TRANSGENIC PIGS WITH GENETIC MODIFICATIONS OF SLA
20180184630 ยท 2018-07-05
Inventors
Cpc classification
A01K67/0275
HUMAN NECESSITIES
A61K35/44
HUMAN NECESSITIES
C07K14/705
CHEMISTRY; METALLURGY
C12N15/8509
CHEMISTRY; METALLURGY
C12N15/877
CHEMISTRY; METALLURGY
International classification
C12N15/877
CHEMISTRY; METALLURGY
C07K14/705
CHEMISTRY; METALLURGY
A61K35/44
HUMAN NECESSITIES
Abstract
The application provides methods of improving a rejection related symptom, reducing premature separation and methods of producing a compound of interest with an altered epitope profile are provided. Transgenic pigs with a disrupted gene or genes, and porcine organs, tissues, and cells therefrom are provided.
Claims
1. A transgenic pig comprising a disrupted (1,3)-galactosyltransferase, CMAH and SLA gene in the nuclear genome of at least one cell of said pig, wherein expression of (1,3)-galactosyltransferase, CMAH and an SLA gene product is decreased as compared to a wild-type pig.
2. A porcine organ, tissue or cell isolated from said transgenic pig of claim 1.
3. (canceled)
4. The transgenic pig of claim 1 wherein when tissue from said pig is transplanted into a human, a rejection related symptom is improved as compared to when tissue from a wild-type pig is transplanted into a human.
5. The transgenic pig of claim 1 wherein when tissue from said pig is transplanted into a human, the rejection related symptom is selected from the group comprising a cellular rejection response related symptom, a humoral rejection response related symptom, a hyperacute rejection related symptom, an acute humoral xenograft reaction rejection related symptom and an acute vascular rejection response related symptom.
6. The transgenic pig of claim 1 wherein when a liver from said transgenic pig is exposed to human platelets, said liver exhibits reduced platelet uptake as compared to when a liver from a wild-type pig is exposed to human platelets.
7. A skin related product obtained from the transgenic pig of claim 1 wherein said skin related product exhibits reduced premature separation from a wound.
8. (canceled)
9. A method of preparing transplant material for xenotransplantation into a human, the method comprising providing the transgenic pig of claim 1 as a source of said transplant material and wherein said transplant material is selected from the group consisting of organs, tissues and cells, and wherein said transplant material has a reduced level of Gal antigens, a reduced level of Neu5GC antigens and a reduced level of SLA antigens.
10. A transgenic pig comprising a disrupted (1,3)-galactosyltransferase, CMAH and SLA class I gene in the nuclear genome of at least one cell of said pig, wherein the disruption of said (1,3)-galactosyltransferase gene is selected from the group of disruptions comprising a three base pair deletion adjacent to a G to A substitution, a single base pair deletion, a six base pair deletion, a two base pair insertion, a ten base pair deletion, five base pair deletion, a seven base pair deletion, an eight base pair substitution for a five base pair deletion, a single base pair insertion, a five base pair insertion, and both a five base pair deletion and a seven base pair deletion, wherein the disruption of said CMAH gene is selected from the group of disruptions comprising twelve base pair deletion, a five base pair substitution for a three base pair deletion, a four base pair insertion, a two base pair deletion, an eight base pair deletion, a five base pair deletion, a three base pair deletion, a two base pair insertion for a single base pair deletion, a twenty base pair deletion, a one base pair deletion, an eleven base pair deletion, wherein the disruption of said SLA class I gene is selected from the group of disruptions comprising a 276 base pair deletion, a 276 base pair deletion in exon 4, a 4 base pair deletion, a 4 base pair deletion in exon 4, a 2 base deletion, a 1 base pair insertion, and a frameshift mutation in exon 4 and wherein expression of (1,3)-galactosyltransferase, CMAH and SLA is decreased as compared to a wild-type pig, and when tissue from said transgenic pig is transplanted into a human, a hyperacute rejection related symptom is improved as compared to when tissue from a wild-type pig is transplanted into a human.
