is determined to exhibit a decrease in expression of KRT6A relative to a measurement of the subject's expression of KRT6A obtained prior to administration of the oxytocin receptor antagonist.
103. The method of any one of claims 79-102, wherein the subject is determined to exhibit a decrease in expression of IDO2 relative to a measurement of the subject's expression of IDO2 obtained prior to administration of the oxytocin receptor antagonist.
104. The method of any one of claims 1-103, wherein the oxytocin receptor antagonist is administered to the subject from about 1 hour to about 24 hours prior to the transfer of the one or more embryos to the subject.
105. The method of claim 104, wherein the compound is administered to the subject from about 1 hour to about 8 hours prior to the transfer of the one or more embryos to the subject.
106. The method of claim 105, wherein the compound is administered to the subject from about 3 hours to about 5 hours prior to the transfer of the one or more embryos to the subject.
107. The method of claim 106, wherein the compound is administered to the subject about 4 hours prior to the transfer of the one or more embryos to the subject.
108. The method of any one of claims 1-107, wherein the oxytocin receptor antagonist is administered to the subject in a single dose.
109. The method of any one of claims 1-108, wherein the oxytocin receptor antagonist is administered to the subject in multiple doses.
110. The method of claim 109, wherein the oxytocin receptor antagonist is administered to the subject in from 1 to 20 doses per day prior to the transfer of the one or more embryos to the subject.
111. The method of claim 110, wherein the oxytocin receptor antagonist is administered to the subject in from 1 to 7 doses per day prior to the transfer of the one or more embryos to the subject.
112. The method of any one of claims 109-111, wherein the oxytocin receptor antagonist is administered to the subject once daily for from about 1 day to about 14 days prior to the transfer of the one or more embryos to the subject.
113. The method of claim 112, wherein the oxytocin receptor antagonist is administered to the subject once daily for from about 3 days to about 11 days prior to the transfer of the one or more embryos to the subject.
114. The method of claim 113, wherein the oxytocin receptor antagonist is administered to the subject once daily for 7 days prior to the transfer of the one or more embryos to the subject.
115. The method of any one of claims 109-114, wherein the oxytocin receptor antagonist is additionally administered to the subject concurrently with the transfer of the one or more embryos to the subject.
116. The method of any one of claims 109-115, wherein the oxytocin receptor antagonist is additionally administered to the subject following the transfer of the one or more embryos to the subject.
117. The method of claim 116, wherein the oxytocin receptor antagonist is additionally administered to the subject from about 1 hour to about 24 hours following the transfer of the one or more embryos to the subject.
118. The method of claim 116 or 117, wherein the oxytocin receptor antagonist is additionally administered to the subject in from 1 to 20 doses per day following the transfer of the one or more embryos to the subject.
119. The method of claim 118, wherein the oxytocin receptor antagonist is additionally administered to the subject in from 1 to 7 doses per day following the transfer of the one or more embryos to the subject.
120. The method of any one of claims 116-119, wherein the compound is additionally administered to the subject once daily for from about 1 day to about 14 days following the transfer of the one or more embryos to the subject.
121. The method of claim 120, wherein the compound is additionally administered to the subject once daily for from about 3 days to about 11 days following the transfer of the one or more embryos to the subject.
122. The method of claim 121, wherein the compound is additionally administered to the subject once daily for 7 days following the transfer of the one or more embryos to the subject.
123. The method of any one of claims 1-122, wherein from 1 to 2 embryos are transferred to the subject.
124. The method of claim 123, wherein 1 embryo is transferred to the subject.
125. The method of claim 123, wherein 2 embryos are transferred to the subject.
126. The method of any one of claims 1-125, wherein the subject is a mammal and the one or more embryos are mammalian embryos.
127. The method of claim 126, wherein the mammal is a human and the one or more mammalian embryos are human embryos.
128. The method of any one of claims 1-127, wherein the one or more embryos are produced ex vivo by in vitro fertilization (IVF).
129. The method of claim 128, wherein the one or more embryos are produced ex vivo by IVF of one or more ova derived from the subject.
130. The method of any one of claims 1-127, wherein the one or more embryos are produced ex vivo by intracytoplasmic sperm injection (ICSI).
131. The method of claim 130, wherein the one or more embryos are produced ex vivo by ICSI into one or more ova derived from the subject.
132. The method of claim 129 or 131, wherein the one or more ova are derived from one or more oocytes isolated from the subject.
133. The method of claim 132, wherein the one or more oocytes are isolated from the subject from about 1 day to about 7 days prior to the transfer of the one or more embryos to the subject.
134. The method of claim 133, wherein the one or more oocytes are isolated from the subject about 2 days prior to the transfer of the one or more embryos to the subject.
135. The method of claim 133, wherein the one or more oocytes are isolated from the subject about 3 days prior to the transfer of the one or more embryos to the subject.
136. The method of claim 133, wherein the one or more oocytes are isolated from the subject about 4 days prior to the transfer of the one or more embryos to the subject.
137. The method of claim 133, wherein the one or more oocytes are isolated from the subject about 5 days prior to the transfer of the one or more embryos to the subject.
138. The method of any one of claims 132-137, wherein the one or more oocytes comprise from 1 to 4 mature oocytes.
139. The method of any one of claims 132-138, wherein a gonadotropin-releasing hormone (GnRH) antagonist is administered to the subject prior to isolation of the one or more oocytes from the subject.
140. The method of any one of claims 132-139, wherein hCG is administered to the subject prior to isolation of the one or more oocytes from the subject.
141. The method of claim 140, wherein the hCG is administered to the subject by a single intravenous injection.
142. The method of any one of claims 132-141, wherein progesterone is administered to the subject following isolation of the one or more oocytes from the subject.
143. The method of claim 142, wherein the progesterone is administered intravaginally.
144. The method of claim 142 or 143, wherein from about 300 mg to about 600 mg of progesterone per dose is administered to the subject.
145. The method of any one of claims 142-144, wherein the progesterone is administered to the subject daily, preferably beginning within about 24 hours of isolation of the one or more oocytes from the subject and continuing for about 6 or more weeks following the transfer of the one or more embryos to the subject.
146. The method of claim 129 or 131, wherein the one or more ova are isolated directly from the subject.
147. The method of claim 146, wherein the one or more ova are isolated from the subject from about 1 day to about 7 days prior to the transfer of the one or more embryos to the subject.
148. The method of claim 147, wherein the one or more ova are isolated from the subject about 2 days prior to the transfer of the one or more embryos to the subject.
149. The method of claim 147, wherein the one or more ova are isolated from the subject about 3 days prior to the transfer of the one or more embryos to the subject.
150. The method of claim 147, wherein the one or more ova are isolated from the subject about 4 days prior to the transfer of the one or more embryos to the subject.
151. The method of claim 147, wherein the one or more ova are isolated from the subject about 5 days prior to the transfer of the one or more embryos to the subject.
152. The method of any one of claims 146-151, wherein a GnRH antagonist is administered to the subject prior to isolation of the one or more ova from the subject.
153. The method of any one of claims 146-152, wherein hCG is administered to the subject prior to isolation of the one or more ova from the subject.
154. The method of claim 153, wherein the hCG is administered to the subject by a single intravenous injection.
155. The method of any one of claims 146-154, wherein progesterone is administered to the subject following isolation of the one or more ova from the subject.
156. The method of claim 155, wherein the progesterone is administered intravaginally.
157. The method of claim 155 or 156, wherein from about 300 mg to about 600 mg of progesterone per dose is administered to the subject.
158. The method of any one of claims 155-157, wherein the progesterone is administered to the subject daily, preferably beginning within about 24 hours of isolation of the one or more ova from the subject and continuing for about 6 or more weeks following the transfer of the one or more embryos to the subject.
159. The method of any one of claims 132-145, wherein the one or more embryos are transferred to the subject during the same menstrual cycle as isolation of the one or more oocytes from the subject.
160. The method of any one of claims 146-158, wherein the one or more embryos are transferred to the subject during the same menstrual cycle as isolation of the one or more ova from the subject.
161. The method of any one of claims 1-160, wherein the one or more embryos are frozen and thawed prior to the transfer of the one or more embryos to the subject.
162. The method of any one of claims 1-161, wherein the one or more embryos each comprise from 6 to 8 blastomeres immediately prior to the transfer of the one or more embryos to the subject.
163. The method of claim 162, wherein the blastomeres are of approximately equal sizes as assessed by visual microscopy.
164. The method of any one of claims 1-163, wherein the oxytocin receptor antagonist is a compound represented by formula (I) ##STR00021## or a geometric isomer, enantiomer, diastereomer, racemate, or salt thereof, wherein n is an integer from 1 to 3; R.sup.1 is selected from the group consisting of hydrogen and C.sub.1-C.sub.6 alkyl; R.sup.2 is selected from the group consisting of hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkyl aryl, heteroaryl, C.sub.1-C.sub.6 alkyl heteroaryl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkenyl aryl, C.sub.2-C.sub.6 alkenyl heteroaryl, C.sub.2-C.sub.6 alkynyl, C.sub.2-C.sub.6 alkynyl aryl, C.sub.2-C.sub.6 alkynyl heteroaryl, C.sub.3-C.sub.6 cycloalkyl, heterocycloalkyl, C.sub.1-C.sub.6 alkyl cycloalkyl, C.sub.1-C.sub.6 alkyl heterocycloalkyl, C.sub.1-C.sub.6 alkyl carboxy, acyl, C.sub.1-C.sub.6 alkyl acyl, C.sub.1-C.sub.6 alkyl acyloxy, C.sub.1-C.sub.6 alkyl alkoxy, alkoxycarbonyl, C.sub.1-C.sub.6 alkyl alkoxycarbonyl, aminocarbonyl, C.sub.1-C.sub.6 alkyl aminocarbonyl, C.sub.1-C.sub.6 alkyl acylamino, C.sub.1-C.sub.6 alkyl ureido, amino, C.sub.1-C.sub.6 alkyl amino, sulfonyloxy, C.sub.1-C.sub.6 alkyl sulfonyloxy, sulfonyl, C.sub.1-C.sub.6 alkyl sulfonyl, sulfinyl, C.sub.1-C.sub.6 alkyl sulfinyl, C.sub.1-C.sub.6 alkyl sulfanyl, and C.sub.1-C.sub.6 alkyl sulfonylamino; R.sup.3 is selected from the group consisting of aryl and heteroaryl; X is selected from the group consisting of oxygen and NR.sup.4; and R.sup.4 is selected from the group consisting of hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkyl aryl, C.sub.1-C.sub.6 alkyl heteroaryl, aryl, and heteroaryl, wherein R.sup.2 and R.sup.4, together with the nitrogen to which they are bound, can form a 5-8 membered saturated or unsaturated heterocycloalkyl ring.
165. The method of claim 164, wherein the compound is represented by formula (II) ##STR00022##
166. The method of claim 164 or 165, wherein the compound is administered to the subject in an amount of from about 700 mg to about 1,100 mg per dose, optionally wherein the compound is administered to the subject in a single dose of from about 700 mg to about 1,100 mg.
167. The method of claim 166, wherein the compound is administered to the subject in an amount of from about 750 mg to about 1,050 mg per dose, optionally wherein the compound is administered to the subject in a single dose of from about 750 mg to about 1,050 mg.
168. The method of claim 167, wherein the compound is administered to the subject in an amount of from about 800 mg to about 1,000 mg per dose, optionally wherein the compound is administered to the subject in a single dose of from about 800 mg to about 1,000 mg.
169. The method of claim 168, wherein the compound is administered to the subject in an amount of from about 850 mg to about 950 mg per dose, optionally wherein the compound is administered to the subject in a single dose of from about 850 mg to about 950 mg.
170. The method of claim 169, wherein the compound is administered to the subject in an amount of about 900 mg per dose, optionally wherein the compound is administered to the subject in a single dose of about 900 mg.
171. The method of any one of claims 164-170, wherein the compound is administered to the subject in one or more doses totaling from about 700 mg to about 1,100 mg.
172. The method of claim 171, wherein the compound is administered to the subject in one or more doses totaling from about 750 mg to about 1,050 mg.
173. The method of claim 172, wherein the compound is administered to the subject in one or more doses totaling from about 800 mg to about 1,000 mg.
174. The method of claim 173, wherein the compound is administered to the subject in one or more doses totaling from about 850 mg to about 950 mg.
175. The method of claim 174, wherein the compound is administered to the subject in one or more doses totaling about 900 mg.
176. The method of claim 164 or 165, wherein the compound is administered to the subject in an amount of from about 1,600 mg to about 2,000 mg per dose, optionally wherein the compound is administered to the subject in a single dose of from about 1,600 mg to about 2,000 mg.
177. The method of claim 176, wherein the compound is administered to the subject in an amount of from about 1,650 mg to about 1,950 mg per dose, optionally wherein the compound is administered to the subject in a single dose of from about 1,650 mg to about 1,950 mg.
178. The method of claim 177, wherein the compound is administered to the subject in an amount of from about 1,700 mg to about 1,900 mg per dose, optionally wherein the compound is administered to the subject in a single dose of from about 1,700 mg to about 1,900 mg.
179. The method of claim 178, wherein the compound is administered to the subject in an amount of from about 1,750 mg to about 1,850 mg per dose, optionally wherein the compound is administered to the subject in a single dose of from about 1,750 mg to about 1,850 mg.
180. The method of claim 179, wherein the compound is administered to the subject in an amount of about 1,800 mg per dose, optionally wherein the compound is administered to the subject in a single dose of about 1,800 mg.
181. The method of any one of claims 164, 165, and 176-180, wherein the compound is administered to the subject in one or more doses totaling from about 1,600 mg to about 2,000 mg.
182. The method of claim 181, wherein the compound is administered to the subject in one or more doses totaling from about 1,650 mg to about 1,950 mg.
183. The method of claim 182, wherein the compound is administered to the subject in one or more doses totaling from about 1,700 mg to about 1,900 mg.
184. The method of claim 183, wherein the compound is administered to the subject in one or more doses totaling from about 1,750 mg to about 1,850 mg.
185. The method of claim 184, wherein the compound is administered to the subject in one or more doses totaling about 1,800 mg.
186. The method of any one of claims 1-163, wherein the oxytocin receptor antagonist is barusiban, atosiban, epelsiban, or retosiban.
187. The method of any one of claims 1-186, wherein the subject has been determined to exhibit a serum progesterone (P4) concentration of less than 320 nM prior to the transfer of the one or more embryos to the subject, optionally wherein the subject has been determined to exhibit a serum P4 concentration of less than about 320 nM within 24 hours prior to the transfer of the one or more embryos to the subject.
188. The method of claim 187, wherein the subject has been determined to exhibit a serum P4 concentration of from 200 nM to 300 nM prior to the transfer of the one or more embryos to the subject, optionally wherein the subject has been determined to exhibit a serum P4 concentration of from about 200 nM to about 300 nM within 24 hours prior to the transfer of the one or more embryos to the subject.
189. The method of any one of claims 1-188, wherein the subject has been determined to exhibit a serum P4 concentration of less than 2.0 ng/ml (e.g., a serum P4 concentration of 1.54 ng/ml or less) prior to the transfer of the one or more embryos to the subject, optionally wherein the subject has been determined to exhibit a serum P4 concentration of less than 2.0 ng/ml from about 1 day to about 7 days prior to the transfer of the one or more embryos to the subject.
190. The method of claim 189, wherein the subject has been determined to exhibit a serum P4 concentration of less than 2.0 ng/ml (e.g., a serum P4 concentration of 1.54 ng/ml or less) about 2 days prior to the transfer of the one or more embryos to the subject.
191. The method of claim 189, wherein the subject has been determined to exhibit a serum P4 concentration of less than 2.0 ng/ml (e.g., a serum P4 concentration of 1.54 ng/ml or less) about 3 days prior to the transfer of the one or more embryos to the subject.
192. The method of claim 189, wherein the subject has been determined to exhibit a serum P4 concentration of less than 2.0 ng/ml (e.g., a serum P4 concentration of 1.54 ng/ml or less) about 4 days prior to the transfer of the one or more embryos to the subject.
193. The method of claim 189, wherein the subject has been determined to exhibit a serum P4 concentration of less than 2.0 ng/ml (e.g., a serum P4 concentration of 1.54 ng/ml or less) about 5 days prior to the transfer of the one or more embryos to the subject.
194. The method of any one of claims 189-193, wherein the subject has been determined to exhibit the serum P4 concentration on the day of isolation of one or more oocytes or ova from the subject.
195. The method of any one of claims 189-194, wherein the subject has been determined to exhibit the serum P4 concentration within about 48 hours of administering hCG to the subject (e.g., so as to induce final follicular maturation).
196. The method of claim 189, wherein the subject has been determined to exhibit a serum P4 concentration of less than 1.5 ng/ml prior to the transfer of the one or more embryos to the subject, optionally wherein the subject has been determined to exhibit a serum P4 concentration of less than 1.5 ng/ml from about 1 day to about 7 days prior to the transfer of the one or more embryos to the subject.
197. The method of claim 196, wherein the subject has been determined to exhibit a serum P4 concentration of less than 1.5 ng/ml about 2 days prior to the transfer of the one or more embryos to the subject.
198. The method of claim 196, wherein the subject has been determined to exhibit a serum P4 concentration of less than 1.5 ng/ml about 3 days prior to the transfer of the one or more embryos to the subject.
199. The method of claim 196, wherein the subject has been determined to exhibit a serum P4 concentration of less than 1.5 ng/ml about 4 days prior to the transfer of the one or more embryos to the subject.
200. The method of claim 196, wherein the subject has been determined to exhibit a serum P4 concentration of less than 1.5 ng/ml about 5 days prior to the transfer of the one or more embryos to the subject.
201. The method of any one of claims 196-200, wherein the subject has been determined to exhibit the serum P4 concentration on the day of isolation of one or more oocytes or ova from the subject.
202. The method of any one of claims 196-201, wherein the subject has been determined to exhibit the serum P4 concentration within about 48 hours of administering hCG to the subject.
203. The method of any one of claims 1-202, wherein the subject exhibits an increase in endometrial prostaglandin F2α (PGF2α) expression following administration of the oxytocin receptor antagonist to the subject.
204. The method of any one of claims 1-203, wherein the subject exhibits a reduction in PGF2α signaling following administration of the oxytocin receptor antagonist to the subject.
205. The method of any one of claims 1-204, wherein the subject exhibits an increase in endometrial prostaglandin E2 (PGE2) expression following administration of the oxytocin receptor antagonist to the subject.
206. The method of any one of claims 1-205, wherein the subject sustains pregnancy for at least about 14 days following the transfer of the one or more embryos to the subject.
207. The method of claim 206, wherein the subject sustains pregnancy for at least about 6 weeks following the transfer of the one or more embryos to the subject.
208. The method of claim 207, wherein the subject sustains pregnancy for at least about 10 weeks following retrieval of one or more oocytes or ova from the subject.
209. The method of any one of claims 206-208, wherein pregnancy is assessed by a blood pregnancy test.
210. The method of claim 209, wherein the blood pregnancy test comprises detecting hCG in a blood sample isolated from the subject.
211. The method of claim 207 or 208, wherein pregnancy is assessed by detecting intrauterine embryo heartbeat.
212. The method of any one of claims 1-211, wherein the subject sustains pregnancy and exhibits a live birth following administration of the oxytocin receptor antagonist to the subject.
213. The method of claim 212, wherein the subject exhibits the live birth at a gestational age of at least about 24 weeks.
214. The method of claim 213, wherein the subject exhibits the live birth at a gestational age of at least about 34 weeks.
215. The method of any one of claims 1-214, wherein the level of expression of the one or more genes is assessed by evaluating the level of mRNA corresponding to the one or more genes.
216. The method of any one of claims 1-214, wherein the level of expression of the one or more genes is assessed by evaluating the level of protein encoded by the one or more genes.
217. A kit comprising one or more probes for detecting expression of one or more of genes DPP4, CNTNAP3, CNTN4, CXCL12, TNXB, CTSE, OLFM4, KRT5, KRT6A, and IDO2, wherein the kit comprises a package insert instructing a user of the kit to perform the method of any one of claims 1-214.
218. The kit of claim 217, wherein the one or more probes comprise one or more oligonucleotides that anneal to a nucleic acid encoding one or more of DPP4, CNTNAP3, CNTN4, CXCL12, TNXB, CTSE, OLFM4, KRT5, KRT6A, and IDO2.
219. The kit of claim 217 or 218 wherein the one or more probes are capable of detecting expression of the one or more genes by way of a polymerase chain reaction (PCR) method.
220. The kit of claim 217, wherein the one or more probes comprise one or more antibodies, or antigen-binding fragments thereof, that specifically bind one or more of DPP4, CNTNAP3, CNTN4, CXCL12, TNXB, CTSE, OLFM4, KRT5, KRT6A, and IDO2 proteins.
221. The kit of any one of claims 217-220, wherein the kit further comprises an oxytocin receptor antagonist.
222. The kit of claim 221, wherein the oxytocin receptor antagonist is a compound represented by formula (I) ##STR00023## or a geometric isomer, enantiomer, diastereomer, racemate, or salt thereof, wherein n is an integer from 1 to 3; R.sup.1 is selected from the group consisting of hydrogen and C.sub.1-C.sub.6 alkyl; R.sup.2 is selected from the group consisting of hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkyl aryl, heteroaryl, C.sub.1-C.sub.6 alkyl heteroaryl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkenyl aryl, C.sub.2-C.sub.6 alkenyl heteroaryl, C.sub.2-C.sub.6 alkynyl, C.sub.2-C.sub.6 alkynyl aryl, C.sub.2-C.sub.6 alkynyl heteroaryl, C.sub.3-C.sub.6 cycloalkyl, heterocycloalkyl, C.sub.1-C.sub.6 alkyl cycloalkyl, C.sub.1-C.sub.6 alkyl heterocycloalkyl, C.sub.1-C.sub.6 alkyl carboxy, acyl, C.sub.1-C.sub.6 alkyl acyl, C.sub.1-C.sub.6 alkyl acyloxy, C.sub.1-C.sub.6 alkyl alkoxy, alkoxycarbonyl, C.sub.1-C.sub.6 alkyl alkoxycarbonyl, aminocarbonyl, C.sub.1-C.sub.6 alkyl aminocarbonyl, C.sub.1-C.sub.6 alkyl acylamino, C.sub.1-C.sub.6 alkyl ureido, amino, C.sub.1-C.sub.6 alkyl amino, sulfonyloxy, C.sub.1-C.sub.6 alkyl sulfonyloxy, sulfonyl, C.sub.1-C.sub.6 alkyl sulfonyl, sulfinyl, C.sub.1-C.sub.6 alkyl sulfinyl, C.sub.1-C.sub.6 alkyl sulfanyl, and C.sub.1-C.sub.6 alkyl sulfonylamino; R.sup.3 is selected from the group consisting of aryl and heteroaryl; X is selected from the group consisting of oxygen and NR.sup.4; and R.sup.4 is selected from the group consisting of hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkyl aryl, C.sub.1-C.sub.6 alkyl heteroaryl, aryl, and heteroaryl, wherein R.sup.2 and R.sup.4, together with the nitrogen to which they are bound, can form a 5-8 membered saturated or unsaturated heterocycloalkyl ring.
223. The kit of claim 222, wherein the compound is represented by formula (II) ##STR00024##
224. The kit of claim 222 or 223, wherein the compound is formulated for oral administration to the subject.
225. The kit of claim 224, wherein the compound is formulated as a tablet, capsule, gel cap, powder, liquid solution, or liquid suspension.
226. The kit of claim 225, wherein the compound is formulated as a tablet.
227. The kit of claim 226, wherein the tablet is a dispersible tablet.
228. The kit of any one of claims 222-227, wherein the compound is formulated in a unit dosage form comprising about 50 mg of the compound.
229. The kit of any one of claims 222-227, wherein the compound is formulated in a unit dosage form comprising about 200 mg of the compound.
230. The kit of any one of claims 222-229, wherein the kit comprises from about 700 mg to about 1,100 mg of the compound.
231. The kit of claim 230, wherein the kit comprises from about 750 mg to about 1,050 mg of the compound.
232. The kit of claim 231, wherein the kit comprises from about 800 mg to about 1,000 mg of the compound.
233. The kit of claim 232, wherein the kit comprises from about 850 mg to about 950 mg of the compound.
234. The kit of claim 233, wherein the kit comprises about 900 mg of the compound.
235. The kit of any one of claims 222-229, wherein the kit comprises from about 1,600 mg to about 2,000 mg of the compound.
236. The kit of claim 235, wherein the kit comprises from about 1,650 mg to about 1,950 mg of the compound.
237. The kit of claim 236, wherein the kit comprises from about 1,700 mg to about 1,900 mg of the compound.
238. The kit of claim 237, wherein the kit comprises from about 1,750 mg to about 1,850 mg of the compound.
239. The kit of claim 238, wherein the kit comprises about 1,800 mg of the compound.
240. The kit of claim 221, wherein the oxytocin receptor antagonist is barusiban, atosiban, epelsiban, or retosiban.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0475] The application file contains at least one drawing executed in color. Copies of this patent or patent application with color drawings will be provided by the Office upon request and payment of the necessary fee.
[0476]
[0477]
[0478]
[0479]
[0480]
[0481]
[0482]
[0483]
[0484]
[0485]
[0486]
[0487]
[0488]
DETAILED DESCRIPTION
[0489] The present disclosure provides compositions and methods that can be used to determine whether a subject (e.g., a female human subject) undergoing embryo transfer procedures is particularly likely to benefit from administration of an oxytocin receptor antagonist. Using the compositions and methods described herein, a subject that is undergoing an embryo transfer procedure may be assessed for their propensity to benefit from oxytocin receptor antagonist treatment by analyzing the subject's expression of one or more genes, either before or after administration of an oxytocin receptor antagonist to the subject. An observation that the subject exhibits elevated expression of a certain gene or set of genes and/or diminished expression of another gene or set of genes may indicate that the subject is particularly likely to respond to oxytocin receptor antagonist treatment.
[0490] Exemplary responses to oxytocin receptor antagonist treatment include reduced uterine contractility and enhanced blood flow to the endometrium. Collectively, these phenotypes contribute to a subject's endometrial receptivity toward a transferred embryo. Without being bound by theory, an oxytocin receptor antagonist administered to a subject using the compositions and methods described herein may enhance uterine perfusion and suppress uterine contractions that could otherwise lead to embryo expulsion, ultimately serving to create an environment within the endometrium that is conducive to successful embryo implantation and the establishment and maintenance of a healthy pregnancy.
[0491] The compositions and methods of the disclosure are based, in part, on the discovery that oxytocin receptor antagonists (e.g., substituted pyrrolidin-3-one oxime compounds, such as (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime) can effectuate these responses in a subject (e.g., a human female subject) by (i) elevating the subject's expression of one or more of Dipeptidyl Peptidase 4 (DPP4), Contactin Associated Protein Like 3 (CNTNAP3), Contactin 4 (CNTN4), C-X-C Motif Chemokine Ligand 12 (CXCL12), and Tenascin XB (TNXB) and/or (ii) reducing the subject's expression of one or more of Cathepsin E (CTSE), Olfactomedin 4 (OLFM4), Keratin 5 (KRT5), Keratin 6A (KRT6A), and Indoleamine 2,3-Dioxygenase 2 (IDO2). Thus, using the compositions and methods described herein, a subject exhibiting low expression of one or more of DPP4, CNTNAP3, CNTN4, CXCL12, and TNXB, and/or heightened expression of one or more of CTSE, OLFM4, KRT5, KRT6A, and IDO2, prior to administration of an oxytocin receptor antagonist may be identified as particularly likely to benefit from this form of treatment. In this way, the compositions and methods of the disclosure allow subjects that have a particularly high likelihood of responding to oxytocin receptor antagonist treatment to be identified and treated accordingly.
[0492] Moreover, using the compositions and methods of the disclosure, a subject that is undergoing embryo transfer therapy and has been treated with an oxytocin receptor antagonist (e.g., a substituted pyrrolidin-3-one oxime compound, such as (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime) can be monitored following treatment to evaluate the subject's responsiveness and to determine whether the subject would benefit from one or more additional doses of the antagonist. For example, following administration of an oxytocin receptor antagonist to a subject undergoing an embryo transfer procedure, the subject's expression of DPP4, CNTNAP3, CNTN4, CXCL12, and/or TNXB may be assessed. A finding that the subject's expression of one or more of DPP4, CNTNAP3, CNTN4, CXCL12, and TNXB has increased can indicate that the subject is responding to the oxytocin receptor antagonist, whereas a finding that the subject's expression of one or more of DPP4, CNTNAP3, CNTN4, CXCL12, and TNXB has decreased or remains unchanged can indicate that the subject is in need of a subsequent dose of the oxytocin receptor antagonist. Similarly, following administration of an oxytocin receptor antagonist to a subject undergoing an embryo transfer procedure, the subject's expression of CTSE, OLFM4, KRT5, KRT6A, and/or IDO2 may be assessed. A finding that the subject's expression of one or more of CTSE, OLFM4, KRT5, KRT6A, and IDO2 has decreased can indicate that the subject is responding to the oxytocin receptor antagonist, whereas a finding that the subject's expression of one or more of CTSE, OLFM4, KRT5, KRT6A, and IDO2 has increased or remains unchanged can indicate that the subject is in need of a subsequent dose of the oxytocin receptor antagonist.
[0493] Using the methods described herein, an oxytocin receptor antagonist can be administered to the subject before, during, and/or after the transfer of one or more embryos to the uterus of the subject so as to promote successful embryo implantation and a sustained pregnancy. The oxytocin receptor antagonist can be administered in a single dose or in multiple doses, such as doses of varying strength or repeat doses of the same strength. For instance, the oxytocin receptor antagonist may be administered in a single high dose or in multiple, lower-strength doses so as to achieve a maximal plasma concentration of the oxytocin receptor antagonist. Oxytocin receptor antagonists useful in conjunction with the compositions and methods described herein include pyrrolidin-3-one oxime compounds represented by formula (I)
##STR00011##
or a geometric isomer, enantiomer, diastereomer, racemate, or salt thereof, wherein
[0494] n is an integer from 1 to 3;
[0495] R.sup.1 is selected from the group consisting of hydrogen and C.sub.1-C.sub.6 alkyl;
[0496] R.sup.2 is selected from the group consisting of hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkyl aryl, heteroaryl, C.sub.1-C.sub.6 alkyl heteroaryl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkenyl aryl, C.sub.2-C.sub.6 alkenyl heteroaryl, C.sub.2-C.sub.6 alkynyl, C.sub.2-C.sub.6 alkynyl aryl, C.sub.2-C.sub.6 alkynyl heteroaryl, C.sub.3-C.sub.6 cycloalkyl, heterocycloalkyl, C.sub.1-C.sub.6 alkyl cycloalkyl, C.sub.1-C.sub.6 alkyl heterocycloalkyl, C.sub.1-C.sub.6 alkyl carboxy, acyl, C.sub.1-C.sub.6 alkyl acyl, C.sub.1-C.sub.6 alkyl acyloxy, C.sub.1-C.sub.6 alkyl alkoxy, alkoxycarbonyl, C.sub.1-C.sub.6 alkyl alkoxycarbonyl, aminocarbonyl, C.sub.1-C.sub.6 alkyl aminocarbonyl, C.sub.1-C.sub.6 alkyl acylamino, C.sub.1-C.sub.6 alkyl ureido, amino, C.sub.1-C.sub.6 alkyl amino, sulfonyloxy, C.sub.1-C.sub.6 alkyl sulfonyloxy, sulfonyl, C.sub.1-C.sub.6 alkyl sulfonyl, sulfinyl, C.sub.1-C.sub.6 alkyl sulfinyl, C.sub.1-C.sub.6 alkyl sulfanyl, and C.sub.1-C.sub.6 alkyl sulfonylamino;
[0497] R.sup.3 is selected from the group consisting of aryl and heteroaryl;
[0498] X is selected from the group consisting of oxygen and NR.sup.4; and
[0499] R.sup.4 is selected from the group consisting of hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkyl aryl, C.sub.1-C.sub.6 alkyl heteroaryl, aryl, and heteroaryl, wherein R.sup.2 and R.sup.4, together with the nitrogen to which they are bound, can form a 5-8 membered saturated or unsaturated heterocycloalkyl ring. Compounds of this genus are described, for example, in U.S. Pat. No. 7,115,754, the disclosure of which is incorporated herein by reference in its entirety. For instance, oxytocin receptor antagonists that can be used in conjunction with the compositions and methods described herein include (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II), below.
##STR00012##
[0500] Using the methods described herein, one can administer an oxytocin receptor antagonist, such as compound (I) or compound (II), to a subject, such as a mammalian subject (e.g., a female human subject) in order to promote enhanced endometrial receptivity, reduce the likelihood of embryo implantation failure, and/or prevent miscarriage in a subject following the transfer of one or more embryos to the uterus of the subject. According to the methods described herein, a compound of formula (I), such as compound (II), may be administered to a subject prior to, concurrently with, and/or following the transfer of one or more embryos to the uterus of the subject so as to achieve a serum concentration of the compound of, for example, from about 1 μM to about 20 μM.
[0501] Additional oxytocin receptor antagonists that may be used in conjunction with the compositions and methods described herein include epelsiban, retosiban, barusiban, and atosiban, as well as derivatives thereof, among others. For instance, oxytocin receptor antagonists that may be used in conjunction with the compositions and methods described herein include epelsiban, as well as salts, derivatives, variants, crystal forms, and formulations thereof, such as a salt, derivative, variant, crystal form, or formulation described in U.S. Pat. Nos. 7,514,437; 8,367,673; 8,541,579; 7,550,462; 7,919,492; 8,202,864; 8,742,099; 9,408,851; 8,716,286; or 8,815,856, the disclosures of each of which are incorporated herein by reference in their entirety. Additional oxytocin receptor antagonists that may be used in conjunction with the compositions and methods described herein include retosiban, as well as salts, derivatives, variants, crystal forms, and formulations thereof, such as a salt, derivative, variant, crystal form, or formulation described in U.S. Pat. Nos. 7,514,437; 8,367,673; 8,541,579; 8,071,594; 8,357,685; 8,937,179; or 9,452,169, the disclosures of each of which are incorporated herein by reference in their entirety. Oxytocin receptor antagonists useful in conjunction with the compositions and methods described herein further include barusiban, as well as salts, derivatives, variants, crystal forms, and formulations thereof, such as a salt, derivative, variant, crystal form, or formulation described in U.S. Pat. Nos. 6,143,722; 7,091,314; 7,816,489; or 9,579,305, or WO 2017/060339, the disclosures of each of which are incorporated herein by reference in their entirety. Oxytocin receptor antagonists useful in conjunction with the compositions and methods described herein additionally include atosiban, as well as salts, derivatives, variants, crystal forms, and formulations thereof, such as a salt, derivative, variant, crystal form, or formulation described in U.S. Pat. Nos. 4,504,469 or 4,402,942, the disclosures of each of which are incorporated herein by reference in their entirety. Using the methods described herein, one can administer one of the foregoing oxytocin receptor antagonists, to a subject, such as a mammalian subject (e.g., a female human subject) in order to reduce the likelihood of embryo implantation failure. According to the methods described herein, one of the foregoing oxytocin receptor antagonists may be administered to a subject prior to, concurrently with, and/or following the transfer of one or more embryos to the uterus of the subject so as to promote enhanced endometrial receptivity, reduce the likelihood of embryo implantation failure, and/or prevent miscarriage in a subject following the transfer of one or more embryos to the uterus of the subject.
[0502] The subject may be one that has previously undergone one or more successful or unsuccessful embryo implantation procedures. Alternatively, the subject may be one that has not undergone a previous embryo transfer cycle. According to the methods described herein, the one or more embryos that are ultimately transferred to the subject can be obtained, for instance, by in vitro fertilization (IFV) or intracytoplasmic sperm injection (ICSI) of an ovum isolated or derived from the subject or from a donor. For instances in which the ovum is isolated or derived from the subject, the ovum may be isolated from the subject directly or may be produced ex vivo by inducing maturation of one or more oocytes isolated from the subject. The ova or oocytes may be isolated from the subject, for instance, from about 1 day to about 7 days prior to embryo transfer. In some embodiments, the ova or oocytes are isolated from the subject from about 2 days to about 5 days prior to embryo transfer (e.g., 2 days, 3 days, 4 days, or 5 days prior to embryo transfer). Following fertilization of the ovum by contact with one or more sperm cells, the subsequently formed zygote can be matured ex vivo so as to produce an embryo, such as a morula or blastula (e.g., a mammalian blastocyst), which can then be transferred to the uterus of the subject for implantation into the endometrium. Embryo transfers that can be performed using the methods described herein include fresh embryo transfers, in which the ovum or oocyte used for embryo generation is retrieved from the subject and the ensuing embryo is transferred to the subject during the same menstrual cycle. The embryo can alternatively be produced and cryopreserved for long-term storage prior to transfer to the subject.
[0503] The sections that follow provide a description of various oxytocin receptor antagonists useful in conjunction with the compositions and methods provided by the disclosure, as well as a description of patient selection procedures and dosing regimens that may guide the administration of oxytocin receptor antagonists to a subject so as to enhance endometrial receptivity upon embryo transfer, reduce the likelihood of embryo implantation failure, and/or prevent the occurrence of a miscarriage in a subject undergoing an assisted reproduction procedure.
(3Z,5S)-5-(hydroxymethyl)-1-[(T-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime (Compound II)
[0504] Compounds of formula (I), such as (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II), above, are non-peptide oxytocin receptor antagonists that can be used to enhance endometrial receptivity, promote successful embryo implantation, and reduce the likelihood of miscarriage in subjects undergoing or that have undergone embryo transfer therapy. Compound (II), in particular, is an orally-active oxytocin receptor antagonist capable of inhibiting human oxytocin receptor with a K.sub.i of 52 nM and suppressing Ca.sup.2+ mobilization in cultured HEK293EBNA cells with an IC.sub.50 of 81 nM. Additionally, compound (II) selectively inhibits the oxytocin receptor over the vasopressin Vla receptor, as compound (II) inhibits the vasopressin Vla receptor with a K.sub.i of 120 nM. Compound (II) additionally demonstrates a variety of favorable pharmacokinetic properties, as this compound exhibits an oral bioavailability of from 42-100%, with a serum half-life of from 11-12 hours and a t.sub.max of from about 1-4 hours. The foregoing biochemical properties of compound (II), as well as methods for the synthesis and purification of this compound, are described in detail, for instance, in U.S. Pat. No. 9,670,155, the disclosure of which is incorporated herein by reference in its entirety.
Synthesis of Compound (II)
[0505] An exemplary procedure for the synthesis of compound (II) is shown in Scheme 1, below.
##STR00013## ##STR00014##
Purity of Compound (II)
[0506] In some embodiments, the compound represented by formula (II) (i.e., (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime) is substantially pure. For instance, in some embodiments, the compound represented by formula (II) has a purity of at least 85%, such as a purity of from 85% to 99.9% or more (e.g., a purity of 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or more). The purity of the compound represented by formula (II) may be assessed, for instance, using NMR techniques and/or chromatographic methods, such as HPLC procedures, that are known in the art and described herein, such as those techniques that are described in U.S. Pat. No. 9,670,155, the disclosure of which is incorporated herein by reference in its entirety.
[0507] In some embodiments, the compound represented by formula (II) is substantially pure with respect to diastereomers of this compound and other by-products that may be formed during the synthesis of this compound. For instance, in some embodiments, the compound represented by formula (II) has a purity of at least 85%, such as a purity of from 85% to 99.9% or more (e.g., a purity of 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 5 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or more) with respect to diastereomers of this compound and other by-products that may be formed during the synthesis of this compound, such as a by-product that is formed during the synthesis of this compound as described in U.S. Pat. No. 9,670,155. The purity of the compound represented by formula (II) may be assessed, for instance, using NMR techniques and/or chromatographic methods, such as HPLC procedures, that are known in the art and described herein, such as those techniques that are described in U.S. Pat. No. 9,670,155.
[0508] In some embodiments, the compound represented by formula (II) is substantially pure with respect to its (3E) diastereomer, (3E,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime. For instance, in some embodiments, the compound represented by formula (II) has a purity of at least 85%, such as a purity of from 85% to 99.9% or more (e.g., a purity of 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or more) with respect to (3E,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime. For instance, compound (II) may be administered in the form of a composition (e.g., a tablet, such as a dispersible tablet, capsule, gel cap, powder, liquid solution, or liquid suspension) that contains less than 15% of the (3E) diastereomer. For example, compound (II) may be administered in the form of a composition (e.g., a tablet, such as a dispersible tablet, capsule, gel cap, powder, liquid solution, or liquid suspension) that contains less than 14%, less than 13%, less than 12%, less than 11%, less than 10%, less than 9%, less than 8%, less than 7%, less than 6%, less than 5%, less than 4%, less than 3%, less than 2%, less than 1%, less than 0.1%, less than 0.01%, less than 0.001%, or less of the (3E) diastereomer. The purity of the compound represented by formula (II) may be assessed, for instance, using NMR techniques and/or chromatographic methods, such as HPLC procedures, that are known in the art and described herein, such as those techniques that are described in U.S. Pat. No. 9,670,155.
Therapeutic Activity
[0509] The present disclosure is based in part on the discovery that compounds of formula (I), such as compound (II), is capable of promoting successful endometrial implantation of a transferred embryo in female human subjects and prolonging the duration of pregnancy relative to subjects not treated with this compound. Specifically, compound (II) has been found to reduce the risk of embryo implantation failure in clinical studies conducted with human subjects that previously underwent ovarian hyperstimulation and oocyte retrieval. It has been discovered that compounds of formula (I), such as compound (II), increase the rate of successful embryo implantation as assessed by a variety of metrics. These manifestations have been found to include an increase in the rate of positive pregnancy tests at 14 days, 6 weeks, and 10 weeks following embryo transfer and/or oocyte retrieval, as well as an increase in the rate of live births at a gestational age of at least 24 weeks.
[0510] Oxytocin receptor antagonists, such as compounds of formula (I) and (II) and other oxytocin receptor antagonists described herein, are particularly effective in subjects that do not exhibit elevated serum concentrations of progesterone (P4). For instance, as is described in detail in Example 1, below, compound (II) was found to improve successful embryo implantation rate (for example, as assessed by the above metrics) in a dose-dependent manner. This dose-dependent response was found to be particularly strong in subjects that exhibited a pre-treatment serum P4 concentration of less than 320 nM, such as from about 200 nM to about 300 nM or less. The foregoing P4 concentrations were measured on the day of transfer of one or more embryos to the subject. These heightened P4 levels are indicative of an elevated P4 concentration within about 48 hours of final follicular maturation (e.g., by way of hCG administration) and/or on the day of oocyte or ovum retrieval from the subject, such as a P4 concentration of from 1.0 ng/ml to 2.0 ng/ml (e.g., a P4 concentration of 1.0 ng/ml, 1.1 ng/ml, 1.2 ng/ml, 1.3 ng/ml, 1.4 ng/ml, 1.5 ng/ml, 1.6 ng/ml, 1.7 ng/ml, 1.8 ng/ml, 1.9 ng/ml, or 2.0 ng/ml, and particularly, 1.5 ng/ml). Thus, it has been discovered that a subject's propensity to benefit from treatment with an oxytocin receptor antagonist, such as a compound of formula (I) or formula (II), or another oxytocin receptor antagonist described herein, such as epelsiban, retosiban, barusiban, or atosiban, or a salt, derivative, variant, crystal form, or formulation thereof, can be determined based on the subject's pre-treatment serum level of P4.
[0511] Using the compositions and methods described herein, one of skill in the art can assess a patient's likelihood of benefiting from (e.g., experiencing enhanced (i.e., increased) endometrial receptivity in response to) oxytocin receptor antagonist treatment by determining the subject's serum P4 concentration prior to treatment with an oxytocin receptor antagonist. If the subject exhibits a serum P4 concentration below a reference level, such as a serum P4 concentration of below 320 nM on the day of embryo transfer (e.g., up to 24 hours prior to a scheduled embryo transfer, such as immediately prior to a scheduled embryo transfer) or a serum P4 concentration of less than 1.5 ng/ml within about 48 hours of final follicular maturation (e.g., by way of hCG administration) and/or on the day of oocyte or ovum retrieval (e.g., from 1 to 7 days prior to embryo transfer for a patient undergoing an IVF-ET procedure, such as from 3 to 5 days prior to embryo transfer for a patient undergoing an IVF-ET procedure), the subject may be administered an oxytocin receptor antagonist, for instance, prior to, concurrently with, and/or following the transfer of one or more embryos to the subject. If the subject exhibits a serum P4 concentration above a reference level, such as a serum P4 concentration of above 320 nM on the day of embryo transfer (e.g., up to 24 hours prior to a scheduled embryo transfer, such as immediately prior to a scheduled embryo transfer) or a serum P4 concentration of greater than 1.5 ng/ml on the day of oocyte or ovum retrieval (e.g., from 1 to 7 days prior to embryo transfer for a patient undergoing an IVF-ET procedure, such as from 3 to 5 days prior to embryo transfer for a patient undergoing an IVF-ET procedure), a physician of skill in the art may determine that the subject will not be administered an oxytocin receptor antagonist, and/or that the subject will be re-scheduled for oocyte or ovum retrieval or embryo transfer until such a time as the subject's serum P4 concentration declines to beneath the P4 reference level.
[0512] Additionally, without being limited by mechanism, it has been discovered that oxytocin receptor antagonists such as compounds of formula (I) and (II), and other oxytocin receptor antagonists described herein, may promote the transient overexpression of prostaglandin F2α (PGF2α) and prostaglandin E2 (PGE2) and subsequently inhibit the propagation of PGF2α signal transduction. The attenuation of PGF2α signaling may occur, for instance, by desensitization of the PGF2α receptor in response to the initial flare in PGF2α secretion. This pattern of (i) transiently heightened expression of PGF2α followed by (ii) the reduction in PGF2α signaling induced by oxytocin receptor antagonists such as compounds of formula (I) and (II), as well as other oxytocin receptor antagonists described herein, can in turn enhance the receptivity of the endometrium to one or more exogenous embryos, thereby promoting endometrial implantation and reducing the likelihood of embryo implantation failure. Notably, P4 is a negative regulator of PGF2α expression, which may explain why oxytocin receptor antagonists such as compounds of formula (I) and (II), among other oxytocin receptor antagonists described herein, can have a particularly robust therapeutic effect on subjects that do not exhibit elevated pre-treatment serum P4 concentrations. Such subjects include those that do not exhibit pre-treatment serum P4 concentrations of 320 nM or greater on the day of embryo transfer and/or pre-treatment serum P4 concentrations of 1.5 ng/ml or greater on the day of oocyte or ovum retrieval, as described in Examples 1 and 2, below.
[0513] The foregoing discoveries form important bases for the oxytocin receptor antagonist dosing regimens described herein. To optimally enhance endometrial receptivity to one or more transferred embryos, compounds of formulas (I) and (II), as well as additional oxytocin receptor antagonists described herein and known in the art, such as epelsiban, retosiban, barusiban, and atosiban, or a salt, derivative, variant, crystal form, or formulation thereof, can be administered to a subject so as to saturate the oxytocin receptor and achieve complete (i.e., 100%) inhibition of the receptor at the time of embryo implantation. This can be achieved, for instance, by administering compounds of formula (I) or (II) or another oxytocin receptor antagonist described herein or known in the art, such as epelsiban, retosiban, barusiban, and atosiban, or a salt, derivative, variant, crystal form, or formulation thereof, to a subject undergoing embryo transfer therapy such that a maximum plasma concentration of the compound is reached at the time of embryo transfer.
[0514] For instance, compounds of formula (I) or (II) can be administered to a subject from about 1 hour to about 24 hours prior to embryo transfer, such as from about 1 hour to about 8 hours prior to embryo transfer so as to achieve a maximum plasma concentration of the compound at the time of embryo transfer. In some embodiments, the compound is administered about 4 hours prior to embryo transfer, as it has been discovered that oral administration of various doses of compound (II) results in a peak plasma concentration of the compound at from about 1 hour to about 4 hours following administration of the compound. Compounds of formula (I) or (II) may be administered prior to, during, and/or after embryo transfer in order to enhance endometrial receptivity and promote successful embryo implantation, for instance, as described below.
[0515] The sections that follow describe in further detail additional oxytocin receptor antagonists that may be used in conjunction with the compositions and methods of the disclosure, as well as dosing schedules for the administration of oxytocin receptor antagonists to subjects undergoing embryo transfer therapy and methods of assessing whether a subject is likely to benefit from oxytocin receptor antagonist treatment on the basis of the subject's pre-treatment progesterone level(s).
Additional Oxytocin Receptor Antagonists
[0516] In addition to compounds of formula (I) and (II), oxytocin receptor antagonists that may be used in conjunction with the compositions and methods described herein include epelsiban, retosiban, barusiban, and atosiban, as well as salts, derivative, variants, crystal forms, and formulations thereof. The sections that follow provide a description of these agents, as well as synthetic methods for the preparation of these oxytocin receptor antagonists.
Epelsiban
[0517] Oxytocin receptor antagonists useful in conjunction with the compositions and methods described herein include epelsiban ((3R,6R)-3-(2,3-dihydro-1H-inden-2-yl)-1-[(1R)-1-(2,6-dimethyl-3-pyridinyl)-2-(4-morpholinyl)-2-oxoethyl]-6-[(1S)-1-methylpropyl]-2,5-piperazinedione), as well as salts, derivatives, variants, crystal forms, and formulations thereof, such as a salt, derivative, variant, crystal form, or formulation described in U.S. Pat. Nos. 7,514,437; 8,367,673; 8,541,579; 7,550,462; 7,919,492; 8,202,864; 8,742,099; 9,408,851; 8,716,286; or 8,815,856, the disclosures of each of which are incorporated herein by reference in their entirety. Epelsiban is shown graphically in structural formula (III), below.
##STR00015##
[0518] Exemplary methods for the preparation of epelsiban are described, for instance, in U.S. Pat. No. 15 8,742,099, and are depicted in Scheme 2, below.
##STR00016##
wherein X represents oxygen or sulfur. It is to be understood that the foregoing compound can be synthesized by alternative methods, for instance, by substituting one of the amide-bond forming agents shown in the foregoing scheme with another amide-bond forming agent described herein or known in the art.
Retosiban
[0519] Oxytocin receptor antagonists useful in conjunction with the compositions and methods described herein include retosiban ((3R,6R)-3-(2,3-dihydro-1H-inden-2-yl)-1-[(1R)-1-(2-methyl-1,3-oxazol-4-yl)-2-(4-morpholinyl)-2-oxoethyl]-6-[(1S)-1-methylpropyl]-2,5-piperazinedione), as well as salts, derivatives, variants, crystal forms, and formulations thereof, such as a salt, derivative, variant, crystal form, or formulation described in U.S. Pat. Nos. 7,514,437; 8,367,673; 8,541,579; 8,071,594; 8,357,685; 8,937,179; or 9,452,169, the disclosures of each of which are incorporated herein by reference in their entirety. Retosiban is shown graphically in structural formula (IV), below.
##STR00017##
[0520] Exemplary methods for the preparation of retosiban are described, for instance, in U.S. Pat. No. 8,937,139, and are depicted in Scheme 3, below.
##STR00018##
[0521] It is to be understood that the foregoing compound can be synthesized by alternative methods, for instance, by substituting one of the amide-bond forming agents shown in the foregoing scheme with another amide-bond forming agent described herein or known in the art.
Barusiban
[0522] Oxytocin receptor antagonists useful in conjunction with the compositions and methods described herein include barusiban, as well as salts, derivatives, variants, crystal forms, and formulations thereof, such as a salt, derivative, variant, crystal form, or formulation described in U.S. Pat. Nos. 6,143,722; 7,091,314; 7,816,489; or 9,579,305, or WO 2017/060339, the disclosures of each of which are incorporated herein by reference in their entirety. Barusiban is shown graphically in structural formula (V), below.
##STR00019##
[0523] Exemplary methods for the preparation of barusiban are described, for instance, in WO 2017/060339, and may involve solid-phase peptide synthesis as well as solution-phase cyclization, for instance, by thioetherification. It is to be understood that the foregoing compound can be synthesized by alternative methods, for instance, by substituting one of the amide-bond forming agents shown WO 2017/060339 with another amide-bond forming agent described herein or known in the art.
Atosiban
[0524] Oxytocin receptor antagonists useful in conjunction with the compositions and methods described herein include atosiban, as well as salts, derivatives, variants, crystal forms, and formulations thereof, such as a salt, derivative, variant, crystal form, or formulation described in U.S. Pat. Nos. 4,504,469 or 4,402,942, the disclosures of each of which are incorporated herein by reference in their entirety. Atosiban is shown graphically in structural formula (VI), below.
##STR00020##
[0525] Exemplary methods for the preparation of atosiban are described, for instance, in U.S. Pat. Nos. 4,504,469 and 4,402,942, and may involve solid-phase peptide synthesis as well as solution-phase cyclization, for instance, by disulfide bond formation. It is to be understood that the foregoing compound can be synthesized by alternative methods, for instance, by substituting one of the amide-bond forming agents shown U.S. Pat. Nos. 4,504,469 or 4,402,942 with another amide-bond forming agent described herein or known in the art.
Biomarkers for Determining Responsiveness to Oxytocin Receptor Antagonist Administration
[0526] Using the compositions and methods of the disclosure, prior to administration of an oxytocin receptor antagonist, a subject exhibiting (i) a decrease in expression of one or more of DPP4, CNTNAP3, CNTN4, CXCL12, and TNXB relative to a reference expression level of the one or more genes, and/or (ii) an increase in expression of one or more of CTSE, OLFM4, KRT5, KRT6A, and IDO2 relative to a reference expression level of the one or more genes, may be identified as particularly likely to benefit from this form of treatment. Further, after administration of an oxytocin receptor antagonist to a subject undergoing an embryo transfer procedure, the subject's expression of DPP4, CNTNAP3, CNTN4, CXCL12, and/or TNXB may be assessed. A finding that the subject's expression of one or more of DPP4, CNTNAP3, CNTN4, CXCL12, and TNXB has increased can indicate that the subject is responding to the oxytocin receptor antagonist, whereas a finding to the contrary can indicate that the subject is in need of a subsequent dose of the oxytocin receptor antagonist. Similarly, after administration of an oxytocin receptor antagonist to a subject undergoing an embryo transfer procedure, the subject's expression of CTSE, OLFM4, KRT5, KRT6A, and/or IDO2 may be assessed. A finding that the subject's expression of one or more of CTSE, OLFM4, KRT5, KRT6A, and IDO2 has decreased can indicate that the subject is responding to the oxytocin receptor antagonist, whereas a contrary finding can indicate that the subject is in need of a subsequent dose of the oxytocin receptor antagonist.
[0527] In accordance with the compositions and methods described herein, expression of one or more of DPP4, CNTNAP3, CNTN4, CXCL12, TNXB, CTSE, OLFM4, KRT5, KRT6A, and IDO2 can be assessed by detecting a nucleic acid corresponding to one or more of the above genes (e.g., a ribonucleic acid (RNA) transcript encoding one of the foregoing genes) and/or by detecting one or more of the foregoing proteins. Methods that can be used to detect expression of DPP4, CNTNAP3, CNTN4, CXCL12, TNXB, CTSE, OLFM4, KRT5, KRT6A, and IDO2, either in the form of a nucleic acid or in the form of a protein, are known in the art. Exemplary procedures are described below.
DPP4
[0528] Using the compositions and methods of the disclosure, a probe (e.g., an oligonucleotide or antibody, among other probes described herein) may be used to detect expression of DPP4. An exemplary mRNA nucleic acid sequence encoding DPP4 is set forth in European Nucleotide Archive (ENA) Sequence X60708.1, which is reproduced as SEQ ID NO: 1, below. A probe of the disclosure may, for example, be an oligonucleotide that can be used to detect the presence of an mRNA encoding DPP4, or a fragment of such mRNA, such as by way of an RNA-Seq assay, PCR assay, or other RNA detection assay known in the art or described herein. Exemplary probes useful in conjunction with the compositions and methods of the disclosure for the detection of DPP4 mRNA include oligonucleotides that anneal to an mRNA encoding DPP4, such as an mRNA having the nucleic acid sequence of SEQ ID NO: 1, or a fragment thereof. Examples of probes useful in conjunction with the compositions and methods of the disclosure for the detection of DPP4 mRNA include oligonucleotides that are at least 85% complementary (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary) to the nucleic acid sequence of an mRNA encoding DPP4, such as an mRNA having the nucleic acid sequence of SEQ ID NO: 1, or a fragment thereof.
TABLE-US-00002 (SEQ ID NO: 1) CGCGCGTCTCCGCCGCCCGCGTGACTTCTGCCTGCGCTCCTTCTCTGAACGCTCACTTCC GAGGAGACGCCGACGATGAAGACACCGTGGAAGATTCTTCTGGGACTGCTGGGTGCTGCT GCGCTTGTCACCATCATCACCGTGCCCGTGGTTCTGCTGAACAAAGGCACAGATGATGCT ACAGCTGACAGTCGCAAAACTTACACTCTAACTGATTACTTAAAAAATACTTATAGACTG AAGTTATACTCCTTAAGATGGATTTCAGATCATGAATATCTCTACAAACAAGAAAATAAT ATCTTGGTATTCAATGCTGAATATGGAAACAGCTCAGTTTTCTTGGAGAACAGTACATTT GATGAGTTTGGACATTCTATCAATGATTATTCAATATCTCCTGATGGGCAGTTTATTCTC TTAGAATACAACTACGTGAAGCAATGGAGGCATTCCTACACAGCTTCATATGACATTTAT GATTTAAATAAAAGGCAGCTGATTACAGAAGAGAGGATTCCAAACAACACACAGTGGGTC ACATGGTCACCAGTGGGTCATAAATTGGCATATGTTTGGAACAATGACATTTATGTTAAA ATTGAACCAAATTTACCAAGTTACAGAATCACATGGACGGGGAAAGAAGATATAATATAT AATGGAATAACTGACTGGGTTTATGAAGAGGAAGTCTTCAGTGCCTACTCTGCTCTGTGG TGGTCTCCAAACGGCACTTTTTTAGCATATGCCCAATTTAACGACACAGAAGTCCCACTT ATTGAATACTCCTTCTACTCTGATGAGTCACTGCAGTACCCAAAGACTGTACGGGTTCCA TATCCAAAGGCAGGAGCTGTGAATCCAACTGTAAAGTTCTTTGTTGTAAATACAGACTCT CTCAGCTCAGTCACCAATGCAACTTCCATACAAATCACTGCTCCTGCTTCTATGTTGATA GGGGATCACTACTTGTGTGATGTGACATGGGCAACACAAGAAAGAATTTCTTTGCAGTGG CTCAGGAGGATTCAGAACTATTCGGTCATGGATATTTGTGACTATGATGAATCCAGTGGA AGATGGAACTGCTTAGTGGCACGGCAACACATTGAAATGAGTACTACTGGCTGGGTTGGA AGATTTAGGCCTTCAGAACCTCATTTTACCCTTGATGGTAATAGCTTCTACAAGATCATC AGCAATGAAGAAGGTTACAGACACATTTGCTATTTCCAAATAGATAAAAAAGACTGCACA TTTATTACAAAAGGCACCTGGGAAGTCATCGGGATAGAAGCTCTAACCAGTGATTATCTA TACTACATTAGTAATGAATATAAAGGAATGCCAGGAGGAAGGAATCTTTATAAAATCCAA CTTATTGACTATACAAAAGTGACATGCCTCAGTTGTGAGCTGAATCCGGAAAGGTGTCAG TACTATTCTGTGTCATTCAGTAAAGAGGCGAAGTATTATCAGCTGAGATGTTCCGGTCCT GGTCTGCCCCTCTATACTCTACACAGCAGCGTGAATGATAAAGGGCTGAGAGTCCTGGAA GACAATTCAGCTTTGGATAAAATGCTGCAGAATGTCCAGATGCCCTCCAAAAAACTGGAC TTCATTATTTTGAATGAAACAAAATTTTGGTATCAGATGATCTTGCCTCCTCATTTTGAT AAATCCAAGAAATATCCTCTACTATTAGATGTGTATGCAGGCCCATGTAGTCAAAAAGCA GACACTGTCTTCAGACTGAACTGGGCCACTTACCTTGCAAGCACAGAAAACATTATAGTA GCTAGCTTTGATGGCAGAGGAAGTGGTTACCAAGGAGATAAGATCATGCATGCAATCAAC AGAAGACTGGGAACATTTGAAGTTGAAGATCAAATTGAAGCAGCCAGACAATTTTCAAAA ATGGGATTTGTGGACAACAAACGAATTGCAATTTGGGGCTGGTCATATGGAGGGTACGTA ACCTCAATGGTCCTGGGATCGGGAAGTGGCGTGTTCAAGTGTGGAATAGCCGTGGCGCCT GTATCCCGGTGGGAGTACTATGACTCAGTGTACACAGAACGTTACATGGGTCTCCCAACT CCAGAAGACAACCTTGACCATTACAGAAATTCAACAGTCATGAGCAGAGCTGAAAATTTT AAACAAGTTGAGTACCTCCTTATTCATGGAACAGCAGATGATAACGTTCACTTTCAGCAG TCAGCTCAGATCTCCAAAGCCCTGGTCGATGTTGGAGTGGATTTCCAGGCAATGTGGTAT ACTGATGAAGACCATGGAATAGCTAGCAGCACAGCACACCAACATATATATACCCACATG AGCCACTTCATAAAACAATGTTTCTCTTTACCTTAGCACCTCAAAATACCATGCCATTTA AAGCTTATTAAAACTCATTTTTGTTTTCATTATCTCAAAACTGCACTGTCAAGATGATGA TGATCTTTAAAATACACACTCAAATCAAGAAACTTAAGGTTACCTTTGTTCCCAAATTTC ATACCTATCATCTTAAGTAGGGACTTCTGTCTTCACAACAGATTATTACCTTACAGAAGT TTGAATTATCCGGTCGGGTTTTATTGTTTAAAATCATTTCTGCATCAGCTGCTGAAACAA CAAATAGGAATTGTTTTTATGGAGGCTTTGCATAGATTCCCTGAGCAGGATTTTAATCTT TTTCTAACTGGACTGGTTCAAATGTTGTTCTCTTCTTTAAAGGGATGGCAAGATGTGGGC AGTGATGTCACTAGGGCAGGGACAGGATAAGAGGGATTAGGGAGAGAAGATAGCAGGGCA TGGCTGGGAACCCAAGTCCAAGCATACCAACACGAGCAGGCTACTGTCAGCTCCCCTCGG AGAAGAGCTGTTCACCACGAGACTGGCACAGTTTTCTGAGAAAGACTATTCAAACAGTCT CAGGAAATCAAATATCGAAAGCACTGACTTCTAAGTAAACCACAGCAGTTGAAAGACTCC AAAGAAATGTAAGGGAAACTGCCAGCAACGCAGCCCCCAGGTGCCAGTTATGGCTATAGG TGCTACAAAAACACAGCAAGGGTGATGGGAAAGCATTGTAAATGTGCTTTTAAAAAAAAA TACTGATGTTCCTAGTGAAAGAGGCAGCTTGAAACTGAGATGTGAACACATCAGCTTGCC CTGTTAAAAGATGAAAATATTTGTATCACAAATCTTAACTTGAAGGAGTCCTTGCATCAA TTTTTCTTATTTCATTTCTTTGAGTGTCTTAATTAAAAGAATATTTTAACTTCCTTGGAC TCATTTTAAAAAATGGAACATAAAATACAATGTTATGTATTATTATTCCCATTCTAGATA CTATGGAATTTCTCCCAGTCATTTAATAAATGTGCCTTCATTTTTTC
CNTNAP3
[0529] Using the compositions and methods of the disclosure, a probe (e.g., an oligonucleotide or antibody, among other probes described herein) may be used to detect expression of CNTNAP3. An exemplary mRNA nucleic acid sequence encoding CNTNAP3 is set forth in ENA Sequence AF333769.2, which is reproduced as SEQ ID NO: 2, below. A probe of the disclosure may, for example, be an oligonucleotide that can be used to detect the presence of an mRNA encoding CNTNAP3, or a fragment of such mRNA, such as by way of an RNA-Seq assay, PCR assay, or other RNA detection assay known in the art or described herein. Exemplary probes useful in conjunction with the compositions and methods of the disclosure for the detection of CNTNAP3 mRNA include oligonucleotides that anneal to an mRNA encoding CNTNAP3, such as an mRNA having the nucleic acid sequence of SEQ ID NO: 2, or a fragment thereof. Examples of probes useful in conjunction with the compositions and methods of the disclosure for the detection of CNTNAP3 mRNA include oligonucleotides that are at least 85% complementary (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary) to the nucleic acid sequence of an mRNA encoding CNTNAP3, such as an mRNA having the nucleic acid sequence of SEQ ID NO: 2, or a fragment thereof.
TABLE-US-00003 (SEQ ID NO: 2) GGCACGAGGCCGCGCAGGGGACGGGAGTGAGAGCGGGAGTGAGAGCAGGAACGACGCAGA GCGGCCGTCGCCGTGCCCGGGTCTCAGGGCGCCTGGCTGAAGTGAGCATGGCTTCAGTGG CCTGGGCCGTCCTCAAGGTGCTGCTGCTTCTCCCCACTCAGACTTGGAGACCCGTAGGAG CAGGAAATCCACCTGACTGTGATTCCCCACTGGCCTCTGCCTTGCCTAGGTCATCCTTCA GCAGCTCCTCAGAGCTGTCCAGCAGCCACGGCCCGGGGTTTTCAAGGCTTAATCGAAGAG ATGGAGCTGGTGGCTGGACCCCACTTGTGTCAAATAAATACCAATGGCTGCAAATTGACC TTGGAGAGAGAATAGAGGTCACTGCTGTCGCCACCCAAGGAGGATATGGGAGCTCTGACT GGGTGACCAGCTACCTCCTGATGTTCAGTGATGGTGGGAGAAACTGGAAGCAGTATCGCC GAGAAGAAAGCATCTGGGGTTTTCCAGGAAACACAAACGCAGACAGTGTGGTGCACTACA GACTCCAGCCTCCCTTTGAAGCCAGGTTCCTGCGCTTTCTCCCTTTAGCCTGGAACCCTA GGGGCAGGATTGGGATGCGGATCGAAGTGTACGGATGTGCATATAAATCTGAGGTGGTTT ATTTTGATGGACAAAGTGCTCTGCTGTATAGACTTGATAAAAAACCTTTAAAACCAATAA GAGACGTTATTTCTTTGAAATTTAAAGCCATGCAGAGCAATGGAATTCTACTTCACAGAG AAGGACAACATGGAAATCACATTACTCTGGAATTAATTAAAGGAAAGCTTGTCTTTTTTC TTAATTCAGGCAATGCTAAGCTGCCTTCCACTATTGCTCCTGTGACCCTCACCCTGGGCA GCCTGCTGGACGACCAGCACTGGCATTCCGTCCTCATCGAGCTCCTCGACACGCAGGTCA ACTTCACCGTGGACAAACACACTCATCATTTCCAAGCAAAGGGAGATTCCAGTTACTTGG ATCTTAATTTTGAGATCAGCTTTGGGGGAATTCCGACACCCGGAAGATCGCGGGCATTCA GACGTAAAAGCTTTCATGGGTGTTTAGAAAATCTTTATTATAATGGAGTGGATGTTACCG AATTAGCCAAGAAACACAAACCACAGATCCTCATGATGGGAAATGTGTCCTTCTCATGTC CACAGCCACAGACTGTCCCTGTGACTTTTCTGAGCTCCAGGAGTTATCTGGCTCTGCCAG GCAACTCTGGGGAGGACAAAGTGTCTGTCACTTTTCAATTTCGAACGTGGAACAGAGCAG GACATTTGCTTTTCGGCGAACTTCGACGTGGTTCAGGGAGTTTCGTCCTCTTTCTTAAGG ATGGCAAGCTCAAACTGAGTCTCTTCCAGCCGGGACAGTCACCAAGGAATGTCACAGCAG GTGCTGGATTAAACGATGGGCAGTGGCACTCTGTGTCCTTCTCTGCCAAGTGGAGCCATA TGAATGTGGTGGTGGACGATGACACAGCTGTTCAGCCCCTGGTGGCTGTGCTCATTGATT CAGGTGACACCTATTATTTTGGAGGCTGCCTGGACAACAGCTCTGGCTCTGGATGTAAAA GCCCCCTGGGAGGGTTTCAGGGCTGCCTAAGGCTCATCACCATTGGTGACAAAGCGGTGG ATCCCATCTTAGTACAGCAGGGGGCGCTGGGGAGTTTCAGGGACCTCCAGATAGACTCCT GCGGCATCACAGACAGGTGCTTGCCCAGCTACTGTGAGCATGGGGGCGAGTGTTCCCAGT CGTGGGACACCTTCTCCTGTGACTGTCTAGGCACAGGCTATACGGGCGAGACCTGCCATT CCTCTCTCTACGAGCAGTCTTGTGAAGCCCACAAGCACCGAGGGAACCCGTCTGGGCTTT ACTATATTGATGCAGATGGAAGTGGCCCCCTGGGACCATTTCTTGTGTACTGCAATATGA CAGCAGACGCCGCGTGGACGGTGGTGCAGCACGGTGGCCCCGACGCGGTGACCCTCCGAG GTGCCCCCAGCGGGCACCCGCGCTCGGCTGTGTCCTTCGCGTACGCAGCGGGCGCGGGGC AGCTGCGGTCCGCGGTGAACCTGGCGGAGCGCTGCGAGCAGCGGCTGGCTCTGCGCTGCG GGACGGCGCGGCGCCCGGACTCACGAGATGGAACCCCACTGAGCTGGTGGGTTGGAAGAA CCAATGAAACACACACTTACTGGGGAGGTTCTCTGCCTGATGCTCAAAAGTGTACTTGTG GATTAGAGGGGAACTGCATTGATTCTCAGTATTACTGCAACTGTGATGCTGGCCGGAATG AATGGACTAGTGACACAATAGTCCTTTCCCAAAAGGAGCACCTGCCAGTCACTCAGATTG TGATGACAGACACAGGCCAACCACATTCCGAAGCAGATTATACACTGGGGCCACTGCTCT GCCGCGGAGATCAGTCATTTTGGAATTCAGCTTCCTTCAACACTGAGACTTCATACCTTC ATTTCCCTGCTTTCCACGGAGAACTCACTGCTGACGTGTGCTTCTTTTTTAAGACCACAG TTTCCTCTGGGGTGTTTATGGAGAACCTGGGGATCACAGATTTCATCAGGATTGAGCTGC GTGCTCCCACAGAAGTGACCTTTTCCTTCGATGTGGGGAATGGACCTTGTGAGGTCACGG TGCAGTCACCCACTCCCTTTAATGACAATCAGTGGCACCACGTGAGGGCAGAGAGAAATG TTAAAGGAGCGTCTCTTCAAGTTGATCAGCTTCCTCAGAAGATGCAGCCTGCCCCTGCTG ATGGGCACGTTCGTTTACAGCTCAACAGCCAGCTCTTCATTGGTGGAACGGCCACCAGAC AGAGAGGCTTTCTAGGATGCATTCGGTCTCTGCAGTTGAACGGGGTGGCCCTGGATCTGG AAGAAAGAGCCACAGTGACGCCAGGAGTGGAGCCAGGGTGTGCAGGACACTGCAGCACCT ATGGACACTTGTGTCGCAATGGAGGGAGATGCAGAGAGAAACGCAGGGGGGTCACCTGTG ACTGTGCCTTCTCAGCCTATGATGGGCCGTTCTGCTCCAATGAGATTTCCGCATATTTTG CAACTGGCTCCTCAATGACATACCATTTTCAAGAACATTACACTTTAAGTGAAAACTCCA GCTCTCTCGTTTCTTCATTACACAGAGATGTAACATTGACCAGAGAAATGATCACACTGA GCTTCCGAACCACACGAACTCCGAGCTTATTGCTGTATGTGAGCTCTTTCTATGAGGAAT ACCTTTCAGTTATCCTCGCCAACAATGGAAGTTTGCAGATTAGGTACAAGCTAGATAGAC ATCAAAATCCTGATGCATTTACCTTTGATTTTAAAAACATGGCTGATGGGCAACTTCACC AAGTGAAGATTAACAGAGAAGAAGCTGTGGTCATGGTAGAGGTTAACCAGAGCACAAAGA AACAAGTCATCTTGTCCTCAGGGACAGAATTCAACGCCGTCAAATCTCTCATATTGGGAA AGGTTTTAGAGGCTGCCGGCGCGGACCCGGACACAAGGCGGGCGGCGACTAGTGGCTTCA CTGGCTGCCTCTCGGCGGTGCGCTTCGGCCGCGCTGCTCCCCTGAAGGCGGCGCTGCGCC CCAGCGGCCCCTCCCGGGTCACCGTCCGCGGCCACGTGGCCCCTATGGCCCGCTGCGCAG CGGGGGCGGCGTCCGGCTCCCCGGCGCGGGAACTGGCTCCCCGACTCGCGGGGGGCGCAG GTCGTTCTGGACCAGCGGATGAGGGAGAGCCCTTGGTTAATGCAGACAGAAGAGACTCTG CTGTCATCGGAGGTGTGATAGCAGTGGTGATATTTATTTTGCTTTGCATCACTGCCATAG CCATACGCATCTATCAACAGAGAAAGTTACGCAAAGAAAATGAGTCAAAAGTCTCAAAAA AAGAAGAGTGCTAGGACAGCTCTAAACAGTGAGCTCGATGTGCAAAACGCAGTCCATGAA AACCAGAAAGAGCGAGTCTTCTGATTGGCAGCTGTGGCTGTCTCTATCATCGTGACTGTG GACTTCCCTGCTGTTGCCATCAGGGTGCACACAAGCAGGTGCAGTGCTGTCACCTGGCTG AAGACCTGCAGCCTCGGAGCCTCTGGGAGGTCCCTTTCTCCCTCGGTGAAACACAGTCCT CCACATCAATTTCCAAACAATGAATTAGGTATGGCCATTCATCACTGTTCAGTAGTTTCC CCGTCCAAAGGCTCTCTTCCAAAACTGCAGTTTGATCTGTGTTAATAATTGTGGGGTTTT AGATGAGAAAATGGCTATAAAGCTGTGGCCCTACTTTATTTTTTAAAAATGACAGAACTT TTGTTCAGATGTAAAAGACAAAATTGCACTTTAATGTTTTTTGTTACTTGAAAACATATC TGGGATCCCTTTTTTTGGTCCTCTGCTGATATTTATAAAACAAGAAATGCTTCTTGGACT ACCTTCACTGGCATTTCCATAGTCCTGGAATCCAGAGCCAAGTGGCCTATCTAAAATTCA CAGCCCTTTTATTCTCCTGTGTGATGGTTAATACAACACAGTTGAAGCCTGGAAACACTA CCATTATTTTTGGTGTATTGCTTTTTCTAATTGACTGTTTTTAATGATTTTGATACATTT TAATGTTGAAATTAATATTGAATGTTAGCTATGAAATTTTAGTATTGAATTTTATAATGG AACAGAACATTGGTAGGTAACAAGATGCAAGAGGATGTCAATACAAGATTGTCTGCCTGT TTTTCTTTGTAATTTGTAATTACAGTTTTTGTAACTTGTGATTATGTTTTTAACTAAATT TACCACCAGATACAAACAATACTTCTTACACAGAGTTATCCTTTATTTATATCATTAAGA CGTGAATGAAACATCATCCTAACTTACTTCCCCAAGATATTGAGAGGTCATATCTGTTTT TCTTTATCATTCATTTCTTTTTCTAAAAGTTGTTACTGATATGCTTTTGATTTCCTATGA CTCTATTATGTTGTACAGAACATCTTTTCAATTTATTAAAAAAATAGCTTAACTGAAAAA AAAAAAAAAAAAAAAAAAA
CNTN4
[0530] Using the compositions and methods of the disclosure, a probe (e.g., an oligonucleotide or antibody, among other probes described herein) may be used to detect expression of CNTN4. An exemplary mRNA nucleic acid sequence encoding CNTN4 is set forth in ENA Sequence AF464063.1, which is reproduced as SEQ ID NO: 3, below. A probe of the disclosure may, for example, be an oligonucleotide that can be used to detect the presence of an mRNA encoding CNTN4, or a fragment of such mRNA, such as by way of an RNA-Seq assay, PCR assay, or other RNA detection assay known in the art or described herein. Exemplary probes useful in conjunction with the compositions and methods of the disclosure for the detection of CNTN4 mRNA include oligonucleotides that anneal to an mRNA encoding CNTN4, such as an mRNA having the nucleic acid sequence of SEQ ID NO: 3, or a fragment thereof. Examples of probes useful in conjunction with the compositions and methods of the disclosure for the detection of CNTN4 mRNA include oligonucleotides that are at least 85% complementary (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary) to the nucleic acid sequence of an mRNA encoding CNTN4, such as an mRNA having the nucleic acid sequence of SEQ ID NO: 3, or a fragment thereof.
TABLE-US-00004 (SEQ ID NO: 3) GAGGATCTTCAGCCAAGATGGTTTTTCTTCCTTCAGTGAGATCTTTTGTCTATTTGGCAA TGGAAGAAGATTAGTATTAGAGGATACGTGTTGGAAATGTGGTTTTTCAGGAGACCGATG TCCAGTGTTTTTTTTTTTACAATCATTTCCAACCATTTCAGAGCTGGGTCTGCCCCATCA AAGAGCAAGCTCTGGACTGCAGATCCTCATTACGTTTTCAACCCTGTCCAGTACATCATA ACTGTTTAAGATAGACTGACTGCAAGCCCTAAATTTAAAAGACTGTTAACAAAACGCCAA ATAAGATGGGTGGAGAAGGATGTAGACAAGAATGTTACAAGGGAAACAAAAACGATTTTT GCATTTGAGTGAAACTACTGTGATTTCTGAAGACCACCTTCCTTCTTTCCCAGACGGTCC CTGAGGAATTACAGAATGGTCGTGGCTTTGGTTATGTGGTGGCCTTCCGGCCCTACGGTA AAATGATCTGGATGCTGACAGTGCTGGCCTCAGCTGACGCCTCTAGATACGTGTTCAGGA ATGAGAGCGTGCACCCCTTCTCTCCCTTTGAGGTTAAAGTAGGTGTCTTCAACAACAAAG GAGAAGGCCCTTTCAGTCCCACCACGGTGGTGTATTCTGCAGAAGAAGAACCCACCAAAC CACCAGCCAGTATCTTTGCCAGAAGTCTTTCTGCCACAGATATTGAAGTTTTCTGGGCCT CCCCACTGGAGAAGAATAGAGGACGAATACAAGGTTATGAGGTTAAATATTGGAGACATG AAGACAAAGAAGAAAATGCTAGAAAAATACGAACAGTTGGAAATCAGACATCAACAAAAA TCACGAACTTAAAAGGCAGTGTGCTGTATCACTTAGCTGTCAAGGCATATAATTCTGCTG GGACAGGCCCCTCTAGTGCAACAGTCAATGTGACAACCCGAAAGCCACCACCAAGTCAAC CCCCCGGAAACATCATATGGAATTCATCAGACTCCAAAATTATCCTGAATTGGGATCAAG TGAAGGCCCTGGATAATGAGTCGGAAGTAAAAGGATACAAAGTCTTGTACAGATGGAACA GACAAAGCAGCACATCTGTCATTGAAACAAATAAAACATCGGTGGAGCTTTCTTTGCCTT TCGATGAAGATTATATAATAGAAATTAAGCCATTCAGCGACGGAGGAGATGGCAGCAGCA GTGAACAAATTCGAATTCCAAAGATATCAAATGCCTACGCGAGAGGATCTGGGGCTTCCA CTTCGAATGCATGTACGCTGTCAGCCATCAGTACAATAATGATTTCCCTCACAGCTAGGT CCAGTTTATGACAAAAGTTATCTGAAGGACTTGCTGTTTATAATATAAGCAACATTTAGC TAGTTGTTTTGAAGACACCCAGTACTAAGTAATATTGTTGTTCAAGTACATCTTATTACT GGAATAAAAATGTTTTTTGCTTCTTTACGAATGGCATTATACAGTACTTCCTCAAAGCAA ATCTAGCTTTGTCTGAAGTTTCTTTGGAAACTCTGCAATGCACTGAAGACATCTGTAATA TGATGTTACCAAAGCAGTTTAGATATGTCCTTATATGCATATTTTTTATTATATATTTAG TGTTTTATAGAATTTTTTAAAGTTAACATATAATGTAGATATTAATTTTTTCCTCGGCTG TAAAATGCTATGGGCAACACAATCATGCAATTATAATTTGAAAATATTTCCTTTAAAGAC AGAGTTTGAAACTCATCTTGGTAAATAAATTGCAAATTACTCGTACAGTTTTACAAGGAT CTCATGGCAGAACAGCGGAAGACTTGGTCCGTAACTCAAGGCTGTTGTATGCAAACTACT CTTCTAGTGGTTAATGCACTTGACATGTACAGTATGTTTCCCATGCCGTTGTGATTTTGA CATGTACAGTATGTTTTCATGCCGTTGTGAATTTTGTTGTTCAACCCAACTTGAGATGGT TTCAGGAATGGCTGCAATCTCAAAAGCTCAATGTACTGCCCAAGAGGCACCTTGTGCAAT ATTCCCATCCCTGAATTTAGCATTGTACAGGAAGATTTTCTTTTCACTCAACTGAGTTAG CATTGTCTTTGTGGTAGCATTATCTTAGACATTAAATTTGAAGTAACATATATCCTGTAG TAACATAGACCCAAAGTTACTATAGTCAACCAAGTCTTTCAAAGGATAAAAGATCATTTT ATTATCTTTAACTGTATCTATTTTGAATGTAAATTTAAAAAAAGTAATTCTCTGTCAATG GATTCGTAATTTCTTTACAAAATTTCTTATATATAATATGTGTATCTCTGTAATAATAGA GCCCTTCTTTTGAATCAAAATTACATATGGACTTTGGAAGATTGCTCCTATTTCAACAAA TAGTTGCTGCAAGAATTTTTAATATGACTCTATAAAAGCTCTTTAGTACAATTGTATGGT TTCTTGATGATTCTGTTTTGCAATAGGTAGCCTAGTTGCTTTATATGCTTTACCTTCTAG GTCTTAAAATCACACATTGGAAAATGACAATATCAACAAAACTGTATTCTTATGAAAAGA ACTATTTGTTACAATGAGAAAGGTTTTGTGAGTAAACCCTACTGGACAGTGACATAAAAG GCAATGGAATTTTCTATAAACATTTTCTCATGTAAACATGCTGCCACCTTTTCTTCTTTC TCAGAGAACTCAAATTTGCTATAGTTTGTCATTTTTGCTTACAAATAATATAACTTTTCA ACCTTCTAGTTATATTTATCCAATAAAGTCATAATCGGGATTCCATTTGTGTAAAAACTA GGGTGGTAACCGGAAAAAAATATTGTCAGTATTTCAAGCTGTGTTCCTTTCTTAGTTTGA TATGGTTACTTCTATGTTGAAATAAAATTTAAAATCACATGCAAAAAAAAAATCAGCAAA ATAATAAAATGAACGAAAAAAAATGACACCCAGGGAGTTCCCAACCCCAGTGTAAATGAT ATTTACCAGTGATCTAGCATATGTAATCTTTTTTAAAGGTATTGTTAATAAATATTCTGT CATT
CXCL12
[0531] Using the compositions and methods of the disclosure, a probe (e.g., an oligonucleotide or antibody, among other probes described herein) may be used to detect expression of CXCL12. An exemplary mRNA nucleic acid sequence encoding CXCL12 is set forth in ENA Sequence L36033.1, which is reproduced as SEQ ID NO: 4, below. A probe of the disclosure may, for example, be an oligonucleotide that can be used to detect the presence of an mRNA encoding CXCL12, or a fragment of such mRNA, such as by way of an RNA-Seq assay, PCR assay, or other RNA detection assay known in the art or described herein. Exemplary probes useful in conjunction with the compositions and methods of the disclosure for the detection of CXCL12 mRNA include oligonucleotides that anneal to an mRNA encoding CXCL12, such as an mRNA having the nucleic acid sequence of SEQ ID NO: 4, or a fragment thereof. Examples of probes useful in conjunction with the compositions and methods of the disclosure for the detection of CXCL12 mRNA include oligonucleotides that are at least 85% complementary (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary) to the nucleic acid sequence of an mRNA encoding CXCL12, such as an mRNA having the nucleic acid sequence of SEQ ID NO: 4, or a fragment thereof.
TABLE-US-00005 (SEQ ID NO: 4) TCTCCGTCAGCCGCATTGCCCGCTCGGCGTCCGGCCCCCGACCCGTGCTCGTCCGCCCGC CCGCCCGCCCGCCCGCGCCATGAACGCCAAGGTCGTGGTCGTGCTGGTCCTCGTGCTGAC CGCGCTCTGCCTCAGCGACGGGAAGCCCGTCAGCCTGAGCTACAGATGCCCATGCCGATT CTTCGAAAGCCATGTTGCCAGAGCCAACGTCAAGCATCTCAAAATTCTCAACACTCCAAA CTGTGCCCTTCAGATTGTAGCCCGGCTGAAGAACAACAACAGACAAGTGTGCATTGACCC GAAGCTAAAGTGGATTCAGGAGTACCTGGAGAAAGCTTTAAACAAGAGGTTCAAGATGTG AGAGGGTCAGACGCCTGAGGAACCCTTACAGTAGGAGCCCAGCTCTGAAACCAGTGTTAG GGAAGGGCCTGCCACAGCCTCCCCTGCCAGGGCAGGGCCCCAGGCATTGCCAAGGGCTTT GTTTTGCACACTTTGCCATATTTTCACCATTTGATTATGTAGCAAAATACATGACATTTA TTTTTCATTTAGTTTGATTATTCAGTGTCACTGGCGACACGTAGCAGCTTAGACTAAGGC CATTATTGTACTTGCCTTATTAGAGTGTCTTTCCACGGAGCCACTCCTCTGACTCAGGGC TCCTGGGTTTTGTATTCTCTGAGCTGTGCAGGTGGGGAGACTGGGCTGAGGGAGCCTGGC CCCATGGTCAGCCCTAGGGTGGAGAGCCACCAAGAGGGACGCCTGGGGGTGCCAGGACCA GTCAACCTGGGCAAAGCCTAGTGAAGGCTTCTCTCTGTGGGATGGGATGGTGGAGGGCCA CATGGGAGGCTCACCCCCTTCTCCATCCACATGGGAGCCGGGTCTGCCTCTTCTGGGAGG GCAGCAGGGCTACCCTGAGCTGAGGCAGCAGTGTGAGGCCAGGGCAGAGTGAGACCCAGC CCTCATCCCGAGCACCTCCACATCCTCCACGTTCTGCTCATCATTCTCTGTCTCATCCAT CATCATGTGTGTCCACGACTGTCTCCATGGCCCCGCAAAAGGACTCTCAGGACCAAAGCT TTCATGTAAACTGTGCACCAAGCAGGAAATGAAAATGTCTTGTGTTACCTGAAAACACTG TGCACATCTGTGTCTTGTGTGGAATATTGTCCATTGTCCAATCCTATGTTTTTGTTCAAA GCCAGCGTCCTCCTCTGTGACCAATGTCTTGATGCATGCACTGTTCCCCCTGTGCAGCCG CTGAGCGAGGAGATGCTCCTTGGGCCCTTTGAGTGCAGTCCTGATCAGAGCCGTGGTCCT TTGGGGTGAACTACCTTGGTTCCCCCACTGATCACAAAAACATGGTGGGTCCATGGGCAG AGCCCAAGGGAATTCGGTGTGCACCAGGGTTGACCCCAGAGGATTGCTGCCCCATCAGTG CTCCCTCACATGTCAGTACCTTCAAACTAGGGCCAAGCCCAGCACTGCTTGAGGAAAACA AGCATTCACAACTTGTTTTTGGTTTTTAAAACCCAGTCCACAAAATAACCAATCCTGGAC ATGAAGATTCTTTCCCAATTCACATCTAACCTCATCTTCTTCACCATTTGGCAATGCCAT CATCTCCTGCCTTCCTCCTGGGCCCTCTCTGCTCTGCGTGTCACCTGTGCTTCGGGCCCT TCCCACAGGACATTTCTCTAAGAGAACAATGTGCTATGTGAAGAGTAAGTCAACCTGCCT GACATTTGGAGTGTTCCCCTCCCACTGAGGGCAGTCGATAGAGCTGTATTAAGCCACTTA AAATGTTCACTTTTGACAAAGGCAAGCACTTGTGGGTTTTTGTTTTGTTTTTCATTCAGT CTTACGAATACTTTTGCCCTTTGATTAAAGACTCCAGTTAAAAAAAATTTTAATGAAGAA AGTGGAAAACAAGGAAGTCAAAGCAAGGAAACTATGTAACATGTAGGAAGTAGGAAGTAA ATTATAGTGATGTAATCTTGAATTGTAACTGTTCGTGAATTTAATAATCTGTAGGGTAAT TAGTAACATGTGTTAAGTATTTTCATAAGTATTTCAAATTGGAGCTTCATGGCAGAAGGC AAACCCATCAACAAAAATTGTCCCTTAAACAAAAATTAAAATCCTCAATCCAGCTATGTT ATATTGAAAAAATAGAGCCTGAGGGATCTTTACTAGTTATAAAGATACAGAACTCTTTCA AAACCTTTTGAAATTAACCTCTCACTATACCAGTATAATTGAGTTTTCAGTGGGGCAGTC ATTATCCAGGTAATCCAAGATATTTTAAAATCTGTCACGTAGAACTTGGATGTACCTGCC CCCAATCCATGAACCAAGACCATTGAATTCTTGGTTGAGGAAACAAACATGACCCTAAAT CTTGACTACAGTCAGGAAAGGAATCATTTCTATTTCTCCTCCATGGGAGAAAATAGATAA GAGTAGAAACTGCAGGGAAAATTATTTGCATAACAATTCCTCTACTAACAATCAGCTCCT TCCTGGAGACTGCCCAGCTAAAGCAATATGCATTTAAATACAGTCTTCCATTTGCAAGGG AAAAGTCTCTTGTAATCCGAATCTCTTTTTGCTTTCGAACTGCTAGTCAAGTGCGTCCAC GAGCTGTTTACTAGGGATCCCTCATCTGTCCCTCCGGGACCTGGTGCTGCCTCTACCTGA CACTCCCTTGGGCTCCCTGTAACCTCTTCAGAGGCCCTCGCTGCCAGCTCTGTATCAGGA CCCAGAGGAAGGGGCCAGAGGCTCGTTGACTGGCTGTGTGTTGGGATTGAGTCTGTGCCA CGTGTATGTGCTGTGGTGTGTCCCCCTCTGTCCAGGCACTGAGATACCAGCGAGGAGGCT CCAGAGGGCACTCTGCTTGTTATTAGAGATTACCTCCTGAGAAAAAAGCTTCCGCTTGGA GCAGAGGGGCTGAATAGCAGAAGGTTGCACCTCCCCCAACCTTAGATGTTCTAAGTCTTT CCATTGGATCTCATTGGACCCTTCCATGGTGTGATCGTCTGACTGGTGTTATCACCGTGG GCTCCCTGACTGGGAGTTGATCGCCTTTCCCAGGTGCTACACCCTTTTCCAGCTGGATGA GAATTTGAGTGCTCTGATCCCTCTACAGAGCTTCCCTGACTCATTCTGAAGGAGCCCCAT TCCTGGGAAATATTCCCTAGAAACTTCCAAATCCCCTAAGCAGACCACTGATAAAACCAT GTAGAAAATTTGTTATTTTGCAACCTCGCTGGACTCTCAGTCTCTGAGCAGTGAATGATT CAGTGTTAAATGTGATGAATACTGTATTTTGTATTGTTTCAAGTGCATCTCCCAGATAAT GTGAAAATGGTCCAGGAGAAGGCCAATTCCTATACGCAGCGTGCTTTAAAAAATAAATAA GAAACAACTCTTTGAGAAACAACAATTTCTACTTTGAAGTCATACCAATGAAAAAATGTA TATGCACTTATAATTTTCCTAATAAAGTTCTGTACTCAAATGTA
TNXB
[0532] Using the compositions and methods of the disclosure, a probe (e.g., an oligonucleotide or antibody, among other probes described herein) may be used to detect expression of TNXB. An exemplary mRNA nucleic acid sequence encoding TNXB is set forth in ENA Sequence U24488.1, which is reproduced as SEQ ID NO: 5, below. A probe of the disclosure may, for example, be an oligonucleotide that can be used to detect the presence of an mRNA encoding TNXB, or a fragment of such mRNA, such as by way of an RNA-Seq assay, PCR assay, or other RNA detection assay known in the art or described herein. Exemplary probes useful in conjunction with the compositions and methods of the disclosure for the detection of TNXB mRNA include oligonucleotides that anneal to an mRNA encoding TNXB, such as an mRNA having the nucleic acid sequence of SEQ ID NO: 5, or a fragment thereof. Examples of probes useful in conjunction with the compositions and methods of the disclosure for the detection of TNXB mRNA include oligonucleotides that are at least 85% complementary (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary) to the nucleic acid sequence of an mRNA encoding TNXB, such as an mRNA having the nucleic acid sequence of SEQ ID NO: 5, or a fragment thereof.