11. A method of increasing the duration of the period between when a human subject is identified as a subject in need of a human liver transplant and when said human liver transplant occurs, said method comprising providing a liver from a transgenic pig comprising a disrupted (1,3)-galactosyltransferase, CMAH and SLA gene in the nuclear genome of at least one cell of said pig, wherein expression of (1,3)-galactosyltransferase, CMAH and SLA in said pig is decreased as compared to a wild-type pig, and surgically attaching said liver from said transgenic pig to said human subject in a therapeutically effective manner.
12. The method of claim 11, wherein said liver from said transgenic pig is surgically attached internal to said human subject.
13. (canceled)
14. The method of claim 11, wherein said liver is directly or indirectly attached to said subject.
15. A method of reducing premature separation of a skin related product from a human, comprising the steps of providing a transgenic pig comprising disrupted (1,3)-galactosyltransferase, CMAH, and SLA genes wherein expression of (1,3)-galactosyltransferase, CMAH and SLA in said pig is decreased as compared to a wild-type pig, and preparing a skin related product from said transgenic pig.
16. A method of improving a hyperacute rejection related symptom in a human subject comprising transplanting porcine transplant material having reduced levels of Gal antigens, reduced levels of Neu5GC antigens and reduced levels of SLA antigens into a subject in need of a transplant, wherein a hyperacute rejection related symptom is improved as compared to when porcine transplant material from a wild-type pig is transplanted into a human subject.
17. A cell culture reagent that exhibits an altered epitope profile wherein said cell culture reagent is isolated from a transgenic pig comprising disrupted (1,3)-galactosyltransferase, CMAH, and SLA genes and wherein expression of (1,3)-galactosyltransferase, CMAH and SLA in said transgenic pig is decreased as compared to a wild-type pig.
18. The cell culture reagent of claim 17, wherein said cell culture reagent is selected from the group comprising cell culture media, cell culture serum, cell culture additive and an isolated cell capable of proliferation.
19. The cell culture reagent of claim 17, wherein said cell culture reagent is isolated from a transgenic pig wherein the disruption of said (1,3)-galactosyltransferase gene is selected from the group of disruptions comprising a three base pair deletion adjacent to a G to A substitution, a single base pair deletion, a six base pair deletion, a two base pair insertion, a ten base pair deletion, five base pair deletion, a seven base pair deletion, an eight base pair substitution for a five base pair deletion, a single base pair insertion, a five base pair insertion, and both a five base pair deletion and a seven base pair deletion, wherein the disruption of said CMAH gene is selected from the group of disruptions comprising twelve base pair deletion, a five base pair substitution for a three base pair deletion, a four base pair insertion, a two base pair deletion, an eight base pair deletion, a five base pair deletion, a three base pair deletion, a two base pair insertion for a single base pair deletion, a twenty base pair deletion, a one base pair deletion, an eleven base pair deletion, wherein the disruption of said SLA class I gene is selected from the group of disruptions comprising a 276 base pair deletion, a 276 base pair deletion in exon 4, a 4 base pair deletion, a 4 base pair deletion in exon 4, a 2 base deletion, a 1 base pair insertion, and a frameshift mutation in exon 4 and wherein expression of (1,3)-galactosyltransferase, CMAH and SLA is decreased as compared to a wild-type pig.
20. A method of producing a compound of interest with an altered epitope profile, said method comprising the steps of providing a cell culture reagent that exhibits an altered epitope profile wherein said cell culture reagent is isolated from a transgenic pig comprising disrupted functional (1,3)-galactosyltransferase, CMAH, and SLA genes and wherein expression of (1,3)-galactosyltransferase, CMAH and SLA genes in said transgenic pig is decreased as compared to a wild-type pig, and incubating an isolated cell capable of expressing said compound of interest with said cell culture reagent; and wherein the level of Neu5Gc or alphaGal or SLA epitopes on said compound of interest is lower than the level of said epitopes on said compound of interest when said compound of interest is produced from an isolated cell incubated with a cell culture reagent isolated from a wild-type pig.
21. The method of claim 20, wherein said compound of interest is selected from the group comprising glycolipids and glycoproteins.