TABLE-US-00006 (SEQ ID NO: 5) CCTTGTGCATTTGGTCTGAAGACAAAGATGACTGCAGGAGTGGGCAGGCCGGAGTGGGGG TGACCTGGCCTGTGCCAGGAAGGAGGAGGAGTCTGCAGCCCTGTGCGGTTCAACATCCAT CAAGGAGTCCAGAGCAGGAGCCAGGCCAGGCGGGAGGGAAAGGCCCTGGGAGGGGCTCTC TAATCTCCCAGCCCCGACTCTGCCCCGTCACTGCCGCTGCTCCTCATTACTCGCTGGGGC TGCTGTCGCCTCCCCGAAGGGTGGCCTTGTCCAGATAGTGGCAAACCTCCCTGCCGTGGA TGAGTCAGGAGCATTTTCTTAAGAGGAACATCACTGGAAAACAAAATGAGCGGGGACACA GAAACCAACAGCAGTGGCTGCATTTGTGGTACAGGCTCCTCTTCCAGAGCTCGCTGATGC CCACCTCAGACAGGCCTGACCACGGCACGGCTGGTGGGATTTGCCAGTCACCTCAACCAG CCAGTTCCACCCTCAGCTTCTCTCAGAAGGGAGCACCACACTCCTCAAGCTCAGTGAATG TATCCCGGCATGGGTGGGGCCAGAGCCTGTGATATCTCGAGGTGGGCTCGGCAGGACACC GGGGTGTGGAAGGGGGAAGCGAGCACCTGACTCAGACAGCGCGGGAGCTCGCAGGAGTCA CGAGGCCACAGCGACTTCATTGTCTGACTGGGCCTGGACCTATAAACTTCCCACCTCAGC CTTGGGCCAAGCCTGGAAGATAAAAATGGAGCACCCCATGGCGCCCCTCACTCAGATTCT CCCCTGGGCTTCTCCCACGCAGCCCCAGAAGAGGACACACCAGCCCCAGAGTTAGCCCCA GAGGCCCCTGAGCCTCCTGAAGAGCCCCGCCTAGGAGTGCTGACCGTGACCGACACAACC CCAGACTCCATGCGCCTCTCGTGGAGCGTGGCCCAGGGCCCCTTTGATTCCTTCGTGGTC CAGTATGAGGACACGAACGGGCAGCCCCAGGCCTTGCTCGTGGACGGCGACCAGAGCAAG ATCCTCATCTCAGGCCTGGAGCCCAGCACCCCCTACAGGTTCCTCCTCTATGGCCTCCAT GAAGGGAAGCGCCTGGGGCCCCTCTCAGCTGAGGGCACCACAGGGCTGGCTCCTGCTGGT CAGACCTCAGAGGAGTCAAGGCCCCGCCTGTCCCAGCTGTCTGTGACTGACGTGACCACC AGTTCACTGAGGCTCAACTGGGAGGCCCCACCGGGGGCCTTCGACTCCTTCCTGCTCCGC TTTGGGGTTCCATCACCAAGCACTCTGGAGCCGCATCCGCGTCCACTGCTGCAGCGCGAG CTGATGGTGCCGGGGACGCGGCACTCGGCCGTGCTCCGGGACCTGCGTTCCGGGACTCTG TACAGCCTGACACTGTATGGGCTGCGAGGACCCCACAAGGCCGACAGCATCCAGGGAACC GCCCGCACCCTCAGCCCAGTTCTGGAGAGCCCCCGTGACCTCCAATTCAGTGAAATCAGG GAGACCTCAGCCAAGGTCAACTGGATGCCCCCACCATCCCGGGCGGACAGCTTCAAAGTC TCCTACCAGCTGGCGGACGGAGGGGAGCCTCAGAGTGTGCAGGTGGATGGCCAGGCCCGG ACCCAGAAACTCCAGGGGCTGATCCCAGGCGCTCGCTATGAGGTGACCGTGGTCTCGGTC CGAGGCTTTGAGGAGAGTGAGCCTCTCACAGGCTTCCTCACCACGGTTCCTGACGGTCCC ACACAGTTGCGTGCACTGAACTTGACCGAGGGATTCGCCGTGCTGCACTGGAAGCCCCCC CAGAATCCTGTGGACACCTATGACGTCCAGGTCACAGCCCCTGGGGCCCCGCCTCTGCAG GCGGAGACCCCAGGCAGCGCGGTGGACTACCCCCTGCATGACCTTGTCCTCCACACCAAC TACACCGCCACAGTGCGTGGCCTGCGGGGCCCCAACCTCACTTCCCCAGCCAGCATCACC TTCACCACAGGGCTAGAGGCCCCTCGGGACTTGGAGGCCAAGGAAGTGACCCCCCGCACC GCCCTGCTCACTTGGACTGAGCCCCCAGTCCGGCCCGCAGGCTACCTGCTCAGCTTCCAC ACCCCTGGTGGACAGAACCAGGAGATCCTGCTCCCAGGAGGGATCACATCTCACCAGCTC CTTGGCCTCTTTGGGTCCACCTCCTACAATGCACGGCTCCAGGCCATGTGGGGCCAGAGC CTCCTGCCGCCCGTGTCCACCTCTTTCACCACGGGTGGGCTGCGGATCCCCTTCCCCAGG GACTGCGGGGAGGAGATGCAGAACGGAGCCGGTGCCTCCAGGACCAGCACCATCTTCCTC AACGGCAACCGCGAGCGGCCCCTGAACGTGTTTTGCGACATGGAGACTGATGGGGGCGGC TGGCTGGTGTTCCAGCGCCGCATGGATGGACAGACAGACTTCTGGAGGGACTGGGAGGAC TATGCCCATGGTTTTGGGAACATCTCTGGAGAGTTCTGGCTGGGCAATGAGGCCCTGCAC AGCCTGACACAGGCAGGTGACTACTCCATCCGCGTGGACCTGCGGGCTGGGGACGAGGCT GTGTTCGCCCAGTACGACTCCTTCCACGTAGACTCGGCTGCGGAGTACTACCGCCTCCAC TTGGAGGGCTACCACGGCACCGCAGGGGACTCCATGAGCTACCACAGCGGCAGTGTCTTC TCTGCCCGTGATCGGGACCCCAACAGCTTGCTCATCTCCTGCGCTGTCTCCTACCGAGGG GCCTGGTGGTACAGGAACTGCCACTACGCCAACCTCAACGGGCTCTACGGGAGCACAGTG GACCATCAGGGAGTGAGCTGGTACCACTGGAAGGGCTTCGAGTTCTCGGTGCCCTTCACG GAAATGAAGCTGAGACCAAGAAACTTTCGCTCCCCAGCGGGGGGAGGCTGAGCTGCTGCC CACCTCTCTCGCACCCCAGTATGACTGCCGAGCACTGAGGGGTCGCCCCGAGAGAAGAGC CAGGGTCCTTCACCACCCAGCCGCTGGAGGAAGCCTTCTCTGCCAGCGATCTCGCAGCAC TGTGTTTACAGGGGGGAGGGGAGGGGTTCGTACAGGAGCAATAAAGGAGAAACTGAGGTA CCCGAAAA
CTSE
[0533] Using the compositions and methods of the disclosure, a probe (e.g., an oligonucleotide or antibody, among other probes described herein) may be used to detect expression of CTSE. An exemplary mRNA nucleic acid sequence encoding CTSE is set forth in ENA Sequence J05036.1, which is reproduced as SEQ ID NO: 6, below. A probe of the disclosure may, for example, be an oligonucleotide that can be used to detect the presence of an mRNA encoding CTSE, or a fragment of such mRNA, such as by way of an RNA-Seq assay, PCR assay, or other RNA detection assay known in the art or described herein. Exemplary probes useful in conjunction with the compositions and methods of the disclosure for the detection of CTSE mRNA include oligonucleotides that anneal to an mRNA encoding CTSE, such as an mRNA having the nucleic acid sequence of SEQ ID NO: 6, or a fragment thereof. Examples of probes useful in conjunction with the compositions and methods of the disclosure for the detection of CTSE mRNA include oligonucleotides that are at least 85% complementary (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary) to the nucleic acid sequence of an mRNA encoding CTSE, such as an mRNA having the nucleic acid sequence of SEQ ID NO: 6, or a fragment thereof.
TABLE-US-00007 (SEQ ID NO: 6) GGAGAGAAGAAAGGAGGGGGCAAGGGAGAAGCTGCTGGTCGGACTCACAATGAAAAGGCT CCTTCTTTTGCTGCTGGTGCTCCTGGAGCTGGGAGAGGCCCAAGGATCCCTTCACAGGGT GCCCCTCAGGAGGCATCCGTCCCTCAAGAAGAAGCTGCGGGCACGGAGCCAGCTCTCTGA GTTCTGGAAATCCCATAATTTGGACATGATCCAGTTCACCGAGTCCTGCTCAATGGACCA GAGTGCCAAGGAACCCCTCATCAACTACTTGGATATGGAATACTTCGGCACTATCTCCAT TGGCTCCCCACCACAGAACTTCACTGTCATCTTCGACACTGGCTCCTCCAACCTCTGGGT CCCCTCTGTGTACTGCACTAGCCCAGCCTGCAAGACGCACAGCAGGTTCCAGCCTTCCCA GTCCAGCACATACAGCCAGCCAGGTCAATCTTTCTCCATTCAGTATGGAACCGGGAGCTT GTCCGGGATCATTGGAGCCGACCAAGTCTCTGTGGAAGGACTAACCGTGGTTGGCCAGCA GTTTGGAGAAAGTGTCACAGAGCCAGGCCAGACCTTTGTGGATGCAGAGTTTGATGGAAT TCTGGGCCTGGGATACCCCTCCTTGGCTGTGGGAGGAGTGACTCCAGTATTTGACAACAT GATGGCTCAGAACCTGGTGGACTTGCCGATGTTTTCTGTCTACATGAGCAGTAACCCAGA AGGTGGTGCGGGGAGCGAGCTGATTTTTGGAGGCTACGACCACTCCCATTTCTCTGGGAG CCTGAATTGGGTCCCAGTCACCAAGCAAGCTTACTGGCAGATTGCACTGGATAACATCCA GGTGGGAGGCACTGTTATGTTCTGCTCCGAGGGCTGCCAGGCCATTGTGGACACAGGGAC TTCCCTCATCACTGGCCCTTCCGACAAGATTAAGCAGCTGCAAAACGCCATTGGGGCAGC CCCCGTGGATGGAGAATATGCTGTGGAGTGTGCCAACCTTAACGTCATGCCGGATGTCAC CTTCACCATTAACGGAGTCCCCTATACCCTCAGCCCAACTGCCTACACCCTACTGGACTT CGTGGATGGAATGCAGTTCTGCAGCAGTGGCTTTCAAGGACTTGACATCCACCCTCCAGC TGGGCCCCTCTGGATCCTGGGGGATGTCTTCATTCGACAGTTTTACTCAGTCTTTGACCG TGGGAATAACCGTGTGGGACTGGCCCCAGCAGTCCCCTAAGGAGGGGCCTTGTGTCTGTG CCTGCCTGTCTGACAGACCTTGAATATGTTAGGCTGGGGCATTCTTTACACCTACAAAAA GTTATTTTCCAGAGAATGTAGCTGTTTCCAGGGTTGCAACTTGAATTAAGACCAAACAGA ACATGAGAATACACACACACACACACATATACACACACACACACTTCACACATACACACC ACTCCCACCACCGTCATGATGGAGGAATTAGGTTATACATTCATATTTTGTATTGATTTT TGATTATGAAAATCAAAAATTTTCACATTTGATTATGAAAATCTCCAAACATATGCACAA GCAGAGATCATGGTATAATAAATCCCTTTGCAACTCCACTCAGCCCTGACAACCCATCCA CACACGGCCAGGCCTGTTTATCTACACTGCTGCCCACTCCTCTCTCCAGCTCCACATGCT GTACCTGGATCATTCTGAAGCAAATTCCGAGCATTACATCATTTTGTCCATAAATATTTC TAACATCCTTAAATATACAATCGGAATTCAAGCATCTCCCATTGTCCCACAAATGTTTGG CTGTTTTTGTAGTTGGATTGTTTGTATTAGGATTCAAGCAAGGCCCATATATTGCATTTA TTTGAAATGTCTGTAAGTCTCTTTCCATCTACAGAGTTTAGCACATTTGAACGTTGCTGG TTGAAATCCCGAGGTGTCATTTGACATGGTTCTCTGAACTTATCTTTCCTATAAAATGGT AGTTAGATCTGGAGGTCTGATTTTGTGGCAAAAATACTTCCTAGGTGGTGCTGGGTACTT CTTGTTGCATCCTGTCAGGAGGCAGATAATGCTGGTGCCTCTCTATTGGTAATGTTAAGA CTGCTGGGTGGGTTTGGAGTTCTTGGCTTTAATCATTCATTACAAAGTTCAGCATTTT
OLFM4
[0534] Using the compositions and methods of the disclosure, a probe (e.g., an oligonucleotide or antibody, among other probes described herein) may be used to detect expression of OLFM4. An exemplary mRNA nucleic acid sequence encoding OLFM4 is set forth in ENA Sequence AY358567.1, which is reproduced as SEQ ID NO: 7, below. A probe of the disclosure may, for example, be an oligonucleotide that can be used to detect the presence of an mRNA encoding OLFM4, or a fragment of such mRNA, such as by way of an RNA-Seq assay, PCR assay, or other RNA detection assay known in the art or described herein. Exemplary probes useful in conjunction with the compositions and methods of the disclosure for the detection of OLFM4 mRNA include oligonucleotides that anneal to an mRNA encoding OLFM4, such as an mRNA having the nucleic acid sequence of SEQ ID NO: 7, or a fragment thereof. Examples of probes useful in conjunction with the compositions and methods of the disclosure for the detection of OLFM4 mRNA include oligonucleotides that are at least 85% complementary (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary) to the nucleic acid sequence of an mRNA encoding OLFM4, such as an mRNA having the nucleic acid sequence of SEQ ID NO: 7, or a fragment thereof.
TABLE-US-00008 (SEQ ID NO: 7) CTAAGAGGACAAGATGAGGCCCGGCCTCTCATTTCTCCTAGCCCTTCTGTTCTTCCTTGG CCAAGCTGCAGGGGATTTGGGGGATGTGGGACCTCCAATTCCCAGCCCCGGCTTCAGCTC TTTCCCAGGTGTTGACTCCAGCTCCAGCTTCAGCTCCAGCTCCAGGTCGGGCTCCAGCTC CAGCCGCAGCTTAGGCAGCGGAGGTTCTGTGTCCCAGTTGTTTTCCAATTTCACCGGCTC CGTGGATGACCGTGGGACCTGCCAGTGCTCTGTTTCCCTGCCAGACACCACCTTTCCCGT GGACAGAGTGGAACGCTTGGAATTCACAGCTCATGTTCTTTCTCAGAAGTTTGAGAAAGA ACTTTCTAAAGTGAGGGAATATGTCCAATTAATTAGTGTGTATGAAAAGAAACTGTTAAA CCTAACTGTCCGAATTGACATCATGGAGAAGGATACCATTTCTTACACTGAACTGGACTT CGAGCTGATCAAGGTAGAAGTGAAGGAGATGGAAAAACTGGTCATACAGCTGAAGGAGAG TTTTGGTGGAAGCTCAGAAATTGTTGACCAGCTGGAGGTGGAGATAAGAAATATGACTCT CTTGGTAGAGAAGCTTGAGACACTAGACAAAAACAATGTCCTTGCCATTCGCCGAGAAAT CGTGGCTCTGAAGACCAAGCTGAAAGAGTGTGAGGCCTCTAAAGATCAAAACACCCCTGT CGTCCACCCTCCTCCCACTCCAGGGAGCTGTGGTCATGGTGGTGTGGTGAACATCAGCAA ACCGTCTGTGGTTCAGCTCAACTGGAGAGGGTTTTCTTATCTATATGGTGCTTGGGGTAG GGATTACTCTCCCCAGCATCCAAACAAAGGACTGTATTGGGTGGCGCCATTGAATACAGA TGGGAGACTGTTGGAGTATTATAGACTGTACAACACACTGGATGATTTGCTATTGTATAT AAATGCTCGAGAGTTGCGGATCACCTATGGCCAAGGTAGTGGTACAGCAGTTTACAACAA CAACATGTACGTCAACATGTACAACACCGGGAATATTGCCAGAGTTAACCTGACCACCAA CACGATTGCTGTGACTCAAACTCTCCCTAATGCTGCCTATAATAACCGCTTTTCATATGC TAATGTTGCTTGGCAAGATATTGACTTTGCTGTGGATGAGAATGGATTGTGGGTTATTTA TTCAACTGAAGCCAGCACTGGTAACATGGTGATTAGTAAACTCAATGACACCACACTTCA GGTGCTAAACACTTGGTATACCAAGCAGTATAAACCATCTGCTTCTAACGCCTTCATGGT ATGTGGGGTTCTGTATGCCACCCGTACTATGAACACCAGAACAGAAGAGATTTTTTACTA TTATGACACAAACACAGGGAAAGAGGGCAAACTAGACATTGTAATGCATAAGATGCAGGA AAAAGTGCAGAGCATTAACTATAACCCTTTTGACCAGAAACTTTATGTCTATAACGATGG TTACCTTCTGAATTATGATCTTTCTGTCTTGCAGAAGCCCCAGTAAGCTGTTTAGGAGTT AGGGTGAAAGAGAAAATGTTTGTTGAAAAAATAGTCTTCTCCACTTACTTAGATATCTGC AGGGGTGTCTAAAAGTGTGTTCATTTTGCAGCAATGTTTAGGTGCATAGTTCTACCACAC TAGAGATCTAGGACATTTGTCTTGATTTGGTGAGTTCTCTTGGGAATCATCTGCCTCTTC AGGCGCATTTTGCAATAAAGTCTGTCTAGGGTGGGATTGTCAGAGGTCTAGGGGCACTGT GGGCCTAGTGAAGCCTACTGTGAGGAGGCTTCACTAGAAGCCTTAAATTAGGAATTAAGG AACTTAAAACTCAGTATGGCGTCTAGGGATTCTTTGTACAGGAAATATTGCCCAATGACT AGTCCTCATCCATGTAGCACCACTAATTCTTCCATGCCTGGAAGAAACCTGGGGACTTAG TTAGGTAGATTAATATCTGGAGCTCCTCGAGGGACCAAATCTCCAACTTTTTTTTCCCCT CACTAGCACCTGGAATGATGCTTTGTATGTGGCAGATAAGTAAATTTGGCATGCTTATAT ATTCTACATCTGTAAAGTGCTGAGTTTTATGGAGAGAGGCCTTTTTATGCATTAAATTGT ACATGGCAAATAAATCCCAGAAGGATCTGTAGATGAGGCACCTGCTTTTTCTTTTCTCTC ATTGTCCACCTTACTAAAAGTCAGTAGAATCTTCTACCTCATAACTTCCTTCCAAAGGCA GCTCAGAAGATTAGAACCAGACTTACTAACCAATTCCACCCCCCACCAACCCCCTTCTAC TGCCTACTTTAAAAAAATTAATAGTTTTCTATGGAACTGATCTAAGATTAGAAAAATTAA TTTTCTTTAATTTCATTATGGACTTTTATTTACATGACTCTAAGACTATAAGAAAATCTG ATGGCAGTGACAAAGTGCTAGCATTTATTGTTATCTAATAAAGACCTTGGAGCATATGTG CAACTTATGAGTGTATCAGTTGTTGCATGTAATTTTTGCCTTTGTTTAAGCCTGGAACTT GTAAGAAAATGAAAATTTAATTTTTTTTTCTAGGACGAGCTATAGAAAAGCTATTGAGAG TATCTAGTTAATCAGTGCAGTAGTTGGAAACCTTGCTGGTGTATGTGATGTGCTTCTGTG CTTTTGAATGACTTTATCATCTAGTCTTTGTCTATTTTTCCTTTGATGTTCAAGTCCTAG TCTATAGGATTGGCAGTTTAAATGCTTTACTCCCCCTTTTAAAATAAATGATTAAAATGT GCTTTGAAAAAAAAAAAAAAAAAAAAAAAAAAAA
KRT5
[0535] Using the compositions and methods of the disclosure, a probe (e.g., an oligonucleotide or antibody, among other probes described herein) may be used to detect expression of KRT5. An exemplary mRNA nucleic acid sequence encoding KRT5 is set forth in ENA Sequence M21389.1, which is reproduced as SEQ ID NO: 8, below. A probe of the disclosure may, for example, be an oligonucleotide that can be used to detect the presence of an mRNA encoding KRT5, or a fragment of such mRNA, such as by way of an RNA-Seq assay, PCR assay, or other RNA detection assay known in the art or described herein. Exemplary probes useful in conjunction with the compositions and methods of the disclosure for the detection of KRT5 mRNA include oligonucleotides that anneal to an mRNA encoding KRT5, such as an mRNA having the nucleic acid sequence of SEQ ID NO: 8, or a fragment thereof. Examples of probes useful in conjunction with the compositions and methods of the disclosure for the detection of KRT5 mRNA include oligonucleotides that are at least 85% complementary (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary) to the nucleic acid sequence of an mRNA encoding KRT5, such as an mRNA having the nucleic acid sequence of SEQ ID NO: 8, or a fragment thereof.
TABLE-US-00009 (SEQ ID NO: 8) GCATCCTTTTTGGGCTGCTCACAGCCCCCAGCCTCTATGGTGAAGACATACTTGCTAGCA GCGTCACCAACTTGCTGCCAAGAGATCAGTGCTGCAAGGCAAGGTTATTTCTAACTGAGC AGAGCCTGCCAGGAAGAAAGCGTTTGCACCCCACACCACTGTGCAGGTGTGACCGGTGAG CTCACAGCTGCCCCCCAGGCATGCCCAGCCCACTTAATCATTCACAGCTCGACAGCTCTC TCGCCCAGCCCAGTTCTGGAAGGGATAAAAAGGGGGCATCACCGTTCCTGGGTAACAGAG CCACCTTCTGCGTCCTGCTGAGCTCTGTTCTCTCCAGCACCTCCCAACCCACTAGTGCCT GGTTCTCTTGCTCCACCAGGAACAAGCCACCATGTCTCGCCAGTCAAGTGTGTCCTTCCG GAGCGGGGGCAGTCGTAGCTTCAGCACCGCCTCTGCCATCACCCCGTCTGTCTCCCGCAC CAGCTTCACCTCCGTGTCCCGGTCCGGGGGTGGCGGTGGTGGTGGCTTCGGCAGGGTCAG CCTTGCGGGTGCTTGTGGAGTGGGTGGCTATGGCAGCCGGAGCCTCTACAACCTGGGGGG CTCCAAGAGGATATCCATCAGCACTAGAGGAGGCAGCTTCAGGAACCGGTTTGGTGCTGG TGCTGGAGGCGGCTATGGCTTTGGAGGTGGTGCCGGTAGTGGATTTGGTTTCGGCGGTGG AGCTGGTGGTGGCTTTGGGCTCGGTGGCGGAGCTGGCTTTGGAGGTGGCTTCGGTGGCCC TGGCTTTCCTGTCTGCCCTCCTGGAGGTATCCAAGAGGTCACTGTCAACCAGAGTCTCCT GACTCCCCTCAACCTGCAAATCGACCCCAGCATCCAGAGGGTGAGGACCGAGGAGCGCGA GCAGATCAAGACCCTCAACAATAAGTTTGCCTCCTTCATCGACAAGGTGCGGTTCCTGGA GCAGCAGAACAAGGTTCTGGACACCAAGTGGACCCTGCTGCAGGAGCAGGGCACCAAGAC TGTGAGGCAGAACCTGGAGCCGTTGTTCGAGCAGTACATCAACAACCTCAGGAGGCAGCT GGACAGCATCGTGGGGGAACGGGGCCGCCTGGACTCAGAGCTGAGAAACATGCAGGACCT GGTGGAAGACTTCAAGAACAAGTATGAGGATGAAATCAACAAGCGTACCACTGOTGAGAA TGAGTTTGTGATGOTGAAGAAGGATGTAGATGOTGCCTACATGAACAAGGTGGAGCTGGA GGCCAAGGTTGATGCACTGATGGATGAGATTAACTTCATGAAGATGTTCTTTGATGCGGA GCTGTCCCAGATGCAGACGCATGTCTCTGACACCTCAGTGGTCCTCTCCATGGACAACAA CCGCAACCTGGACCTGGATAGCATCATCGCTGAGGTCAAGGCCCAGTATGAGGAGATTGC CAACCGCAGCCGGACAGAAGCCGAGTCCTGGTATCAGACCAAGTATGAGGAGCTGCAGCA GACAGCTGGCCGGCATGGCGATGACCTCCGCAACACCAAGCATGAGATCACAGAGATGAA CCGGATGATCCAGAGGCTGAGAGCCGAGATTGACAATGTCAAGAAACAGTGCGCCAATCT GCAGAACGCCATTGCGGATGCCGAGCAGCGTGGGGAGCTGGCCCTCAAGGATGCCAGGAA CAAGCTGGCCGAGCTGGAGGAGGCCCTGCAGAAGGCCAAGCAGGACATGGCCCGGCTGCT GCGTGAGTACCAGGAGCTCATGAACACCAAGCTGGCCCTGGACGTGGAGATCGCCACTTA CCGCAAGCTGCTGGAGGGCGAGGAATGCAGACTCAGTGGAGAAGGAGTTGGACCAGTCAA CATCTCTGTTGTCACAAGCAGTGTTTCCTCTGGATATGGCAGTGGCAGTGGCTATGGCGG TGGCCTCGGTGGAGGTCTTGGCGGCGGCCTCGGTGGAGGTCTTGCCGGAGGTAGCAGTGG AAGCTACTACTCCAGCAGCAGTGGGGGTGTCGGCCTAGGTGGTGGGCTCAGTGTGGGGGG CTCTGGCTTCAGTGCAAGCAGTGGCCGAGGGCTGGGGGTGGGCTTTGGCAGTGGCGGGGG TAGCAGCTCCAGCGTCAAATTTGTCTCCACCACCTCCTCCTCCCGGAAGAGCTTCAAGAG CTAAGAACCTGCTGCAAGTCACTGCCTTCCAAGTGCAGCAACCCAGCCCATGGAGATTGC CTCTTCTAGGCAGTTGCTCAAGCCATGTTTTATCCTTTTCTGGAGAGTAGTCTAGACCAA GCCAATTGCAGAACCACATTCTTTGGTTCCCAGGAGAGCCCCATTCCCAGCCCCTGGTCT CCCGTGCCGCAGTTCTATATTCTGCTTCAAATCAGCCTTCAGGTTTCCCACAGCATGGCC CCTGCTGACACGAGAACCCAAAGTTTTCCCAAATCTAAATCATCAAAACAGAATCCCCAC CCCAATCCCAAATTTTGTTTTGGTTCTAACTACCTCCAGAATGTGTTCAATAAAATGCTT TTATAATAT
KRT6A
[0536] Using the compositions and methods of the disclosure, a probe (e.g., an oligonucleotide or antibody, among other probes described herein) may be used to detect expression of KRT6A. An exemplary mRNA nucleic acid sequence encoding KRT6A is set forth in ENA Sequence BT006899.1, which is reproduced as SEQ ID NO: 9, below. A probe of the disclosure may, for example, be an oligonucleotide that can be used to detect the presence of an mRNA encoding KRT6A, or a fragment of such mRNA, such as by way of an RNA-Seq assay, PCR assay, or other RNA detection assay known in the art or described herein. Exemplary probes useful in conjunction with the compositions and methods of the disclosure for the detection of KRT6A mRNA include oligonucleotides that anneal to an mRNA encoding KRT6A, such as an mRNA having the nucleic acid sequence of SEQ ID NO: 9, or a fragment thereof. Examples of probes useful in conjunction with the compositions and methods of the disclosure for the detection of KRT6A mRNA include oligonucleotides that are at least 85% complementary (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary) to the nucleic acid sequence of an mRNA encoding KRT6A, such as an mRNA having the nucleic acid sequence of SEQ ID NO: 9, or a fragment thereof.
TABLE-US-00010 (SEQ ID NO: 9) ATGGCCAGCACATCCACCACCATCAGGAGCCACAGCAGCAGCCGCCGGGGTTTCAGTGCC AACTCAGCCAGGCTCCCTGGGGTCAGCCGCTCTGGCTTCAGCAGCGTCTCCGTGTCCCGC TCCAGGGGCAGTGGTGGCCTGGGTGGTGCATGTGGAGGAGCTGGCTTTGGCAGCCGCAGT CTGTATGGCCTGGGGGGCTCCAAGAGGATCTCCATTGGAGGGGGCAGCTGTGCCATCAGT GGCGGCTATGGCAGCAGAGCCGGAGGCAGCTATGGCTTTGGTGGCGCCGGGAGTGGATTT GGTTTCGGTGGTGGAGCCGGCATTGGCTTTGGTCTGGGTGGTGGAGCCGGCCTTGCTGGT GGCTTTGGGGGCCCTGGCTTCCCTGTGTGCCCCCCTGGAGGCATCCAAGAGGTCACCGTC AACCAGAGTCTCCTGACTCCCCTCAACCTGCAAATCGATCCCACCATCCAGCGGGTGCGG GCTGAGGAGCGTGAACAGATCAAGACCCTCAACAACAAGTTTGCCTCCTTCATCGACAAG GTGCGGTTCCTGGAGCAGCAGAACAAGGTTCTGGAAACAAAGTGGACCCTGCTGCAGGAG CAGGGCACCAAGACTGTGAGGCAGAACCTGGAGCCGTTGTTCGAGCAGTACATCAACAAC CTCAGGAGGCAGCTGGACAGCATTGTCGGGGAACGGGGCCGCCTGGACTCAGAGCTCAGA GGCATGCAGGACCTGGTGGAGGACTTCAAGAACAAATATGAGGATGAAATCAACAAGCGC ACAGCAGCAGAGAATGAATTTGTGACTCTGAAGAAGGATGTGGATGCTGCCTACATGAAC AAGGTTGAACTGCAAGCCAAGGCAGACACTCTCACAGACGAGATCAACTTCCTGAGAGCC TTGTATGATGCAGAGCTGTCCCAGATGCAGACCCACATCTCAGACACATCTGTGGTGCTG TCCATGGACAACAACCGCAACCTGGACCTGGACAGCATCATCGCTGAGGTCAAGGCCCAA TATGAGGAGATTGCTCAGAGAAGCCGGGCTGAGGCTGAGTCCTGGTACCAGACCAAGTAC GAGGAGCTGCAGGTCACAGCAGGCAGACATGGGGACGACCTGCGCAACACCAAGCAGGAG ATTGCTGAGATCAACCGCATGATCCAGAGGCTGAGATCTGAGATCGACCACGTCAAGAAG CAGTGCGCCAACCTGCAGGCCGCCATTGCTGATGCTGAGCAGCGTGGGGAGATGGCCCTC AAGGATGCCAAGAACAAGCTGGAAGGGCTGGAGGATGCCCTGCAGAAGGCCAAGCAGGAC CTGGCCCGGCTGCTGAAGGAGTACCAGGAGCTGATGAATGTCAAGCTGGCCCTGGACGTG GAGATCGCCACCTACCGCAAGCTGCTGGAGGGTGAGGAGTGCAGGCTGAATGGCGAAGGC GTTGGACAAGTCAACATCTCTGTGGTGCAGTCCACCGTCTCCAGTGGCTATGGCGGTGCC AGTGGTGTCGGCAGTGGCTTAGGCCTGGGTGGAGGAAGCAGCTACTCCTATGGCAGTGGT CTTGGCGTTGGAGGTGGCTTCAGTTCCAGCAGTGGCAGAGCCATTGGGGGTGGCCTCAGC TCTGTTGGAGGCGGCAGTTCCACCATCAAGTACACCACCACCTCCTCCTCCAGCAGGAAG AGCTATAAGCACTAG
IDO2
[0537] Using the compositions and methods of the disclosure, a probe (e.g., an oligonucleotide or antibody, among other probes described herein) may be used to detect expression of IDO2. An exemplary mRNA nucleic acid sequence encoding IDO2 is set forth in ENA Sequence EF052681.1, which is reproduced as SEQ ID NO: 10, below. A probe of the disclosure may, for example, be an oligonucleotide that can be used to detect the presence of an mRNA encoding IDO2, or a fragment of such mRNA, such as by way of an RNA-Seq assay, PCR assay, or other RNA detection assay known in the art or described herein. Exemplary probes useful in conjunction with the compositions and methods of the disclosure for the detection of IDO2 mRNA include oligonucleotides that anneal to an mRNA encoding IDO2, such as an mRNA having the nucleic acid sequence of SEQ ID NO: 10, or a fragment thereof. Examples of probes useful in conjunction with the compositions and methods of the disclosure for the detection of IDO2 mRNA include oligonucleotides that are at least 85% complementary (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary) to the nucleic acid sequence of an mRNA encoding IDO2, such as an mRNA having the nucleic acid sequence of SEQ ID NO: 10, or a fragment thereof.
TABLE-US-00011 (SEQ ID NO: 10) ATGGAGCCCCACAGACCGAATGTGAAGACAGCAGTGCCATTGTCTTTGGAAAGCTATCAC ATATCTGAAGAGTATGGCTTTCTTCTTCCAGATTCTCTGAAAGAACTTCCAGATCATTAT AGGCCTTGGATGGAAATTGCCAACAAACTTCCTCAATTGATTGATGCTCACCAGCTTCAA GCTCATGTGGACAAGATGCCCCTGCTGAGCTGCCAGTTCCTGAAGGGTCACCGGGAGCAG CGCCTGGCCCACCTGGTCCTGAGCTTCCTCACCATGGGTTATGTCTGGCAGGAAGGAGAG GCGCAGCCTGCAGAGGTCCTGCCAAGGAATCTTGCCCTTCCATTTGTCGAAGTCTCCAGG AACTTGGGGCTCCCTCCTATCCTGGTCCACTCAGACTTGGTGCTGACGAACTGGACCAAA AAAGATCCAGACGGATTCCTGGAAATTGGGAACCTGGAGACCATCATCTCATTTCCTGGG GGAGAGAGCCTGCATGGTTTTATACTGGTGACTGCTTTGGTAGAGAAAGAAGCAGTGCCT GGGATAAAGGCTCTTGTTCAGGCCACGAATGCTATCTTGCAGCCCAACCAGGAGGCCCTG CTCCAAGCCCTGCAGCGACTGAGACTGTCTATTCAGGACATCACCAAAACCTTAGGACAG ATGCATGATTATGTAGATCCAGACATATTTTATGCAGGCATCCGGATCTTTCTCTCTGGA TGGAAAGACAACCCAGCAATGCCTGCAGGGCTGATGTATGAAGGAGTTTCCCAAGAGCCC CTGAAATACTCCGGCGGGAGTGCAGCTCAGAGCACAGTGCTTCATGCCTTTGATGAGTTC TTAGGCATTCGTCATAGCAAGGAAAGTGGTGACTTTCTGTACAGAATGAGGGATTACATG CCTCCTTCCCATAAGGCCTTCATAGAAGACATCCACTCAGCACCTTCCCTGAGGGACTAC ATCCTGTCCTCTGGACAGGACCACTTGCTGACAGCTTATAACCAGTGTGTGCAGGCCCTG GCAGAGCTGCGGAGCTATCACATCACCATGGTCACCAAATACCTCATCACAGCTGCAGCC AAGGCAAAGCATGGGAAGCCAAACCATCTCCCAGGGCCTCCTCAGGCTTTAAAAGACAGG GGCACAGGTGGAACCGCAGTTATGAGCTTTCTTAAGAGTGTCAGGGATAAGACCTTGGAG TCAATCCTTCACCCACGTGGTTAGGAG
Nucleic Acid Detection
[0538] In some embodiments of any of the aspects or embodiments of the disclosure, the expression level of a gene of interest is measured by evaluating RNA (e.g., mRNA) expression. Nucleic acid-based methods for detection of RNA transcript expression include imaging-based techniques (e.g., Northern blotting or Southern blotting). For example, Northern blot analysis is a conventional technique well known in the art and is described, for example, in Molecular Cloning, a Laboratory Manual, second edition, 1989, Sambrook, Fritch, Maniatis, Cold Spring Harbor Press, 10 Skyline Drive, Plainview, N.Y. 11803-2500. Typical protocols for evaluating the status of genes and gene products are found, for example in Ausubel et al., eds., 1995, Current Protocols In Molecular Biology, Units 2 (Northern Blotting), 4 (Southern Blotting), 15 (Immunoblotting) and 18 (PCR Analysis) .
[0539] RNA detection techniques that may be used in conjunction with the compositions and methods described herein further include microarray sequencing experiments (e.g., Sanger sequencing and next-generation sequencing methods, also known as high-throughput sequencing or deep sequencing). Exemplary next generation sequencing technologies include, without limitation, Illumina sequencing, Ion Torrent sequencing, 454 sequencing, SOLiD sequencing, and nanopore sequencing platforms. Additional methods of sequencing known in the art can also be used. For example, transgene expression at the mRNA level may be determined using RNA-Seq (e.g., as described in Mortazavi et al., Nat. Methods 5:621-628 (2008), the disclosure of which is incorporated herein by reference in their entirety). RNA-Seq is a robust technology for monitoring expression by direct sequencing the RNA molecules in a sample. Briefly, this methodology may involve fragmentation of RNA to an average length of 200 nucleotides, conversion to cDNA by random priming, and synthesis of double-stranded cDNA (e.g., using the Just cDNA DoubleStranded cDNA Synthesis Kit from Agilent Technology®). Then, the cDNA is converted into a molecular library for sequencing by addition of sequence adapters for each library (e.g., from Illumina®/Solexa), and the resulting 50-100 nucleotide reads are mapped onto the genome.
[0540] RNA expression levels may also be determined using microarray-based platforms (e.g., single nucleotide polymorphism arrays), as microarray technology offers high resolution. Details of various microarray methods can be found in the literature. See, for example, U.S. Pat. No. 6,232,068 and Pollack et al., Nat. Genet. 23:41-46 (1999), the disclosures of each of which are incorporated herein by reference in their entirety. Using nucleic acid microarrays, mRNA samples are reverse transcribed and labeled to generate cDNA. The probes can then hybridize to one or more complementary nucleic acids arrayed and immobilized on a solid support. The array can be configured, for example, such that the sequence and position of each member of the array is known. Hybridization of a labeled probe with a particular array member indicates that the sample from which the probe was derived expresses that gene. Expression level may be quantified according to the amount of signal detected from hybridized probe-sample complexes. A typical microarray experiment may involve the following steps: 1) preparation of fluorescently labeled target from RNA isolated from the sample, 2) hybridization of the labeled target to the microarray, 3) washing, staining, and scanning of the array, 4) analysis of the scanned image and 5) generation of gene expression profiles. One example of a microarray processor is the Affymetrix GENECHIP® system, which is commercially available and comprises arrays fabricated by direct synthesis of oligonucleotides on a glass surface. Other systems may be used as known to one skilled in the art.
[0541] Amplification-based assays also can be used to measure the expression level of a particular RNA transcript. In such assays, the nucleic acid sequence of the transcript acts as a template in an amplification reaction (for example, PCR, such as qPCR). In a quantitative amplification, the amount of amplification product is proportional to the amount of template in the original sample. Comparison to appropriate controls provides a measure of the expression level of the transcript of interest, corresponding to the specific probe used, according to the principles described herein. Methods of real-time qPCR using TaqMan probes are well known in the art. Detailed protocols for real-time qPCR are provided, for example, in Gibson et al., Genome Res. 6:995-1001 (1996), and in Heid et al., Genome Res. 6:986-994 (1996), the disclosures of each of which are incorporated herein by reference in their entirety. Levels of RNA transcript expression as described herein can be determined, for example, by RT-PCR technology. Probes used for PCR may be labeled with a detectable marker, such as, for example, a radioisotope, fluorescent compound, bioluminescent compound, a chemiluminescent compound, metal chelator, or enzyme.
[0542] Nucleic acid probes that may be used in conjunction with any one or more of the foregoing detection methods include, for example, oligonucleotides capable of annealing to a nucleic acid encoding a gene of interest or RNA transcript thereof. For example, the oligonucleotide may be at least 85% complementary to a portion of a gene of interest or a portion of an RNA transcript corresponding to the gene of interest (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a portion of a gene of interest or a portion of an RNA transcript corresponding to the gene of interest). In some embodiments, the oligonucleotide is at least 85% identical to a portion of an antisense RNA strand corresponding to the gene of interest (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a portion of an antisense RNA strand corresponding to the gene of interest).
Protein Detection
[0543] In some embodiments of any of the aspects or embodiments of the disclosure, expression of a gene of interest, such as one or more of DPP4, CNTNAP3, CNTN4, CXCL12, TNXB, CTSE, OLFM4, KRT5, KRT6A, and IDO2, may be assessed by detecting the protein encoded by the gene. Protein levels can be assessed using standard detection techniques known in the art. Protein expression assays suitable for use with the compositions and methods described herein include proteomics approaches, immunohistochemical and/or western blot analysis, immunoprecipitation, molecular binding assays, ELISA, enzyme-linked immunofiltration assay (ELIFA), mass spectrometry, mass spectrometric immunoassay, and biochemical enzymatic activity assays. In particular, proteomics methods can be used to generate large-scale protein expression datasets in multiplex. Proteomics methods may utilize mass spectrometry to detect and quantify polypeptides (e.g., proteins) and/or peptide microarrays utilizing capture reagents (e.g., antibodies) specific to a panel of target proteins to identify and measure expression levels of proteins expressed in a sample (e.g., a single cell sample or a multi-cell population).
[0544] Exemplary peptide microarrays have a substrate-bound plurality of polypeptides, the binding of an oligonucleotide, a peptide, or a protein to each of the plurality of bound polypeptides being separately detectable. Alternatively, the peptide microarray may include a plurality of binders, including, but not limited to, monoclonal antibodies, polyclonal antibodies, phage display binders, yeast two-hybrid binders, aptamers, which can specifically detect the binding of specific oligonucleotides, peptides, or proteins. Examples of peptide arrays may be found in U.S. Pat. Nos. 6,268,210, 5,766,960, and 5,143,854, the disclosures of each of which are incorporated herein by reference in their entirety.
[0545] Mass spectrometry (MS) may be used in conjunction with the methods described herein to identify and characterize transgene expression in a cell from a patient (e.g., a human patient) following delivery of the transgene. Any method of MS known in the art may be used to determine, detect, and/or measure a protein or peptide fragment of interest, e.g., LC-MS, ESI-MS, ESI-MS/MS, MALDI-TOF-MS, MALDI-TOF/TOF-MS, tandem MS, and the like. Mass spectrometers generally contain an ion source and optics, mass analyzer, and data processing electronics. Mass analyzers include scanning and ion-beam mass spectrometers, such as time-of-flight (TOF) and quadruple (Q), and trapping mass spectrometers, such as ion trap (IT), Orbitrap, and Fourier transform ion cyclotron resonance (FT-ICR), may be used in the methods described herein. Details of various MS methods can be found in the literature. See, for example, Yates et al., Annu. Rev. Biomed. Eng. 11:49-79, 2009, the disclosure of which is incorporated herein by reference in its entirety.
[0546] Prior to MS analysis, proteins in a sample obtained from the patient can be first digested into smaller peptides by chemical (e.g., via cyanogen bromide cleavage) or enzymatic (e.g., trypsin) digestion. Complex peptide samples also benefit from the use of front-end separation techniques, e.g., 2D-PAGE, HPLC, RPLC, and affinity chromatography. The digested, and optionally separated, sample is then ionized using an ion source to create charged molecules for further analysis. Ionization of the sample may be performed, e.g., by electrospray ionization (ESI), atmospheric pressure chemical ionization (APCI), photoionization, electron ionization, fast atom bombardment (FAB)/liquid secondary ionization (LSIMS), matrix assisted laser desorption/ionization (MALDI), field ionization, field desorption, thermospray/plasmaspray ionization, and particle beam ionization. Additional information relating to the choice of ionization method is known to those of skill in the art.
[0547] After ionization, digested peptides may then be fragmented to generate signature MS/MS spectra. Tandem MS, also known as MS/MS, may be particularly useful for analyzing complex mixtures. Tandem MS involves multiple steps of MS selection, with some form of ion fragmentation occurring in between the stages, which may be accomplished with individual mass spectrometer elements separated in space or using a single mass spectrometer with the MS steps separated in time. In spatially separated tandem MS, the elements are physically separated and distinct, with a physical connection between the elements to maintain high vacuum. In temporally separated tandem MS, separation is accomplished with ions trapped in the same place, with multiple separation steps taking place over time. Signature MS/MS spectra may then be compared against a peptide sequence database (e.g., SEQUEST). Post-translational modifications to peptides may also be determined, for example, by searching spectra against a database while allowing for specific peptide modifications.
Oxytocin Receptor Antagonist Dosing Regimens
[0548] To promote endometrial receptivity and successful embryo implantation and to reduce the likelihood of miscarriage in a subject undergoing or that has undergone embryo transfer therapy, compounds of formula (I) or (II), or another oxytocin receptor antagonist described herein, may be administered to a subject (e.g., a human subject) before, during, or after embryo transfer. In each case, compounds of formula (I) or (II), or another oxytocin receptor antagonist described herein, may be administered to the subject so as to saturate the oxytocin receptor and achieve inhibition (e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% inhibition) of the receptor prior to embryo transfer, at the time of embryo transfer, and/or following embryo transfer.
Administration Beginning Prior to Embryo Transfer Therapy
[0549] Compounds of formula (I) or (II) or another oxytocin receptor antagonist described herein, such as epelsiban, retosiban, barusiban, and atosiban, or a salt, derivative, variant, crystal form, or formulation thereof, may be administered to the subject prior to embryo transfer, such as from about 1 hour to about 24 hours prior to the transfer of the one or more embryos to the subject. In some embodiments, the compound is administered to the subject so as to achieve a maximum plasma concentration of the compound at the time of embryo transfer. For instance, in some embodiments, the compound is administered to the subject from about 1 hour to about 8 hours prior to embryo transfer, such as about four hours prior to embryo transfer.
[0550] In some embodiments, a compound of formula (I) or (II) is administered to the subject in an amount of from 100 mg to 600 mg per dose. The compound may be administered to the subject in an amount of about 100 mg per dose, 105 mg per dose, 110 mg per dose, 115 mg per dose, 120 mg per dose, 125 mg per dose, 130 mg per dose, 135 mg per dose, 140 mg per dose, 145 mg per dose, 150 mg per dose, 155 mg per dose, 160 mg per dose, 165 mg per dose, 170 mg per dose, 175 mg per dose, 180 mg per dose, 185 mg per dose, 190 mg per dose, 195 mg per dose, 200 mg per dose, 205 mg per dose, 210 mg per dose, 215 mg per dose, 220 mg per dose, 225 mg per dose, 230 mg per dose, 235 mg per dose, 240 mg per dose, 245 mg per dose, 250 mg per dose, 255 mg per dose, 260 mg per dose, 265 mg per dose, 270 mg per dose, 275 mg per dose, 280 mg per dose, 285 mg per dose, 290 mg per dose, 295 mg per dose, 300 mg per dose, 305 mg per dose, 310 mg per dose, 315 mg per dose, 320 mg per dose, 325 mg per dose, 330 mg per dose, 335 mg per dose, 340 mg per dose, 345 mg per dose, 350 mg per dose, 355 mg per dose, 360 mg per dose, 365 mg per dose, 370 mg per dose, 375 mg per dose, 380 mg per dose, 385 mg per dose, 390 mg per dose, 395 mg per dose, 400 mg per dose, 405 mg per dose, 410 mg per dose, 415 mg per dose, 420 mg per dose, 425 mg per dose, 430 mg per dose, 435 mg per dose, 440 mg per dose, 445 mg per dose, 450 mg per dose, 455 mg per dose, 460 mg per dose, 465 mg per dose, 470 mg per dose, 475 mg per dose, 480 mg per dose, 485 mg per dose, 490 mg per dose, 495 mg per dose, 500 mg per dose, 505 mg per dose, 510 mg per dose, 515 mg per dose, 520 mg per dose, 525 mg per dose, 530 mg per dose, 535 mg per dose, 540 mg per dose, 545 mg per dose, 550 mg per dose, 555 mg per dose, 560 mg per dose, 565 mg per dose, 570 mg per dose, 575 mg per dose, 580 mg per dose, 585 mg per dose, 590 mg per dose, 595 mg per dose, or 600 mg per dose (e.g., wherein the compound is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)). For example, (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II), may be administered to the subject in an amount of about 100 mg per dose or about 300 mg per dose.
[0551] In some embodiments, a compound of formula (I) or (II) is administered to the subject in one or more doses (e.g., in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more doses) totaling from 100 mg to 600 mg. The compound may be administered to the subject in one or more doses (e.g., in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more doses) totaling about 100 mg, 105 mg, 110 mg, 115 mg, 120 mg, 125 mg, 130 mg, 135 mg, 140 mg, 145 mg, 150 mg, 155 mg, 160 mg, 165 mg, 170 mg, 175 mg, 180 mg, 185 mg, 190 mg, 195 mg, 200 mg, 205 mg, 210 mg, 215 mg, 220 mg, 225 mg, 230 mg, 235 mg, 240 mg, 245 mg, 250 mg, 255 mg, 260 mg, 265 mg, 270 mg, 275 mg, 280 mg, 285 mg, 290 mg, 295 mg, 300 mg, 305 mg, 310 mg, 315 mg, 320 mg, 325 mg, 330 mg, 335 mg, 340 mg, 345 mg, 350 mg, 355 mg, 360 mg, 365 mg, 370 mg, 375 mg, 380 mg, 385 mg, 390 mg, 395 mg, 400 mg, 405 mg, 410 mg, 415 mg, 420 mg, 425 mg, 430 mg, 435 mg, 440 mg, 445 mg, 450 mg, 455 mg, 460 mg, 465 mg, 470 mg, 475 mg, 480 mg, 485 mg, 490 mg, 495 mg, 500 mg, 505 mg, 510 mg, 515 mg, 520 mg, 525 mg, 530 mg, 535 mg, 540 mg, 545 mg, 550 mg, 555 mg, 560 mg, 565 mg, 570 mg, 575 mg, 580 mg, 585 mg, 590 mg, 595 mg, or 600 mg (e.g., wherein the compound is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)). For example, (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II), may be administered to the subject in one or more doses (e.g., in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more doses) totaling about 100 mg or about 300 mg.
[0552] In some embodiments, the compound is administered to the subject in a single dose (e.g., on the day of the embryo transfer therapy) of from 100 mg to 600 mg. The compound may be administered to the subject in a single dose (e.g., on the day of the embryo transfer therapy) of about 100 mg, 105 mg, 110 mg, 115 mg, 120 mg, 125 mg, 130 mg, 135 mg, 140 mg, 145 mg, 150 mg, 155 mg, 160 mg, 165 mg, 170 mg, 175 mg, 180 mg, 185 mg, 190 mg, 195 mg, 200 mg, 205 mg, 210 mg, 215 mg, 220 mg, 225 mg, 230 mg, 235 mg, 240 mg, 245 mg, 250 mg, 255 mg, 260 mg, 265 mg, 270 mg, 275 mg, 280 mg, 285 mg, 290 mg, 295 mg, 300 mg, 305 mg, 310 mg, 315 mg, 320 mg, 325 mg, 330 mg, 335 mg, 340 mg, 345 mg, 350 mg, 355 mg, 360 mg, 365 mg, 370 mg, 375 mg, 380 mg, 385 mg, 390 mg, 395 mg, 400 mg, 405 mg, 410 mg, 415 mg, 420 mg, 425 mg, 430 mg, 435 mg, 440 mg, 445 mg, 450 mg, 455 mg, 460 mg, 465 mg, 470 mg, 475 mg, 480 mg, 485 mg, 490 mg, 495 mg, 500 mg, 505 mg, 510 mg, 515 mg, 520 mg, 525 mg, 530 mg, 535 mg, 540 mg, 545 mg, 550 mg, 555 mg, 560 mg, 565 mg, 570 mg, 575 mg, 580 mg, 585 mg, 590 mg, 595 mg, or 600 mg (e.g., wherein the compound is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)). For example, (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II), may be administered to the subject in a single dose (e.g., on the day of the embryo transfer therapy) of about 100 mg or about 300 mg.
[0553] In some embodiments, a compound of formula (I) or (II) is administered to the subject in an amount of from 600 mg to 1,200 mg per dose, such as an amount of from 610 mg to 1,190 mg per dose, from 620 mg to 1,180 mg per dose, from 630 mg to 1,170 mg per dose, from 640 mg to 1,160 mg per dose, from 650 mg to 1,150 mg per dose, from 660 mg to 1,140 mg per dose, from 670 mg to 1,130 mg per dose, from 680 mg to 1,120 mg per dose, from 690 mg to 1,110 mg per dose, from 700 mg to 1,100 mg per dose, from 710 mg to 1,090 mg per dose, from 720 mg to 1,080 mg per dose, from 730 mg to 1,070 mg per dose, from 740 mg to 1,060 mg per dose, from 750 mg to 1,050 mg per dose, from 760 mg to 1,040 mg per dose, from 770 mg to 1,030 mg per dose, from 780 mg to 1,020 mg per dose, from 790 mg to 1,010 mg per dose, from 800 mg to 1,000 mg per dose, from 810 mg to 990 mg per dose, from 820 mg to 980 mg per dose, from 830 mg to 970 mg per dose, from 840 mg to 960 mg per dose, from 850 mg to 950 mg per dose, from 860 mg to 940 mg per dose, from 870 mg to 930 mg per dose, from 880 mg to 920 mg per dose, or from 890 mg to 910 mg per dose (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0554] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in an amount of from about 601 mg to about 1,199 mg per dose, such as an amount of about 601 mg, 602 mg, 603 mg, 604 mg, 605 mg, 606 mg, 607 mg, 608 mg, 609 mg, 610 mg, 611 mg, 612 mg, 613 mg, 614 mg, 615 mg, 616 mg, 617 mg, 618 mg, 619 mg, 620 mg, 621 mg, 622 mg, 623 mg, 624 mg, 625 mg, 626 mg, 627 mg, 628 mg, 629 mg, 630 mg, 631 mg, 632 mg, 633 mg, 634 mg, 635 mg, 636 mg, 637 mg, 638 mg, 639 mg, 640 mg, 641 mg, 642 mg, 643 mg, 644 mg, 645 mg, 646 mg, 647 mg, 648 mg, 649 mg, 650 mg, 651 mg, 652 mg, 653 mg, 654 mg, 655 mg, 656 mg, 657 mg, 658 mg, 659 mg, 660 mg, 661 mg, 662 mg, 663 mg, 664 mg, 665 mg, 666 mg, 667 mg, 668 mg, 669 mg, 670 mg, 671 mg, 672 mg, 673 mg, 674 mg, 675 mg, 676 mg, 677 mg, 678 mg, 679 mg, 680 mg, 681 mg, 682 mg, 683 mg, 684 mg, 685 mg, 686 mg, 687 mg, 688 mg, 689 mg, 690 mg, 691 mg, 692 mg, 693 mg, 694 mg, 695 mg, 696 mg, 697 mg, 698 mg, 699 mg, 700 mg, 701 mg, 702 mg, 703 mg, 704 mg, 705 mg, 706 mg, 707 mg, 708 mg, 709 mg, 710 mg, 711 mg, 712 mg, 713 mg, 714 mg, 715 mg, 716 mg, 717 mg, 718 mg, 719 mg, 720 mg, 721 mg, 722 mg, 723 mg, 724 mg, 725 mg, 726 mg, 727 mg, 728 mg, 729 mg, 730 mg, 731 mg, 732 mg, 733 mg, 734 mg, 735 mg, 736 mg, 737 mg, 738 mg, 739 mg, 740 mg, 741 mg, 742 mg, 743 mg, 744 mg, 745 mg, 746 mg, 747 mg, 748 mg, 749 mg, 750 mg, 751 mg, 752 mg, 753 mg, 754 mg, 755 mg, 756 mg, 757 mg, 758 mg, 759 mg, 760 mg, 761 mg, 762 mg, 763 mg, 764 mg, 765 mg, 766 mg, 767 mg, 768 mg, 769 mg, 770 mg, 771 mg, 772 mg, 773 mg, 774 mg, 775 mg, 776 mg, 777 mg, 778 mg, 779 mg, 780 mg, 781 mg, 782 mg, 783 mg, 784 mg, 785 mg, 786 mg, 787 mg, 788 mg, 789 mg, 790 mg, 791 mg, 792 mg, 793 mg, 794 mg, 795 mg, 796 mg, 797 mg, 798 mg, 799 mg, 800 mg, 801 mg, 802 mg, 803 mg, 804 mg, 805 mg, 806 mg, 807 mg, 808 mg, 809 mg, 810 mg, 811 mg, 812 mg, 813 mg, 814 mg, 815 mg, 816 mg, 817 mg, 818 mg, 819 mg, 820 mg, 821 mg, 822 mg, 823 mg, 824 mg, 825 mg, 826 mg, 827 mg, 828 mg, 829 mg, 830 mg, 831 mg, 832 mg, 833 mg, 834 mg, 835 mg, 836 mg, 837 mg, 838 mg, 839 mg, 840 mg, 841 mg, 842 mg, 843 mg, 844 mg, 845 mg, 846 mg, 847 mg, 848 mg, 849 mg, 850 mg, 851 mg, 852 mg, 853 mg, 854 mg, 855 mg, 856 mg, 857 mg, 858 mg, 859 mg, 860 mg, 861 mg, 862 mg, 863 mg, 864 mg, 865 mg, 866 mg, 867 mg, 868 mg, 869 mg, 870 mg, 871 mg, 872 mg, 873 mg, 874 mg, 875 mg, 876 mg, 877 mg, 878 mg, 879 mg, 880 mg, 881 mg, 882 mg, 883 mg, 884 mg, 885 mg, 886 mg, 887 mg, 888 mg, 889 mg, 890 mg, 891 mg, 892 mg, 893 mg, 894 mg, 895 mg, 896 mg, 897 mg, 898 mg, 899 mg, 900 mg, 901 mg, 902 mg, 903 mg, 904 mg, 905 mg, 906 mg, 907 mg, 908 mg, 909 mg, 910 mg, 911 mg, 912 mg, 913 mg, 914 mg, 915 mg, 916 mg, 917 mg, 918 mg, 919 mg, 920 mg, 921 mg, 922 mg, 923 mg, 924 mg, 925 mg, 926 mg, 927 mg, 928 mg, 929 mg, 930 mg, 931 mg, 932 mg, 933 mg, 934 mg, 935 mg, 936 mg, 937 mg, 938 mg, 939 mg, 940 mg, 941 mg, 942 mg, 943 mg, 944 mg, 945 mg, 946 mg, 947 mg, 948 mg, 949 mg, 950 mg, 951 mg, 952 mg, 953 mg, 954 mg, 955 mg, 956 mg, 957 mg, 958 mg, 959 mg, 960 mg, 961 mg, 962 mg, 963 mg, 964 mg, 965 mg, 966 mg, 967 mg, 968 mg, 969 mg, 970 mg, 971 mg, 972 mg, 973 mg, 974 mg, 975 mg, 976 mg, 977 mg, 978 mg, 979 mg, 980 mg, 981 mg, 982 mg, 983 mg, 984 mg, 985 mg, 986 mg, 987 mg, 988 mg, 989 mg, 990 mg, 991 mg, 992 mg, 993 mg, 994 mg, 995 mg, 996 mg, 997 mg, 998 mg, 999 mg, 1,000 mg, 1,001 mg, 1,002 mg, 1,003 mg, 1,004 mg, 1,005 mg, 1,006 mg, 1,007 mg, 1,008 mg, 1,009 mg, 1,010 mg, 1,011 mg, 1,012 mg, 1,013 mg, 1,014 mg, 1,015 mg, 1,016 mg, 1,017 mg, 1,018 mg, 1,019 mg, 1,020 mg, 1,021 mg, 1,022 mg, 1,023 mg, 1,024 mg, 1,025 mg, 1,026 mg, 1,027 mg, 1,028 mg, 1,029 mg, 1,030 mg, 1,031 mg, 1,032 mg, 1,033 mg, 1,034 mg, 1,035 mg, 1,036 mg, 1,037 mg, 1,038 mg, 1,039 mg, 1,040 mg, 1,041 mg, 1,042 mg, 1,043 mg, 1,044 mg, 1,045 mg, 1,046 mg, 1,047 mg, 1,048 mg, 1,049 mg, 1,050 mg, 1,051 mg, 1,052 mg, 1,053 mg, 1,054 mg, 1,055 mg, 1,056 mg, 1,057 mg, 1,058 mg, 1,059 mg, 1,060 mg, 1,061 mg, 1,062 mg, 1,063 mg, 1,064 mg, 1,065 mg, 1,066 mg, 1,067 mg, 1,068 mg, 1,069 mg, 1,070 mg, 1,071 mg, 1,072 mg, 1,073 mg, 1,074 mg, 1,075 mg, 1,076 mg, 1,077 mg, 1,078 mg, 1,079 mg, 1,080 mg, 1,081 mg, 1,082 mg, 1,083 mg, 1,084 mg, 1,085 mg, 1,086 mg, 1,087 mg, 1,088 mg, 1,089 mg, 1,090 mg, 1,091 mg, 1,092 mg, 1,093 mg, 1,094 mg, 1,095 mg, 1,096 mg, 1,097 mg, 1,098 mg, 1,099 mg, 1,100 mg, 1,101 mg, 1,102 mg, 1,103 mg, 1,104 mg, 1,105 mg, 1,106 mg, 1,107 mg, 1,108 mg, 1,109 mg, 1,110 mg, 1,111 mg, 1112 mg, 1,113 mg, 1,114 mg, 1,115 mg, 1,116 mg, 1,117 mg, 1,118 mg, 1,119 mg, 1,120 mg, 1,121 mg, 1,122 mg, 1,123 mg, 1,124 mg, 1,125 mg, 1,126 mg, 1,127 mg, 1,128 mg, 1,129 mg, 1,130 mg, 1,131 mg, 1,132 mg, 1,133 mg, 1,134 mg, 1,135 mg, 1,136 mg, 1,137 mg, 1,138 mg, 1,139 mg, 1,140 mg, 1,141 mg, 1,142 mg, 1,143 mg, 1,144 mg, 1,145 mg, 1,146 mg, 1,147 mg, 1,148 mg, 1,149 mg, 1,150 mg, 1,151 mg, 1,152 mg, 1,153 mg, 1,154 mg, 1,155 mg, 1,156 mg, 1,157 mg, 1,158 mg, 1,159 mg, 1,160 mg, 1,161 mg, 1,162 mg, 1,163 mg, 1,164 mg, 1,165 mg, 1,166 mg, 1,167 mg, 1,168 mg, 1,169 mg, 1,170 mg, 1,171 mg, 1,172 mg, 1,173 mg, 1,174 mg, 1,175 mg, 1,176 mg, 1,177 mg, 1,178 mg, 1,179 mg, 1,180 mg, 1,181 mg, 1,182 mg, 1,183 mg, 1,184 mg, 1,185 mg, 1,186 mg, 1,187 mg, 1,188 mg, 1,189 mg, 1,190 mg, 1,191 mg, 1,192 mg, 1,193 mg, 1,194 mg, 1,195 mg, 1,196 mg, 1,197 mg, 1,198 mg, or 1,199 mg per dose (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0555] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in an amount of from about 700 mg to about 1,100 mg per dose, such as an amount of about 700 mg, 701 mg, 702 mg, 703 mg, 704 mg, 705 mg, 706 mg, 707 mg, 708 mg, 709 mg, 710 mg, 711 mg, 712 mg, 713 mg, 714 mg, 715 mg, 716 mg, 717 mg, 718 mg, 719 mg, 720 mg, 721 mg, 722 mg, 723 mg, 724 mg, 725 mg, 726 mg, 727 mg, 728 mg, 729 mg, 730 mg, 731 mg, 732 mg, 733 mg, 734 mg, 735 mg, 736 mg, 737 mg, 738 mg, 739 mg, 740 mg, 741 mg, 742 mg, 743 mg, 744 mg, 745 mg, 746 mg, 747 mg, 748 mg, 749 mg, 750 mg, 751 mg, 752 mg, 753 mg, 754 mg, 755 mg, 756 mg, 757 mg, 758 mg, 759 mg, 760 mg, 761 mg, 762 mg, 763 mg, 764 mg, 765 mg, 766 mg, 767 mg, 768 mg, 769 mg, 770 mg, 771 mg, 772 mg, 773 mg, 774 mg, 775 mg, 776 mg, 777 mg, 778 mg, 779 mg, 780 mg, 781 mg, 782 mg, 783 mg, 784 mg, 785 mg, 786 mg, 787 mg, 788 mg, 789 mg, 790 mg, 791 mg, 792 mg, 793 mg, 794 mg, 795 mg, 796 mg, 797 mg, 798 mg, 799 mg, 800 mg, 801 mg, 802 mg, 803 mg, 804 mg, 805 mg, 806 mg, 807 mg, 808 mg, 809 mg, 810 mg, 811 mg, 812 mg, 813 mg, 814 mg, 815 mg, 816 mg, 817 mg, 818 mg, 819 mg, 820 mg, 821 mg, 822 mg, 823 mg, 824 mg, 825 mg, 826 mg, 827 mg, 828 mg, 829 mg, 830 mg, 831 mg, 832 mg, 833 mg, 834 mg, 835 mg, 836 mg, 837 mg, 838 mg, 839 mg, 840 mg, 841 mg, 842 mg, 843 mg, 844 mg, 845 mg, 846 mg, 847 mg, 848 mg, 849 mg, 850 mg, 851 mg, 852 mg, 853 mg, 854 mg, 855 mg, 856 mg, 857 mg, 858 mg, 859 mg, 860 mg, 861 mg, 862 mg, 863 mg, 864 mg, 865 mg, 866 mg, 867 mg, 868 mg, 869 mg, 870 mg, 871 mg, 872 mg, 873 mg, 874 mg, 875 mg, 876 mg, 877 mg, 878 mg, 879 mg, 880 mg, 881 mg, 882 mg, 883 mg, 884 mg, 885 mg, 886 mg, 887 mg, 888 mg, 889 mg, 890 mg, 891 mg, 892 mg, 893 mg, 894 mg, 895 mg, 896 mg, 897 mg, 898 mg, 899 mg, 900 mg, 901 mg, 902 mg, 903 mg, 904 mg, 905 mg, 906 mg, 907 mg, 908 mg, 909 mg, 910 mg, 911 mg, 912 mg, 913 mg, 914 mg, 915 mg, 916 mg, 917 mg, 918 mg, 919 mg, 920 mg, 921 mg, 922 mg, 923 mg, 924 mg, 925 mg, 926 mg, 927 mg, 928 mg, 929 mg, 930 mg, 931 mg, 932 mg, 933 mg, 934 mg, 935 mg, 936 mg, 937 mg, 938 mg, 939 mg, 940 mg, 941 mg, 942 mg, 943 mg, 944 mg, 945 mg, 946 mg, 947 mg, 948 mg, 949 mg, 950 mg, 951 mg, 952 mg, 953 mg, 954 mg, 955 mg, 956 mg, 957 mg, 958 mg, 959 mg, 960 mg, 961 mg, 962 mg, 963 mg, 964 mg, 965 mg, 966 mg, 967 mg, 968 mg, 969 mg, 970 mg, 971 mg, 972 mg, 973 mg, 974 mg, 975 mg, 976 mg, 977 mg, 978 mg, 979 mg, 980 mg, 981 mg, 982 mg, 983 mg, 984 mg, 985 mg, 986 mg, 987 mg, 988 mg, 989 mg, 990 mg, 991 mg, 992 mg, 993 mg, 994 mg, 995 mg, 996 mg, 997 mg, 998 mg, 999 mg, 1,000 mg, 1,001 mg, 1,002 mg, 1,003 mg, 1,004 mg, 1,005 mg, 1,006 mg, 1,007 mg, 1,008 mg, 1,009 mg, 1,010 mg, 1,011 mg, 1,012 mg, 1,013 mg, 1,014 mg, 1,015 mg, 1,016 mg, 1,017 mg, 1,018 mg, 1,019 mg, 1,020 mg, 1,021 mg, 1,022 mg, 1,023 mg, 1,024 mg, 1,025 mg, 1,026 mg, 1,027 mg, 1,028 mg, 1,029 mg, 1,030 mg, 1,031 mg, 1,032 mg, 1,033 mg, 1,034 mg, 1,035 mg, 1,036 mg, 1,037 mg, 1,038 mg, 1,039 mg, 1,040 mg, 1,041 mg, 1,042 mg, 1,043 mg, 1,044 mg, 1,045 mg, 1,046 mg, 1,047 mg, 1,048 mg, 1,049 mg, 1,050 mg, 1,051 mg, 1,052 mg, 1,053 mg, 1,054 mg, 1,055 mg, 1,056 mg, 1,057 mg, 1,058 mg, 1,059 mg, 1,060 mg, 1,061 mg, 1,062 mg, 1,063 mg, 1,064 mg, 1,065 mg, 1,066 mg, 1,067 mg, 1,068 mg, 1,069 mg, 1,070 mg, 1,071 mg, 1,072 mg, 1,073 mg, 1,074 mg, 1,075 mg, 1,076 mg, 1,077 mg, 1,078 mg, 1,079 mg, 1,080 mg, 1,081 mg, 1,082 mg, 1,083 mg, 1,084 mg, 1,085 mg, 1,086 mg, 1,087 mg, 1,088 mg, 1,089 mg, 1,090 mg, 1,091 mg, 1,092 mg, 1,093 mg, 1,094 mg, 1,095 mg, 1,096 mg, 1,097 mg, 1,098 mg, 1,099 mg, or 1,100 mg per dose (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0556] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in an amount of from about 800 mg to about 1,000 mg per dose, such as an amount of about 800 mg, 801 mg, 802 mg, 803 mg, 804 mg, 805 mg, 806 mg, 807 mg, 808 mg, 809 mg, 810 mg, 811 mg, 812 mg, 813 mg, 814 mg, 815 mg, 816 mg, 817 mg, 818 mg, 819 mg, 820 mg, 821 mg, 822 mg, 823 mg, 824 mg, 825 mg, 826 mg, 827 mg, 828 mg, 829 mg, 830 mg, 831 mg, 832 mg, 833 mg, 834 mg, 835 mg, 836 mg, 837 mg, 838 mg, 839 mg, 840 mg, 841 mg, 842 mg, 843 mg, 844 mg, 845 mg, 846 mg, 847 mg, 848 mg, 849 mg, 850 mg, 851 mg, 852 mg, 853 mg, 854 mg, 855 mg, 856 mg, 857 mg, 858 mg, 859 mg, 860 mg, 861 mg, 862 mg, 863 mg, 864 mg, 865 mg, 866 mg, 867 mg, 868 mg, 869 mg, 870 mg, 871 mg, 872 mg, 873 mg, 874 mg, 875 mg, 876 mg, 877 mg, 878 mg, 879 mg, 880 mg, 881 mg, 882 mg, 883 mg, 884 mg, 885 mg, 886 mg, 887 mg, 888 mg, 889 mg, 890 mg, 891 mg, 892 mg, 893 mg, 894 mg, 895 mg, 896 mg, 897 mg, 898 mg, 899 mg, 900 mg, 901 mg, 902 mg, 903 mg, 904 mg, 905 mg, 906 mg, 907 mg, 908 mg, 909 mg, 910 mg, 911 mg, 912 mg, 913 mg, 914 mg, 915 mg, 916 mg, 917 mg, 918 mg, 919 mg, 920 mg, 921 mg, 922 mg, 923 mg, 924 mg, 925 mg, 926 mg, 927 mg, 928 mg, 929 mg, 930 mg, 931 mg, 932 mg, 933 mg, 934 mg, 935 mg, 936 mg, 937 mg, 938 mg, 939 mg, 940 mg, 941 mg, 942 mg, 943 mg, 944 mg, 945 mg, 946 mg, 947 mg, 948 mg, 949 mg, 950 mg, 951 mg, 952 mg, 953 mg, 954 mg, 955 mg, 956 mg, 957 mg, 958 mg, 959 mg, 960 mg, 961 mg, 962 mg, 963 mg, 964 mg, 965 mg, 966 mg, 967 mg, 968 mg, 969 mg, 970 mg, 971 mg, 972 mg, 973 mg, 974 mg, 975 mg, 976 mg, 977 mg, 978 mg, 979 mg, 980 mg, 981 mg, 982 mg, 983 mg, 984 mg, 985 mg, 986 mg, 987 mg, 988 mg, 989 mg, 990 mg, 991 mg, 992 mg, 993 mg, 994 mg, 995 mg, 996 mg, 997 mg, 998 mg, 999 mg, or 1,000 mg per dose (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0557] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in an amount of from about 850 mg to about 950 mg per dose, such as an amount of about 850 mg, 851 mg, 852 mg, 853 mg, 854 mg, 855 mg, 856 mg, 857 mg, 858 mg, 859 mg, 860 mg, 861 mg, 862 mg, 863 mg, 864 mg, 865 mg, 866 mg, 867 mg, 868 mg, 869 mg, 870 mg, 871 mg, 872 mg, 873 mg, 874 mg, 875 mg, 876 mg, 877 mg, 878 mg, 879 mg, 880 mg, 881 mg, 882 mg, 883 mg, 884 mg, 885 mg, 886 mg, 887 mg, 888 mg, 889 mg, 890 mg, 891 mg, 892 mg, 893 mg, 894 mg, 895 mg, 896 mg, 897 mg, 898 mg, 899 mg, 900 mg, 901 mg, 902 mg, 903 mg, 904 mg, 905 mg, 906 mg, 907 mg, 908 mg, 909 mg, 910 mg, 911 mg, 912 mg, 913 mg, 914 mg, 915 mg, 916 mg, 917 mg, 918 mg, 919 mg, 920 mg, 921 mg, 922 mg, 923 mg, 924 mg, 925 mg, 926 mg, 927 mg, 928 mg, 929 mg, 930 mg, 931 mg, 932 mg, 933 mg, 934 mg, 935 mg, 936 mg, 937 mg, 938 mg, 939 mg, 940 mg, 941 mg, 942 mg, 943 mg, 944 mg, 945 mg, 946 mg, 947 mg, 948 mg, 949 mg, or 950 mg per dose (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0558] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in an amount of from about 860 mg to about 940 mg per dose, such as an amount of about 860 mg, 861 mg, 862 mg, 863 mg, 864 mg, 865 mg, 866 mg, 867 mg, 868 mg, 869 mg, 870 mg, 871 mg, 872 mg, 873 mg, 874 mg, 875 mg, 876 mg, 877 mg, 878 mg, 879 mg, 880 mg, 881 mg, 882 mg, 883 mg, 884 mg, 885 mg, 886 mg, 887 mg, 888 mg, 889 mg, 890 mg, 891 mg, 892 mg, 893 mg, 894 mg, 895 mg, 896 mg, 897 mg, 898 mg, 899 mg, 900 mg, 901 mg, 902 mg, 903 mg, 904 mg, 905 mg, 906 mg, 907 mg, 908 mg, 909 mg, 910 mg, 911 mg, 912 mg, 913 mg, 914 mg, 915 mg, 916 mg, 917 mg, 918 mg, 919 mg, 920 mg, 921 mg, 922 mg, 923 mg, 924 mg, 925 mg, 926 mg, 927 mg, 928 mg, 929 mg, 930 mg, 931 mg, 932 mg, 933 mg, 934 mg, 935 mg, 936 mg, 937 mg, 938 mg, 939 mg, or 940 mg per dose (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0559] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in an amount of from about 870 mg to about 930 mg per dose, such as an amount of about 870 mg, 871 mg, 872 mg, 873 mg, 874 mg, 875 mg, 876 mg, 877 mg, 878 mg, 879 mg, 880 mg, 881 mg, 882 mg, 883 mg, 884 mg, 885 mg, 886 mg, 887 mg, 888 mg, 889 mg, 890 mg, 891 mg, 892 mg, 893 mg, 894 mg, 895 mg, 896 mg, 897 mg, 898 mg, 899 mg, 900 mg, 901 mg, 902 mg, 903 mg, 904 mg, 905 mg, 906 mg, 907 mg, 908 mg, 909 mg, 910 mg, 911 mg, 912 mg, 913 mg, 914 mg, 915 mg, 916 mg, 917 mg, 918 mg, 919 mg, 920 mg, 921 mg, 922 mg, 923 mg, 924 mg, 925 mg, 926 mg, 927 mg, 928 mg, 929 mg, or 930 mg per dose (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0560] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in an amount of from about 880 mg to about 920 mg per dose, such as an amount of about 880 mg, 881 mg, 882 mg, 883 mg, 884 mg, 885 mg, 886 mg, 887 mg, 888 mg, 889 mg, 890 mg, 891 mg, 892 mg, 893 mg, 894 mg, 895 mg, 896 mg, 897 mg, 898 mg, 899 mg, 900 mg, 901 mg, 902 mg, 903 mg, 904 mg, 905 mg, 906 mg, 907 mg, 908 mg, 909 mg, 910 mg, 911 mg, 912 mg, 913 mg, 914 mg, 915 mg, 916 mg, 917 mg, 918 mg, 919 mg, or 920 mg per dose (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0561] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in an amount of from about 890 mg to about 910 mg per dose, such as an amount of about 890 mg, 891 mg, 892 mg, 893 mg, 894 mg, 895 mg, 896 mg, 897 mg, 898 mg, 899 mg, 900 mg, 901 mg, 902 mg, 903 mg, 904 mg, 905 mg, 906 mg, 907 mg, 908 mg, 909 mg, or 910 mg per dose (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0562] In some embodiments, the oxytocin receptor antagonist is administered to the subject in an amount of about 900 mg per dose (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0563] In some embodiments, the oxytocin receptor antagonist is administered to the subject in one or more doses (e.g., in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more doses) totaling from 600 mg to 1,200 mg, such as in one or more doses (e.g., in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more doses) totaling from 610 mg to 1,190 mg, from 620 mg to 1,180 mg, from 630 mg to 1,170 mg, from 640 mg to 1,160 mg, from 650 mg to 1,150 mg, from 660 mg to 1,140 mg, from 670 mg to 1,130 mg, from 680 mg to 1,120 mg, from 690 mg to 1,110 mg, from 700 mg to 1,100 mg, from 710 mg to 1,090 mg, from 720 mg to 1,080 mg, from 730 mg to 1,070 mg, from 740 mg to 1,060 mg, from 750 mg to 1,050 mg, from 760 mg to 1,040 mg, from 770 mg to 1,030 mg, from 780 mg to 1,020 mg, from 790 mg to 1,010 mg, from 800 mg to 1,000 mg, from 810 mg to 990 mg, from 820 mg to 980 mg, from 830 mg to 970 mg, from 840 mg to 960 mg, from 850 mg to 950 mg, from 860 mg to 940 mg, from 870 mg to 930 mg, from 880 mg to 920 mg, or from 890 mg to 910 mg (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0564] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in one or more doses (e.g., in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more doses) totaling from about 601 mg to about 1,199 mg, such as in one or more doses (e.g., in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more doses) totaling about 601 mg, 602 mg, 603 mg, 604 mg, 605 mg, 606 mg, 607 mg, 608 mg, 609 mg, 610 mg, 611 mg, 612 mg, 613 mg, 614 mg, 615 mg, 616 mg, 617 mg, 618 mg, 619 mg, 620 mg, 621 mg, 622 mg, 623 mg, 624 mg, 625 mg, 626 mg, 627 mg, 628 mg, 629 mg, 630 mg, 631 mg, 632 mg, 633 mg, 634 mg, 635 mg, 636 mg, 637 mg, 638 mg, 639 mg, 640 mg, 641 mg, 642 mg, 643 mg, 644 mg, 645 mg, 646 mg, 647 mg, 648 mg, 649 mg, 650 mg, 651 mg, 652 mg, 653 mg, 654 mg, 655 mg, 656 mg, 657 mg, 658 mg, 659 mg, 660 mg, 661 mg, 662 mg, 663 mg, 664 mg, 665 mg, 666 mg, 667 mg, 668 mg, 669 mg, 670 mg, 671 mg, 672 mg, 673 mg, 674 mg, 675 mg, 676 mg, 677 mg, 678 mg, 679 mg, 680 mg, 681 mg, 682 mg, 683 mg, 684 mg, 685 mg, 686 mg, 687 mg, 688 mg, 689 mg, 690 mg, 691 mg, 692 mg, 693 mg, 694 mg, 695 mg, 696 mg, 697 mg, 698 mg, 699 mg, 700 mg, 701 mg, 702 mg, 703 mg, 704 mg, 705 mg, 706 mg, 707 mg, 708 mg, 709 mg, 710 mg, 711 mg, 712 mg, 713 mg, 714 mg, 715 mg, 716 mg, 717 mg, 718 mg, 719 mg, 720 mg, 721 mg, 722 mg, 723 mg, 724 mg, 725 mg, 726 mg, 727 mg, 728 mg, 729 mg, 730 mg, 731 mg, 732 mg, 733 mg, 734 mg, 735 mg, 736 mg, 737 mg, 738 mg, 739 mg, 740 mg, 741 mg, 742 mg, 743 mg, 744 mg, 745 mg, 746 mg, 747 mg, 748 mg, 749 mg, 750 mg, 751 mg, 752 mg, 753 mg, 754 mg, 755 mg, 756 mg, 757 mg, 758 mg, 759 mg, 760 mg, 761 mg, 762 mg, 763 mg, 764 mg, 765 mg, 766 mg, 767 mg, 768 mg, 769 mg, 770 mg, 771 mg, 772 mg, 773 mg, 774 mg, 775 mg, 776 mg, 777 mg, 778 mg, 779 mg, 780 mg, 781 mg, 782 mg, 783 mg, 784 mg, 785 mg, 786 mg, 787 mg, 788 mg, 789 mg, 790 mg, 791 mg, 792 mg, 793 mg, 794 mg, 795 mg, 796 mg, 797 mg, 798 mg, 799 mg, 800 mg, 801 mg, 802 mg, 803 mg, 804 mg, 805 mg, 806 mg, 807 mg, 808 mg, 809 mg, 810 mg, 811 mg, 812 mg, 813 mg, 814 mg, 815 mg, 816 mg, 817 mg, 818 mg, 819 mg, 820 mg, 821 mg, 822 mg, 823 mg, 824 mg, 825 mg, 826 mg, 827 mg, 828 mg, 829 mg, 830 mg, 831 mg, 832 mg, 833 mg, 834 mg, 835 mg, 836 mg, 837 mg, 838 mg, 839 mg, 840 mg, 841 mg, 842 mg, 843 mg, 844 mg, 845 mg, 846 mg, 847 mg, 848 mg, 849 mg, 850 mg, 851 mg, 852 mg, 853 mg, 854 mg, 855 mg, 856 mg, 857 mg, 858 mg, 859 mg, 860 mg, 861 mg, 862 mg, 863 mg, 864 mg, 865 mg, 866 mg, 867 mg, 868 mg, 869 mg, 870 mg, 871 mg, 872 mg, 873 mg, 874 mg, 875 mg, 876 mg, 877 mg, 878 mg, 879 mg, 880 mg, 881 mg, 882 mg, 883 mg, 884 mg, 885 mg, 886 mg, 887 mg, 888 mg, 889 mg, 890 mg, 891 mg, 892 mg, 893 mg, 894 mg, 895 mg, 896 mg, 897 mg, 898 mg, 899 mg, 900 mg, 901 mg, 902 mg, 903 mg, 904 mg, 905 mg, 906 mg, 907 mg, 908 mg, 909 mg, 910 mg, 911 mg, 912 mg, 913 mg, 914 mg, 915 mg, 916 mg, 917 mg, 918 mg, 919 mg, 920 mg, 921 mg, 922 mg, 923 mg, 924 mg, 925 mg, 926 mg, 927 mg, 928 mg, 929 mg, 930 mg, 931 mg, 932 mg, 933 mg, 934 mg, 935 mg, 936 mg, 937 mg, 938 mg, 939 mg, 940 mg, 941 mg, 942 mg, 943 mg, 944 mg, 945 mg, 946 mg, 947 mg, 948 mg, 949 mg, 950 mg, 951 mg, 952 mg, 953 mg, 954 mg, 955 mg, 956 mg, 957 mg, 958 mg, 959 mg, 960 mg, 961 mg, 962 mg, 963 mg, 964 mg, 965 mg, 966 mg, 967 mg, 968 mg, 969 mg, 970 mg, 971 mg, 972 mg, 973 mg, 974 mg, 975 mg, 976 mg, 977 mg, 978 mg, 979 mg, 980 mg, 981 mg, 982 mg, 983 mg, 984 mg, 985 mg, 986 mg, 987 mg, 988 mg, 989 mg, 990 mg, 991 mg, 992 mg, 993 mg, 994 mg, 995 mg, 996 mg, 997 mg, 998 mg, 999 mg, 1,000 mg, 1,001 mg, 1,002 mg, 1,003 mg, 1,004 mg, 1,005 mg, 1,006 mg, 1,007 mg, 1,008 mg, 1,009 mg, 1,010 mg, 1,011 mg, 1,012 mg, 1,013 mg, 1,014 mg, 1,015 mg, 1,016 mg, 1,017 mg, 1,018 mg, 1,019 mg, 1,020 mg, 1,021 mg, 1,022 mg, 1,023 mg, 1,024 mg, 1,025 mg, 1,026 mg, 1,027 mg, 1,028 mg, 1,029 mg, 1,030 mg, 1,031 mg, 1,032 mg, 1,033 mg, 1,034 mg, 1,035 mg, 1,036 mg, 1,037 mg, 1,038 mg, 1,039 mg, 1,040 mg, 1,041 mg, 1,042 mg, 1,043 mg, 1,044 mg, 1,045 mg, 1,046 mg, 1,047 mg, 1,048 mg, 1,049 mg, 1,050 mg, 1,051 mg, 1,052 mg, 1,053 mg, 1,054 mg, 1,055 mg, 1,056 mg, 1,057 mg, 1,058 mg, 1,059 mg, 1,060 mg, 1,061 mg, 1,062 mg, 1,063 mg, 1,064 mg, 1,065 mg, 1,066 mg, 1,067 mg, 1,068 mg, 1,069 mg, 1,070 mg, 1,071 mg, 1,072 mg, 1,073 mg, 1,074 mg, 1,075 mg, 1,076 mg, 1,077 mg, 1,078 mg, 1,079 mg, 1,080 mg, 1,081 mg, 1,082 mg, 1,083 mg, 1,084 mg, 1,085 mg, 1,086 mg, 1,087 mg, 1,088 mg, 1,089 mg, 1,090 mg, 1,091 mg, 1,092 mg, 1,093 mg, 1,094 mg, 1,095 mg, 1,096 mg, 1,097 mg, 1,098 mg, 1,099 mg, 1,100 mg, 1,101 mg, 1,102 mg, 1,103 mg, 1,104 mg, 1,105 mg, 1,106 mg, 1,107 mg, 1,108 mg, 1,109 mg, 1,110 mg, 1,111 mg, 1,112 mg, 1,113 mg, 1,114 mg, 1,115 mg, 1,116 mg, 1,117 mg, 1,118 mg, 1,119 mg, 1,120 mg, 1,121 mg, 1,122 mg, 1,123 mg, 1,124 mg, 1,125 mg, 1,126 mg, 1,127 mg, 1,128 mg, 1,129 mg, 1,130 mg, 1,131 mg, 1,132 mg, 1,133 mg, 1,134 mg, 1,135 mg, 1,136 mg, 1,137 mg, 1,138 mg, 1,139 mg, 1,140 mg, 1,141 mg, 1,142 mg, 1,143 mg, 1,144 mg, 1,145 mg, 1,146 mg, 1,147 mg, 1,148 mg, 1,149 mg, 1,150 mg, 1,151 mg, 1,152 mg, 1,153 mg, 1,154 mg, 1,155 mg, 1,156 mg, 1,157 mg, 1,158 mg, 1,159 mg, 1,160 mg, 1,161 mg, 1,162 mg, 1,163 mg, 1,164 mg, 1,165 mg, 1,166 mg, 1,167 mg, 1,168 mg, 1,169 mg, 1,170 mg, 1,171 mg, 1,172 mg, 1,173 mg, 1,174 mg, 1,175 mg, 1,176 mg, 1,177 mg, 1,178 mg, 1,179 mg, 1,180 mg, 1,181 mg, 1,182 mg, 1,183 mg, 1,184 mg, 1,185 mg, 1,186 mg, 1,187 mg, 1,188 mg, 1,189 mg, 1,190 mg, 1,191 mg, 1,192 mg, 1,193 mg, 1,194 mg, 1,195 mg, 1,196 mg, 1,197 mg, 1,198 mg, or 1,199 mg (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0565] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in one or more doses (e.g., in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more doses) totaling from about 700 mg to about 1,100 mg, such as in one or more doses (e.g., in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more doses) totaling about 700 mg, 701 mg, 702 mg, 703 mg, 704 mg, 705 mg, 706 mg, 707 mg, 708 mg, 709 mg, 710 mg, 711 mg, 712 mg, 713 mg, 714 mg, 715 mg, 716 mg, 717 mg, 718 mg, 719 mg, 720 mg, 721 mg, 722 mg, 723 mg, 724 mg, 725 mg, 726 mg, 727 mg, 728 mg, 729 mg, 730 mg, 731 mg, 732 mg, 733 mg, 734 mg, 735 mg, 736 mg, 737 mg, 738 mg, 739 mg, 740 mg, 741 mg, 742 mg, 743 mg, 744 mg, 745 mg, 746 mg, 747 mg, 748 mg, 749 mg, 750 mg, 751 mg, 752 mg, 753 mg, 754 mg, 755 mg, 756 mg, 757 mg, 758 mg, 759 mg, 760 mg, 761 mg, 762 mg, 763 mg, 764 mg, 765 mg, 766 mg, 767 mg, 768 mg, 769 mg, 770 mg, 771 mg, 772 mg, 773 mg, 774 mg, 775 mg, 776 mg, 777 mg, 778 mg, 779 mg, 780 mg, 781 mg, 782 mg, 783 mg, 784 mg, 785 mg, 786 mg, 787 mg, 788 mg, 789 mg, 790 mg, 791 mg, 792 mg, 793 mg, 794 mg, 795 mg, 796 mg, 797 mg, 798 mg, 799 mg, 800 mg, 801 mg, 802 mg, 803 