22. (canceled)
23. The method of claim 20 wherein said cell culture reagent is isolated from a transgenic pig wherein the disruption of said (1,3)-galactosyltransferase gene is selected from the group of disruptions comprising a three base pair deletion adjacent to a G to A substitution, a single base pair deletion, a six base pair deletion, a two base pair insertion, a ten base pair deletion, five base pair deletion, a seven base pair deletion, an eight base pair substitution for a five base pair deletion, a single base pair insertion, a five base pair insertion, and both a five base pair deletion and a seven base pair deletion, wherein the disruption of said CMAH gene is selected from the group of disruptions comprising twelve base pair deletion, a five base pair substitution for a three base pair deletion, a four base pair insertion, a two base pair deletion, an eight base pair deletion, a five base pair deletion, a three base pair deletion, a two base pair insertion for a single base pair deletion, a twenty base pair deletion, a one base pair deletion, an eleven base pair deletion, wherein the disruption of said SLA class I gene is selected from the group of disruptions comprising a 276 base pair deletion, a 276 base pair deletion in exon 4, a 4 base pair deletion, a 4 base pair deletion in exon 4, a 2 base deletion, a 1 base pair insertion, and a frameshift mutation in exon 4 and wherein expression of (1,3)-galactosyltransferase, CMAH and SLA is decreased as compared to a wild-type pig.
24. A porcine transplant material for transplantation into a human, wherein lipids and proteins of said transplant material have a reduced level of Gal antigens, Neu5Gc antigens and SLA antigens.
25. A transgenic pig comprising a disrupted (1,3)-galactosyltransferase and SLA class I gene in the nuclear genome of at least one cell of said pig, wherein expression of (1,3)-galactosyltransferase and an SLA gene product is decreased as compared to a wild-type pig.
26. The transgenic pig of claim 25 wherein the disruption of said SLA class I gene is selected from the group comprising exon 4 disruptions, a 276 base pair deletion, a 276 base pair deletion in exon 4, a 4 base pair frameshift mutation, a two base pair deletion and a one base pair insertion.
27. The transgenic pig of claim 25 wherein the disruption of said (1,3)-galactosyltransferase gene is selected from the group comprising a three base pair deletion adjacent to a G to A substitution, a single base pair deletion, a six base pair deletion, a two base pair insertion, a ten base pair deletion, five base pair deletion, a seven base pair deletion, an eight base pair substitution for a five base pair deletion, a single base pair insertion, a five base pair insertion, and both a five base pair deletion and a seven base pair deletion.
28. A transgenic pig comprising a nucleotide sequence encoding a class I HLA polypeptide in the nuclear genome of at least one cell of said pig, wherein expression of said HLA polypeptide is increased as compared to a wild-type pig and further comprising a disrupted (1,3)-galactosyltransferase and SLA gene in the nuclear genome of at least one cell of said pig, wherein expression of (1,3)-galactosyltransferase and an SLA gene product is decreased as compared to a wild-type pig.
29. The transgenic pig of claim 28 further comprising a disrupted CMAH gene in the nuclear genome of at least one cell of said pig, wherein expression of CMAH is decreased as compared to a wild-type pig.
30. The transgenic pig of claim 28, wherein said nucleotide sequence encodes a class I HLA polypeptide selected from the group comprising HLA-A, HLA-B, HLA-C, HLA-C and HLA-A2.
31. A porcine organ, tissue or cell isolated from said transgenic pig of claim 28.
32. (canceled)
33. The transgenic pig of claim 28 wherein when tissue from said pig is transplanted into a human, a rejection related symptom is improved as compared to when tissue from a wild-type pig is transplanted into a human.
34. (canceled)
35. The transgenic pig of claim 28 wherein when a liver from said transgenic pig is exposed to human platelets, said liver exhibits reduced platelet uptake as compared to when a liver from a wild-type pig is exposed to human platelets.
36. A skin related product obtained from the transgenic pig of claim 28 wherein said skin related product exhibits reduced premature separation from a wound.
37. (canceled)
38. A method of preparing transplant material for xenotransplantation into a human, the method comprising providing the transgenic pig of claim 28 as a source of said transplant material and wherein said transplant material is selected from the group consisting of organs, tissues and cells, and wherein said transplant material has an increased level of class I HLA polypeptides and reduced level of Gal antigens, and a reduced level of SLA antigens.
39. A method of preparing transplant material for xenotransplant into a human, the method comprising providing the transgenic pig of claim 29 as a source of said transplant material and wherein said transplant material is selected from the group consisting of organs, tissues and cells, and wherein said transplant material has an increased level of class I HLA polypeptides and reduced level of Gal antigens, a reduced level of Neu5Gc antigens and a reduced level of SLA antigens.