mg, 804 mg, 805 mg, 806 mg, 807 mg, 808 mg, 809 mg, 810 mg, 811 mg, 812 mg, 813 mg, 814 mg, 815 mg, 816 mg, 817 mg, 818 mg, 819 mg, 820 mg, 821 mg, 822 mg, 823 mg, 824 mg, 825 mg, 826 mg, 827 mg, 828 mg, 829 mg, 830 mg, 831 mg, 832 mg, 833 mg, 834 mg, 835 mg, 836 mg, 837 mg, 838 mg, 839 mg, 840 mg, 841 mg, 842 mg, 843 mg, 844 mg, 845 mg, 846 mg, 847 mg, 848 mg, 849 mg, 850 mg, 851 mg, 852 mg, 853 mg, 854 mg, 855 mg, 856 mg, 857 mg, 858 mg, 859 mg, 860 mg, 861 mg, 862 mg, 863 mg, 864 mg, 865 mg, 866 mg, 867 mg, 868 mg, 869 mg, 870 mg, 871 mg, 872 mg, 873 mg, 874 mg, 875 mg, 876 mg, 877 mg, 878 mg, 879 mg, 880 mg, 881 mg, 882 mg, 883 mg, 884 mg, 885 mg, 886 mg, 887 mg, 888 mg, 889 mg, 890 mg, 891 mg, 892 mg, 893 mg, 894 mg, 895 mg, 896 mg, 897 mg, 898 mg, 899 mg, 900 mg, 901 mg, 902 mg, 903 mg, 904 mg, 905 mg, 906 mg, 907 mg, 908 mg, 909 mg, 910 mg, 911 mg, 912 mg, 913 mg, 914 mg, 915 mg, 916 mg, 917 mg, 918 mg, 919 mg, 920 mg, 921 mg, 922 mg, 923 mg, 924 mg, 925 mg, 926 mg, 927 mg, 928 mg, 929 mg, 930 mg, 931 mg, 932 mg, 933 mg, 934 mg, 935 mg, 936 mg, 937 mg, 938 mg, 939 mg, 940 mg, 941 mg, 942 mg, 943 mg, 944 mg, 945 mg, 946 mg, 947 mg, 948 mg, 949 mg, 950 mg, 951 mg, 952 mg, 953 mg, 954 mg, 955 mg, 956 mg, 957 mg, 958 mg, 959 mg, 960 mg, 961 mg, 962 mg, 963 mg, 964 mg, 965 mg, 966 mg, 967 mg, 968 mg, 969 mg, 970 mg, 971 mg, 972 mg, 973 mg, 974 mg, 975 mg, 976 mg, 977 mg, 978 mg, 979 mg, 980 mg, 981 mg, 982 mg, 983 mg, 984 mg, 985 mg, 986 mg, 987 mg, 988 mg, 989 mg, 990 mg, 991 mg, 992 mg, 993 mg, 994 mg, 995 mg, 996 mg, 997 mg, 998 mg, 999 mg, 1,000 mg, 1,001 mg, 1,002 mg, 1,003 mg, 1,004 mg, 1,005 mg, 1,006 mg, 1,007 mg, 1,008 mg, 1,009 mg, 1,010 mg, 1,011 mg, 1,012 mg, 1,013 mg, 1,014 mg, 1,015 mg, 1,016 mg, 1,017 mg, 1,018 mg, 1,019 mg, 1,020 mg, 1,021 mg, 1,022 mg, 1,023 mg, 1,024 mg, 1,025 mg, 1,026 mg, 1,027 mg, 1,028 mg, 1,029 mg, 1,030 mg, 1,031 mg, 1,032 mg, 1,033 mg, 1,034 mg, 1,035 mg, 1,036 mg, 1,037 mg, 1,038 mg, 1,039 mg, 1,040 mg, 1,041 mg, 1,042 mg, 1,043 mg, 1,044 mg, 1,045 mg, 1,046 mg, 1,047 mg, 1,048 mg, 1,049 mg, 1,050 mg, 1,051 mg, 1,052 mg, 1,053 mg, 1,054 mg, 1,055 mg, 1,056 mg, 1,057 mg, 1,058 mg, 1,059 mg, 1,060 mg, 1,061 mg, 1,062 mg, 1,063 mg, 1,064 mg, 1,065 mg, 1,066 mg, 1,067 mg, 1,068 mg, 1,069 mg, 1,070 mg, 1,071 mg, 1,072 mg, 1,073 mg, 1,074 mg, 1,075 mg, 1,076 mg, 1,077 mg, 1,078 mg, 1,079 mg, 1,080 mg, 1,081 mg, 1,082 mg, 1,083 mg, 1,084 mg, 1,085 mg, 1,086 mg, 1,087 mg, 1,088 mg, 1,089 mg, 1,090 mg, 1,091 mg, 1,092 mg, 1,093 mg, 1,094 mg, 1,095 mg, 1,096 mg, 1,097 mg, 1,098 mg, 1,099 mg, or 1,100 mg (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0566] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in one or more doses (e.g., in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more doses) totaling from about 800 mg to about 1,000 mg, such as in one or more doses (e.g., in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more doses) totaling about 800 mg, 801 mg, 802 mg, 803 mg, 804 mg, 805 mg, 806 mg, 807 mg, 808 mg, 809 mg, 810 mg, 811 mg, 812 mg, 813 mg, 814 mg, 815 mg, 816 mg, 817 mg, 818 mg, 819 mg, 820 mg, 821 mg, 822 mg, 823 mg, 824 mg, 825 mg, 826 mg, 827 mg, 828 mg, 829 mg, 830 mg, 831 mg, 832 mg, 833 mg, 834 mg, 835 mg, 836 mg, 837 mg, 838 mg, 839 mg, 840 mg, 841 mg, 842 mg, 843 mg, 844 mg, 845 mg, 846 mg, 847 mg, 848 mg, 849 mg, 850 mg, 851 mg, 852 mg, 853 mg, 854 mg, 855 mg, 856 mg, 857 mg, 858 mg, 859 mg, 860 mg, 861 mg, 862 mg, 863 mg, 864 mg, 865 mg, 866 mg, 867 mg, 868 mg, 869 mg, 870 mg, 871 mg, 872 mg, 873 mg, 874 mg, 875 mg, 876 mg, 877 mg, 878 mg, 879 mg, 880 mg, 881 mg, 882 mg, 883 mg, 884 mg, 885 mg, 886 mg, 887 mg, 888 mg, 889 mg, 890 mg, 891 mg, 892 mg, 893 mg, 894 mg, 895 mg, 896 mg, 897 mg, 898 mg, 899 mg, 900 mg, 901 mg, 902 mg, 903 mg, 904 mg, 905 mg, 906 mg, 907 mg, 908 mg, 909 mg, 910 mg, 911 mg, 912 mg, 913 mg, 914 mg, 915 mg, 916 mg, 917 mg, 918 mg, 919 mg, 920 mg, 921 mg, 922 mg, 923 mg, 924 mg, 925 mg, 926 mg, 927 mg, 928 mg, 929 mg, 930 mg, 931 mg, 932 mg, 933 mg, 934 mg, 935 mg, 936 mg, 937 mg, 938 mg, 939 mg, 940 mg, 941 mg, 942 mg, 943 mg, 944 mg, 945 mg, 946 mg, 947 mg, 948 mg, 949 mg, 950 mg, 951 mg, 952 mg, 953 mg, 954 mg, 955 mg, 956 mg, 957 mg, 958 mg, 959 mg, 960 mg, 961 mg, 962 mg, 963 mg, 964 mg, 965 mg, 966 mg, 967 mg, 968 mg, 969 mg, 970 mg, 971 mg, 972 mg, 973 mg, 974 mg, 975 mg, 976 mg, 977 mg, 978 mg, 979 mg, 980 mg, 981 mg, 982 mg, 983 mg, 984 mg, 985 mg, 986 mg, 987 mg, 988 mg, 989 mg, 990 mg, 991 mg, 992 mg, 993 mg, 994 mg, 995 mg, 996 mg, 997 mg, 998 mg, 999 mg, or 1,000 mg (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0567] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in one or more doses (e.g., in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more doses) totaling from about 850 mg to about 950 mg, such as an amount of about 850 mg, 851 mg, 852 mg, 853 mg, 854 mg, 855 mg, 856 mg, 857 mg, 858 mg, 859 mg, 860 mg, 861 mg, 862 mg, 863 mg, 864 mg, 865 mg, 866 mg, 867 mg, 868 mg, 869 mg, 870 mg, 871 mg, 872 mg, 873 mg, 874 mg, 875 mg, 876 mg, 877 mg, 878 mg, 879 mg, 880 mg, 881 mg, 882 mg, 883 mg, 884 mg, 885 mg, 886 mg, 887 mg, 888 mg, 889 mg, 890 mg, 891 mg, 892 mg, 893 mg, 894 mg, 895 mg, 896 mg, 897 mg, 898 mg, 899 mg, 900 mg, 901 mg, 902 mg, 903 mg, 904 mg, 905 mg, 906 mg, 907 mg, 908 mg, 909 mg, 910 mg, 911 mg, 912 mg, 913 mg, 914 mg, 915 mg, 916 mg, 917 mg, 918 mg, 919 mg, 920 mg, 921 mg, 922 mg, 923 mg, 924 mg, 925 mg, 926 mg, 927 mg, 928 mg, 929 mg, 930 mg, 931 mg, 932 mg, 933 mg, 934 mg, 935 mg, 936 mg, 937 mg, 938 mg, 939 mg, 940 mg, 941 mg, 942 mg, 943 mg, 944 mg, 945 mg, 946 mg, 947 mg, 948 mg, 949 mg, or 950 mg (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0568] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in one or more doses (e.g., in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more doses) totaling from about 860 mg to about 940 mg, such as in one or more doses (e.g., in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more doses) totaling about 860 mg, 861 mg, 862 mg, 863 mg, 864 mg, 865 mg, 866 mg, 867 mg, 868 mg, 869 mg, 870 mg, 871 mg, 872 mg, 873 mg, 874 mg, 875 mg, 876 mg, 877 mg, 878 mg, 879 mg, 880 mg, 881 mg, 882 mg, 883 mg, 884 mg, 885 mg, 886 mg, 887 mg, 888 mg, 889 mg, 890 mg, 891 mg, 892 mg, 893 mg, 894 mg, 895 mg, 896 mg, 897 mg, 898 mg, 899 mg, 900 mg, 901 mg, 902 mg, 903 mg, 904 mg, 905 mg, 906 mg, 907 mg, 908 mg, 909 mg, 910 mg, 911 mg, 912 mg, 913 mg, 914 mg, 915 mg, 916 mg, 917 mg, 918 mg, 919 mg, 920 mg, 921 mg, 922 mg, 923 mg, 924 mg, 925 mg, 926 mg, 927 mg, 928 mg, 929 mg, 930 mg, 931 mg, 932 mg, 933 mg, 934 mg, 935 mg, 936 mg, 937 mg, 938 mg, 939 mg, or 940 mg (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0569] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in one or more doses (e.g., in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more doses) totaling from about 870 mg to about 930 mg, such as an amount of about 870 mg, 871 mg, 872 mg, 873 mg, 874 mg, 875 mg, 876 mg, 877 mg, 878 mg, 879 mg, 880 mg, 881 mg, 882 mg, 883 mg, 884 mg, 885 mg, 886 mg, 887 mg, 888 mg, 889 mg, 890 mg, 891 mg, 892 mg, 893 mg, 894 mg, 895 mg, 896 mg, 897 mg, 898 mg, 899 mg, 900 mg, 901 mg, 902 mg, 903 mg, 904 mg, 905 mg, 906 mg, 907 mg, 908 mg, 909 mg, 910 mg, 911 mg, 912 mg, 913 mg, 914 mg, 915 mg, 916 mg, 917 mg, 918 mg, 919 mg, 920 mg, 921 mg, 922 mg, 923 mg, 924 mg, 925 mg, 926 mg, 927 mg, 928 mg, 929 mg, or 930 mg (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0570] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in one or more doses (e.g., in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more doses) totaling from about 880 mg to about 920 mg, such as an amount of about 880 mg, 881 mg, 882 mg, 883 mg, 884 mg, 885 mg, 886 mg, 887 mg, 888 mg, 889 mg, 890 mg, 891 mg, 892 mg, 893 mg, 894 mg, 895 mg, 896 mg, 897 mg, 898 mg, 899 mg, 900 mg, 901 mg, 902 mg, 903 mg, 904 mg, 905 mg, 906 mg, 907 mg, 908 mg, 909 mg, 910 mg, 911 mg, 912 mg, 913 mg, 914 mg, 915 mg, 916 mg, 917 mg, 918 mg, 919 mg, or 920 mg (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0571] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in one or more doses (e.g., in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more doses) totaling from about 890 mg to about 910 mg, such as an amount of about 890 mg, 891 mg, 892 mg, 893 mg, 894 mg, 895 mg, 896 mg, 897 mg, 898 mg, 899 mg, 900 mg, 901 mg, 902 mg, 903 mg, 904 mg, 905 mg, 906 mg, 907 mg, 908 mg, 909 mg, or 910 mg (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0572] In some embodiments, the oxytocin receptor antagonist is administered to the subject in one or more doses (e.g., in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more doses) totaling about 900 mg (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0573] In some embodiments, the oxytocin receptor antagonist is administered to the subject in a single dose (e.g., on the day of the embryo transfer therapy) of from 600 mg to 1,200 mg, such as in a single dose (e.g., on the day of the embryo transfer therapy) of from 1610 mg to 1,190 mg, from 620 mg to 1,180 mg, from 630 mg to 1,170 mg, from 640 mg to 1,160 mg, from 650 mg to 1,150 mg, from 660 mg to 1,140 mg, from 670 mg to 1,130 mg, from 680 mg to 1,120 mg, from 690 mg to 1,110 mg, from 700 mg to 1,100 mg, from 710 mg to 1,090 mg, from 720 mg to 1,080 mg, from 730 mg to 1,070 mg, from 740 mg to 1,060 mg, from 750 mg to 1,050 mg, from 760 mg to 1,040 mg, from 770 mg to 1,030 mg, from 780 mg to 1,020 mg, from 790 mg to 1,010 mg, from 800 mg to 1,000 mg, from 810 mg to 990 mg, from 820 mg to 980 mg, from 830 mg to 970 mg, from 840 mg to 960 mg, from 850 mg to 950 mg, from 860 mg to 940 mg, from 870 mg to 930 mg, from 880 mg to 920 mg, or from 890 mg to 910 mg (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0574] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in a single dose (e.g., on the day of the embryo transfer therapy) of from about 601 mg to about 1,199 mg, such as in a single dose (e.g., on the day of the embryo transfer therapy) of about 601 mg, 602 mg, 603 mg, 604 mg, 605 mg, 606 mg, 607 mg, 608 mg, 609 mg, 610 mg, 611 mg, 612 mg, 613 mg, 614 mg, 615 mg, 616 mg, 617 mg, 618 mg, 619 mg, 620 mg, 621 mg, 622 mg, 623 mg, 624 mg, 625 mg, 626 mg, 627 mg, 628 mg, 629 mg, 630 mg, 631 mg, 632 mg, 633 mg, 634 mg, 635 mg, 636 mg, 637 mg, 638 mg, 639 mg, 640 mg, 641 mg, 642 mg, 643 mg, 644 mg, 645 mg, 646 mg, 647 mg, 648 mg, 649 mg, 650 mg, 651 mg, 652 mg, 653 mg, 654 mg, 655 mg, 656 mg, 657 mg, 658 mg, 659 mg, 660 mg, 661 mg, 662 mg, 663 mg, 664 mg, 665 mg, 666 mg, 667 mg, 668 mg, 669 mg, 670 mg, 671 mg, 672 mg, 673 mg, 674 mg, 675 mg, 676 mg, 677 mg, 678 mg, 679 mg, 680 mg, 681 mg, 682 mg, 683 mg, 684 mg, 685 mg, 686 mg, 687 mg, 688 mg, 689 mg, 690 mg, 691 mg, 692 mg, 693 mg, 694 mg, 695 mg, 696 mg, 697 mg, 698 mg, 699 mg, 700 mg, 701 mg, 702 mg, 703 mg, 704 mg, 705 mg, 706 mg, 707 mg, 708 mg, 709 mg, 710 mg, 711 mg, 712 mg, 713 mg, 714 mg, 715 mg, 716 mg, 717 mg, 718 mg, 719 mg, 720 mg, 721 mg, 722 mg, 723 mg, 724 mg, 725 mg, 726 mg, 727 mg, 728 mg, 729 mg, 730 mg, 731 mg, 732 mg, 733 mg, 734 mg, 735 mg, 736 mg, 737 mg, 738 mg, 739 mg, 740 mg, 741 mg, 742 mg, 743 mg, 744 mg, 745 mg, 746 mg, 747 mg, 748 mg, 749 mg, 750 mg, 751 mg, 752 mg, 753 mg, 754 mg, 755 mg, 756 mg, 757 mg, 758 mg, 759 mg, 760 mg, 761 mg, 762 mg, 763 mg, 764 mg, 765 mg, 766 mg, 767 mg, 768 mg, 769 mg, 770 mg, 771 mg, 772 mg, 773 mg, 774 mg, 775 mg, 776 mg, 777 mg, 778 mg, 779 mg, 780 mg, 781 mg, 782 mg, 783 mg, 784 mg, 785 mg, 786 mg, 787 mg, 788 mg, 789 mg, 790 mg, 791 mg, 792 mg, 793 mg, 794 mg, 795 mg, 796 mg, 797 mg, 798 mg, 799 mg, 800 mg, 801 mg, 802 mg, 803 mg, 804 mg, 805 mg, 806 mg, 807 mg, 808 mg, 809 mg, 810 mg, 811 mg, 812 mg, 813 mg, 814 mg, 815 mg, 816 mg, 817 mg, 818 mg, 819 mg, 820 mg, 821 mg, 822 mg, 823 mg, 824 mg, 825 mg, 826 mg, 827 mg, 828 mg, 829 mg, 830 mg, 831 mg, 832 mg, 833 mg, 834 mg, 835 mg, 836 mg, 837 mg, 838 mg, 839 mg, 840 mg, 841 mg, 842 mg, 843 mg, 844 mg, 845 mg, 846 mg, 847 mg, 848 mg, 849 mg, 850 mg, 851 mg, 852 mg, 853 mg, 854 mg, 855 mg, 856 mg, 857 mg, 858 mg, 859 mg, 860 mg, 861 mg, 862 mg, 863 mg, 864 mg, 865 mg, 866 mg, 867 mg, 868 mg, 869 mg, 870 mg, 871 mg, 872 mg, 873 mg, 874 mg, 875 mg, 876 mg, 877 mg, 878 mg, 879 mg, 880 mg, 881 mg, 882 mg, 883 mg, 884 mg, 885 mg, 886 mg, 887 mg, 888 mg, 889 mg, 890 mg, 891 mg, 892 mg, 893 mg, 894 mg, 895 mg, 896 mg, 897 mg, 898 mg, 899 mg, 900 mg, 901 mg, 902 mg, 903 mg, 904 mg, 905 mg, 906 mg, 907 mg, 908 mg, 909 mg, 910 mg, 911 mg, 912 mg, 913 mg, 914 mg, 915 mg, 916 mg, 917 mg, 918 mg, 919 mg, 920 mg, 921 mg, 922 mg, 923 mg, 924 mg, 925 mg, 926 mg, 927 mg, 928 mg, 929 mg, 930 mg, 931 mg, 932 mg, 933 mg, 934 mg, 935 mg, 936 mg, 937 mg, 938 mg, 939 mg, 940 mg, 941 mg, 942 mg, 943 mg, 944 mg, 945 mg, 946 mg, 947 mg, 948 mg, 949 mg, 950 mg, 951 mg, 952 mg, 953 mg, 954 mg, 955 mg, 956 mg, 957 mg, 958 mg, 959 mg, 960 mg, 961 mg, 962 mg, 963 mg, 964 mg, 965 mg, 966 mg, 967 mg, 968 mg, 969 mg, 970 mg, 971 mg, 972 mg, 973 mg, 974 mg, 975 mg, 976 mg, 977 mg, 978 mg, 979 mg, 980 mg, 981 mg, 982 mg, 983 mg, 984 mg, 985 mg, 986 mg, 987 mg, 988 mg, 989 mg, 990 mg, 991 mg, 992 mg, 993 mg, 994 mg, 995 mg, 996 mg, 997 mg, 998 mg, 999 mg, 1,000 mg, 1,001 mg, 1,002 mg, 1,003 mg, 1,004 mg, 1,005 mg, 1,006 mg, 1,007 mg, 1,008 mg, 1,009 mg, 1,010 mg, 1,011 mg, 1,012 mg, 1,013 mg, 1,014 mg, 1,015 mg, 1,016 mg, 1,017 mg, 1,018 mg, 1,019 mg, 1,020 mg, 1,021 mg, 1,022 mg, 1,023 mg, 1,024 mg, 1,025 mg, 1,026 mg, 1,027 mg, 1,028 mg, 1,029 mg, 1,030 mg, 1,031 mg, 1,032 mg, 1,033 mg, 1,034 mg, 1,035 mg, 1,036 mg, 1,037 mg, 1,038 mg, 1,039 mg, 1,040 mg, 1,041 mg, 1,042 mg, 1,043 mg, 1,044 mg, 1,045 mg, 1,046 mg, 1,047 mg, 1,048 mg, 1,049 mg, 1,050 mg, 1,051 mg, 1,052 mg, 1,053 mg, 1,054 mg, 1,055 mg, 1,056 mg, 1,057 mg, 1,058 mg, 1,059 mg, 1,060 mg, 1,061 mg, 1,062 mg, 1,063 mg, 1,064 mg, 1,065 mg, 1,066 mg, 1,067 mg, 1,068 mg, 1,069 mg, 1,070 mg, 1,071 mg, 1,072 mg, 1,073 mg, 1,074 mg, 1,075 mg, 1,076 mg, 1,077 mg, 1,078 mg, 1,079 mg, 1,080 mg, 1,081 mg, 1,082 mg, 1,083 mg, 1,084 mg, 1,085 mg, 1,086 mg, 1,087 mg, 1,088 mg, 1,089 mg, 1,090 mg, 1,091 mg, 1,092 mg, 1,093 mg, 1,094 mg, 1,095 mg, 1,096 mg, 1,097 mg, 1,098 mg, 1,099 mg, 1,100 mg, 1,101 mg, 1,102 mg, 1,103 mg, 1,104 mg, 1,105 mg, 1,106 mg, 1,107 mg, 1,108 mg, 1,109 mg, 1,110 mg, 1,111 mg, 1,112 mg, 1,113 mg, 1,114 mg, 1,115 mg, 1,116 mg, 1,117 mg, 1,118 mg, 1,119 mg, 1,120 mg, 1,121 mg, 1,122 mg, 1,123 mg, 1,124 mg, 1,125 mg, 1,126 mg, 1,127 mg, 1,128 mg, 1,129 mg, 1,130 mg, 1,131 mg, 1,132 mg, 1,133 mg, 1,134 mg, 1,135 mg, 1,136 mg, 1,137 mg, 1,138 mg, 1,139 mg, 1,140 mg, 1,141 mg, 1,142 mg, 1,143 mg, 1,144 mg, 1,145 mg, 1,146 mg, 1,147 mg, 1,148 mg, 1,149 mg, 1,150 mg, 1,151 mg, 1,152 mg, 1,153 mg, 1,154 mg, 1,155 mg, 1,156 mg, 1,157 mg, 1,158 mg, 1,159 mg, 1,160 mg, 1,161 mg, 1,162 mg, 1,163 mg, 1,164 mg, 1,165 mg, 1,166 mg, 1,167 mg, 1,168 mg, 1,169 mg, 1,170 mg, 1,171 mg, 1,172 mg, 1,173 mg, 1,174 mg, 1,175 mg, 1,176 mg, 1,177 mg, 1,178 mg, 1,179 mg, 1,180 mg, 1,181 mg, 1,182 mg, 1,183 mg, 1,184 mg, 1,185 mg, 1,186 mg, 1,187 mg, 1,188 mg, 1,189 mg, 1,190 mg, 1,191 mg, 1,192 mg, 1,193 mg, 1,194 mg, 1,195 mg, 1,196 mg, 1,197 mg, 1,198 mg, or 1,199 mg (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0575] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in a single dose (e.g., on the day of the embryo transfer therapy) of from about 700 mg to about 1,100 mg, such as in a single dose (e.g., on the day of the embryo transfer therapy) of about 700 mg, 701 mg, 702 mg, 703 mg, 704 mg, 705 mg, 706 mg, 707 mg, 708 mg, 709 mg, 710 mg, 711 mg, 712 mg, 713 mg, 714 mg, 715 mg, 716 mg, 717 mg, 718 mg, 719 mg, 720 mg, 721 mg, 722 mg, 723 mg, 724 mg, 725 mg, 726 mg, 727 mg, 728 mg, 729 mg, 730 mg, 731 mg, 732 mg, 733 mg, 734 mg, 735 mg, 736 mg, 737 mg, 738 mg, 739 mg, 740 mg, 741 mg, 742 mg, 743 mg, 744 mg, 745 mg, 746 mg, 747 mg, 748 mg, 749 mg, 750 mg, 751 mg, 752 mg, 753 mg, 754 mg, 755 mg, 756 mg, 757 mg, 758 mg, 759 mg, 760 mg, 761 mg, 762 mg, 763 mg, 764 mg, 765 mg, 766 mg, 767 mg, 768 mg, 769 mg, 770 mg, 771 mg, 772 mg, 773 mg, 774 mg, 775 mg, 776 mg, 777 mg, 778 mg, 779 mg, 780 mg, 781 mg, 782 mg, 783 mg, 784 mg, 785 mg, 786 mg, 787 mg, 788 mg, 789 mg, 790 mg, 791 mg, 792 mg, 793 mg, 794 mg, 795 mg, 796 mg, 797 mg, 798 mg, 799 mg, 800 mg, 801 mg, 802 mg, 803 mg, 804 mg, 805 mg, 806 mg, 807 mg, 808 mg, 809 mg, 810 mg, 811 mg, 812 mg, 813 mg, 814 mg, 815 mg, 816 mg, 817 mg, 818 mg, 819 mg, 820 mg, 821 mg, 822 mg, 823 mg, 824 mg, 825 mg, 826 mg, 827 mg, 828 mg, 829 mg, 830 mg, 831 mg, 832 mg, 833 mg, 834 mg, 835 mg, 836 mg, 837 mg, 838 mg, 839 mg, 840 mg, 841 mg, 842 mg, 843 mg, 844 mg, 845 mg, 846 mg, 847 mg, 848 mg, 849 mg, 850 mg, 851 mg, 852 mg, 853 mg, 854 mg, 855 mg, 856 mg, 857 mg, 858 mg, 859 mg, 860 mg, 861 mg, 862 mg, 863 mg, 864 mg, 865 mg, 866 mg, 867 mg, 868 mg, 869 mg, 870 mg, 871 mg, 872 mg, 873 mg, 874 mg, 875 mg, 876 mg, 877 mg, 878 mg, 879 mg, 880 mg, 881 mg, 882 mg, 883 mg, 884 mg, 885 mg, 886 mg, 887 mg, 888 mg, 889 mg, 890 mg, 891 mg, 892 mg, 893 mg, 894 mg, 895 mg, 896 mg, 897 mg, 898 mg, 899 mg, 900 mg, 901 mg, 902 mg, 903 mg, 904 mg, 905 mg, 906 mg, 907 mg, 908 mg, 909 mg, 910 mg, 911 mg, 912 mg, 913 mg, 914 mg, 915 mg, 916 mg, 917 mg, 918 mg, 919 mg, 920 mg, 921 mg, 922 mg, 923 mg, 924 mg, 925 mg, 926 mg, 927 mg, 928 mg, 929 mg, 930 mg, 931 mg, 932 mg, 933 mg, 934 mg, 935 mg, 936 mg, 937 mg, 938 mg, 939 mg, 940 mg, 941 mg, 942 mg, 943 mg, 944 mg, 945 mg, 946 mg, 947 mg, 948 mg, 949 mg, 950 mg, 951 mg, 952 mg, 953 mg, 954 mg, 955 mg, 956 mg, 957 mg, 958 mg, 959 mg, 960 mg, 961 mg, 962 mg, 963 mg, 964 mg, 965 mg, 966 mg, 967 mg, 968 mg, 969 mg, 970 mg, 971 mg, 972 mg, 973 mg, 974 mg, 975 mg, 976 mg, 977 mg, 978 mg, 979 mg, 980 mg, 981 mg, 982 mg, 983 mg, 984 mg, 985 mg, 986 mg, 987 mg, 988 mg, 989 mg, 990 mg, 991 mg, 992 mg, 993 mg, 994 mg, 995 mg, 996 mg, 997 mg, 998 mg, 999 mg, 1,000 mg, 1,001 mg, 1,002 mg, 1,003 mg, 1,004 mg, 1,005 mg, 1,006 mg, 1,007 mg, 1,008 mg, 1,009 mg, 1,010 mg, 1,011 mg, 1,012 mg, 1,013 mg, 1,014 mg, 1,015 mg, 1,016 mg, 1,017 mg, 1,018 mg, 1,019 mg, 1,020 mg, 1,021 mg, 1,022 mg, 1,023 mg, 1,024 mg, 1,025 mg, 1,026 mg, 1,027 mg, 1,028 mg, 1,029 mg, 1,030 mg, 1,031 mg, 1,032 mg, 1,033 mg, 1,034 mg, 1,035 mg, 1,036 mg, 1,037 mg, 1,038 mg, 1,039 mg, 1,040 mg, 1,041 mg, 1,042 mg, 1,043 mg, 1,044 mg, 1,045 mg, 1,046 mg, 1,047 mg, 1,048 mg, 1,049 mg, 1,050 mg, 1,051 mg, 1,052 mg, 1,053 mg, 1,054 mg, 1,055 mg, 1,056 mg, 1,057 mg, 1,058 mg, 1,059 mg, 1,060 mg, 1,061 mg, 1,062 mg, 1,063 mg, 1,064 mg, 1,065 mg, 1,066 mg, 1,067 mg, 1,068 mg, 1,069 mg, 1,070 mg, 1,071 mg, 1,072 mg, 1,073 mg, 1,074 mg, 1,075 mg, 1,076 mg, 1,077 mg, 1,078 mg, 1,079 mg, 1,080 mg, 1,081 mg, 1,082 mg, 1,083 mg, 1,084 mg, 1,085 mg, 1,086 mg, 1,087 mg, 1,088 mg, 1,089 mg, 1,090 mg, 1,091 mg, 1,092 mg, 1,093 mg, 1,094 mg, 1,095 mg, 1,096 mg, 1,097 mg, 1,098 mg, 1,099 mg, or 1,100 mg (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0576] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in a single dose (e.g., on the day of the embryo transfer therapy) of from about 800 mg to about 1,000 mg, such as in a single dose (e.g., on the day of the embryo transfer therapy) of about 800 mg, 801 mg, 802 mg, 803 mg, 804 mg, 805 mg, 806 mg, 807 mg, 808 mg, 809 mg, 810 mg, 811 mg, 812 mg, 813 mg, 814 mg, 815 mg, 816 mg, 817 mg, 818 mg, 819 mg, 820 mg, 821 mg, 822 mg, 823 mg, 824 mg, 825 mg, 826 mg, 827 mg, 828 mg, 829 mg, 830 mg, 831 mg, 832 mg, 833 mg, 834 mg, 835 mg, 836 mg, 837 mg, 838 mg, 839 mg, 840 mg, 841 mg, 842 mg, 843 mg, 844 mg, 845 mg, 846 mg, 847 mg, 848 mg, 849 mg, 850 mg, 851 mg, 852 mg, 853 mg, 854 mg, 855 mg, 856 mg, 857 mg, 858 mg, 859 mg, 860 mg, 861 mg, 862 mg, 863 mg, 864 mg, 865 mg, 866 mg, 867 mg, 868 mg, 869 mg, 870 mg, 871 mg, 872 mg, 873 mg, 874 mg, 875 mg, 876 mg, 877 mg, 878 mg, 879 mg, 880 mg, 881 mg, 882 mg, 883 mg, 884 mg, 885 mg, 886 mg, 887 mg, 888 mg, 889 mg, 890 mg, 891 mg, 892 mg, 893 mg, 894 mg, 895 mg, 896 mg, 897 mg, 898 mg, 899 mg, 900 mg, 901 mg, 902 mg, 903 mg, 904 mg, 905 mg, 906 mg, 907 mg, 908 mg, 909 mg, 910 mg, 911 mg, 912 mg, 913 mg, 914 mg, 915 mg, 916 mg, 917 mg, 918 mg, 919 mg, 920 mg, 921 mg, 922 mg, 923 mg, 924 mg, 925 mg, 926 mg, 927 mg, 928 mg, 929 mg, 930 mg, 931 mg, 932 mg, 933 mg, 934 mg, 935 mg, 936 mg, 937 mg, 938 mg, 939 mg, 940 mg, 941 mg, 942 mg, 943 mg, 944 mg, 945 mg, 946 mg, 947 mg, 948 mg, 949 mg, 950 mg, 951 mg, 952 mg, 953 mg, 954 mg, 955 mg, 956 mg, 957 mg, 958 mg, 959 mg, 960 mg, 961 mg, 962 mg, 963 mg, 964 mg, 965 mg, 966 mg, 967 mg, 968 mg, 969 mg, 970 mg, 971 mg, 972 mg, 973 mg, 974 mg, 975 mg, 976 mg, 977 mg, 978 mg, 979 mg, 980 mg, 981 mg, 982 mg, 983 mg, 984 mg, 985 mg, 986 mg, 987 mg, 988 mg, 989 mg, 990 mg, 991 mg, 992 mg, 993 mg, 994 mg, 995 mg, 996 mg, 997 mg, 998 mg, 999 mg, or 1,000 mg (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0577] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in a single dose (e.g., on the day of the embryo transfer therapy) of from about 850 mg to about 950 mg, such as in a single dose (e.g., on the day of the embryo transfer therapy) of about 850 mg, 851 mg, 852 mg, 853 mg, 854 mg, 855 mg, 856 mg, 857 mg, 858 mg, 859 mg, 860 mg, 861 mg, 862 mg, 863 mg, 864 mg, 865 mg, 866 mg, 867 mg, 868 mg, 869 mg, 870 mg, 871 mg, 872 mg, 873 mg, 874 mg, 875 mg, 876 mg, 877 mg, 878 mg, 879 mg, 880 mg, 881 mg, 882 mg, 883 mg, 884 mg, 885 mg, 886 mg, 887 mg, 888 mg, 889 mg, 890 mg, 891 mg, 892 mg, 893 mg, 894 mg, 895 mg, 896 mg, 897 mg, 898 mg, 899 mg, 900 mg, 901 mg, 902 mg, 903 mg, 904 mg, 905 mg, 906 mg, 907 mg, 908 mg, 909 mg, 910 mg, 911 mg, 912 mg, 913 mg, 914 mg, 915 mg, 916 mg, 917 mg, 918 mg, 919 mg, 920 mg, 921 mg, 922 mg, 923 mg, 924 mg, 925 mg, 926 mg, 927 mg, 928 mg, 929 mg, 930 mg, 931 mg, 932 mg, 933 mg, 934 mg, 935 mg, 936 mg, 937 mg, 938 mg, 939 mg, 940 mg, 941 mg, 942 mg, 943 mg, 944 mg, 945 mg, 946 mg, 947 mg, 948 mg, 949 mg, or 950 mg (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0578] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in a single dose (e.g., on the day of the embryo transfer therapy) of from about 860 mg to about 940, such as in a single dose (e.g., on the day of the embryo transfer therapy) of about 860 mg, 861 mg, 862 mg, 863 mg, 864 mg, 865 mg, 866 mg, 867 mg, 868 mg, 869 mg, 870 mg, 871 mg, 872 mg, 873 mg, 874 mg, 875 mg, 876 mg, 877 mg, 878 mg, 879 mg, 880 mg, 881 mg, 882 mg, 883 mg, 884 mg, 885 mg, 886 mg, 887 mg, 888 mg, 889 mg, 890 mg, 891 mg, 892 mg, 893 mg, 894 mg, 895 mg, 896 mg, 897 mg, 898 mg, 899 mg, 900 mg, 901 mg, 902 mg, 903 mg, 904 mg, 905 mg, 906 mg, 907 mg, 908 mg, 909 mg, 910 mg, 911 mg, 912 mg, 913 mg, 914 mg, 915 mg, 916 mg, 917 mg, 918 mg, 919 mg, 920 mg, 921 mg, 922 mg, 923 mg, 924 mg, 925 mg, 926 mg, 927 mg, 928 mg, 929 mg, 930 mg, 931 mg, 932 mg, 933 mg, 934 mg, 935 mg, 936 mg, 937 mg, 938 mg, 939 mg, or 940 mg (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0579] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in a single dose (e.g., on the day of the embryo transfer therapy) of from about 870 mg to about 930 mg, such as in a single dose (e.g., on the day of the embryo transfer therapy) of about 870 mg, 871 mg, 872 mg, 873 mg, 874 mg, 875 mg, 876 mg, 877 mg, 878 mg, 879 mg, 880 mg, 881 mg, 882 mg, 883 mg, 884 mg, 885 mg, 886 mg, 887 mg, 888 mg, 889 mg, 890 mg, 891 mg, 892 mg, 893 mg, 894 mg, 895 mg, 896 mg, 897 mg, 898 mg, 899 mg, 900 mg, 901 mg, 902 mg, 903 mg, 904 mg, 905 mg, 906 mg, 907 mg, 908 mg, 909 mg, 910 mg, 911 mg, 912 mg, 913 mg, 914 mg, 915 mg, 916 mg, 917 mg, 918 mg, 919 mg, 920 mg, 921 mg, 922 mg, 923 mg, 924 mg, 925 mg, 926 mg, 927 mg, 928 mg, 929 mg, or 930 mg (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0580] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in a single dose (e.g., on the day of the embryo transfer therapy) of about 880 mg to about 920 mg, such as in a single dose (e.g., on the day of the embryo transfer therapy) of about 880 mg, 881 mg, 882 mg, 883 mg, 884 mg, 885 mg, 886 mg, 887 mg, 888 mg, 889 mg, 890 mg, 891 mg, 892 mg, 893 mg, 894 mg, 895 mg, 896 mg, 897 mg, 898 mg, 899 mg, 900 mg, 901 mg, 902 mg, 903 mg, 904 mg, 905 mg, 906 mg, 907 mg, 908 mg, 909 mg, 910 mg, 911 mg, 912 mg, 913 mg, 914 mg, 915 mg, 916 mg, 917 mg, 918 mg, 919 mg, or 920 mg (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0581] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in a single dose (e.g., on the day of the embryo transfer therapy) of from about 890 mg to about 910 mg, such as in a single dose (e.g., on the day of the embryo transfer therapy) of about 890 mg, 891 mg, 892 mg, 893 mg, 894 mg, 895 mg, 896 mg, 897 mg, 898 mg, 899 mg, 900 mg, 901 mg, 902 mg, 903 mg, 904 mg, 905 mg, 906 mg, 907 mg, 908 mg, 909 mg, or 910 mg (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0582] In some embodiments, the oxytocin receptor antagonist is administered to the subject in a single dose (e.g., on the day of the embryo transfer therapy) of about 900 mg (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0583] In some embodiments, a compounds of formula (I) or (II) is administered to a subject undergoing embryo transfer therapy in a single dose, such as in a single dose of from about 1,500 mg to about 2,100 mg, such as in a single dose of from 1,510 mg to 2,090 mg, from 1,520 mg to 2,080 mg per dose, from 1,530 mg to 2,070 mg per dose, from 1,540 mg to 2,060 mg per dose, from 1,550 mg to 2,050 mg per dose, from 1,560 mg to 2,040 mg per dose, from 1,570 mg to 2,030 mg per dose, from 1,580 mg to 2,020 mg per dose, from 1,590 mg to 2,010 mg per dose, from 1,600 mg to 2,000 mg per dose, from 1,610 mg to 1,990 mg per dose, from 1,620 mg to 1,980 mg per dose, from 1,630 mg to 1,970 mg per dose, from 1,640 mg to 1,960 mg per dose, from 1,650 mg to 1,950 mg per dose, from 1,660 mg to 1,940 mg per dose, from 1,670 mg to 1,930 mg per dose, from 1,680 mg to 1,920 mg per dose, from 1,690 mg to 1,910 mg per dose, from 1,700 mg to 1,900 mg per dose, from 1,710 mg to 1,890 mg per dose, from 1,720 mg to 1,880 mg per dose, from 1,730 mg to 1,870 mg per dose, from 1,740 mg to 1,860 mg per dose, from 1,750 mg to 1,850 mg per dose, from 1,760 mg to 1,840 mg per dose, from 1,770 mg to 1,830 mg per dose, from 1,780 mg to 1,820 mg per dose, or from 1,790 mg to 1,810 mg per dose.
[0584] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in an amount of from 1,500 to 2,100 mg per dose, such as an amount of from 1,510 mg to 2,090 mg per dose, from 1,520 mg to 2,080 mg per dose, from 1,530 mg to 2,070 mg per dose, from 1,540 mg to 2,060 mg per dose, from 1,550 mg to 2,050 mg per dose, from 1,560 mg to 2,040 mg per dose, from 1,570 mg to 2,030 mg per dose, from 1,580 mg to 2,020 mg per dose, from 1,590 mg to 2,010 mg per dose, from 1,600 mg to 2,000 mg per dose, from 1,610 mg to 1,990 mg per dose, from 1,620 mg to 1,980 mg per dose, from 1,630 mg to 1,970 mg per dose, from 1,640 mg to 1,960 mg per dose, from 1,650 mg to 1,950 mg per dose, from 1,660 mg to 1,940 mg per dose, from 1,670 mg to 1,930 mg per dose, from 1,680 mg to 1,920 mg per dose, from 1,690 mg to 1,910 mg per dose, from 1,700 mg to 1,900 mg per dose, from 1,710 mg to 1,890 mg per dose, from 1,720 mg to 1,880 mg per dose, from 1,730 mg to 1,870 mg per dose, from 1,740 mg to 1,860 mg per dose, from 1,750 mg to 1,850 mg per dose, from 1,760 mg to 1,840 mg per dose, from 1,770 mg to 1,830 mg per dose, from 1,780 mg to 1,820 mg per dose, or from 1,790 mg to 1,810 mg per dose (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0585] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in an amount of from about 1,501 mg to about 2,099 mg per dose, such as an amount of about 1,501 mg, 1,502 mg, 1,503 mg, 1,504 mg, 1,505 mg, 1,506 mg, 1,507 mg, 1,508 mg, 1,509 mg, 1,510 mg, 1,511 mg, 1,512 mg, 1,513 mg, 1,514 mg, 1,515 mg, 1,516 mg, 1,517 mg, 1,518 mg, 1,519 mg, 1,520 mg, 1,521 mg, 1,522 mg, 1,523 mg, 1,524 mg, 1,525 mg, 1,526 mg, 1,527 mg, 1,528 mg, 1,529 mg, 1,530 mg, 1,531 mg, 1,532 mg, 1,533 mg, 1,534 mg, 1,535 mg, 1,536 mg, 1,537 mg, 1,538 mg, 1,539 mg, 1,540 mg, 1,541 mg, 1,542 mg, 1,543 mg, 1,544 mg, 1,545 mg, 1,546 mg, 1,547 mg, 1,548 mg, 1,549 mg, 1,550 mg, 1,551 mg, 1,552 mg, 1,553 mg, 1,554 mg, 1,555 mg, 1,556 mg, 1,557 mg, 1,558 mg, 1,559 mg, 1,560 mg, 1,561 mg, 1,562 mg, 1,563 mg, 1,564 mg, 1,565 mg, 1,566 mg, 1,567 mg, 1,568 mg, 1,569 mg, 1,570 mg, 1,571 mg, 1,572 mg, 1,573 mg, 1,574 mg, 1,575 mg, 1,576 mg, 1,577 mg, 1,578 mg, 1,579 mg, 1,580 mg, 1,581 mg, 1,582 mg, 1,583 mg, 1,584 mg, 1,585 mg, 1,586 mg, 1,587 mg, 1,588 mg, 1,589 mg, 1,590 mg, 1,591 mg, 1,592 mg, 1,593 mg, 1,594 mg, 1,595 mg, 1,596 mg, 1,597 mg, 1,598 mg, 1,599 mg, 1,600 mg, 1,601 mg, 1,602 mg, 1,603 mg, 1,604 mg, 1,605 mg, 1,606 mg, 1,607 mg, 1,608 mg, 1,609 mg, 1,610 mg, 1,611 mg, 1,612 mg, 1,613 mg, 1,614 mg, 1,615 mg, 1,616 mg, 1,617 mg, 1,618 mg, 1,619 mg, 1,620 mg, 1,621 mg, 1,622 mg, 1,623 mg, 1,624 mg, 1,625 mg, 1,626 mg, 1,627 mg, 1,628 mg, 1,629 mg, 1,630 mg, 1,631 mg, 1,632 mg, 1,633 mg, 1,634 mg, 1,635 mg, 1,636 mg, 1,637 mg, 1,638 mg, 1,639 mg, 1,640 mg, 1,641 mg, 1,642 mg, 1,643 mg, 1,644 mg, 1,645 mg, 1,646 mg, 1,647 mg, 1,648 mg, 1,649 mg, 1,650 mg, 1,651 mg, 1,652 mg, 1,653 mg, 1,654 mg, 1,655 mg, 1,656 mg, 1,657 mg, 1,658 mg, 1,659 mg, 1,660 mg, 1,661 mg, 1,662 mg, 1,663 mg, 1,664 mg, 1,665 mg, 1,666 mg, 1,667 mg, 1,668 mg, 1,669 mg, 1,670 mg, 1,671 mg, 1,672 mg, 1,673 mg, 1,674 mg, 1,675 mg, 1,676 mg, 1,677 mg, 1,678 mg, 1,679 mg, 1,680 mg, 1,681 mg, 1,682 mg, 1,683 mg, 1,684 mg, 1,685 mg, 1,686 mg, 1,687 mg, 1,688 mg, 1,689 mg, 1,690 mg, 1,691 mg, 1,692 mg, 1,693 mg, 1,694 mg, 1,695 mg, 1,696 mg, 1,697 mg, 1,698 mg, 1,699 mg, 1,700 mg, 1,701 mg, 1,702 mg, 1,703 mg, 1,704 mg, 1,705 mg, 1,706 mg, 1,707 mg, 1,708 mg, 1,709 mg, 1,710 mg, 1,711 mg, 1,712 mg, 1,713 mg, 1,714 mg, 1,715 mg, 1,716 mg, 1,717 mg, 1,718 mg, 1,719 mg, 1,720 mg, 1,721 mg, 1,722 mg, 1,723 mg, 1,724 mg, 1,725 mg, 1,726 mg, 1,727 mg, 1,728 mg, 1,729 mg, 1,730 mg, 1,731 mg, 1,732 mg, 1,733 mg, 1,734 mg, 1,735 mg, 1,736 mg, 1,737 mg, 1,738 mg, 1,739 mg, 1,740 mg, 1,741 mg, 1,742 mg, 1,743 mg, 1,744 mg, 1,745 mg, 1,746 mg, 1,747 mg, 1,748 mg, 1,749 mg, 1,750 mg, 1,751 mg, 1,752 mg, 1,753 mg, 1,754 mg, 1,755 mg, 1,756 mg, 1,757 mg, 1,758 mg, 1,759 mg, 1,760 mg, 1,761 mg, 1,762 mg, 1,763 mg, 1,764 mg, 1,765 mg, 1,766 mg, 1,767 mg, 1,768 mg, 1,769 mg, 1,770 mg, 1,771 mg, 1,772 mg, 1,773 mg, 1,774 mg, 1,775 mg, 1,776 mg, 1,777 mg, 1,778 mg, 1,779 mg, 1,780 mg, 1,781 mg, 1,782 mg, 1,783 mg, 1,784 mg, 1,785 mg, 1,786 mg, 1,787 mg, 1,788 mg, 1,789 mg, 1,790 mg, 1,791 mg, 1,792 mg, 1,793 mg, 1,794 mg, 1,795 mg, 1,796 mg, 1,797 mg, 1,798 mg, 1,799 mg, 1,800 mg, 1,801 mg, 1,802 mg, 1,803 mg, 1,804 mg, 1,805 mg, 1,806 mg, 1,807 mg, 1,808 mg, 1,809 mg, 1,810 mg, 1,811 mg, 1,812 mg, 1,813 mg, 1,814 mg, 1,815 mg, 1,816 mg, 1,817 mg, 1,818 mg, 1,819 mg, 1,820 mg, 1,821 mg, 1,822 mg, 1,823 mg, 1,824 mg, 1,825 mg, 1,826 mg, 1,827 mg, 1,828 mg, 1,829 mg, 1,830 mg, 1,831 mg, 1,832 mg, 1,833 mg, 1,834 mg, 1,835 mg, 1,836 mg, 1,837 mg, 1,838 mg, 1,839 mg, 1,840 mg, 1,841 mg, 1,842 mg, 1,843 mg, 1,844 mg, 1,845 mg, 1,846 mg, 1,847 mg, 1,848 mg, 1,849 mg, 1,850 mg, 1,851 mg, 1,852 mg, 1,853 mg, 1,854 mg, 1,855 mg, 1,856 mg, 1,857 mg, 1,858 mg, 1,859 mg, 1,860 mg, 1,861 mg, 1,862 mg, 1,863 mg, 1,864 mg, 1,865 mg, 1,866 mg, 1,867 mg, 1,868 mg, 1,869 mg, 1,870 mg, 1,871 mg, 1,872 mg, 1,873 mg, 1,874 mg, 1,875 mg, 1,876 mg, 1,877 mg, 1,878 mg, 1,879 mg, 1,880 mg, 1,881 mg, 1,882 mg, 1,883 mg, 1,884 mg, 1,885 mg, 1,886 mg, 1,887 mg, 1,888 mg, 1,889 mg, 1,890 mg, 1,891 mg, 1,892 mg, 1,893 mg, 1,894 mg, 1,895 mg, 1,896 mg, 1,897 mg, 1,898 mg, 1,899 mg, 1,900 mg, 1,901 mg, 1,902 mg, 1,903 mg, 1,904 mg, 1,905 mg, 1,906 mg, 1,907 mg, 1,908 mg, 1,909 mg, 1,910 mg, 1,911 mg, 1,912 mg, 1,913 mg, 1,914 mg, 1,915 mg, 1,916 mg, 1,917 mg, 1,918 mg, 1,919 mg, 1,920 mg, 1,921 mg, 1,922 mg, 1,923 mg, 1,924 mg, 1,925 mg, 1,926 mg, 1,927 mg, 1,928 mg, 1,929 mg, 1,930 mg, 1,931 mg, 1,932 mg, 1,933 mg, 1,934 mg, 1,935 mg, 1,936 mg, 1,937 mg, 1,938 mg, 1,939 mg, 1,940 mg, 1,941 mg, 1,942 mg, 1,943 mg, 1,944 mg, 1,945 mg, 1,946 mg, 1,947 mg, 1,948 mg, 1,949 mg, 1,950 mg, 1,951 mg, 1,952 mg, 1,953 mg, 1,954 mg, 1,955 mg, 1,956 mg, 1,957 mg, 1,958 mg, 1,959 mg, 1,960 mg, 1,961 mg, 1,962 mg, 1,963 mg, 1,964 mg, 1,965 mg, 1,966 mg, 1,967 mg, 1,968 mg, 1,969 mg, 1,970 mg, 1,971 mg, 1,972 mg, 1,973 mg, 1,974 mg, 1,975 mg, 1,976 mg, 1,977 mg, 1,978 mg, 1,979 mg, 1,980 mg, 1,981 mg, 1,982 mg, 1,983 mg, 1,984 mg, 1,985 mg, 1,986 mg, 1,987 mg, 1,988 mg, 1,989 mg, 1,990 mg, 1,991 mg, 1,992 mg, 1,993 mg, 1,994 mg, 1,995 mg, 1,996 mg, 1,997 mg, 1,998 mg, 1,999 mg, 2,000 mg, 2,001 mg, 2,002 mg, 2,003 mg, 2,004 mg, 2,005 mg, 2,006 mg, 2,007 mg, 2,008 mg, 2,009 mg, 2,010 mg, 2,011 mg, 2,012 mg, 2,013 mg, 2,014 mg, 2,015 mg, 2,016 mg, 2,017 mg, 2,018 mg, 2,019 mg, 2,020 mg, 2,021 mg, 2,022 mg, 2,023 mg, 2,024 mg, 2,025 mg, 2,026 mg, 2,027 mg, 2,028 mg, 2,029 mg, 2,030 mg, 2,031 mg, 2,032 mg, 2,033 mg, 2,034 mg, 2,035 mg, 2,036 mg, 2,037 mg, 2,038 mg, 2,039 mg, 2,040 mg, 2,041 mg, 2,042 mg, 2,043 mg, 2,044 mg, 2,045 mg, 2,046 mg, 2,047 mg, 2,048 mg, 2,049 mg, 2,050 mg, 2,051 mg, 2,052 mg, 2,053 mg, 2,054 mg, 2,055 mg, 2,056 mg, 2,057 mg, 2,058 mg, 2,059 mg, 2,060 mg, 2,061 mg, 2,062 mg, 2,063 mg, 2,064 mg, 2,065 mg, 2,066 mg, 2,067 mg, 2,068 mg, 2,069 mg, 2,070 mg, 2,071 mg, 2,072 mg, 2,073 mg, 2,074 mg, 2,075 mg, 2,076 mg, 2,077 mg, 2,078 mg, 2,079 mg, 2,080 mg, 2,081 mg, 2,082 mg, 2,083 mg, 2,084 mg, 2,085 mg, 2,086 mg, 2,087 mg, 2,088 mg, 2,089 mg, 2,090 mg, 2,091 mg, 2,092 mg, 2,093 mg, 2,094 mg, 2,095 mg, 2,096 mg, 2,097 mg, 2,098 mg, or 2,099 mg per dose (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0586] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in an amount of from about 1,600 mg to about 2,000 mg per dose, such as an amount of about 1,600 mg, 1,601 mg, 1,602 mg, 1,603 mg, 1,604 mg, 1,605 mg, 1,606 mg, 1,607 mg, 1,608 mg, 1,609 mg, 1,610 mg, 1,611 mg, 1,612 mg, 1,613 mg, 1,614 mg, 1,615 mg, 1,616 mg, 1,617 mg, 1,618 mg, 1,619 mg, 1,620 mg, 1,621 mg, 1,622 mg, 1,623 mg, 1,624 mg, 1,625 mg, 1,626 mg, 1,627 mg, 1,628 mg, 1,629 mg, 1,630 mg, 1,631 mg, 1,632 mg, 1,633 mg, 1,634 mg, 1,635 mg, 1,636 mg, 1,637 mg, 1,638 mg, 1,639 mg, 1,640 mg, 1,641 mg, 1,642 mg, 1,643 mg, 1,644 mg, 1,645 mg, 1,646 mg, 1,647 mg, 1,648 mg, 1,649 mg, 1,650 mg, 1,651 mg, 1,652 mg, 1,653 mg, 1,654 mg, 1,655 mg, 1,656 mg, 1,657 mg, 1,658 mg, 1,659 mg, 1,660 mg, 1,661 mg, 1,662 mg, 1,663 mg, 1,664 mg, 1,665 mg, 1,666 mg, 1,667 mg, 1,668 mg, 1,669 mg, 1,670 mg, 1,671 mg, 1,672 mg, 1,673 mg, 1,674 mg, 1,675 mg, 1,676 mg, 1,677 mg, 1,678 mg, 1,679 mg, 1,680 mg, 1,681 mg, 1,682 mg, 1,683 mg, 1,684 mg, 1,685 mg, 1,686 mg, 1,687 mg, 1,688 mg, 1,689 mg, 1,690 mg, 1,691 mg, 1,692 mg, 1,693 mg, 1,694 mg, 1,695 mg, 1,696 mg, 1,697 mg, 1,698 mg, 1,699 mg, 1,700 mg, 1,701 mg, 1,702 mg, 1,703 mg, 1,704 mg, 1,705 mg, 1,706 mg, 1,707 mg, 1,708 mg, 1,709 mg, 1,710 mg, 1,711 mg, 1,712 mg, 1,713 mg, 1,714 mg, 1,715 mg, 1,716 mg, 1,717 mg, 1,718 mg, 1,719 mg, 1,720 mg, 1,721 mg, 1,722 mg, 1,723 mg, 1,724 mg, 1,725 mg, 1,726 mg, 1,727 mg, 1,728 mg, 1,729 mg, 1,730 mg, 1,731 mg, 1,732 mg, 1,733 mg, 1,734 mg, 1,735 mg, 1,736 mg, 1,737 mg, 1,738 mg, 1,739 mg, 1,740 mg, 1,741 mg, 1,742 mg, 1,743 mg, 1,744 mg, 1,745 mg, 1,746 mg, 1,747 mg, 1,748 mg, 1,749 mg, 1,750 mg, 1,751 mg, 1,752 mg, 1,753 mg, 1,754 mg, 1,755 mg, 1,756 mg, 1,757 mg, 1,758 mg, 1,759 mg, 1,760 mg, 1,761 mg, 1,762 mg, 1,763 mg, 1,764 mg, 1,765 mg, 1,766 mg, 1,767 mg, 1,768 mg, 1,769 mg, 1,770 mg, 1,771 mg, 1,772 mg, 1,773 mg, 1,774 mg, 1,775 mg, 1,776 mg, 1,777 mg, 1,778 mg, 1,779 mg, 1,780 mg, 1,781 mg, 1,782 mg, 1,783 mg, 1,784 mg, 1,785 mg, 1,786 mg, 1,787 mg, 1,788 mg, 1,789 mg, 1,790 mg, 1,791 mg, 1,792 mg, 1,793 mg, 1,794 mg, 1,795 mg, 1,796 mg, 1,797 mg, 1,798 mg, 1,799 mg, 1,800 mg, 1,801 mg, 1,802 mg, 1,803 mg, 1,804 mg, 1,805 mg, 1,806 mg, 1,807 mg, 1,808 mg, 1,809 mg, 1,810 mg, 1,811 mg, 1,812 mg, 1,813 mg, 1,814 mg, 1,815 mg, 1,816 mg, 1,817 mg, 1,818 mg, 1,819 mg, 1,820 mg, 1,821 mg, 1,822 mg, 1,823 mg, 1,824 mg, 1,825 mg, 1,826 mg, 1,827 mg, 1,828 mg, 1,829 mg, 1,830 mg, 1,831 mg, 1,832 mg, 1,833 mg, 1,834 mg, 1,835 mg, 1,836 mg, 1,837 mg, 1,838 mg, 1,839 mg, 1,840 mg, 1,841 mg, 1,842 mg, 1,843 mg, 1,844 mg, 1,845 mg, 1,846 mg, 1,847 mg, 1,848 mg, 1,849 mg, 1,850 mg, 1,851 mg, 1,852 mg, 1,853 mg, 1,854 mg, 1,855 mg, 1,856 mg, 1,857 mg, 1,858 mg, 1,859 mg, 1,860 mg, 1,861 mg, 1,862 mg, 1,863 mg, 1,864 mg, 1,865 mg, 1,866 mg, 1,867 mg, 1,868 mg, 1,869 mg, 1,870 mg, 1,871 mg, 1,872 mg, 1,873 mg, 1,874 mg, 1,875 mg, 1,876 mg, 1,877 mg, 1,878 mg, 1,879 mg, 1,880 mg, 1,881 mg, 1,882 mg, 1,883 mg, 1,884 mg, 1,885 mg, 1,886 mg, 1,887 mg, 1,888 mg, 1,889 mg, 1,890 mg, 1,891 mg, 1,892 mg, 1,893 mg, 1,894 mg, 1,895 mg, 1,896 mg, 1,897 mg, 1,898 mg, 1,899 mg, 1,900 mg, 1,901 mg, 1,902 mg, 1,903 mg, 1,904 mg, 1,905 mg, 1,906 mg, 1,907 mg, 1,908 mg, 1,909 mg, 1,910 mg, 1,911 mg, 1,912 mg, 1,913 mg, 1,914 mg, 1,915 mg, 1,916 mg, 1,917 mg, 1,918 mg, 1,919 mg, 1,920 mg, 1,921 mg, 1,922 mg, 1,923 mg, 1,924 mg, 1,925 mg, 1,926 mg, 1,927 mg, 1,928 mg, 1,929 mg, 1,930 mg, 1,931 mg, 1,932 mg, 1,933 mg, 1,934 mg, 1,935 mg, 1,936 mg, 1,937 mg, 1,938 mg, 1,939 mg, 1,940 mg, 1,941 mg, 1,942 mg, 1,943 mg, 1,944 mg, 1,945 mg, 1,946 mg, 1,947 mg, 1,948 mg, 1,949 mg, 1,950 mg, 1,951 mg, 1,952 mg, 1,953 mg, 1,954 mg, 1,955 mg, 1,956 mg, 1,957 mg, 1,958 mg, 1,959 mg, 1,960 mg, 1,961 mg, 1,962 mg, 1,963 mg, 1,964 mg, 1,965 mg, 1,966 mg, 1,967 mg, 1,968 mg, 1,969 mg, 1,970 mg, 1,971 mg, 1,972 mg, 1,973 mg, 1,974 mg, 1,975 mg, 1,976 mg, 1,977 mg, 1,978 mg, 1,979 mg, 1,980 mg, 1,981 mg, 1,982 mg, 1,983 mg, 1,984 mg, 1,985 mg, 1,986 mg, 1,987 mg, 1,988 mg, 1,989 mg, 1,990 mg, 1,991 mg, 1,992 mg, 1,993 mg, 1,994 mg, 1,995 mg, 1,996 mg, 1,997 mg, 1,998 mg, 1,999 mg, or 2,000 mg per dose (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0587] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in an amount of from about 1,700 mg to about 1,900 mg per dose, such as an amount of about 1,700 mg, 1,701 mg, 1,702 mg, 1,703 mg, 1,704 mg, 1,705 mg, 1,706 mg, 1,707 mg, 1,708 mg, 1,709 mg, 1,710 mg, 1,711 mg, 1,712 mg, 1,713 mg, 1,714 mg, 1,715 mg, 1,716 mg, 1,717 mg, 1,718 mg, 1,719 mg, 1,720 mg, 1,721 mg, 1,722 mg, 1,723 mg, 1,724 mg, 1,725 mg, 1,726 mg, 1,727 mg, 1,728 mg, 1,729 mg, 1,730 mg, 1,731 mg, 1,732 mg, 1,733 mg, 1,734 mg, 1,735 mg, 1,736 mg, 1,737 mg, 1,738 mg, 1,739 mg, 1,740 mg, 1,741 mg, 1,742 mg, 1,743 mg, 1,744 mg, 1,745 mg, 1,746 mg, 1,747 mg, 1,748 mg, 1,749 mg, 1,750 mg, 1,751 mg, 1,752 mg, 1,753 mg, 1,754 mg, 1,755 mg, 1,756 mg, 1,757 mg, 1,758 mg, 1,759 mg, 1,760 mg, 1,761 mg, 1,762 mg, 1,763 mg, 1,764 mg, 1,765 mg, 1,766 mg, 1,767 mg, 1,768 mg, 1,769 mg, 1,770 mg, 1,771 mg, 1,772 mg, 1,773 mg, 1,774 mg, 1,775 mg, 1,776 mg, 1,777 mg, 1,778 mg, 1,779 mg, 1,780 mg, 1,781 mg, 1,782 mg, 1,783 mg, 1,784 mg, 1,785 mg, 1,786 mg, 1,787 mg, 1,788 mg, 1,789 mg, 1,790 mg, 1,791 mg, 1,792 mg, 1,793 mg, 1,794 mg, 1,795 mg, 1,796 mg, 1,797 mg, 1,798 mg, 1,799 mg, 1,800 mg, 1,801 mg, 1,802 mg, 1,803 mg, 1,804 mg, 1,805 mg, 1,806 mg, 1,807 mg, 1,808 mg, 1,809 mg, 1,810 mg, 1,811 mg, 1,812 mg, 1,813 mg, 1,814 mg, 1,815 mg, 1,816 mg, 1,817 mg, 1,818 mg, 1,819 mg, 1,820 mg, 1,821 mg, 1,822 mg, 1,823 mg, 1,824 mg, 1,825 mg, 1,826 mg, 1,827 mg, 1,828 mg, 1,829 mg, 1,830 mg, 1,831 mg, 1,832 mg, 1,833 mg, 1,834 mg, 1,835 mg, 1,836 mg, 1,837 mg, 1,838 mg, 1,839 mg, 1,840 mg, 1,841 mg, 1,842 mg, 1,843 mg, 1,844 mg, 1,845 mg, 1,846 mg, 1,847 mg, 1,848 mg, 1,849 mg, 1,850 mg, 1,851 mg, 1,852 mg, 1,853 mg, 1,854 mg, 1,855 mg, 1,856 mg, 1,857 mg, 1,858 mg, 1,859 mg, 1,860 mg, 1,861 mg, 1,862 mg, 1,863 mg, 1,864 mg, 1,865 mg, 1,866 mg, 1,867 mg, 1,868 mg, 1,869 mg, 1,870 mg, 1,871 mg, 1,872 mg, 1,873 mg, 1,874 mg, 1,875 mg, 1,876 mg, 1,877 mg, 1,878 mg, 1,879 mg, 1,880 mg, 1,881 mg, 1,882 mg, 1,883 mg, 1,884 mg, 1,885 mg, 1,886 mg, 1,887 mg, 1,888 mg, 1,889 mg, 1,890 mg, 1,891 mg, 1,892 mg, 1,893 mg, 1,894 mg, 1,895 mg, 1,896 mg, 1,897 mg, 1,898 mg, 1,899 mg, or 1,900 mg per dose (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0588] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in an amount of from about 1,750 mg to about 1,850 mg per dose, such as an amount of about 1,750 mg, 1,751 mg, 1,752 mg, 1,753 mg, 1,754 mg, 1,755 mg, 1,756 mg, 1,757 mg, 1,758 mg, 1,759 mg, 1,760 mg, 1,761 mg, 1,762 mg, 1,763 mg, 1,764 mg, 1,765 mg, 1,766 mg, 1,767 mg, 1,768 mg, 1,769 mg, 1,770 mg, 1,771 mg, 1,772 mg, 1,773 mg, 1,774 mg, 1,775 mg, 1,776 mg, 1,777 mg, 1,778 mg, 1,779 mg, 1,780 mg, 1,781 mg, 1,782 mg, 1,783 mg, 1,784 mg, 1,785 mg, 1,786 mg, 1,787 mg, 1,788 mg, 1,789 mg, 1,790 mg, 1,791 mg, 1,792 mg, 1,793 mg, 1,794 mg, 1,795 mg, 1,796 mg, 1,797 mg, 1,798 mg, 1,799 mg, 1,800 mg, 1,801 mg, 1,802 mg, 1,803 mg, 1,804 mg, 1,805 mg, 1,806 mg, 1,807 mg, 1,808 mg, 1,809 mg, 1,810 mg, 1,811 mg, 1,812 mg, 1,813 mg, 1,814 mg, 1,815 mg, 1,816 mg, 1,817 mg, 1,818 mg, 1,819 mg, 1,820 mg, 1,821 mg, 1,822 mg, 1,823 mg, 1,824 mg, 1,825 mg, 1,826 mg, 1,827 mg, 1,828 mg, 1,829 mg, 1,830 mg, 1,831 mg, 1,832 mg, 1,833 mg, 1,834 mg, 1,835 mg, 1,836 mg, 1,837 mg, 1,838 mg, 1,839 mg, 1,840 mg, 1,841 mg, 1,842 mg, 1,843 mg, 1,844 mg, 1,845 mg, 1,846 mg, 1,847 mg, 1,848 mg, 1,849 mg, or 1,850 mg per dose (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0589] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in an amount of from about 1,760 mg to about 1,840 mg per dose, such as an amount of about 1,760 mg, 1,761 mg, 1,762 mg, 1,763 mg, 1,764 mg, 1,765 mg, 1,766 mg, 1,767 mg, 1,768 mg, 1,769 mg, 1,770 mg, 1,771 mg, 1,772 mg, 1,773 mg, 1,774 mg, 1,775 mg, 1,776 mg, 1,777 mg, 1,778 mg, 1,779 mg, 1,780 mg, 1,781 mg, 1,782 mg, 1,783 mg, 1,784 mg, 1,785 mg, 1,786 mg, 1,787 mg, 1,788 mg, 1,789 mg, 1,790 mg, 1,791 mg, 1,792 mg, 1,793 mg, 1,794 mg, 1,795 mg, 1,796 mg, 1,797 mg, 1,798 mg, 1,799 mg, 1,800 mg, 1,801 mg, 1,802 mg, 1,803 mg, 1,804 mg, 1,805 mg, 1,806 mg, 1,807 mg, 1,808 mg, 1,809 mg, 1,810 mg, 1,811 mg, 1,812 mg, 1,813 mg, 1,814 mg, 1,815 mg, 1,816 mg, 1,817 mg, 1,818 mg, 1,819 mg, 1,820 mg, 1,821 mg, 1,822 mg, 1,823 mg, 1,824 mg, 1,825 mg, 1,826 mg, 1,827 mg, 1,828 mg, 1,829 mg, 1,830 mg, 1,831 mg, 1,832 mg, 1,833 mg, 1,834 mg, 1,835 mg, 1,836 mg, 1,837 mg, 1,838 mg, 1,839 mg, or 1,840 mg per dose (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0590] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in an amount of from about 1,770 mg to about 1,830 mg per dose, such as an amount of about 1,770 mg, 1,771 mg, 1,772 mg, 1,773 mg, 1,774 mg, 1,775 mg, 1,776 mg, 1,777 mg, 1,778 mg, 1,779 mg, 1,780 mg, 1,781 mg, 1,782 mg, 1,783 mg, 1,784 mg, 1,785 mg, 1,786 mg, 1,787 mg, 1,788 mg, 1,789 mg, 1,790 mg, 1,791 mg, 1,792 mg, 1,793 mg, 1,794 mg, 1,795 mg, 1,796 mg, 1,797 mg, 1,798 mg, 1,799 mg, 1,800 mg, 1,801 mg, 1,802 mg, 1,803 mg, 1,804 mg, 1,805 mg, 1,806 mg, 1,807 mg, 1,808 mg, 1,809 mg, 1,810 mg, 1,811 mg, 1,812 mg, 1,813 mg, 1,814 mg, 1,815 mg, 1,816 mg, 1,817 mg, 1,818 mg, 1,819 mg, 1,820 mg, 1,821 mg, 1,822 mg, 1,823 mg, 1,824 mg, 1,825 mg, 1,826 mg, 1,827 mg, 1,828 mg, 1,829 mg, or 1,830 mg per dose (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0591] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in an amount of from about 1,780 mg to about 1,820 mg per dose, such as an amount of about 1,780 mg, 1,781 mg, 1,782 mg, 1,783 mg, 1,784 mg, 1,785 mg, 1,786 mg, 1,787 mg, 1,788 mg, 1,789 mg, 1,790 mg, 1,791 mg, 1,792 mg, 1,793 mg, 1,794 mg, 1,795 mg, 1,796 mg, 1,797 mg, 1,798 mg, 1,799 mg, 1,800 mg, 1,801 mg, 1,802 mg, 1,803 mg, 1,804 mg, 1,805 mg, 1,806 mg, 1,807 mg, 1,808 mg, 1,809 mg, 1,810 mg, 1,811 mg, 1,812 mg, 1,813 mg, 1,814 mg, 1,815 mg, 1,816 mg, 1,817 mg, 1,818 mg, 1,819 mg, or 1,820 mg per dose (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0592] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in an amount of from about 1,790 mg to about 1,810 mg per dose, such as an amount of about 1,790 mg, 1,791 mg, 1,792 mg, 1,793 mg, 1,794 mg, 1,795 mg, 1,796 mg, 1,797 mg, 1,798 mg, 1,799 mg, 1,800 mg, 1,801 mg, 1,802 mg, 1,803 mg, 1,804 mg, 1,805 mg, 1,806 mg, 1,807 mg, 1,808 mg, 1,809 mg, or 1,810 mg per dose (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0593] In some embodiments, the oxytocin receptor antagonist is administered to the subject in an amount of about 1,800 mg per dose (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0594] In some embodiments, the oxytocin receptor antagonist is administered to the subject in one or more doses (e.g., in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more doses) totaling from 1,500 to 2,100 mg, such as in one or more doses (e.g., in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more doses) totaling from 1,510 mg to 2,090 mg, from 1,520 mg to 2,080 mg, from 1,530 mg to 2,070 mg, from 1,540 mg to 2,060 mg, from 1,550 mg to 2,050 mg, from 1,560 mg to 2,040 mg, from 1,570 mg to 2,030 mg, from 1,580 mg to 2,020 mg, from 1,590 mg to 2,010 mg, from 1,600 mg to 2,000 mg, from 1,610 mg to 1,990 mg, from 1,620 mg to 1,980 mg, from 1,630 mg to 1,970 mg, from 1,640 mg to 1,960 mg, from 1,650 mg to 1,950 mg, from 1,660 mg to 1,940 mg, from 1,670 mg to 1,930 mg, from 1,680 mg to 1,920 mg, from 1,690 mg to 1,910 mg, from 1,700 mg to 1,900 mg, from 1,710 mg to 1,890 mg, from 1,720 mg to 1,880 mg, from 1,730 mg to 1,870 mg, from 1,740 mg to 1,860 mg, from 1,750 mg to 1,850 mg, from 1,760 mg to 1,840 mg, from 1,770 mg to 1,830 mg, from 1,780 mg to 1,820 mg, or from 1,790 mg to 1,810 mg (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0595] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in one or more doses (e.g., in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more doses) totaling from about 1,501 mg to about 2,099 mg, such as in one or more doses (e.g., in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more doses) totaling about 1,501 mg, 1,502 mg, 1,503 mg, 1,504 mg, 1,505 mg, 1,506 mg, 1,507 mg, 1,508 mg, 1,509 mg, 1,510 mg, 1,511 mg, 1,512 mg, 1,513 mg, 1,514 mg, 1,515 mg, 1,516 mg, 1,517 mg, 1,518 mg, 1,519 mg, 1,520 mg, 1,521 mg, 1,522 mg, 1,523 mg, 1,524 mg, 1,525 mg, 1,526 mg, 1,527 mg, 1,528 mg, 1,529 mg, 1,530 mg, 1,531 mg, 1,532 mg, 1,533 mg, 1,534 mg, 1,535 mg, 1,536 mg, 1,537 mg, 1,538 mg, 1,539 mg, 1,540 mg, 1,541 mg, 1,542 mg, 1,543 mg, 1,544 mg, 1,545 mg, 1,546 mg, 1,547 mg, 1,548 mg, 1,549 mg, 1,550 mg, 1,551 mg, 1,552 mg, 1,553 mg, 1,554 mg, 1,555 mg, 1,556 mg, 1,557 mg, 1,558 mg, 1,559 mg, 1,560 mg, 1,561 mg, 1,562 mg, 1,563 mg, 1,564 mg, 1,565 mg, 1,566 mg, 1,567 mg, 1,568 mg, 1,569 mg, 1,570 mg, 1,571 mg, 1,572 mg, 1,573 mg, 1,574 mg, 1,575 mg, 1,576 mg, 1,577 mg, 1,578 mg, 1,579 mg, 1,580 mg, 1,581 mg, 1,582 mg, 1,583 mg, 1,584 mg, 1,585 mg, 1,586 mg, 1,587 mg, 1,588 mg, 1,589 mg, 1,590 mg, 1,591 mg, 1,592 mg, 1,593 mg, 1,594 mg, 1,595 mg, 1,596 mg, 1,597 mg, 1,598 mg, 1,599 mg, 1,600 mg, 1,601 mg, 1,602 mg, 1,603 mg, 1,604 mg, 1,605 mg, 1,606 mg, 1,607 mg, 1,608 mg, 1,609 mg, 1,610 mg, 1,611 mg, 1,612 mg, 1,613 mg, 1,614 mg, 1,615 mg, 1,616 mg, 1,617 mg, 1,618 mg, 1,619 mg, 1,620 mg, 1,621 mg, 1,622 mg, 1,623 mg, 1,624 mg, 1,625 mg, 1,626 mg, 1,627 mg, 1,628 mg, 1,629 mg, 1,630 mg, 1,631 mg, 1,632 mg, 1,633 mg, 1,634 mg, 1,635 mg, 1,636 mg, 1,637 mg, 1,638 mg, 1,639 mg, 1,640 mg, 1,641 mg, 1,642 mg, 1,643 mg, 1,644 mg, 1,645 mg, 1,646 mg, 1,647 mg, 1,648 mg, 1,649 mg, 1,650 mg, 1,651 mg, 1,652 mg, 1,653 mg, 1,654 mg, 1,655 mg, 1,656 mg, 1,657 mg, 1,658 mg, 1,659 mg, 1,660 mg, 1,661 mg, 1,662 mg, 1,663 mg, 1,664 mg, 1,665 mg, 1,666 mg, 1,667 mg, 1,668 mg, 1,669 mg, 1,670 mg, 1,671 mg, 1,672 mg, 1,673 mg, 1,674 mg, 1,675 mg, 1,676 mg, 1,677 mg, 1,678 mg, 1,679 mg, 1,680 mg, 1,681 mg, 1,682 mg, 1,683 mg, 1,684 mg, 1,685 mg, 1,686 mg, 1,687 mg, 1,688 mg, 1,689 mg, 1,690 mg, 1,691 mg, 1,692 mg, 1,693 mg, 1,694 mg, 1,695 mg, 1,696 mg, 1,697 mg, 1,698 mg, 1,699 mg, 1,700 mg, 1,701 mg, 1,702 mg, 1,703 mg, 1,704 mg, 1,705 mg, 1,706 mg, 1,707 mg, 1,708 mg, 1,709 mg, 1,710 mg, 1,711 mg, 1,712 mg, 1,713 mg, 1,714 mg, 1,715 mg, 1,716 mg, 1,717 mg, 1,718 mg, 1,719 mg, 1,720 mg, 1,721 mg, 1,722 mg, 1,723 mg, 1,724 mg, 1,725 mg, 1,726 mg, 1,727 mg, 1,728 mg, 1,729 mg, 1,730 mg, 1,731 mg, 1,732 mg, 1,733 mg, 1,734 mg, 1,735 mg, 1,736 mg, 1,737 mg, 1,738 mg, 1,739 mg, 1,740 mg, 1,741 mg, 1,742 mg, 1,743 mg, 1,744 mg, 1,745 mg, 1,746 mg, 1,747 mg, 1,748 mg, 1,749 mg, 1,750 mg, 1,751 mg, 1,752 mg, 1,753 mg, 1,754 mg, 1,755 mg, 1,756 mg, 1,757 mg, 1,758 mg, 1,759 mg, 1,760 mg, 1,761 mg, 1,762 mg, 1,763 mg, 1,764 mg, 1,765 mg, 1,766 mg, 1,767 mg, 1,768 mg, 1,769 mg, 1,770 mg, 1,771 mg, 1,772 mg, 1,773 mg, 1,774 mg, 1,775 mg, 1,776 mg, 1,777 mg, 1,778 mg, 1,779 mg, 1,780 mg, 1,781 mg, 1,782 mg, 1,783 mg, 1,784 mg, 1,785 mg, 1,786 mg, 1,787 mg, 1,788 mg, 1,789 mg, 1,790 mg, 1,791 mg, 1,792 mg, 1,793 mg, 1,794 mg, 1,795 mg, 1,796 mg, 1,797 mg, 1,798 mg, 1,799 mg, 1,800 mg, 1,801 mg, 1,802 mg, 1,803 mg, 1,804 mg, 1,805 mg, 1,806 mg, 1,807 mg, 1,808 mg, 1,809 mg, 1,810 mg, 1,811 mg, 1,812 mg, 1,813 mg, 1,814 mg, 1,815 mg, 1,816 mg, 1,817 mg, 1,818 mg, 1,819 mg, 1,820 mg, 1,821 mg, 1,822 mg, 1,823 mg, 1,824 mg, 1,825 mg, 1,826 mg, 1,827 mg, 1,828 mg, 1,829 mg, 1,830 mg, 1,831 mg, 1,832 mg, 1,833 mg, 1,834 mg, 1,835 mg, 1,836 mg, 1,837 mg, 1,838 mg, 1,839 mg, 1,840 mg, 1,841 mg, 1,842 mg, 1,843 mg, 1,844 mg, 1,845 mg, 1,846 mg, 1,847 mg, 1,848 mg, 1,849 mg, 1,850 mg, 1,851 mg, 1,852 mg, 1,853 mg, 1,854 mg, 1,855 mg, 1,856 mg, 1,857 mg, 1,858 mg, 1,859 mg, 1,860 mg, 1,861 mg, 1,862 mg, 1,863 mg, 1,864 mg, 1,865 mg, 1,866 mg, 1,867 mg, 1,868 mg, 1,869 mg, 1,870 mg, 1,871 mg, 1,872 mg, 1,873 mg, 1,874 mg, 1,875 mg, 1,876 mg, 1,877 mg, 1,878 mg, 1,879 mg, 1,880 mg, 1,881 mg, 1,882 mg, 1,883 mg, 1,884 mg, 1,885 mg, 1,886 mg, 1,887 mg, 1,888 mg, 1,889 mg, 1,890 mg, 1,891 mg, 1,892 mg, 1,893 mg, 1,894 mg, 1,895 mg, 1,896 mg, 1,897 mg, 1,898 mg, 1,899 mg, 1,900 mg, 1,901 mg, 1,902 mg, 1,903 mg, 1,904 mg, 1,905 mg, 1,906 mg, 1,907 mg, 1,908 mg, 1,909 mg, 1,910 mg, 1,911 mg, 1,912 mg, 1,913 mg, 1,914 mg, 1,915 mg, 1,916 mg, 1,917 mg, 1,918 mg, 1,919 mg, 1,920 mg, 1,921 mg, 1,922 mg, 1,923 mg, 1,924 mg, 1,925 mg, 1,926 mg, 1,927 mg, 1,928 mg, 1,929 mg, 1,930 mg, 1,931 mg, 1,932 mg, 1,933 mg, 1,934 mg, 1,935 mg, 1,936 mg, 1,937 mg, 1,938 mg, 1,939 mg, 1,940 mg, 1,941 mg, 1,942 mg, 1,943 mg, 1,944 mg, 1,945 mg, 1,946 mg, 1,947 mg, 1,948 mg, 1,949 mg, 1,950 mg, 1,951 mg, 1,952 mg, 1,953 mg, 1,954 mg, 1,955 mg, 1,956 mg, 1,957 mg, 1,958 mg, 1,959 mg, 1,960 mg, 1,961 mg, 1,962 mg, 1,963 mg, 1,964 mg, 1,965 mg, 1,966 mg, 1,967 mg, 1,968 mg, 1,969 mg, 1,970 mg, 1,971 mg, 1,972 mg, 1,973 mg, 1,974 mg, 1,975 mg, 1,976 mg, 1,977 mg, 1,978 mg, 1,979 mg, 1,980 mg, 1,981 mg, 1,982 mg, 1,983 mg, 1,984 mg, 1,985 mg, 1,986 mg, 1,987 mg, 1,988 mg, 1,989 mg, 1,990 mg, 1,991 mg, 1,992 mg, 1,993 mg, 1,994 mg, 1,995 mg, 1,996 mg, 1,997 mg, 1,998 mg, 1,999 mg, 2,000 mg, 2,001 mg, 2,002 mg, 2,003 mg, 2,004 mg, 2,005 mg, 2,006 mg, 2,007 mg, 2,008 mg, 2,009 mg, 2,010 mg, 2,011 mg, 2,012 mg, 2,013 mg, 2,014 mg, 2,015 mg, 2,016 mg, 2,017 mg, 2,018 mg, 2,019 mg, 2,020 mg, 2,021 mg, 2,022 mg, 2,023 mg, 2,024 mg, 2,025 mg, 2,026 mg, 2,027 mg, 2,028 mg, 2,029 mg, 2,030 mg, 2,031 mg, 2,032 mg, 2,033 mg, 2,034 mg, 2,035 mg, 2,036 mg, 2,037 mg, 2,038 mg, 2,039 mg, 2,040 mg, 2,041 mg, 2,042 mg, 2,043 mg, 2,044 mg, 2,045 mg, 2,046 mg, 2,047 mg, 2,048 mg, 2,049 mg, 2,050 mg, 2,051 mg, 2,052 mg, 2,053 mg, 2,054 mg, 2,055 mg, 2,056 mg, 2,057 mg, 2,058 mg, 2,059 mg, 2,060 mg, 2,061 mg, 2,062 mg, 2,063 mg, 2,064 mg, 2,065 mg, 2,066 mg, 2,067 mg, 2,068 mg, 2,069 mg, 2,070 mg, 2,071 mg, 2,072 mg, 2,073 mg, 2,074 mg, 2,075 mg, 2,076 mg, 2,077 mg, 2,078 mg, 2,079 mg, 2,080 mg, 2,081 mg, 2,082 mg, 2,083 mg, 2,084 mg, 2,085 mg, 2,086 mg, 2,087 mg, 2,088 mg, 2,089 mg, 2,090 mg, 2,091 mg, 2,092 mg, 2,093 mg, 2,094 mg, 2,095 mg, 2,096 mg, 2,097 mg, 2,098 mg, or 2,099 mg (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0596] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in one or more doses (e.g., in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more doses) totaling from about 1,600 mg to about 2,000 mg, such as in one or more doses (e.g., in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more doses) totaling about 1,600 mg, 1,601 mg, 1,602 mg, 1,603 mg, 1,604 mg, 1,605 mg, 1,606 mg, 1,607 mg, 1,608 mg, 1,609 mg, 1,610 mg, 1,611 mg, 1,612 mg, 1,613 mg, 1,614 mg, 1,615 mg, 1,616 mg, 1,617 mg, 1,618 mg, 1,619 mg, 1,620 mg, 1,621 mg, 1,622 mg, 1,623 mg, 1,624 mg, 1,625 mg, 1,626 mg, 1,627 mg, 1,628 mg, 1,629 mg, 1,630 mg, 1,631 mg, 1,632 mg, 1,633 mg, 1,634 mg, 1,635 mg, 1,636 mg, 1,637 mg, 1,638 mg, 1,639 mg, 1,640 mg, 1,641 mg, 1,642 mg, 1,643 mg, 1,644 mg, 1,645 mg, 1,646 mg, 1,647 mg, 1,648 mg, 1,649 mg, 1,650 mg, 1,651 mg, 1,652 mg, 1,653 mg, 1,654 mg, 1,655 mg, 1,656 mg, 1,657 mg, 1,658 mg, 1,659 mg, 1,660 mg, 1,661 mg, 1,662 mg, 1,663 mg, 1,664 mg, 1,665 mg, 1,666 mg, 1,667 mg, 1,668 mg, 1,669 mg, 1,670 mg, 1,671 mg, 1,672 mg, 1,673 mg, 1,674 mg, 1,675 mg, 1,676 mg, 1,677 mg, 1,678 mg, 1,679 mg, 1,680 mg, 1,681 mg, 1,682 mg, 1,683 mg, 1,684 mg, 1,685 mg, 1,686 mg, 1,687 mg, 1,688 mg, 1,689 mg, 1,690 mg, 1,691 mg, 1,692 mg, 1,693 mg, 1,694 mg, 1,695 mg, 1,696 mg, 1,697 mg, 1,698 mg, 1,699 mg, 1,700 mg, 1,701 mg, 1,702 mg, 1,703 mg, 1,704 mg, 1,705 mg, 1,706 mg, 1,707 mg, 1,708 mg, 1,709 mg, 1,710 mg, 1,711 mg, 1,712 mg, 1,713 mg, 1,714 mg, 1,715 mg, 1,716 mg, 1,717 mg, 1,718 mg, 1,719 mg, 1,720 mg, 1,721 mg, 1,722 mg, 1,723 mg, 1,724 mg, 1,725 mg, 1,726 mg, 1,727 mg, 1,728 mg, 1,729 mg, 1,730 mg, 1,731 mg, 1,732 mg, 1,733 mg, 1,734 mg, 1,735 mg, 1,736 mg, 1,737 mg, 1,738 mg, 1,739 mg, 1,740 mg, 1,741 mg, 1,742 mg, 1,743 mg, 1,744 mg, 1,745 mg, 1,746 mg, 1,747 mg, 1,748 mg, 1,749 mg, 1,750 mg, 1,751 mg, 1,752 mg, 1,753 mg, 1,754 mg, 1,755 mg, 1,756 mg, 1,757 mg, 1,758 mg, 1,759 mg, 1,760 mg, 1,761 mg, 1,762 mg, 1,763 mg, 1,764 mg, 1,765 mg, 1,766 mg, 1,767 mg, 1,768 mg, 1,769 mg, 1,770 mg, 1,771 mg, 1,772 mg, 1,773 mg, 1,774 mg, 1,775 mg, 1,776 mg, 1,777 mg, 1,778 mg, 1,779 mg, 1,780 mg, 1,781 mg, 1,782 mg, 1,783 mg, 1,784 mg, 1,785 mg, 1,786 mg, 1,787 mg, 1,788 mg, 1,789 mg, 1,790 mg, 1,791 mg, 1,792 mg, 1,793 mg, 1,794 mg, 1,795 mg, 1,796 mg, 1,797 mg, 1,798 mg, 1,799 mg, 1,800 mg, 1,801 mg, 1,802 mg, 1,803 mg, 1,804 mg, 1,805 mg, 1,806 mg, 1,807 mg, 1,808 mg, 1,809 mg, 1,810 mg, 1,811 mg, 1,812 mg, 1,813 mg, 1,814 mg, 1,815 mg, 1,816 mg, 1,817 mg, 1,818 mg, 1,819 mg, 1,820 mg, 1,821 mg, 1,822 mg, 1,823 mg, 1,824 mg, 1,825 mg, 1,826 mg, 1,827 mg, 1,828 mg, 1,829 mg, 1,830 mg, 1,831 mg, 1,832 mg, 1,833 mg, 1,834 mg, 1,835 mg, 1,836 mg, 1,837 mg, 1,838 mg, 1,839 mg, 1,840 mg, 1,841 mg, 1,842 mg, 1,843 mg, 1,844 mg, 1,845 mg, 1,846 mg, 1,847 mg, 1,848 mg, 1,849 mg, 1,850 mg, 1,851 mg, 1,852 mg, 1,853 mg, 1,854 mg, 1,855 mg, 1,856 mg, 1,857 mg, 1,858 mg, 1,859 mg, 1,860 mg, 1,861 mg, 1,862 mg, 1,863 mg, 1,864 mg, 1,865 mg, 1,866 mg, 1,867 mg, 1,868 mg, 1,869 mg, 1,870 mg, 1,871 mg, 1,872 mg, 1,873 mg, 1,874 mg, 1,875 mg, 1,876 mg, 1,877 mg, 1,878 mg, 1,879 mg, 1,880 mg, 1,881 mg, 1,882 mg, 1,883 mg, 1,884 mg, 1,885 mg, 1,886 mg, 1,887 mg, 1,888 mg, 1,889 mg, 1,890 mg, 1,891 mg, 1,892 mg, 1,893 mg, 1,894 mg, 1,895 mg, 1,896 mg, 1,897 mg, 1,898 mg, 1,899 mg, 1,900 mg, 1,901 mg, 1,902 mg, 1,903 mg, 1,904 mg, 1,905 mg, 1,906 mg, 1,907 mg, 1,908 mg, 1,909 mg, 1,910 mg, 1,911 mg, 1,912 mg, 1,913 mg, 1,914 mg, 1,915 mg, 1,916 mg, 1,917 mg, 1,918 mg, 1,919 mg, 1,920 mg, 1,921 mg, 1,922 mg, 1,923 mg, 1,924 mg, 1,925 mg, 1,926 mg, 1,927 mg, 1,928 mg, 1,929 mg, 1,930 mg, 1,931 mg, 1,932 mg, 1,933 mg, 1,934 mg, 1,935 mg, 1,936 mg, 1,937 mg, 1,938 mg, 1,939 mg, 1,940 mg, 1,941 mg, 1,942 mg, 1,943 mg, 1,944 mg, 1,945 mg, 1,946 mg, 1,947 mg, 1,948 mg, 1,949 mg, 1,950 mg, 1,951 mg, 1,952 mg, 1,953 mg, 1,954 mg, 1,955 mg, 1,956 mg, 1,957 mg, 1,958 mg, 1,959 mg, 1,960 mg, 1,961 mg, 1,962 mg, 1,963 mg, 1,964 mg, 1,965 mg, 1,966 mg, 1,967 mg, 1,968 mg, 1,969 mg, 1,970 mg, 1,971 mg, 1,972 mg, 1,973 mg, 1,974 mg, 1,975 mg, 1,976 mg, 1,977 mg, 1,978 mg, 1,979 mg, 1,980 mg, 1,981 mg, 1,982 mg, 1,983 mg, 1,984 mg, 1,985 mg, 1,986 mg, 1,987 mg, 1,988 mg, 1,989 mg, 1,990 mg, 1,991 mg, 1,992 mg, 1,993 mg, 1,994 mg, 1,995 mg, 1,996 mg, 1,997 mg, 1,998 mg, 1,999 mg, or 2,000 mg (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0597] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in one or more doses (e.g., in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more doses) totaling from about 1,700 mg to about 1,900 mg, such as in one or more doses (e.g., in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more doses) totaling about 1,700 mg, 1,701 mg, 1,702 mg, 1,703 mg, 1,704 mg, 1,705 mg, 1,706 mg, 1,707 mg, 1,708 mg, 1,709 mg, 1,710 mg, 1,711 mg, 1,712 mg, 1,713 mg, 1,714 mg, 1,715 mg, 1,716 mg, 1,717 mg, 1,718 mg, 1,719 mg, 1,720 mg, 1,721 mg, 1,722 mg, 1,723 mg, 1,724 mg, 1,725 mg, 1,726 mg, 1,727 mg, 1,728 mg, 1,729 mg, 1,730 mg, 1,731 mg, 1,732 mg, 1,733 mg, 1,734 mg, 1,735 mg, 1,736 mg, 1,737 mg, 1,738 mg, 1,739 mg, 1,740 mg, 1,741 mg, 1,742 mg, 1,743 mg, 1,744 mg, 1,745 mg, 1,746 mg, 1,747 mg, 1,748 mg, 1,749 mg, 1,750 mg, 1,751 mg, 1,752 mg, 1,753 mg, 1,754 mg, 1,755 mg, 1,756 mg, 1,757 mg, 1,758 mg, 1,759 mg, 1,760 mg, 1,761 mg, 1,762 mg, 1,763 mg, 1,764 mg, 1,765 mg, 1,766 mg, 1,767 mg, 1,768 mg, 1,769 mg, 1,770 mg, 1,771 mg, 1,772 mg, 1,773 mg, 1,774 mg, 1,775 mg, 1,776 mg, 1,777 mg, 1,778 mg, 1,779 mg, 1,780 mg, 1,781 mg, 1,782 mg, 1,783 mg, 1,784 mg, 1,785 mg, 1,786 mg, 1,787 mg, 1,788 mg, 1,789 mg, 1,790 mg, 1,791 mg, 1,792 mg, 1,793 mg, 1,794 mg, 1,795 mg, 1,796 mg, 1,797 mg, 1,798 mg, 1,799 mg, 1,800 mg, 1,801 mg, 1,802 mg, 1,803 mg, 1,804 mg, 1,805 mg, 1,806 mg, 1,807 mg, 1,808 mg, 1,809 mg, 1,810 mg, 1,811 mg, 1,812 mg, 1,813 mg, 1,814 mg, 1,815 mg, 1,816 mg, 1,817 mg, 1,818 mg, 1,819 mg, 1,820 mg, 1,821 mg, 1,822 mg, 1,823 mg, 1,824 mg, 1,825 mg, 1,826 mg, 1,827 mg, 1,828 mg, 1,829 mg, 1,830 mg, 1,831 mg, 1,832 mg, 1,833 mg, 1,834 mg, 1,835 mg, 1,836 mg, 1,837 mg, 1,838 mg, 1,839 mg, 1,840 mg, 1,841 mg, 1,842 mg, 1,843 mg, 1,844 mg, 1,845 mg, 1,846 mg, 1,847 mg, 1,848 mg, 1,849 mg, 1,850 mg, 1,851 mg, 1,852 mg, 1,853 mg, 1,854 mg, 1,855 mg, 1,856 mg, 1,857 mg, 1,858 mg, 1,859 mg, 1,860 mg, 1,861 mg, 1,862 mg, 1,863 mg, 1,864 mg, 1,865 mg, 1,866 mg, 1,867 mg, 1,868 mg, 1,869 mg, 1,870 mg, 1,871 mg, 1,872 mg, 1,873 mg, 1,874 mg, 1,875 mg, 1,876 mg, 1,877 mg, 1,878 mg, 1,879 mg, 1,880 mg, 1,881 mg, 1,882 mg, 1,883 mg, 1,884 mg, 1,885 mg, 1,886 mg, 1,887 mg, 1,888 mg, 1,889 mg, 1,890 mg, 1,891 mg, 1,892 mg, 1,893 mg, 1,894 mg, 1,895 mg, 1,896 mg, 1,897 mg, 1,898 mg, 1,899 mg, or 1,900 mg (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0598] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in one or more doses (e.g., in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more doses) totaling from about 1,750 mg to about 1,850 mg, such as an amount of about 1,750 mg, 1,751 mg, 1,752 mg, 1,753 mg, 1,754 mg, 1,755 mg, 1,756 mg, 1,757 mg, 1,758 mg, 1,759 mg, 1,760 mg, 1,761 mg, 1,762 mg, 1,763 mg, 1,764 mg, 1,765 mg, 1,766 mg, 1,767 mg, 1,768 mg, 1,769 mg, 1,770 mg, 1,771 mg, 1,772 mg, 1,773 mg, 1,774 mg, 1,775 mg, 1,776 mg, 1,777 mg, 1,778 mg, 1,779 mg, 1,780 mg, 1,781 mg, 1,782 mg, 1,783 mg, 1,784 mg, 1,785 mg, 1,786 mg, 1,787 mg, 1,788 mg, 1,789 mg, 1,790 mg, 1,791 mg, 1,792 mg, 1,793 mg, 1,794 mg, 1,795 mg, 1,796 mg, 1,797 mg, 1,798 mg, 1,799 mg, 1,800 mg, 1,801 mg, 1,802 mg, 1,803 mg, 1,804 mg, 1,805 mg, 1,806 mg, 1,807 mg, 1,808 mg, 1,809 mg, 1,810 mg, 1,811 mg, 1,812 mg, 1,813 mg, 1,814 mg, 1,815 mg, 1,816 mg, 1,817 mg, 1,818 mg, 1,819 mg, 1,820 mg, 1,821 mg, 1,822 mg, 1,823 mg, 1,824 mg, 1,825 mg, 1,826 mg, 1,827 mg, 1,828 mg, 1,829 mg, 1,830 mg, 1,831 mg, 1,832 mg, 1,833 mg, 1,834 mg, 1,835 mg, 1,836 mg, 1,837 mg, 1,838 mg, 1,839 mg, 1,840 mg, 1,841 mg, 1,842 mg, 1,843 mg, 1,844 mg, 1,845 mg, 1,846 mg, 1,847 mg, 1,848 mg, 1,849 mg, or 1,850 mg (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0599] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in one or more doses (e.g., in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more doses) totaling from about 1,760 mg to about 1,840 mg, such as in one or more doses (e.g., in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more doses) totaling about 1,760 mg, 1,761 mg, 1,762 mg, 1,763 mg, 1,764 mg, 1,765 mg, 1,766 mg, 1,767 mg, 1,768 mg, 1,769 mg, 1,770 mg, 1,771 mg, 1,772 mg, 1,773 mg, 1,774 mg, 1,775 mg, 1,776 mg, 1,777 mg, 1,778 mg, 1,779 mg, 1,780 mg, 1,781 mg, 1,782 mg, 1,783 mg, 1,784 mg, 1,785 mg, 1,786 mg, 1,787 mg, 1,788 mg, 1,789 mg, 1,790 mg, 1,791 mg, 1,792 mg, 1,793 mg, 1,794 mg, 1,795 mg, 1,796 mg, 1,797 mg, 1,798 mg, 1,799 mg, 1,800 mg, 1,801 mg, 1,802 mg, 1,803 mg, 1,804 mg, 1,805 mg, 1,806 mg, 1,807 mg, 1,808 mg, 1,809 mg, 1,810 mg, 1,811 mg, 1,812 mg, 1,813 mg, 1,814 mg, 1,815 mg, 1,816 mg, 1,817 mg, 1,818 mg, 1,819 mg, 1,820 mg, 1,821 mg, 1,822 mg, 1,823 mg, 1,824 mg, 1,825 mg, 1,826 mg, 1,827 mg, 1,828 mg, 1,829 mg, 1,830 mg, 1,831 mg, 1,832 mg, 1,833 mg, 1,834 mg, 1,835 mg, 1,836 mg, 1,837 mg, 1,838 mg, 1,839 mg, or 1,840 mg (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0600] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in one or more doses (e.g., in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more doses) totaling from about 1,770 mg to about 1,830 mg, such as an amount of about 1,770 mg, 1,771 mg, 1,772 mg, 1,773 mg, 1,774 mg, 1,775 mg, 1,776 mg, 1,777 mg, 1,778 mg, 1,779 mg, 1,780 mg, 1,781 mg, 1,782 mg, 1,783 mg, 1,784 mg, 1,785 mg, 1,786 mg, 1,787 mg, 1,788 mg, 1,789 mg, 1,790 mg, 1,791 mg, 1,792 mg, 1,793 