40. The transgenic pig of claim 28, wherein the disruption of said (1,3)-galactosyltransferase gene is selected from the group of disruptions comprising a three base pair deletion adjacent to a G to A substitution, a single base pair deletion, a six base pair deletion, a two base pair insertion, a ten base pair deletion, five base pair deletion, a seven base pair deletion, an eight base pair substitution for a five base pair deletion, a single base pair insertion, a five base pair insertion, and both a five base pair deletion and a seven base pair deletion, wherein the disruption of said SLA class I gene is selected from the group of disruptions comprising an insertion, a 276 base pair deletion, a 276 base pair deletion in exon 4, a 4 base pair deletion, a 4 base pair deletion in exon 4, a 2 base deletion, a 1 base pair insertion, and a frameshift mutation in exon 4 and wherein expression of (1,3)-galactosyltransferase and SLA is decreased as compared to a wild-type pig, and when tissue from said transgenic pig is transplanted into a human, a hyperacute rejection related symptom is improved as compared to when tissue from a wild-type pig is transplanted into a human.
41. The transgenic pig of claim 29 wherein the disruption of said CMAH gene is selected from the group of disruptions comprising twelve base pair deletion, a five base pair substitution for a three base pair deletion, a four base pair insertion, a two base pair deletion, an eight base pair deletion, a five base pair deletion, a three base pair deletion, a two base pair insertion for a single base pair deletion, a twenty base pair deletion, a one base pair deletion, an eleven base pair deletion, and wherein expression of CMAH is decreased as compared to wildtype pig, and when tissue from said transgenic pig is transplanted into a human, a hyperacute rejection related symptom is improved as compared to when tissue from a wild-type pig is transplanted into a human.
42. A method of increasing the duration of the period between when a human subject is identified as a subject in need of a human liver transplant and when said human liver transplant occurs, said method comprising providing a liver from a transgenic pig comprising a nucleotide sequence encoding a class I HLA polypeptide in the nuclear genome of at least one cell of said pig, wherein expression of said HLA polypeptide is increased as compared to a wild-type pig and further comprising a disrupted (1,3)-galactosyltransferase, CMAH and SLA gene in the nuclear genome of at least one cell of said pig, wherein expression of (1,3)-galactosyltransferase, CMAH and SLA in said pig is decreased as compared to a wild-type pig, and surgically attaching said liver from said transgenic pig to said human subject in a therapeutically effective manner.
43. The method of claim 42, wherein said liver from said transgenic pig is surgically attached internal to said human subject.
44. (canceled)
45. The method of claim 42, wherein said liver is directly or indirectly attached to said subject.
46. A method of reducing premature separation of a skin related product from a human, comprising the steps of providing a transgenic pig comprising a nucleotide sequence encoding a class I HLA polypeptide in the nuclear genome of at least one cell of said pig, wherein expression of said HLA polypeptide is increased as compared to a wild-type pig and further comprising disrupted (1,3)-galactosyltransferase, CMAH, and SLA genes wherein expression of (1,3)-galactosyltransferase, CMAH and SLA in said pig is decreased as compared to a wild-type pig, and preparing a skin related product from said transgenic pig.
47. A method of improving a hyperacute rejection related symptom in a human subject comprising transplanting porcine transplant material having increased levels of a class I HLA polypeptide and reduced levels of Gal antigens, reduced levels of Neu5GC antigens and reduced levels of SLA antigens into a subject in need of a transplant, wherein a hyperacute rejection related symptom is improved as compared to when porcine transplant material from a wild-type pig is transplanted into a human subject.
48. A cell culture reagent that exhibits an altered epitope profile wherein said cell culture reagent is isolated from a transgenic pig comprising a nucleotide sequence encoding a class I HLA polypeptide in the nuclear genome of at least one cell of said pig, wherein expression of said HLA polypeptide is increased as compared to a wild-type pig and further comprising disrupted (1,3)-galactosyltransferase, CMAH, and SLA genes and wherein expression of (1,3)-galactosyltransferase, CMAH and SLA in said transgenic pig is decreased as compared to a wild-type pig.