mg, 1,794 mg, 1,795 mg, 1,796 mg, 1,797 mg, 1,798 mg, 1,799 mg, 1,800 mg, 1,801 mg, 1,802 mg, 1,803 mg, 1,804 mg, 1,805 mg, 1,806 mg, 1,807 mg, 1,808 mg, 1,809 mg, 1,810 mg, 1,811 mg, 1,812 mg, 1,813 mg, 1,814 mg, 1,815 mg, 1,816 mg, 1,817 mg, 1,818 mg, 1,819 mg, 1,820 mg, 1,821 mg, 1,822 mg, 1,823 mg, 1,824 mg, 1,825 mg, 1,826 mg, 1,827 mg, 1,828 mg, 1,829 mg, or 1,830 mg (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0601] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in one or more doses (e.g., in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more doses) totaling from about 1,780 mg to about 1,820 mg, such as an amount of about 1,780 mg, 1,781 mg, 1,782 mg, 1,783 mg, 1,784 mg, 1,785 mg, 1,786 mg, 1,787 mg, 1,788 mg, 1,789 mg, 1,790 mg, 1,791 mg, 1,792 mg, 1,793 mg, 1,794 mg, 1,795 mg, 1,796 mg, 1,797 mg, 1,798 mg, 1,799 mg, 1,800 mg, 1,801 mg, 1,802 mg, 1,803 mg, 1,804 mg, 1,805 mg, 1,806 mg, 1,807 mg, 1,808 mg, 1,809 mg, 1,810 mg, 1,811 mg, 1,812 mg, 1,813 mg, 1,814 mg, 1,815 mg, 1,816 mg, 1,817 mg, 1,818 mg, 1,819 mg, or 1,820 mg (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0602] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in one or more doses (e.g., in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more doses) totaling from about 1,790 mg to about 1,810 mg, such as an amount of about 1,790 mg, 1,791 mg, 1,792 mg, 1,793 mg, 1,794 mg, 1,795 mg, 1,796 mg, 1,797 mg, 1,798 mg, 1,799 mg, 1,800 mg, 1,801 mg, 1,802 mg, 1,803 mg, 1,804 mg, 1,805 mg, 1,806 mg, 1,807 mg, 1,808 mg, 1,809 mg, or 1,810 mg (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0603] In some embodiments, the oxytocin receptor antagonist is administered to the subject in one or more doses (e.g., in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more doses) totaling about 1,800 mg (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0604] In some embodiments, the oxytocin receptor antagonist is administered to the subject in a single dose (e.g., on the day of the embryo transfer therapy) of from 1,500 to 2,100 mg, such as in a single dose (e.g., on the day of the embryo transfer therapy) of from 1,510 mg to 2,090 mg, from 1,520 mg to 2,080 mg, from 1,530 mg to 2,070 mg, from 1,540 mg to 2,060 mg, from 1,550 mg to 2,050 mg, from 1,560 mg to 2,040 mg, from 1,570 mg to 2,030 mg, from 1,580 mg to 2,020 mg, from 1,590 mg to 2,010 mg, from 1,600 mg to 2,000 mg, from 1,610 mg to 1,990 mg, from 1,620 mg to 1,980 mg, from 1,630 mg to 1,970 mg, from 1,640 mg to 1,960 mg, from 1,650 mg to 1,950 mg, from 1,660 mg to 1,940 mg, from 1,670 mg to 1,930 mg, from 1,680 mg to 1,920 mg, from 1,690 mg to 1,910 mg, from 1,700 mg to 1,900 mg, from 1,710 mg to 1,890 mg, from 1,720 mg to 1,880 mg, from 1,730 mg to 1,870 mg, from 1,740 mg to 1,860 mg, from 1,750 mg to 1,850 mg, from 1,760 mg to 1,840 mg, from 1,770 mg to 1,830 mg, from 1,780 mg to 1,820 mg, or from 1,790 mg to 1,810 mg (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0605] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in a single dose (e.g., on the day of the embryo transfer therapy) of from about 1,501 mg to about 2,099 mg, such as in a single dose (e.g., on the day of the embryo transfer therapy) of about 1,501 mg, 1,502 mg, 1,503 mg, 1,504 mg, 1,505 mg, 1,506 mg, 1,507 mg, 1,508 mg, 1,509 mg, 1,510 mg, 1,511 mg, 1,512 mg, 1,513 mg, 1,514 mg, 1,515 mg, 1,516 mg, 1,517 mg, 1,518 mg, 1,519 mg, 1,520 mg, 1,521 mg, 1,522 mg, 1,523 mg, 1,524 mg, 1,525 mg, 1,526 mg, 1,527 mg, 1,528 mg, 1,529 mg, 1,530 mg, 1,531 mg, 1,532 mg, 1,533 mg, 1,534 mg, 1,535 mg, 1,536 mg, 1,537 mg, 1,538 mg, 1,539 mg, 1,540 mg, 1,541 mg, 1,542 mg, 1,543 mg, 1,544 mg, 1,545 mg, 1,546 mg, 1,547 mg, 1,548 mg, 1,549 mg, 1,550 mg, 1,551 mg, 1,552 mg, 1,553 mg, 1,554 mg, 1,555 mg, 1,556 mg, 1,557 mg, 1,558 mg, 1,559 mg, 1,560 mg, 1,561 mg, 1,562 mg, 1,563 mg, 1,564 mg, 1,565 mg, 1,566 mg, 1,567 mg, 1,568 mg, 1,569 mg, 1,570 mg, 1,571 mg, 1,572 mg, 1,573 mg, 1,574 mg, 1,575 mg, 1,576 mg, 1,577 mg, 1,578 mg, 1,579 mg, 1,580 mg, 1,581 mg, 1,582 mg, 1,583 mg, 1,584 mg, 1,585 mg, 1,586 mg, 1,587 mg, 1,588 mg, 1,589 mg, 1,590 mg, 1,591 mg, 1,592 mg, 1,593 mg, 1,594 mg, 1,595 mg, 1,596 mg, 1,597 mg, 1,598 mg, 1,599 mg, 1,600 mg, 1,601 mg, 1,602 mg, 1,603 mg, 1,604 mg, 1,605 mg, 1,606 mg, 1,607 mg, 1,608 mg, 1,609 mg, 1,610 mg, 1,611 mg, 1,612 mg, 1,613 mg, 1,614 mg, 1,615 mg, 1,616 mg, 1,617 mg, 1,618 mg, 1,619 mg, 1,620 mg, 1,621 mg, 1,622 mg, 1,623 mg, 1,624 mg, 1,625 mg, 1,626 mg, 1,627 mg, 1,628 mg, 1,629 mg, 1,630 mg, 1,631 mg, 1,632 mg, 1,633 mg, 1,634 mg, 1,635 mg, 1,636 mg, 1,637 mg, 1,638 mg, 1,639 mg, 1,640 mg, 1,641 mg, 1,642 mg, 1,643 mg, 1,644 mg, 1,645 mg, 1,646 mg, 1,647 mg, 1,648 mg, 1,649 mg, 1,650 mg, 1,651 mg, 1,652 mg, 1,653 mg, 1,654 mg, 1,655 mg, 1,656 mg, 1,657 mg, 1,658 mg, 1,659 mg, 1,660 mg, 1,661 mg, 1,662 mg, 1,663 mg, 1,664 mg, 1,665 mg, 1,666 mg, 1,667 mg, 1,668 mg, 1,669 mg, 1,670 mg, 1,671 mg, 1,672 mg, 1,673 mg, 1,674 mg, 1,675 mg, 1,676 mg, 1,677 mg, 1,678 mg, 1,679 mg, 1,680 mg, 1,681 mg, 1,682 mg, 1,683 mg, 1,684 mg, 1,685 mg, 1,686 mg, 1,687 mg, 1,688 mg, 1,689 mg, 1,690 mg, 1,691 mg, 1,692 mg, 1,693 mg, 1,694 mg, 1,695 mg, 1,696 mg, 1,697 mg, 1,698 mg, 1,699 mg, 1,700 mg, 1,701 mg, 1,702 mg, 1,703 mg, 1,704 mg, 1,705 mg, 1,706 mg, 1,707 mg, 1,708 mg, 1,709 mg, 1,710 mg, 1,711 mg, 1,712 mg, 1,713 mg, 1,714 mg, 1,715 mg, 1,716 mg, 1,717 mg, 1,718 mg, 1,719 mg, 1,720 mg, 1,721 mg, 1,722 mg, 1,723 mg, 1,724 mg, 1,725 mg, 1,726 mg, 1,727 mg, 1,728 mg, 1,729 mg, 1,730 mg, 1,731 mg, 1,732 mg, 1,733 mg, 1,734 mg, 1,735 mg, 1,736 mg, 1,737 mg, 1,738 mg, 1,739 mg, 1,740 mg, 1,741 mg, 1,742 mg, 1,743 mg, 1,744 mg, 1,745 mg, 1,746 mg, 1,747 mg, 1,748 mg, 1,749 mg, 1,750 mg, 1,751 mg, 1,752 mg, 1,753 mg, 1,754 mg, 1,755 mg, 1,756 mg, 1,757 mg, 1,758 mg, 1,759 mg, 1,760 mg, 1,761 mg, 1,762 mg, 1,763 mg, 1,764 mg, 1,765 mg, 1,766 mg, 1,767 mg, 1,768 mg, 1,769 mg, 1,770 mg, 1,771 mg, 1,772 mg, 1,773 mg, 1,774 mg, 1,775 mg, 1,776 mg, 1,777 mg, 1,778 mg, 1,779 mg, 1,780 mg, 1,781 mg, 1,782 mg, 1,783 mg, 1,784 mg, 1,785 mg, 1,786 mg, 1,787 mg, 1,788 mg, 1,789 mg, 1,790 mg, 1,791 mg, 1,792 mg, 1,793 mg, 1,794 mg, 1,795 mg, 1,796 mg, 1,797 mg, 1,798 mg, 1,799 mg, 1,800 mg, 1,801 mg, 1,802 mg, 1,803 mg, 1,804 mg, 1,805 mg, 1,806 mg, 1,807 mg, 1,808 mg, 1,809 mg, 1,810 mg, 1,811 mg, 1,812 mg, 1,813 mg, 1,814 mg, 1,815 mg, 1,816 mg, 1,817 mg, 1,818 mg, 1,819 mg, 1,820 mg, 1,821 mg, 1,822 mg, 1,823 mg, 1,824 mg, 1,825 mg, 1,826 mg, 1,827 mg, 1,828 mg, 1,829 mg, 1,830 mg, 1,831 mg, 1,832 mg, 1,833 mg, 1,834 mg, 1,835 mg, 1,836 mg, 1,837 mg, 1,838 mg, 1,839 mg, 1,840 mg, 1,841 mg, 1,842 mg, 1,843 mg, 1,844 mg, 1,845 mg, 1,846 mg, 1,847 mg, 1,848 mg, 1,849 mg, 1,850 mg, 1,851 mg, 1,852 mg, 1,853 mg, 1,854 mg, 1,855 mg, 1,856 mg, 1,857 mg, 1,858 mg, 1,859 mg, 1,860 mg, 1,861 mg, 1,862 mg, 1,863 mg, 1,864 mg, 1,865 mg, 1,866 mg, 1,867 mg, 1,868 mg, 1,869 mg, 1,870 mg, 1,871 mg, 1,872 mg, 1,873 mg, 1,874 mg, 1,875 mg, 1,876 mg, 1,877 mg, 1,878 mg, 1,879 mg, 1,880 mg, 1,881 mg, 1,882 mg, 1,883 mg, 1,884 mg, 1,885 mg, 1,886 mg, 1,887 mg, 1,888 mg, 1,889 mg, 1,890 mg, 1,891 mg, 1,892 mg, 1,893 mg, 1,894 mg, 1,895 mg, 1,896 mg, 1,897 mg, 1,898 mg, 1,899 mg, 1,900 mg, 1,901 mg, 1,902 mg, 1,903 mg, 1,904 mg, 1,905 mg, 1,906 mg, 1,907 mg, 1,908 mg, 1,909 mg, 1,910 mg, 1,911 mg, 1,912 mg, 1,913 mg, 1,914 mg, 1,915 mg, 1,916 mg, 1,917 mg, 1,918 mg, 1,919 mg, 1,920 mg, 1,921 mg, 1,922 mg, 1,923 mg, 1,924 mg, 1,925 mg, 1,926 mg, 1,927 mg, 1,928 mg, 1,929 mg, 1,930 mg, 1,931 mg, 1,932 mg, 1,933 mg, 1,934 mg, 1,935 mg, 1,936 mg, 1,937 mg, 1,938 mg, 1,939 mg, 1,940 mg, 1,941 mg, 1,942 mg, 1,943 mg, 1,944 mg, 1,945 mg, 1,946 mg, 1,947 mg, 1,948 mg, 1,949 mg, 1,950 mg, 1,951 mg, 1,952 mg, 1,953 mg, 1,954 mg, 1,955 mg, 1,956 mg, 1,957 mg, 1,958 mg, 1,959 mg, 1,960 mg, 1,961 mg, 1,962 mg, 1,963 mg, 1,964 mg, 1,965 mg, 1,966 mg, 1,967 mg, 1,968 mg, 1,969 mg, 1,970 mg, 1,971 mg, 1,972 mg, 1,973 mg, 1,974 mg, 1,975 mg, 1,976 mg, 1,977 mg, 1,978 mg, 1,979 mg, 1,980 mg, 1,981 mg, 1,982 mg, 1,983 mg, 1,984 mg, 1,985 mg, 1,986 mg, 1,987 mg, 1,988 mg, 1,989 mg, 1,990 mg, 1,991 mg, 1,992 mg, 1,993 mg, 1,994 mg, 1,995 mg, 1,996 mg, 1,997 mg, 1,998 mg, 1,999 mg, 2,000 mg, 2,001 mg, 2,002 mg, 2,003 mg, 2,004 mg, 2,005 mg, 2,006 mg, 2,007 mg, 2,008 mg, 2,009 mg, 2,010 mg, 2,011 mg, 2,012 mg, 2,013 mg, 2,014 mg, 2,015 mg, 2,016 mg, 2,017 mg, 2,018 mg, 2,019 mg, 2,020 mg, 2,021 mg, 2,022 mg, 2,023 mg, 2,024 mg, 2,025 mg, 2,026 mg, 2,027 mg, 2,028 mg, 2,029 mg, 2,030 mg, 2,031 mg, 2,032 mg, 2,033 mg, 2,034 mg, 2,035 mg, 2,036 mg, 2,037 mg, 2,038 mg, 2,039 mg, 2,040 mg, 2,041 mg, 2,042 mg, 2,043 mg, 2,044 mg, 2,045 mg, 2,046 mg, 2,047 mg, 2,048 mg, 2,049 mg, 2,050 mg, 2,051 mg, 2,052 mg, 2,053 mg, 2,054 mg, 2,055 mg, 2,056 mg, 2,057 mg, 2,058 mg, 2,059 mg, 2,060 mg, 2,061 mg, 2,062 mg, 2,063 mg, 2,064 mg, 2,065 mg, 2,066 mg, 2,067 mg, 2,068 mg, 2,069 mg, 2,070 mg, 2,071 mg, 2,072 mg, 2,073 mg, 2,074 mg, 2,075 mg, 2,076 mg, 2,077 mg, 2,078 mg, 2,079 mg, 2,080 mg, 2,081 mg, 2,082 mg, 2,083 mg, 2,084 mg, 2,085 mg, 2,086 mg, 2,087 mg, 2,088 mg, 2,089 mg, 2,090 mg, 2,091 mg, 2,092 mg, 2,093 mg, 2,094 mg, 2,095 mg, 2,096 mg, 2,097 mg, 2,098 mg, or 2,099 mg (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0606] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in a single dose (e.g., on the day of the embryo transfer therapy) of from about 1,600 mg to about 2,000 mg, such as in a single dose (e.g., on the day of the embryo transfer therapy) of about 1,600 mg, 1,601 mg, 1,602 mg, 1,603 mg, 1,604 mg, 1,605 mg, 1,606 mg, 1,607 mg, 1,608 mg, 1,609 mg, 1,610 mg, 1,611 mg, 1,612 mg, 1,613 mg, 1,614 mg, 1,615 mg, 1,616 mg, 1,617 mg, 1,618 mg, 1,619 mg, 1,620 mg, 1,621 mg, 1,622 mg, 1,623 mg, 1,624 mg, 1,625 mg, 1,626 mg, 1,627 mg, 1,628 mg, 1,629 mg, 1,630 mg, 1,631 mg, 1,632 mg, 1,633 mg, 1,634 mg, 1,635 mg, 1,636 mg, 1,637 mg, 1,638 mg, 1,639 mg, 1,640 mg, 1,641 mg, 1,642 mg, 1,643 mg, 1,644 mg, 1,645 mg, 1,646 mg, 1,647 mg, 1,648 mg, 1,649 mg, 1,650 mg, 1,651 mg, 1,652 mg, 1,653 mg, 1,654 mg, 1,655 mg, 1,656 mg, 1,657 mg, 1,658 mg, 1,659 mg, 1,660 mg, 1,661 mg, 1,662 mg, 1,663 mg, 1,664 mg, 1,665 mg, 1,666 mg, 1,667 mg, 1,668 mg, 1,669 mg, 1,670 mg, 1,671 mg, 1,672 mg, 1,673 mg, 1,674 mg, 1,675 mg, 1,676 mg, 1,677 mg, 1,678 mg, 1,679 mg, 1,680 mg, 1,681 mg, 1,682 mg, 1,683 mg, 1,684 mg, 1,685 mg, 1,686 mg, 1,687 mg, 1,688 mg, 1,689 mg, 1,690 mg, 1,691 mg, 1,692 mg, 1,693 mg, 1,694 mg, 1,695 mg, 1,696 mg, 1,697 mg, 1,698 mg, 1,699 mg, 1,700 mg, 1,701 mg, 1,702 mg, 1,703 mg, 1,704 mg, 1,705 mg, 1,706 mg, 1,707 mg, 1,708 mg, 1,709 mg, 1,710 mg, 1,711 mg, 1,712 mg, 1,713 mg, 1,714 mg, 1,715 mg, 1,716 mg, 1,717 mg, 1,718 mg, 1,719 mg, 1,720 mg, 1,721 mg, 1,722 mg, 1,723 mg, 1,724 mg, 1,725 mg, 1,726 mg, 1,727 mg, 1,728 mg, 1,729 mg, 1,730 mg, 1,731 mg, 1,732 mg, 1,733 mg, 1,734 mg, 1,735 mg, 1,736 mg, 1,737 mg, 1,738 mg, 1,739 mg, 1,740 mg, 1,741 mg, 1,742 mg, 1,743 mg, 1,744 mg, 1,745 mg, 1,746 mg, 1,747 mg, 1,748 mg, 1,749 mg, 1,750 mg, 1,751 mg, 1,752 mg, 1,753 mg, 1,754 mg, 1,755 mg, 1,756 mg, 1,757 mg, 1,758 mg, 1,759 mg, 1,760 mg, 1,761 mg, 1,762 mg, 1,763 mg, 1,764 mg, 1,765 mg, 1,766 mg, 1,767 mg, 1,768 mg, 1,769 mg, 1,770 mg, 1,771 mg, 1,772 mg, 1,773 mg, 1,774 mg, 1,775 mg, 1,776 mg, 1,777 mg, 1,778 mg, 1,779 mg, 1,780 mg, 1,781 mg, 1,782 mg, 1,783 mg, 1,784 mg, 1,785 mg, 1,786 mg, 1,787 mg, 1,788 mg, 1,789 mg, 1,790 mg, 1,791 mg, 1,792 mg, 1,793 mg, 1,794 mg, 1,795 mg, 1,796 mg, 1,797 mg, 1,798 mg, 1,799 mg, 1,800 mg, 1,801 mg, 1,802 mg, 1,803 mg, 1,804 mg, 1,805 mg, 1,806 mg, 1,807 mg, 1,808 mg, 1,809 mg, 1,810 mg, 1,811 mg, 1,812 mg, 1,813 mg, 1,814 mg, 1,815 mg, 1,816 mg, 1,817 mg, 1,818 mg, 1,819 mg, 1,820 mg, 1,821 mg, 1,822 mg, 1,823 mg, 1,824 mg, 1,825 mg, 1,826 mg, 1,827 mg, 1,828 mg, 1,829 mg, 1,830 mg, 1,831 mg, 1,832 mg, 1,833 mg, 1,834 mg, 1,835 mg, 1,836 mg, 1,837 mg, 1,838 mg, 1,839 mg, 1,840 mg, 1,841 mg, 1,842 mg, 1,843 mg, 1,844 mg, 1,845 mg, 1,846 mg, 1,847 mg, 1,848 mg, 1,849 mg, 1,850 mg, 1,851 mg, 1,852 mg, 1,853 mg, 1,854 mg, 1,855 mg, 1,856 mg, 1,857 mg, 1,858 mg, 1,859 mg, 1,860 mg, 1,861 mg, 1,862 mg, 1,863 mg, 1,864 mg, 1,865 mg, 1,866 mg, 1,867 mg, 1,868 mg, 1,869 mg, 1,870 mg, 1,871 mg, 1,872 mg, 1,873 mg, 1,874 mg, 1,875 mg, 1,876 mg, 1,877 mg, 1,878 mg, 1,879 mg, 1,880 mg, 1,881 mg, 1,882 mg, 1,883 mg, 1,884 mg, 1,885 mg, 1,886 mg, 1,887 mg, 1,888 mg, 1,889 mg, 1,890 mg, 1,891 mg, 1,892 mg, 1,893 mg, 1,894 mg, 1,895 mg, 1,896 mg, 1,897 mg, 1,898 mg, 1,899 mg, 1,900 mg, 1,901 mg, 1,902 mg, 1,903 mg, 1,904 mg, 1,905 mg, 1,906 mg, 1,907 mg, 1,908 mg, 1,909 mg, 1,910 mg, 1,911 mg, 1,912 mg, 1,913 mg, 1,914 mg, 1,915 mg, 1,916 mg, 1,917 mg, 1,918 mg, 1,919 mg, 1,920 mg, 1,921 mg, 1,922 mg, 1,923 mg, 1,924 mg, 1,925 mg, 1,926 mg, 1,927 mg, 1,928 mg, 1,929 mg, 1,930 mg, 1,931 mg, 1,932 mg, 1,933 mg, 1,934 mg, 1,935 mg, 1,936 mg, 1,937 mg, 1,938 mg, 1,939 mg, 1,940 mg, 1,941 mg, 1,942 mg, 1,943 mg, 1,944 mg, 1,945 mg, 1,946 mg, 1,947 mg, 1,948 mg, 1,949 mg, 1,950 mg, 1,951 mg, 1,952 mg, 1,953 mg, 1,954 mg, 1,955 mg, 1,956 mg, 1,957 mg, 1,958 mg, 1,959 mg, 1,960 mg, 1,961 mg, 1,962 mg, 1,963 mg, 1,964 mg, 1,965 mg, 1,966 mg, 1,967 mg, 1,968 mg, 1,969 mg, 1,970 mg, 1,971 mg, 1,972 mg, 1,973 mg, 1,974 mg, 1,975 mg, 1,976 mg, 1,977 mg, 1,978 mg, 1,979 mg, 1,980 mg, 1,981 mg, 1,982 mg, 1,983 mg, 1,984 mg, 1,985 mg, 1,986 mg, 1,987 mg, 1,988 mg, 1,989 mg, 1,990 mg, 1,991 mg, 1,992 mg, 1,993 mg, 1,994 mg, 1,995 mg, 1,996 mg, 1,997 mg, 1,998 mg, 1,999 mg, or 2,000 mg (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0607] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in a single dose (e.g., on the day of the embryo transfer therapy) of from about 1,700 mg to about 1,900 mg, such as in a single dose (e.g., on the day of the embryo transfer therapy) of about 1,700 mg, 1,701 mg, 1,702 mg, 1,703 mg, 1,704 mg, 1,705 mg, 1,706 mg, 1,707 mg, 1,708 mg, 1,709 mg, 1,710 mg, 1,711 mg, 1,712 mg, 1,713 mg, 1,714 mg, 1,715 mg, 1,716 mg, 1,717 mg, 1,718 mg, 1,719 mg, 1,720 mg, 1,721 mg, 1,722 mg, 1,723 mg, 1,724 mg, 1,725 mg, 1,726 mg, 1,727 mg, 1,728 mg, 1,729 mg, 1,730 mg, 1,731 mg, 1,732 mg, 1,733 mg, 1,734 mg, 1,735 mg, 1,736 mg, 1,737 mg, 1,738 mg, 1,739 mg, 1,740 mg, 1,741 mg, 1,742 mg, 1,743 mg, 1,744 mg, 1,745 mg, 1,746 mg, 1,747 mg, 1,748 mg, 1,749 mg, 1,750 mg, 1,751 mg, 1,752 mg, 1,753 mg, 1,754 mg, 1,755 mg, 1,756 mg, 1,757 mg, 1,758 mg, 1,759 mg, 1,760 mg, 1,761 mg, 1,762 mg, 1,763 mg, 1,764 mg, 1,765 mg, 1,766 mg, 1,767 mg, 1,768 mg, 1,769 mg, 1,770 mg, 1,771 mg, 1,772 mg, 1,773 mg, 1,774 mg, 1,775 mg, 1,776 mg, 1,777 mg, 1,778 mg, 1,779 mg, 1,780 mg, 1,781 mg, 1,782 mg, 1,783 mg, 1,784 mg, 1,785 mg, 1,786 mg, 1,787 mg, 1,788 mg, 1,789 mg, 1,790 mg, 1,791 mg, 1,792 mg, 1,793 mg, 1,794 mg, 1,795 mg, 1,796 mg, 1,797 mg, 1,798 mg, 1,799 mg, 1,800 mg, 1,801 mg, 1,802 mg, 1,803 mg, 1,804 mg, 1,805 mg, 1,806 mg, 1,807 mg, 1,808 mg, 1,809 mg, 1,810 mg, 1,811 mg, 1,812 mg, 1,813 mg, 1,814 mg, 1,815 mg, 1,816 mg, 1,817 mg, 1,818 mg, 1,819 mg, 1,820 mg, 1,821 mg, 1,822 mg, 1,823 mg, 1,824 mg, 1,825 mg, 1,826 mg, 1,827 mg, 1,828 mg, 1,829 mg, 1,830 mg, 1,831 mg, 1,832 mg, 1,833 mg, 1,834 mg, 1,835 mg, 1,836 mg, 1,837 mg, 1,838 mg, 1,839 mg, 1,840 mg, 1,841 mg, 1,842 mg, 1,843 mg, 1,844 mg, 1,845 mg, 1,846 mg, 1,847 mg, 1,848 mg, 1,849 mg, 1,850 mg, 1,851 mg, 1,852 mg, 1,853 mg, 1,854 mg, 1,855 mg, 1,856 mg, 1,857 mg, 1,858 mg, 1,859 mg, 1,860 mg, 1,861 mg, 1,862 mg, 1,863 mg, 1,864 mg, 1,865 mg, 1,866 mg, 1,867 mg, 1,868 mg, 1,869 mg, 1,870 mg, 1,871 mg, 1,872 mg, 1,873 mg, 1,874 mg, 1,875 mg, 1,876 mg, 1,877 mg, 1,878 mg, 1,879 mg, 1,880 mg, 1,881 mg, 1,882 mg, 1,883 mg, 1,884 mg, 1,885 mg, 1,886 mg, 1,887 mg, 1,888 mg, 1,889 mg, 1,890 mg, 1,891 mg, 1,892 mg, 1,893 mg, 1,894 mg, 1,895 mg, 1,896 mg, 1,897 mg, 1,898 mg, 1,899 mg, or 1,900 mg (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0608] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in a single dose (e.g., on the day of the embryo transfer therapy) of from about 1,750 mg to about 1,850 mg, such as in a single dose (e.g., on the day of the embryo transfer therapy) of about 1,750 mg, 1,751 mg, 1,752 mg, 1,753 mg, 1,754 mg, 1,755 mg, 1,756 mg, 1,757 mg, 1,758 mg, 1,759 mg, 1,760 mg, 1,761 mg, 1,762 mg, 1,763 mg, 1,764 mg, 1,765 mg, 1,766 mg, 1,767 mg, 1,768 mg, 1,769 mg, 1,770 mg, 1,771 mg, 1,772 mg, 1,773 mg, 1,774 mg, 1,775 mg, 1,776 mg, 1,777 mg, 1,778 mg, 1,779 mg, 1,780 mg, 1,781 mg, 1,782 mg, 1,783 mg, 1,784 mg, 1,785 mg, 1,786 mg, 1,787 mg, 1,788 mg, 1,789 mg, 1,790 mg, 1,791 mg, 1,792 mg, 1,793 mg, 1,794 mg, 1,795 mg, 1,796 mg, 1,797 mg, 1,798 mg, 1,799 mg, 1,800 mg, 1,801 mg, 1,802 mg, 1,803 mg, 1,804 mg, 1,805 mg, 1,806 mg, 1,807 mg, 1,808 mg, 1,809 mg, 1,810 mg, 1,811 mg, 1,812 mg, 1,813 mg, 1,814 mg, 1,815 mg, 1,816 mg, 1,817 mg, 1,818 mg, 1,819 mg, 1,820 mg, 1,821 mg, 1,822 mg, 1,823 mg, 1,824 mg, 1,825 mg, 1,826 mg, 1,827 mg, 1,828 mg, 1,829 mg, 1,830 mg, 1,831 mg, 1,832 mg, 1,833 mg, 1,834 mg, 1,835 mg, 1,836 mg, 1,837 mg, 1,838 mg, 1,839 mg, 1,840 mg, 1,841 mg, 1,842 mg, 1,843 mg, 1,844 mg, 1,845 mg, 1,846 mg, 1,847 mg, 1,848 mg, 1,849 mg, or 1,850 mg (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0609] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in a single dose (e.g., on the day of the embryo transfer therapy) of from about 1,760 mg to about 1,840 mg, such as in a single dose (e.g., on the day of the embryo transfer therapy) of about 1,760 mg, 1,761 mg, 1,762 mg, 1,763 mg, 1,764 mg, 1,765 mg, 1,766 mg, 1,767 mg, 1,768 mg, 1,769 mg, 1,770 mg, 1,771 mg, 1,772 mg, 1,773 mg, 1,774 mg, 1,775 mg, 1,776 mg, 1,777 mg, 1,778 mg, 1,779 mg, 1,780 mg, 1,781 mg, 1,782 mg, 1,783 mg, 1,784 mg, 1,785 mg, 1,786 mg, 1,787 mg, 1,788 mg, 1,789 mg, 1,790 mg, 1,791 mg, 1,792 mg, 1,793 mg, 1,794 mg, 1,795 mg, 1,796 mg, 1,797 mg, 1,798 mg, 1,799 mg, 1,800 mg, 1,801 mg, 1,802 mg, 1,803 mg, 1,804 mg, 1,805 mg, 1,806 mg, 1,807 mg, 1,808 mg, 1,809 mg, 1,810 mg, 1,811 mg, 1,812 mg, 1,813 mg, 1,814 mg, 1,815 mg, 1,816 mg, 1,817 mg, 1,818 mg, 1,819 mg, 1,820 mg, 1,821 mg, 1,822 mg, 1,823 mg, 1,824 mg, 1,825 mg, 1,826 mg, 1,827 mg, 1,828 mg, 1,829 mg, 1,830 mg, 1,831 mg, 1,832 mg, 1,833 mg, 1,834 mg, 1,835 mg, 1,836 mg, 1,837 mg, 1,838 mg, 1,839 mg, or 1,840 mg (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0610] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in a single dose (e.g., on the day of the embryo transfer therapy) of from about 1,770 mg to about 1,830 mg, such as in a single dose (e.g., on the day of the embryo transfer therapy) of about 1,770 mg, 1,771 mg, 1,772 mg, 1,773 mg, 1,774 mg, 1,775 mg, 1,776 mg, 1,777 mg, 1,778 mg, 1,779 mg, 1,780 mg, 1,781 mg, 1,782 mg, 1,783 mg, 1,784 mg, 1,785 mg, 1,786 mg, 1,787 mg, 1,788 mg, 1,789 mg, 1,790 mg, 1,791 mg, 1,792 mg, 1,793 mg, 1,794 mg, 1,795 mg, 1,796 mg, 1,797 mg, 1,798 mg, 1,799 mg, 1,800 mg, 1,801 mg, 1,802 mg, 1,803 mg, 1,804 mg, 1,805 mg, 1,806 mg, 1,807 mg, 1,808 mg, 1,809 mg, 1,810 mg, 1,811 mg, 1,812 mg, 1,813 mg, 1,814 mg, 1,815 mg, 1,816 mg, 1,817 mg, 1,818 mg, 1,819 mg, 1,820 mg, 1,821 mg, 1,822 mg, 1,823 mg, 1,824 mg, 1,825 mg, 1,826 mg, 1,827 mg, 1,828 mg, 1,829 mg, or 1,830 mg (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0611] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in a single dose (e.g., on the day of the embryo transfer therapy) of about 1,780 mg to about 1,820 mg, such as in a single dose (e.g., on the day of the embryo transfer therapy) of about 1,780 mg, 1,781 mg, 1,782 mg, 1,783 mg, 1,784 mg, 1,785 mg, 1,786 mg, 1,787 mg, 1,788 mg, 1,789 mg, 1,790 mg, 1,791 mg, 1,792 mg, 1,793 mg, 1,794 mg, 1,795 mg, 1,796 mg, 1,797 mg, 1,798 mg, 1,799 mg, 1,800 mg, 1,801 mg, 1,802 mg, 1,803 mg, 1,804 mg, 1,805 mg, 1,806 mg, 1,807 mg, 1,808 mg, 1,809 mg, 1,810 mg, 1,811 mg, 1,812 mg, 1,813 mg, 1,814 mg, 1,815 mg, 1,816 mg, 1,817 mg, 1,818 mg, 1,819 mg, or 1,820 mg (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0612] For example, in some embodiments, the oxytocin receptor antagonist is administered to the subject in a single dose (e.g., on the day of the embryo transfer therapy) of from about 1,790 mg to about 1,810 mg, such as in a single dose (e.g., on the day of the embryo transfer therapy) of about 1,790 mg, 1,791 mg, 1,792 mg, 1,793 mg, 1,794 mg, 1,795 mg, 1,796 mg, 1,797 mg, 1,798 mg, 1,799 mg, 1,800 mg, 1,801 mg, 1,802 mg, 1,803 mg, 1,804 mg, 1,805 mg, 1,806 mg, 1,807 mg, 1,808 mg, 1,809 mg, or 1,810 mg (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
[0613] In some embodiments, the oxytocin receptor antagonist is administered to the subject in a single dose (e.g., on the day of the embryo transfer therapy) of about 1,800 mg (e.g., wherein the oxytocin receptor antagonist is (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, represented by formula (II)).
Administration Beginning During Embryo Transfer Therapy
[0614] Compounds of formula (I) or (II) or another oxytocin receptor antagonist described herein, such as epelsiban, retosiban, barusiban, and atosiban, or a salt, derivative, variant, crystal form, or formulation thereof, may be administered to a subject during embryo transfer, such as within about 60 minutes or less of transfer of the embryo to the uterus of the subject. In such instances, the compound may be administered to the subject in a single dose, such as in a single dose of from about 1,500 mg to about 2,100 mg as described herein (e.g., a single dose of about 1,800 mg of the compound of formula (I) or (II)) or in multiple doses of lower strength totaling from about 1,500 mg to about 2,100 mg, such as about 1,800 mg. A single dose of the compound can be administered, for instance, at the initiation of the embryo transfer procedure. For example, a compound of formula (I) or (II) may be administered to the subject upon entrance of an embryo delivery device, such as a catheter containing the one or more embryos to be transferred to the subject, into the vaginal canal of the subject. Additionally or alternatively, the compound may be administered to the subject upon entrance of the embryo delivery device beyond the cervix and into the uterus of the subject. The compound may be administered to the subject upon expulsion of the one or more embryos to be transferred from the embryo delivery device, and/or upon removal of the embryo delivery device from the uterus or vaginal canal of the subject. In some embodiments, multiple doses of the compound are administered throughout the duration of the embryo transfer process. Compounds of formula (I) or (II) may be administered continuously throughout the embryo transfer process, for instance, by continuous intravenous administration.
[0615] Dosing of the oxytocin receptor antagonist that has begun during embryo transfer (e.g., within 60 minutes or less of the embryo transfer) may continue following embryo transfer. For instance, the compound may be administered to the subject in one or more additional doses following embryo transfer, for instance, in multiple repeat doses or doses of varying strength. The compound may be administered to the subject in one or more additional doses administered within, for instance, from about 1 hour to about 1 week, or longer (e.g., within about 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 24 hours, 36 hours, 48 hours, 60 hours, 72 hours, 84 hours, 96 hours, 108 hours, 120 hours, 132 hours, 144 hours, 156 hours, 168 hours, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, or more) following the transfer of the one or more embryos to the subject. When multiple doses of compound (I) or compound (II) are administered to a subject following embryo transfer, the subject may be administered the additional doses, for instance, in regular intervals. Compounds of formula (I) or formula (II) may be administered to the subject following embryo transfer therapy, for example, in from 1 to 20 additional doses per day, per week, per month, or longer. For instance, the compound may be administered to the subject following embryo transfer in up to 7 doses (e.g., 1, 2, 3, 4, 5, 6, or 7 doses) per 24 hours.
Administration Beginning Following Embryo Transfer Therapy
[0616] Dosing of the oxytocin receptor antagonist (e.g., a compound of formula (I) or (II) or another oxytocin receptor antagonist described herein, such as epelsiban, retosiban, barusiban, and atosiban, or a salt, derivative, variant, crystal form, or formulation thereof) may begin following the completion of the embryo transfer process. For instance, the compound of formula (I) or (II) may be administered to the subject following embryo transfer in a single dose (e.g., a single dose of about 1,800 mg of the compound of formula (I) or (II)) or in multiple doses of lower strength totaling from about 1,500 mg to about 2,100 mg, such as about 1,800 mg.
[0617] The compound may be administered to the subject in one or more doses administered within, for instance, from about 1 hour to about 1 week, or longer (e.g., within about 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 24 hours, 36 hours, 48 hours, 60 hours, 72 hours, 84 hours, 96 hours, 108 hours, 120 hours, 132 hours, 144 hours, 156 hours, 168 hours, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, or more) following the transfer of the one or more embryos to the subject. When multiple doses of compound (I) or compound (II) are administered to a subject following embryo transfer, the subject may be administered the doses, for instance, in regular intervals. Compounds of formula (I) or formula (II) may be administered to the subject following embryo transfer therapy, for example, in from 1 to 20 doses per day, per week, per month, or longer. For instance, the compound may be administered to the subject following embryo transfer in up to 7 doses (e.g., 1, 2, 3, 4, 5, 6, or 7 doses) per 24 hours.
Methods of Assessing Serum Progesterone Levels
[0618] Using the compositions and methods described herein, one of skill in the art can assess the likelihood that a subject (e.g., a human subject) undergoing embryo transfer therapy will benefit from oxytocin receptor antagonist treatment by comparing the serum progesterone concentration of a subject to a progesterone reference level. For instance, a physician of skill in the art can withdraw a sample from a subject undergoing embryo transfer therapy at one of multiple time points during an assisted reproductive technology process. Upon comparing the subject's serum progesterone concentration to that of an appropriate progesterone reference level, a determination that the subject exhibits a reduced serum progesterone concentration relative to the progesterone reference level indicates that the subject is particularly well suited for, and likely to benefit from (e.g., likely to exhibit enhanced endometrial receptivity in response to) treatment with an oxytocin receptor antagonist, such as a compound of formula (I) or (II), or another oxytocin receptor antagonist described herein or known in the art, such as epelsiban, retosiban, barusiban, and atosiban, prior to, concurrently with, and/or following the transfer of one or more embryos to the uterus of the subject.
[0619] For example, the sample may be withdrawn from the subject on the day of oocyte or ovum retrieval in the case of a subject using an autologous gamete for the ex vivo production of an embryo. In such instances, the progesterone reference level may be from 1.0 ng/ml to 2.0 ng/ml, such as 1.0 ng/ml, 1.1 ng/ml, 1.2 ng/ml, 1.3 ng/ml, 1.4 ng/ml, 1.5 ng/ml, 1.6 ng/ml, 1.7 ng/ml, 1.8 ng/ml, 1.9 ng/ml, or 2.0 ng/ml. The progesterone reference level may be, for instance, 1.5 ng/ml in such instances. The physician may then compare the progesterone level in the sample (e.g., serum sample) isolated from the subject to that of the progesterone reference level. A determination that the subject exhibits a reduced serum progesterone concentration relative to the progesterone reference level indicates that the subject is particularly well suited for, and likely to benefit from (e.g., likely to exhibit enhanced endometrial receptivity in response to), treatment with an oxytocin receptor antagonist.
[0620] Additionally or alternatively, the sample may be withdrawn from the subject on the day of the embryo transfer procedure (e.g., following oocyte or ovum retrieval in the case of a subject using an autologous gamete for the ex vivo production of an embryo). In such instances, the progesterone reference level may be from 200 nM to 300 nM or more, such as 320 nM. The physician may then compare the progesterone level in the sample (e.g., serum sample) isolated from the subject to that of the progesterone reference level. A determination that the subject exhibits a reduced serum progesterone concentration relative to the progesterone reference level indicates that the subject is particularly well suited for, and likely to benefit from (e.g., likely to exhibit enhanced endometrial receptivity in response to), treatment with an oxytocin receptor antagonist.
[0621] Methods of quantitating the concentration of progesterone in a sample (e.g., serum sample) isolated from a subject are known in the art and include, for instance, competitive enzyme-linked immunosorbant assays (ELISA), such as those described in U.S. Pat. No. 9,201,077, the disclosure of which is incorporated herein by reference in its entirety. Antibodies capable of specifically binding to progesterone and that may be used in conjunction with progesterone detection assays include those produced and released by ATCC Accession Number HB 8886 as described in U.S. Pat. No. 4,720,455, the disclosure of which is incorporated herein by reference in its entirety.
Follicular Maturation and Oocyte/Ovum Retrieval
[0622] A variety of methods can be used in order to induce follicular maturation and to perform oocyte (e.g., mature oocyte) retrieval in conjunction with the compositions and methods described herein. In some embodiments, ova or oocytes are isolated from the subject from about 1 day to about 7 days prior to the transfer of the one or more embryos to the subject, such as from about 2 days to about 5 days prior to embryo transfer. The ova or oocytes isolated from the subject may include mature oocytes, such as from 1 to 4 mature oocytes that are ready for fertilization upon contact with one or more sperm cells. The ova or oocytes may be isolated from a subject undergoing embryo transfer therapy or from a donor, such as a familial donor.
[0623] A subject undergoing embryo transfer therapy or a donor may be prepared for ovum or oocyte retrieval by controlled ovarian hyperstimulation, for instance, according to methods described herein or known in the art. For example, a subject or donor may be administered a GnRH antagonist so as to prevent a premature increase in the serum concentration of luteinizing hormone (LH). Additionally or alternatively, final follicular maturation can be achieved by administration of hCG to the subject or donor prior to isolation of the one or more ova or oocytes. For instance, the hCG can be administered to the subject in a single dose or in multiple doses, for instance, by intravenous injection according to procedures known in the art.
[0624] In some embodiments, a luteal support is provided to the subject or donor following ovum or oocyte retrieval. This may be performed, for instance, by administering progesterone to the subject or donor following the retrieval procedure. For example, progesterone may be administered to the subject or donor intravaginally at a dose of from about 300 mg to about 600 mg. The progesterone may be administered to the subject in a single dose or in multiple doses. For instance, progesterone may be administered to the subject in regularly spaced intervals beginning within about 24 hours of isolation of the one or more ova or oocytes, such as within 12 hours of retrieval, and continuing for about 6 or more weeks following the transfer of the one or more embryos to the subject.
Embryo Quality and Condition
[0625] Embryos for use in conjunction with the compositions and methods described herein include those that are at, for example, the morula or the blastula stage of embryonic development. For instance, embryos that may be transferred to a subject as described herein include those that contain from 6 to 8 blastomeres immediately prior to transfer of the one or more embryos to the subject. The blastomeres may be of approximately equal sizes as assessed by visual microscopy prior to the transfer of the one or more embryos to the subject.
[0626] Embryos for use in conjunction with the compositions and methods described herein include those that are formed, for instance, by IVF or ICSI methods known in the art. In some embodiments, the embryos are freshly transferred to the uterus of the subject, for instance, from about 1 day to about 7 days (e.g., from about 2 days to about 5 days) following the isolation of one or more oocytes or ova from the subject for IVF or ICSI. In some embodiments, the one or more embryos are frozen and cryopreserved for long-term storage prior to thaw and transfer to the subject. Methods for the cryopreservation of embryos are known in the art and have been described, for instance, in WO 1991/003935 and WO 2010/011766, the disclosures of each of which are incorporated herein by reference as they pertain to compositions and procedures for cryopreserving embryos for long-term storage.
Methods of Assessing Pregnancy
[0627] Techniques for assessing pregnancy for use in conjunction with the compositions and methods described herein include qualitative and quantitative assessments of a sample isolated from a subject, such as a sample of blood or urine. Methods for assessing pregnancy include detecting the presence and/or quantity of hCG in a sample isolated from a subject. This can be achieved, for instance, using conventional receptor-ligand binding assays known in the art, such as through the use of competitive radioligand binding assays, which are described for the detection of hCG in U.S. Pat. No. 4,094,963, the disclosure of which is incorporated herein by reference as it pertains to methods of detecting hCG in subject samples to assess pregnancy. Additionally or alternatively, test strips may be used to determine hCG concentrations, as described, for instance, in U.S. Pat. No. 7,989,217, the disclosure of which is incorporated herein by reference as it pertains to methods of detecting hCG in subject samples to assess pregnancy. Urine samples isolated from a subject can additionally be analyzed in order to determine pregnancy, as described, for instance, in U.S. Pat. No. 4,315,908, the disclosure of which is incorporated herein by reference as it pertains to methods of detecting hCG in subject samples to assess pregnancy.
[0628] Additionally or alternatively, pregnancy may be assessed by detecting intrauterine heartbeat, such as the heartbeat of the embryo or developing fetus following successful embryo implantation. Compositions and methods for detecting embryonic and fetal heartbeat are known in the art and are described, for instance, in U.S. Pat. Nos. 3,780,725 and 4,437,467, the disclosures of each of which are incorporated herein by reference as they pertain to methods of detecting heartbeat to assess pregnancy in a subject.
[0629] Following embryo transfer, for instance, as described herein, a subject may be subject to one or more pregnancy tests, for example, using one or more of the foregoing procedures. The subject may be tested for pregnancy at one or more points following embryo transfer therapy, such as at about 14 days, about 6 weeks, about 10 weeks, or longer, following embryo transfer and/or oocyte retrieval.
Pharmaceutical Compositions
[0630] Oxytocin receptor antagonists for use with the compositions and methods of the disclosure can be formulated into a pharmaceutical composition for administration to a subject, such as a female human subject, in a biologically compatible form suitable for administration in vivo. A pharmaceutical composition containing an oxytocin receptor antagonist (e.g., a compound of formula (I) or (II), above) may additionally contain a suitable diluent, carrier, or excipient. Oxytocin receptor antagonists can be administered to a subject, for example, orally or by intravenous injection. Under ordinary conditions of storage and use, a pharmaceutical composition may contain a preservative, e.g., to prevent the growth of microorganisms. Conventional procedures and ingredients for the selection and preparation of suitable formulations are described, for example, in Remington: The Science and Practice of Pharmacy (2012, 22.sup.nd ed.) and in The United States Pharmacopeia: The National Formulary (2015, USP 38 NF 33), the disclosures of each of which are incorporated herein by reference as they pertain to pharmaceutically acceptable formulations for therapeutic compositions.
[0631] In some embodiments, compound (II) is administered to a subject according to the methods described herein in crystalline form. For instance, compound (II) may be administered to a subject undergoing embryo transfer therapy in a crystalline form that exhibits characteristic X-ray powder diffraction peaks at about 7.05° 2θ, about 13.13° 2θ, and about 23.34° 2θ. For instance, the compound may exhibit characteristic X-ray powder diffraction peaks at about 7.05° 2θ, about 12.25° 2θ, about 13.13° 2θ, about 16.54° 2θ, about 18.00° 2θ, about 21.84° 2θ, and about 23.34° 2θ. In some embodiments, the compound exhibits characteristic X-ray powder diffraction peaks as set forth in Table 1, below.
TABLE-US-00012 TABLE 1 Characteristic X-ray powder diffraction (XRPD) peaks of crystal form of compound (II) XRPD Peak (°2θ) d space (Å) Intensity (%) 7.05 ± 0.20 12.520 ± 0.354 45 12.25 ± 0.20 7.218 ± 0.117 36 13.13 ± 0.20 6.739 ± 0.102 55 14.16 ± 0.20 6.250 ± 0.088 8 16.54 ± 0.20 5.356 ± 0.064 38 18.00 ± 0.20 4.923 ± 0.054 36 18.77 ± 0.20 4.723 ± 0.050 34 21.32 ± 0.20 4.165 ± 0.039 5 21.84 ± 0.2 4.066 ± 0.037 36 23.34 ± 0.20 3.808 ± 0.032 100 24.08 ± 0.20 3.693 ± 0.030 14 24.67 ± 0.20 3.605 ± 0.029 1 25.45 ± 0.20 3.497 ± 0.027 27 25.69 ± 0.20 3.465 ± 0.027 8 26.45 ± 0.20 3.367 ± 0.025 10 27.09 ± 0.20 3.289 ± 0.024 2 28.05 ± 0.20 3.179 ± 0.022 14 28.56 ± 0.20 3.123 ± 0.021 3 29.26 ± 0.20 3.050 ± 0.020 16 30.72 ± 0.20 2.908 ± 0.018 2 31.00 ± 0.20 2.882 ± 0.018 3 31.19 ± 0.20 2.865 ± 0.018 5 33.19 ± 0.20 2.697 ± 0.016 2 33.60 ± 0.20 2.665 ± 0.015 6 34.36 ± 0.20 2.608 ± 0.015 4 34.75 ± 0.20 2.580 ± 0.014 2 35.91 ± 0.20 2.499 ± 0.013 2 36.52 ± 0.20 2.458 ± 0.013 3 37.38 ± 0.20 2.404 ± 0.012 2 37.70 ± 0.20 2.384 ± 0.012 1 38.73 ± 0.20 2.323 ± 0.012 3 39.11 ± 0.20 2.301 ± 0.011 2 39.80 ± 0.20 2.264 0.011 4
[0632] The foregoing crystal form has been shown to exhibit enhanced stability to aqueous media and physical stress, and is described in detail, for instance, in US 2016/0002160, the disclosure of which is incorporated herein by reference in its entirety.
[0633] Compounds of formula (I) or (II) can be administered by a variety of routes, such as orally or intravenously. When formulated for oral administration, for instance, the compound may be administered in the form of a tablet, capsule, gel cap, powder, liquid solution, or liquid suspension. In some embodiments, the compound is administered to the subject in the form of a tablet, such as a dispersible tablet. The dispersible tablet may have, for example, one or more, or all, of the following components:
[0634] a. about 1-20% by weight of calcium silicate;
[0635] b. about 0.1-20% by weight of PVP3OK;
[0636] c. about 0.01-5% by weight of poloxamer 188;
[0637] d. about 0.5-20% by weight of sodium croscarmellose;
[0638] e. about 1-90% by weight of microcrystalline cellulose 112;
[0639] f. about 1-90% by weight of lactose monohydrate;
[0640] g. about 0.01-0.5% by weight of sodium saccharine; and
[0641] h. about 0.1-10% by weight of glycerol dibehenate.
[0642] For instance, the dispersible tablet may have the following composition:
[0643] a. about 5% by weight of calcium silicate;
[0644] b. about 1% by weight of PVP3OK;
[0645] c. about 2% by weight of poloxamer 188;
[0646] d. about 5% by weight of sodium croscarmellose;
[0647] e. about 1.5% by weight of microcrystalline cellulose 112;
[0648] f. about 47.8% by weight of lactose monohydrate;
[0649] g. about 0.2% by weight of sodium saccharine; and
[0650] h. about 4% by weight of glycerol dibehenate.
[0651] The foregoing formulations of compound (II) have been shown to exhibit rapid absorption kinetics upon administration to a subject, and are described in detail, for instance, in US 2015/0164859, the disclosure of which is incorporated herein by reference in its entirety.
[0652] Pharmaceutical compositions of compound (I) or (II) may include sterile aqueous solutions, dispersions, or powders, e.g., for the extemporaneous preparation of sterile solutions or dispersions. In all cases the form may be sterilized using techniques known in the art and may be fluidized to the extent that may be easily administered to a subject in need of treatment.
Compound for Use
[0653] In another aspect, the disclosure provides an oxytocin receptor antagonist (e.g., an oxytocin receptor antagonist described herein) for use in any of the methods described herein. For example, the disclosure features an oxytocin receptor antagonist, such as an oxytocin receptor antagonist described herein, for use in a method of treating a subject undergoing an embryo transfer procedure, reducing the likelihood of embryo implantation failure in a subject undergoing an embryo transfer procedure, improving endometrial receptivity in a subject undergoing an embryo transfer procedure, and/or reducing uterine contractility in a subject undergoing an embryo transfer procedure. The method may feature, for example, any one or more of the method steps recited herein.
Medicament
[0654] In another aspect, the disclosure provides an oxytocin receptor antagonist (e.g., an oxytocin receptor antagonist described herein) for use in the manufacture of a medicament for performing any of the methods described herein. For example, the disclosure features an oxytocin receptor antagonist, such as an oxytocin receptor antagonist described herein, for use in the manufacture of a medicament for use in a method of treating a subject undergoing an embryo transfer procedure, reducing the likelihood of embryo implantation failure in a subject undergoing an embryo transfer procedure, improving endometrial receptivity in a subject undergoing an embryo transfer procedure, and/or reducing uterine contractility in a subject undergoing an embryo transfer procedure. The method may feature, for example, any one or more of the method steps recited herein.
EXAMPLES
[0655] The following examples are put forth so as to provide those of ordinary skill in the art with a description of how the compositions and methods described herein may be used, made, and evaluated, and are intended to be purely exemplary of the disclosure and are not intended to limit the scope of what the inventors regard as their disclosure.
Example 1
Oral administration of Compound (II) Promotes Successful Embryo Implantation and Prolongs Pregnancy in Subjects Undergoing Embryo Transfer Therapy
Materials and Methods
[0656] In a randomized, double-blind, parallel groups, Phase 2 clinical study of the efficacy of compound (II) in enhancing endometrial receptivity and promoting successful embryo implantation in humans, this compound was orally administered to subjects undergoing embryo transfer therapy in doses of varying strength. A total of 247 female subjects were selected for treatment based on a variety of inclusion criteria. Of these, 244 subjects completed the study. The study was open to healthy female volunteers from 18 to 36 years of age that had previously undergone up to one IVF or ICSI cycle that resulting in a negative pregnancy test as assessed by hCG detection, despite the transfer of at least one embryo of good quality, which was defined as an embryo having from six to eight blastomeres of uniform size and shape on the day of embryo transfer, ooplasm having no granularity, absence of multinucleation, and a maximum fragmentation of 10%. Subjects included in the study had at least one functional ovary and were capable of communicating with the investigator and research staff and complying with the requirements of the study protocol. A demographic summary of the subjects included in the study is shown in Table 2, below. Data are presented in the form of mean (standard deviation).
TABLE-US-00013 TABLE 2 Demographic summary of subjects included in study Compound (II) Placebo 100 mg dose 300 mg dose 900 mg dose Parameter Unit n = 65 n = 62 n = 60 n = 60 Age years 31.5 (3.3) 31.5 (3.1) 31.8 (3.1) 31.1 (3.3) Body mass index kg/m.sup.2 23.37 (4.15) 23.86 (3.72) 23.72 (6.29) 23.65 (3.99) Endometrium mm 7.0 (2.9) 7.0 (2.8) 6.8 (2.4) 6.9 (2.9) thickness Oocytes retrieved n 11.0 (5.2) 10.3 (4.4) 11.7 (5.6) 10.2 (4.2) Embryos generated n 6.6 (3.1) 6.2 (3.7) 7.3 (4.1) 5.9 (3.2) Good quality n 3.7 (2.3) 3.6 (3.5) 4.4 (3.6) 3.5 (2.9) embryos generated Embryos transferred % n = 1 60.0% 62.9% 60.0% 59.3% % n = 2 40.0% 37.1% 40.0% 40.7% Embryo transfer % 1.50% 3.20% 1.70% 0.0% difficult Uterine contraction n/min 2.01 (0.68) 2.05 (0.49) 1.97 (0.56) 2.12 (0.48) rate at time of embryo transfer Serum P4 level at nM 287 (156) 256 (155) 321 (155) 238 (130) time of embryo transfer Serum E2 level at pM 4255 (2790) 3833 (2127) 4988 (2913) 4265 (2781) time of embryo transfer Serum compound ng/mL N/A 484.1 (159.8) 1453.1 (453.8) 4159.0 (II) level at time of (1367.7) embryo transfer
[0657] Subjects included in the study underwent an initial screening period beginning up to 12 weeks prior to the day of oocyte retrieval from the subject. During this 12-week period, subjects underwent physical and gynecological examination in preparation for oocyte retrieval. This analysis included a recordation of the subjects' vital signs, hematology and biochemistry analysis of blood samples withdrawn from the subjects, urinary analysis, and a comprehensive review of the subjects' medical histories.
[0658] At the conclusion of the screening period, subjects underwent controlled ovarian hyperstimulation by administration of a GnRH antagonist so as to prevent a premature rise in serum LH concentration. Concurrent pre-treatment with an oral contraceptive prior to controlled ovarian hyperstimulation was allowed, but not required. Final follicular maturation was performed with a single administration of hCG to the subject. Luteal support was performed by intravaginal administration of micronized natural progesterone at a dose of 600 mg (3×200 mg dosage forms) daily, commencing within 6-24 hours of oocyte retrieval. Progesterone administration continued for at least 6 weeks following embryo transfer for subjects testing positive for pregnancy at 14 days following embryo transfer. Retrieved oocytes contained at least 1-4 mature oocytes (i.e., ova), which were subsequently used for IVF or ICSI for embryo generation.
[0659] The embryo transfer procedure was conducted three days after the oocyte retrieval day (OPU+3 days). Subjects undergoing embryo transfer were monitored prior to initiating the procedure. This analysis included a recordation of vital signs, as well as a transvaginal ultrasound to assess uterine contraction rate and endometrial thickness. Subjects were considered eligible for embryo transfer if the uterine contraction rate was found to be greater than or equal to 1.5 contractions per minute. Eligible subjects subsequently underwent blood sample analysis to determine pre-treatment levels of serum E2 and P4.
[0660] Upon confirming eligibility, subjects were randomized to one of four treatment arms: those receiving a single 100 mg dose of compound (II), a single 300 mg dose of compound (II), a single 900 mg dose of compound (II), or placebo. Subjects receiving a 100 mg dose of compound (II) received 2×50 mg dispersible tablets. Subjects receiving a 300 mg dose of compound (II) received 2×50 mg dispersible tablets and 1×200 mg dispersible tablet. Subjects receiving a 900 mg dose of compound (II) received 2×50 mg dispersible tablets and 4×200 mg dispersible tablets. Subjects not treated with compound (II) were administered a placebo, for instance, in 2×50 mg dispersible tablets and 4×200 mg dispersible tablets. Subjects did not consume food or fluids, with the exception of water, for 2 hours prior to administration and for 1 hour following administration.
[0661] Subjects were administered the indicated dose of compound (II) or placebo approximately 4 hours prior to embryo transfer. About 30 minutes prior to embryo transfer (approximately 3.5 hours following administration of compound (II) or placebo), a transvaginal ultrasound was conducted so as to record uterine contraction rate, and blood sample analysis was performed to obtain a post-treatment measurement of serum concentrations of compound (II), E2, and P4. At 4 hours following treatment with compound (II) or placebo, subjects underwent an ultrasound-guided embryo transfer according to conventional procedures. From one to two embryos of good quality were transferred to each subject. To reduce uterine contractions at the time of embryo transfer, soft or ultra-soft catheters were used and contact with the uterine fundus was avoided. Any difficulties that occurred during the embryo transfer procedure were recorded, including instances in which uterine sounding or cervical dilation were required, instances in which a harder catheter was required, or instances in which blood was found in any part of the catheter.
[0662] Approximately 1 hour following embryo transfer, subjects underwent a final physical examination and were subsequently discharged from the clinical unit until the first follow-up visit, which occurred at about 14 days following oocyte retrieval (OPU+14 days). At this time, subjects underwent a physical examination as well as a blood sample analysis to assess pregnancy by detection of hCG. Subjects testing positive for pregnancy continued the study and were scheduled for follow-up examinations at about 6 weeks following embryo transfer and at about 10 weeks following oocyte retrieval (OPU+10 weeks). Subjects that returned for examination at about 6 weeks following embryo transfer underwent ultrasound analysis. Pregnancy status was monitored by detecting embryo heartbeat. Subjects that exhibited a live birth during the study were scheduled for follow-up consultations to assess the subjects' physical state.
Statistical Analysis
[0663] A two-sided type I error rate of 0.1 (corresponding to a one-sided type I error rate of 0.05) was used for analysis of data collected from this study. Subjects with a negative blood pregnancy test at 14 days following oocyte retrieval were considered as negative for the subsequent efficacy endpoints (e.g., pregnancy tests at 6 weeks following embryo transfer and 10 weeks following oocyte retrieval, as well as live birth rate).
[0664] Analysis of pregnancy rate at 6 weeks following embryo transfer was conducted via the Cochran-Armitage test of a linear trend in proportions, using all of the treatment arms as an ordinal scaled variable. A secondary analysis was conducted by fitting a logistic regression model with dose as a covariate and testing whether the slope was equal to zero. As higher pregnancy rates may occur with increasing number of transferred embryos, any potential effect of the number of embryos transferred on efficacy was explored, for example, by using the embryo transfer rate as a covariate. In addition, a potential dose time embryo transfer rate interaction was explored. Any potential effect of the embryo transfer difficulty on efficacy was also explored. Any possible site to site effect was explored as well.
[0665] Individual dose versus placebo comparisons were tested via Fisher's exact test and as contrasts within the logistic regression models. Corresponding confidence intervals were produced. No multiplicity adjustment was planned for these individual comparisons.
[0666] Positive blood pregnancy test at 14 days following oocyte retrieval and positive embryo heartbeat at 10 weeks following oocyte retrieval were assessed in the same manner as described above. Change from baseline to the time of embryo transfer in uterine contraction rate was analyzed by the Wilcoxon Rank Sum Test by comparing the uterine contraction rate associated with each dose to that observed with placebo-treated subjects.
[0667] For descriptive statistics of plasma concentrations of compound (II), E2, and P4, concentrations below the limit of quantification (LOQ) were assigned a value of zero, and results were provided if at least ⅔ of the plasma values per time point were above the LOQ.
Results
[0668] A summary of the results of the clinical study over the entirety of the subjects that participated in the trial is shown in Table 3, below. The primary parameters of interest included the relative change in uterine contractility, positive pregnancy rates at about 14 days and 6 weeks following embryo transfer, positive pregnancy rates at 10 weeks following oocyte retrieval, as well as the live birth rate at a gestational age of at least 24 weeks.
TABLE-US-00014 TABLE 3 Results of compound (II) treatment among all subjects that participated in clinical trial Compound (II) Placebo 100 mg dose 300 mg dose 900 mg dose All doses Parameter n = 65 n = 62 n = 60 n = 60 n = 182 Relative 0.0% −8.7% −4.0% −13.3% changes in Wilcoxon Rank p = 0.30 p = 0.72% p = 0.05 p = 0.14 uterine Test contractions Positive 50.8% 56.5% 50.0% 53.3% pregnancy test Fisher Exact p = 0.59 p = 1.00 p = 0.86 at 14 days Test post embryo Logistic p = 0.52 p = 0.93 p = 0.77 Trend test transfer Model* p = 0.96 Ongoing 33.8% 46.8% 35.0% 46.7% 42.9% pregnancy rate Fisher Exact p = 0.15 p = 1.00 p = 0.15 p = 0.24 at 6 weeks Test post embryo Logistic Model p = 0.09 p = 0.99 p = 0.12 Trend test transfer II** p = 0.33 Ongoing 29.2% 43.5% 35.0% 45.0% 41.2% pregnancy rate Fisher Exact p = 0.10 p = 0.57 p = 0.09 p = 0.10 at 10 weeks Test post oocyte Logistic Model p = 0.10 p = 0.49 p = 0.07 Trend test retrieval p = 0.15 Live birth rate 29.2% 40.3% 35.0% 43.3% 39.6% at gestational Fisher Exact p = 0.20 p = 0.57 p = 0.14 p = 0.18 age of at least Test 24 weeks Logistic Model p = 0.19 p = 0.49 p = 0.10 Trend test p = 0.20 *Logistic Model: Endpoint as dependent variable and treatment, site, and embryo transfer rate as independent variable **Logistic Model II: Endpoint as dependent variable and treatment as independent variable
[0669] During the course of the analysis, it was noted that subjects in the 300 mg compound (II) treatment arm exhibited elevated pre-treatment serum P4 concentrations relative to the remainder of the subjects studied (Table 2). These heightened P4 levels are indicative of an elevated P4 concentration on the day of oocyte retrieval from the subject, and can reflect a P4 concentration of from 1.0 ng/ml to 2.0 ng/ml, such as a P4 concentration of 1.5 ng/ml on the day of oocyte retrieval. It was discovered that the effect of compound (II) was particularly robust among subjects that did not exhibit an elevated serum P4 concentration at the time of embryo transfer, and thus, likely did not exhibit a P4 concentration at or above a level of 1.5 ng/ml on the day of oocyte retrieval. Table 4, below, provides a summary of the pregnancy rate at 6 weeks following embryo transfer exhibited by subjects from each pre-treatment serum P4 concentration quartile.
TABLE-US-00015 TABLE 4 Pregnancy rate at about 6 weeks following embryo transfer by pre- treatment serum P4 concentration quartile Ongoing pregnancy rate at 6 weeks post embryo transfer Pre-dose Serum [P4] Quartile Frequency 1 2 3 4 Total Negative 32 37 33 45 147 (51.61%) (59.68%) (54.10%) (72.58%) Positive 30 25 28 17 100 (48.39%) (40.32%) (45.90%) (27.42%) Total 62 62 61 62 247
[0670] Table 5, below, provides a summary of the live birth rate at a gestational age of at least 24 weeks (i) exhibited by all subjects and (ii) excluding subjects that exhibited a pre-treatment serum P4 concentration from the upper quartile of this metric.
TABLE-US-00016 TABLE 5 Live birth rate at a gestational age of at least 24 weeks among subjects from all pre-treatment serum P4 quartiles and excluding subjects from the upper quartile of this metric Live birth rate at a gestational age of at least 24 weeks Frequency No. of Subject embryos 100 mg 300 mg 900 mg Population transferred Placebo dose dose dose All doses All P4 1 11/39 13/39 12/36 14/35 39/110 quartiles (28.21%) (33.33%) (33.33%) (40.00%) (35.45%) Fisher p = 0.81 p = 0.80 p = 0.33 p = 0.44 Exact Test Trend test: p = 0.24 2 8/26 12/23 9/24 12/24 33/71 (30.77%) (52.17%) (37.50%) (50.00%) (46.48%) Fisher p = 0.15 p = 0.77 p = 0.25 p = 0.25 Exact Test Trend test: p = 0.31 Excluding 1 9/30 11/34 10/22 13/29 34/85 upper P4 (30.00%) (32.35%) (45.45%) (44.83%) (40.00%) quartile Fisher p = 1.00 p = 0.38 p = 0.29 p = 0.39 Exact Test Trend test: p = 0.16 2 6/19 8/16 7/13 12/20 27/49 (31.58%) (50.00%) (53.85%) (60.00%) (55.10%) Fisher p = 0.32 p = 0.28 p = 0.11 p = 0.11 Exact Test Trend test: p = 0.08
[0671] Collectively, these data demonstrate that lower overall pregnancy rates were observed among subjects with elevated pre-dose serum P4 concentrations. Upon analyzing, post hoc, the collected data with respect to subjects from pre-dose serum P4 concentration quartiles 1-3, an enhanced therapeutic effect of compound (II) was observed (
[0672] Collectively, these data demonstrate that treatment with compound (II) lead to an overall increase in pregnancy and live-birth rates in the treatment arms versus the placebo group with in a significant dose-dependent fashion (p<0.02).
TABLE-US-00017 TABLE 6 Results of compound (II) treatment excluding subjects from pre- treatment serum P4 concentration Q4 Compound (II) 100 mg 300 mg 900 mg Placebo dose dose dose All doses Parameter n = 49 n = 50 n = 35 n = 49 n = 134 Positive 53.1% 54.0% 62.9% 59.2% pregnancy Fisher Exact p = 1.00 p = 0.50 p = 0.68 p = 0.61 test at 14 Test Trend test days post p = 0.42 embryo transfer Ongoing 36.7% 44.0% 48.6% 53.1% 48.5% pregnancy Fisher Exact p = 0.54 p = 0.37 p = 0.15 p = 0.18 rate at 6 Test Trend test weeks post p = 0.095 embryo transfer Ongoing 30.6% 42.0% 48.6% 51.0% 47.0% pregnancy Fisher Exact p = 0.30 p = 0.11 p = 0.064 p = 0.063 rate at 10 Test Trend test weeks post p = 0.035 oocyte retrieval Live birth rate 15/49; 19/50; 17/35; 25/49; 61/134; at gestational 30.6% 38.0% 48.6% 51.0% 45.5% age of at least Fisher Exact p = 0.53 p = 0.11 p = 0.064 p = 0.090 24 weeks Test Trend test p = 0.025 Absolute increase in live birth 7.4% 18.0% 20.4% 14.9% rate vs placebo Relative increase in live birth 24.2% 58.8% 66.7% 48.7% rate vs placebo
[0673] This post hoc analysis revealed that subjects exhibiting an elevated serum P4 concentration on the day of embryo transfer also exhibited an elevated serum P4 concentration on the day of oocyte retrieval, such as a serum P4 concentration above the threshold level of 1.5 ng/ml. Table 7, below, summarizes the quantity of subjects for which data were available that exhibited a serum P4 concentration above 1.5 ng/ml on the day of oocyte retrieval prior to administration of hCG to induce final follicular maturation.
TABLE-US-00018 TABLE 7 Subjects that exhibited a serum P4 concentration above 1.5 ng/ml on the day of oocyte retrieval prior to hCG administration Subject Compound (II) Population Placebo 100 mg dose 300 mg dose 900 mg dose Total Serum P4 1/24 1/23 5/24 2/23 9/94 greater than (4.17%) (4.35%) (20.83%) (8.70%) (9.57%) 1.5 ng/ml on the day of oocyte retrieval
[0674] As shown in Table 7, the 300 mg treatment arm contained the highest proportion of subjects having a serum P4 concentration of greater than 1.5 ng/ml on the day of oocyte retrieval prior to hCG administration. Table 2, above, demonstrates that subjects in the 300 mg treatment arm exhibited an elevated serum P4 concentration on the day of embryo transfer as well (e.g., an average serum P4 concentration of about 320 nM). Taken together, these data demonstrate that subjects exhibiting an elevated serum P4 concentration on the day of embryo transfer, such as 320 nM or greater, also exhibited a heightened serum P4 concentration on the day of oocyte retrieval, such as 1.5 ng/ml or greater.
[0675] As described above, removal of subjects from the upper serum P4 quartile from the analysis revealed a particularly robust therapeutic effect of compound (II). A regression analysis was conducted to quantify the ability of pre-treatment serum progesterone concentration on the day of embryo transfer to serve as a negative predictor of clinical pregnancy. This regression analysis is summarized in Table 8, below.
TABLE-US-00019 TABLE 8 Regression model of utility of pre-treatment serum P4 as a negative predictor of clinical pregnancy Variable Regression Pre-treatment Pre-treatment No. of embryos Parameter serum E2 serum P4 transferred N 245 245 245 Adjusted odds ratio 1.05 0.78 1.72 90% Confidence 0.66-1.44 0.65-0.93 1.10-3.69 interval of adjusted odds ratio p value 0.40 0.020 0.045
[0676] As shown in Table 8, a significant negative relationship was identified between pre-treatment serum progesterone concentration and clinical pregnancy rate.
[0677] It has been presently discovered that compound (II) may promote the transient overexpression of PGF2α and the subsequent downregulation of PGF2α signaling, for instance, by desensitization of the PGF2α receptor. This heightened expression of PGF2α and subsequent attenuation of PGF2α signaling can in turn enhance the receptivity of the endometrium to exogenously administered embryos. Notably, P4 is a negative regulator of PGF2α expression, which may explain why compound (II) has a particularly strong therapeutic effect on subjects that do not exhibit elevated pre-treatment serum P4 concentrations.
[0678] Taken together, the data obtained from this study demonstrate the ability of compound (II) to promote endometrial receptivity, reduce the likelihood of embryo implantation failure in subjects undergoing embryo transfer therapy, and prolong pregnancy in such subjects through various gestational ages, as well as the ability of pre-treatment serum P4 concentration to serve as a predictive indicator of a subject's propensity to benefit from oxytocin receptor antagonist treatment during the course of an assisted reproductive technology procedure.
Example 2
Administration of an Oxytocin Receptor Antagonist to a Subject Undergoing Embryo Transfer Therapy on the Basis of the Subject's Pre-Treatment Serum Progesterone Level
[0679] Using the compositions and methods described herein, a skilled practitioner can assess the likelihood that a human subject undergoing embryo transfer therapy will benefit from oxytocin receptor antagonist treatment by comparing the serum progesterone concentration of a subject to a progesterone reference level. For example, on the basis of a subject's pre-treatment serum progesterone concentration, a practitioner of skill in the art can determine whether the subject is likely to exhibit increased endometrial receptivity in response to oxytocin receptor antagonist treatment. This determination can subsequently inform the practitioner's decision of whether to administer to the subject an oxytocin receptor antagonist, such as a pyrrolidine-3-one oxime compound of formula (I) or (II) or another oxytocin receptor antagonist described herein or known in the art, such as epelsiban, retosiban, barusiban, and atosiban, or a salt, derivative, variant, crystal form, or formulation thereof.
[0680] For instance, a physician of skill in the art can withdraw a sample from a subject undergoing embryo transfer therapy on the day of oocyte or ovum retrieval in the case of a subject using an autologous gamete for the ex vivo production of an embryo. In such instances, the progesterone reference level may be from 1.0 ng/ml to 2.0 ng/ml, such as 1.0 ng/ml, 1.1 ng/ml, 1.2 ng/ml, 1.3 ng/ml, 1.4 ng/ml, 1.5 ng/ml, 1.6 ng/ml, 1.7 ng/ml, 1.8 ng/ml, 1.9 ng/ml, or 2.0 ng/ml. The progesterone reference level may be, for instance, 1.5 ng/ml in such instances. The physician may then compare the progesterone level in the sample (e.g., serum sample) isolated from the subject to that of the progesterone reference level. A determination that the subject exhibits a reduced serum progesterone concentration relative to the progesterone reference level indicates that the subject is particularly well suited for, and likely to benefit from (e.g., likely to exhibit enhanced endometrial receptivity in response to) treatment with an oxytocin receptor antagonist. Upon making such a determination, the physician may subsequently administer an oxytocin receptor antagonist to the subject. The oxytocin receptor antagonist may be administered to the subject prior to, concurrently with, and/or after the transfer of one or more embryos to the subject.
[0681] Additionally or alternatively, the physician may withdraw a sample (e.g., a serum sample) from the subject on the day of the embryo transfer procedure (e.g., following oocyte or ovum retrieval in the case of a subject using an autologous gamete for the ex vivo production of an embryo). In such instances, the progesterone reference level may be from 200 nM to 300 nM or more, such as 320 nM. The physician may then compare the progesterone level in the sample (e.g., serum sample) isolated from the subject to that of the progesterone reference level. A determination that the subject exhibits a reduced serum progesterone concentration relative to the progesterone reference level indicates that the subject is particularly well suited for, and likely to benefit from (e.g., likely to exhibit enhanced endometrial receptivity in response to), treatment with an oxytocin receptor antagonist. Upon making such a determination, the physician may subsequently administer an oxytocin receptor antagonist to the subject. The oxytocin receptor antagonist may be administered to the subject prior to, concurrently with, and/or after the transfer of one or more embryos to the subject.
Example 3
Beneficial Oxytocin Receptor Antagonistic Effects and Metabolic Profile of Compound (II)
[0682] Using the compositions and methods described herein, one of skill in the art can administer an oxytocin receptor antagonist to a subject undergoing an embryo transfer procedure, such as an oxytocin receptor antagonist represented by formula (I), e.g., compound (II), so as to promote enhanced endometrial receptivity, reduce the likelihood of embryo implantation failure, and/or prevent miscarriage in a subject following the transfer of one or more embryos to the uterus of the subject. When compound (II) is administered as the oxytocin receptor antagonist, it can be particularly advantageous to administer compound (II) in a substantially pure form with respect to its (3E) diastereomer, (3E,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime, such as in a form containing less than 15%, less than 10%, less than 5%, less than 1%, or less than 0.1% of the (3E) diastereomer. This advantage derives from the discovery that substantially pure compound (II) exhibits a superior ability to inhibit spontaneous uterine contractions relative to the substantially pure (3E) diastereomer. Uterine contractility is one component of endometrial receptivity, and elevated uterine contractility can lead to the expulsion of an embryo from the uterus and failed embryo implantation. This surprising disparity in uterine contractility inhibition between compound (II) and its (3E) diastereomer is described, for instance, in U.S. Pat. No. 9,670,155. As described therein, there is a dose-dependent reduction in spontaneous uterine contractions when substantially pure compound (II) is administered at 10, 30, and 60 mg/kg to anesthetized late-term pregnant rats. Inhibition of spontaneous uterine contractions of from about 10% to about 20% was observed from 5 to 15 minutes after oral administration of the substantially pure compound (II), and inhibition of about 42% was observed from 170 to 180 minutes after oral administration of the substantially pure compound (II) at a dose of 60 mg/kg. The inhibitory activity of the substantially pure compound (II) with respect to uterine contraction was found to be markedly higher than that of the substantially pure (3E) diastereomer using the same vehicle and in the same model organism.
[0683] This difference in inhibitory activity leads to an important clinical benefit, as the substantially pure compound (II) may be administered to a subject at a lower therapeutically effective dosage relative to the (3E) diastereomer or an isomeric mixture of both compounds.
[0684] In addition to exhibiting different inhibitory potencies, the substantially pure compound (II) exhibits superior metabolic properties relative to its (3E) diastereomer. It has been discovered that the substantially pure compound (II) is preferentially metabolized by cytochrome P450 isoform 3A4 (CYP3A4), while the substantially pure (3E) diastereomer is preferentially metabolized by cytochrome P450 isoforms 2D6 (CYP2D6) and 2C19 (CYP2C19).
[0685] To measure the metabolic properties of the substantially pure compound (II) and its (3E) diastereomer, microsomal stability assays were conducted. These experiments were designed to investigate the metabolism of the substantially pure compound (II) and its (3E) diastereomer by cytochrome P450 alone (CYP) or in combination with uridine 5′-diphosphoglucuronosyl transferase (UGT). The substantially pure compound (II) and its (3E) diastereomer were each incubated at a concentration of 3 μM with pooled liver microsomes and with appropriate co-factors for either cytochrome P450 alone or in combination with UGT. At five time points over the course of a 45 minute experiment, the compounds were analyzed by liquid chromatography and tandem mass spectrometry (LC-MS/MS). Intrinsic clearance values (CL.sub.int) with standard error (SE CL.sub.int) and metabolic half-life (t.sub.1/2) were calculated and are indicated in Table 9, below.
TABLE-US-00020 TABLE 9 Metabolism of substantially pure (3Z) and (3E) isomers by cytochrome P450 alone or in combination with UGT Metabolic Stability - CYP Metabolic Stability - CYP/UGT CL.sub.int CL.sub.int (μL/min/mg SE t.sub.1/2 (μL/min/mg SE t.sub.1/2 Compound protein) CL.sub.int (min) n protein) CL.sub.int (min) n Compound (II) 11.6 3.74 120 5 9.33 3.87 149 5 (3E) isomer 6.40 3.49 216 5 5.38 3.32 258 5 Z/E ratio 0.56 0.58
[0686] As shown in Table 9, the metabolic stability of each of the substantially pure compound (II) and its (3E) diastereomer in the presence of co-factors required for cytochrome P450 activity is similar to that of each isomer in the presence of co-factors required for combined cytochrome P450 and UGT activity, indicating that cytochrome P450 is primarily responsible for the metabolic degradation of each isomer.
[0687] To determine the selectivity of each of the CYP3A4, CYP2D6, and CYP2C19 isoforms of cytochrome P450, the substantially pure compound (II) and its (3E) diastereomer were each incubated at a concentration of 5 μM with each of the CYP3A4, CYP2C19, and CYP2D6 isoforms. At five time points over the course of a 45 minute experiment, the compounds were analyzed by LC-MS/MS. The percentage of each compound remaining at each time point, along with the metabolic half-lives of each compound in the presence of each cytochrome P450 isoform, are indicated in Tables 10-12, below.
TABLE-US-00021 TABLE 10 Metabolism of substantially pure (3Z) and (3E) isomers by CYP3A4 isoform Compound Remaining (% of t.sub.1/2 compound present at t = 0 min) Compound (min) n 0 min 5 min 15 min 30 min 45 min Compound (II) 73.7 5 100 86.5 75.9 67.3 63.9 (3E) isomer 281 5 100 107 88.8 92.5 92.2 Z/E ratio 0.26.sup.a .sup.aStudent's t-test: p = 0.37
TABLE-US-00022 TABLE 11 Metabolism of substantially pure (3Z) and (3E) isomers by CYP2D6 isoform Compound Remaining (% of t.sub.1/2 compound present at t = 0 min) Compound (min) n 0 min 5 min 15 min 30 min 45 min Compound (II) 14.5 5 100 80.3 50.5 22.5 12.2 (3E) isomer 5.62 4 100 49.3 14.1 2.43 0.845 Z/E ratio 2.6.sup.b .sup.bStudent's t-test: p < 0.0001
TABLE-US-00023 TABLE 12 Metabolism of substantially pure (3Z) and (3E) isomers by CYP2C19 isoform Compound Remaining (% of t.sub.1/2 compound present at t = 0 min) Compound (min) n 0 min 5 min 15 min 30 min 45 min Compound (II) 60.4 5 100 93.7 79.1 67.8 59.9 (3E) isomer 41.4 5 100 87.6 82.7 57.1 47.4 Z/E ratio 1.5.sup.c .sup.cStudent's t-test: p = 0.016
[0688] The data shown in Tables 10-12 demonstrate that the substantially pure compound (II) is preferentially metabolized by the CYP3A4 isoform of cytochrome P450, while the substantially pure (3E) diastereomer is preferentially metabolized by the CYP2D6 and CYP2C19 isoforms of cytochrome P450. The selectivity exhibited by these cytochrome P450 isoforms provides a significant clinical benefit. Allelic variation in the CYP2D6 and CYP2D19 isoforms has been correlated with reduced drug metabolism in vivo in certain segments of the population (see, for example, Lynch et al., Am. Fam. Physician 76:391-396, 2007; the disclosure of which is incorporated herein by reference in its entirety). For example, according to Lynch, 7 percent of white persons and 2 to 7 percent of black persons are poor metabolizers of drugs dependent on CYP2D6, and one in five Asian persons is a poor metabolizer of drugs dependent on CYP2C19. In view of the discovery that the substantially pure compound (II) is preferentially metabolized by CYP3A4, this compound is expected to exhibit more uniform therapeutic and toxicity profiles than the substantially pure (3E) diastereomer.
Example 4
Compound (II) Reduces Uterine Contractility and Increases Endometrial Blood Flow, Modulating the Expression of Various Genes in the Process
[0689] The experiments described in this example were conducted as part of a randomized, double-blind clinical trial aimed at further elucidating the mechanism of action by which compound (II) enhances the likelihood of successful embryo implantation in patients undergoing embryo transfer procedures and reduces the probability of miscarriage. The clinical trial assessed the ability of compound (II) to decrease uterine con6tractions and increase endometrial perfusion, both of which improve uterine receptivity, thereby promoting embryo implantation, reducing the likelihood of miscarriage, and, ultimately, increasing the likelihood of achieving a pregnancy and live birth. The clinical trial further analyzed the effects of compound (II) on the expression of various genes in the endometrium.
Clinical Trial Design
[0690] The randomized, double blind trial was conducted at a UK-based clinical pharmacology unit in 42 healthy female volunteers, aged between 18 and 37 years, who underwent a hormonal preparation identical to that used for infertile patients before frozen-thawed embryo transfer, prior to being administered a single oral dose of either 900 mg or 1,800 mg of compound (II) or matching placebo.
[0691] Particularly, subjects were pre-treated with estradiol valerate at a dosage of 2 mg administered 3 times per day (TID) for 16 days. Administration of estradiol valerate was followed by vaginal progesterone at a dosage of 200 mg administered TID. On the day corresponding to a day 5 embryo transfer, subjects received a single, oral administration of compound (II), in an amount of 900 mg or 1,800 mg, or matching placebo.
[0692] Pharmacodynamic assessments were performed at t=0 hours, 4 hours, 8 hours, and 24 hours after treatment with compound (II) or placebo. These assessments included measurements of uterine contractions by ultrasound and uterine perfusion by a 3D-power Doppler technique. After the last pharmacodynamic assessment at t=24 hours after treatment with compound (II) or placebo, an endometrial biopsy was collected to investigate potential effect of compound (II) on the expression of genes in the endometrium.
Statistical Analyses
[0693] Mean and median changes in uterine contraction frequency and endometrial vascularity indices (particularly, endometrial flow index (FI), vascularity index (VI), and vascularity flow index (VFI)) were calculated. Exploratory non-parametric ANCOVA analyses were conducted to assess differences between each dose of compound (II) (900 mg or 1,800 mg) and placebo with respect to the number of uterine contractions per minute and the proportion of subjects with less than one uterine contraction per minute at t=4 hours, 8 hours, and 24 hours post-dose. The endometrial vascularity indices above were compared between each dose of compound (II) (900 mg or 1,800 mg) and placebo at t=4 hours, 8 hours, and 24 hours post-dose using the same methods. Differences in endometrial mRNA expression were identified and assessed for statistical significance.
Effects of Compound (II) on Endometrial Receptivity
[0694] As shown in
[0695] The results shown in
[0696] Additionally, as these data were collected in subject that underwent hormonal preparation mimicking that of patients undergoing frozen-thawed embryo transfer, these data particularly support the effectiveness of compound (II) in promoting successful implantation of embryos that have previously been cryopreserved and thawed.
[0697] Taken together, the results of these experiments not only demonstrate that compound (II) achieves a dose-dependent reduction in uterine contractility, but also that compound (II) engenders an increase in uterine blood flow. These effects combine to effectuate an environment in which the endometrium exhibits heightened receptivity, such that a patient undergoing an embryo transfer procedure and that has been administered compound (II) will have a higher likelihood of successful embryo implantation and a lower likelihood of miscarriage relative to a patient undergoing a similar procedure that has not been administered compound (II).
Effects of Compound (II) on Endometrial Gene Expression
[0698] The experiments conducted in this trial additionally analyzed the effects of compound (II) on the expression of various genes in endometrial tissue. To do so, endometrial tissue samples were obtained from each subject both before and after administration of compound (II) or placebo. Using an RNA-Seq assay, each subject's mRNA expression level of a variety of genes, including DPP4, CNTNAP3, CNTN4, CXCL12, TNXB, CTSE, OLFM4, KRT5, KRT6A, and IDO2, was then assessed to determine whether the expression of each gene increased, decreased, or underwent no significant change due to administration of the compound or placebo.
[0699] The effects of a single 1,800 mg dose of compound (II) on the expression of DPP4, CNTNAP3, CNTN4, CXCL12, TNXB, CTSE, OLFM4, KRT5, KRT6A, and IDO2 are shown graphically in
TABLE-US-00024 TABLE 13 Effects of compound (II) on endometrial RNA transcript expression, as assessed by RNA-Seq Log2 (Fold Log (Counts per False Discovery Gene Change) Million) P value Rate CTSE −3.816140885 2.566312321 1.09E−06 0.009312535 DPP4 3.813404924 5.507977393 1.09E−05 0.022711225 OLFM4 −3.616062531 1.885484737 5.92E−06 0.021541929 KRT5 −2.728676989 3.252072528 1.18E−05 0.022711225 KRT6A −2.247460229 1.033476041 8.29E−06 0.021541929 CNTNAP3 1.84141649 −0.248619319 2.45E−05 0.037824449 IDO2 −1.70661053 4.470965333 1.85E−06 0.009510348 CNTN4 1.596695597 3.645568029 2.22E−05 0.037824449 CXCL12 1.097804359 5.5863452 8.38E−06 0.021541929 TNXB 1.067833642 7.143209489 1.21E−06 0.009312535
[0700] Taken together, these results demonstrate that compound (II) functions, at least in part, by augmenting endometrial expression of DPP4, CNTNAP3, CNTN4, CXCL12, and TNXB, while suppressing endometrial expression of CTSE, OLFM4, KRT5, KRT6A, and IDO2.
Conclusion
[0701] The results of these experiments demonstrate that both the 900 mg and 1,800 mg doses of compound (II) engender measurable and durable effects on uterine contractions (
[0702] Endometrial perfusion parameters showed marked and sustained increases in median values from baseline to 24 hours for both the 900 mg and 1,800 mg doses of compound (II). The most noticeable increases in VI for compound (II) compared to placebo occurred between the 8-hour and the 24-hour time points. The 1,800 mg dose group exhibited a particular substantial increase in VI at the 8-hour time point (p=0.0714). Endometrial Fl also increased over time, with significant increases at the 24-hour time point for both doses (p=0.0502 and p=0.0625 for the 900 mg and 1,800 mg groups, respectively). An approximately 3-fold increase in median endometrial VFI was observed for both doses between the pre-dose and 24-hour post-dose time points. This increase was significant for the 1,800 mg dose at the 8-hour time point (p=0.0754).
[0703] No differences in mRNA expression in endometrial biopsy tissue were observed after administration of 900 mg of compound (II) compared to placebo. In contrast, within 24 hours of administration of 1,800 mg of compound (II), 10 mRNAs were found to be significantly differentially expressed (adjusted p<0.05). Of these, 5 were upregulated and 5 were downregulated (
[0704] In sum, the results of these experiments demonstrate the ability of compound (II) to improve endometrial receptivity, for example, by reducing uterine contractility, augmenting uterine blood flow, and modulating endometrial gene expression. Importantly, these results also indicate faster, broader, and stronger therapeutic effects achieved by the 1,800 mg dose as compared to the 900 mg dose of compound (II).
Example 5
Administration of an Oxytocin Receptor Antagonist to a Subject Undergoing Embryo Transfer Therapy on the Basis of the Subject's Pre-Treatment Endometrial Expression Level of DPP4, CNTNAP3, CNTN4, CXCL12, TNXB, CTSE, OLFM4, KRT5, KRT6A, and/or IDO2
[0705] Using the compositions and methods described herein, a skilled practitioner can assess the likelihood that a human subject undergoing embryo transfer therapy will benefit from oxytocin receptor antagonist treatment by comparing the subject's expression of one or more of genes DPP4, CNTNAP3, CNTN4, CXCL12, TNXB, CTSE, OLFM4, KRT5, KRT6A, and IDO2 to a reference expression level of the one or more genes. A finding that the subject exhibits a decrease in expression of one or more, or all, of DPP4, CNTNAP3, CNTN4, CXCL12, and TNXB relative to a reference expression level of the gene(s), and/or that the subject exhibits an increase in expression of one or more, or all, of CTSE, OLFM4, KRT5, KRT6A, and IDO2 relative to a reference expression level of the gene(s) may indicate that the subject is likely to benefit from treatment with the oxytocin receptor antagonist. This determination can subsequently inform the practitioner's decision of whether to administer to the subject an oxytocin receptor antagonist, such as a pyrrolidine-3-one oxime compound of formula (I) or (II) or another oxytocin receptor antagonist described herein or known in the art, such as epelsiban, retosiban, barusiban, and atosiban, or a salt, derivative, variant, crystal form, or formulation thereof.
[0706] For instance, a physician of skill in the art can obtain an endometrial tissue sample from a subject undergoing embryo transfer therapy prior to administration of an oxytocin receptor antagonist to the subject. The physician may then compare the level of expression of DPP4, CNTNAP3, CNTN4, CXCL12, TNXB, CTSE, OLFM4, KRT5, KRT6A, and IDO2 in the tissue sample to a reference expression level of the one or more genes. The reference expression level may be, for example, the median level of expression of the one or more genes in a general population of human female subjects that are undergoing embryo transfer therapy and/or that are being considered for oxytocin receptor antagonist treatment. As another example, the reference expression level of the one or more genes may be a level of expression of the gene(s) that was previously exhibited by the subject at a point in the past, such as one or more hours, days, weeks, months, or years prior to a current measurement of the subject's expression of the gene(s). In either scenario, a finding that the subject exhibits a reduced expression of DPP4, CNTNAP3, CNTN4, CXCL12, and/or TNXB relative to the reference expression level, and/or that the subject exhibits an elevated expression of CTSE, OLFM4, KRT5, KRT6A, and/or IDO2 relative to the reference expression level can indicate that the subject is particularly likely to respond to oxytocin receptor antagonist treatment.
Other Embodiments
[0707] All publications, patents, and patent applications mentioned in this specification are incorporated herein by reference to the same extent as if each independent publication or patent application was specifically and individually indicated to be incorporated by reference.
[0708] While the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the invention that come within known or customary practice within the art to which the invention pertains and may be applied to the essential features hereinbefore set forth, and follows in the scope of the claims.
[0709] Other embodiments are within the claims.