49. (canceled)
50. The cell culture reagent of claim 48, wherein said cell culture reagent is isolated from a transgenic pig wherein the disruption of said (1,3)-galactosyltransferase gene is selected from the group of disruptions comprising a three base pair deletion adjacent to a G to A substitution, a single base pair deletion, a six base pair deletion, a two base pair insertion, a ten base pair deletion, five base pair deletion, a seven base pair deletion, an eight base pair substitution for a five base pair deletion, a single base pair insertion, a five base pair insertion, and both a five base pair deletion and a seven base pair deletion, wherein the disruption of said CMAH gene is selected from the group of disruptions comprising twelve base pair deletion, a five base pair substitution for a three base pair deletion, a four base pair insertion, a two base pair deletion, an eight base pair deletion, a five base pair deletion, a three base pair deletion, a two base pair insertion for a single base pair deletion, a twenty base pair deletion, a one base pair deletion, an eleven base pair deletion, wherein the disruption of said SLA class I gene is selected from the group of disruptions comprising an insertion, a 276 base pair deletion, a 276 base pair deletion in exon 4, a 4 base pair deletion, a 4 base pair deletion in exon 4, a 2 base deletion, a 1 base pair insertion, and a frameshift mutation in exon 4 and wherein expression of (1,3)-galactosyltransferase, CMAH and SLA is decreased as compared to a wild-type pig.
51. A method of producing a compound of interest with an altered epitope profile, said method comprising the steps of providing a cell culture reagent of claim 40; and wherein the level of Neu5Gc or alphaGal or SLA epitopes on said compound of interest is lower than the level of said epitopes on said compound of interest when said compound of interest is produced from an isolated cell incubated with a cell culture reagent isolated from a wild-type pig.
52. The method of claim 51, wherein said compound of interest is selected from the group comprising glycolipids and glycoproteins.
53.-55. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
DETAILED DESCRIPTION OF THE INVENTION
[0036] The present application provides transgenic pigs and porcine organs, tissues and cells for transplantation into a human that do not express the indicated pig genome encoded products and methods of making and using the same. In one embodiment the application provides a triple transgenic pig comprising disrupted (1,3)-galactosyltransferase, cytidine monophosphate-N-acetylneuraminic acid hydroxylase and SLA genes, wherein expression of functional (1,3)-galactosyltransferase, cytidine monophosphate-N-acetylneuraminic acid hydroxylase and a SLA antigen in the transgenic pig is decreased as compared to a wild-type pig. In an embodiment the application provides a triple transgenic pig comprising disrupted (1,3)-galactosyltransferase and SLA genes, wherein expression of functional (1,3)-galactosyltransferase and a SLA antigen in the transgenic pig is decreased as compared to a wild-type pig and further comprising a nucleotide sequence encoding a Class I HLA polypeptide wherein expression of a Class I HLA polypeptide in increased as compared to a wildtype pig. In an embodiment the application provides a triple transgenic pig comprising disrupted (1,3)-galactosyltransferase, cytidine monophosphate-N-acetylneuraminic acid hydroxylase and SLA genes, wherein expression of functional (1,3)-galactosyltransferase, cytidine monophosphate-N-acetylneuraminic acid hydroxylase and a SLA antigen in the transgenic pig is decreased as compared to a wild-type pig and further comprising a nucleotide sequence encoding a Class I HLA polypeptide wherein expression of a Class I HLA polypeptide is increased as compared to a wild-type pig.
I. In General
[0037] In the specification and in the claims, the terms including and comprising are open-ended terms and should be interpreted to mean including, but not limited to . . . These terms encompass the more restrictive terms consisting essentially of and consisting of.
[0038] As used herein and in the appended claims, the singular forms a, an, and the include plural reference unless the context clearly dictates otherwise. As well, the terms a (or an), one or more and at least one can be used interchangeably herein. It is also to be noted that the terms comprising, including, and having can be used interchangeably.
[0039] Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention belongs. All publications and patents specifically mentioned herein are incorporated by reference in their entirety for all purposes including describing and disclosing the chemicals, instruments, statistical analyses and methodologies which are reported in the publications which might be used in connection with the invention. All references cited in this specification are to be taken as indicative of the level of skill in the art. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention.
II. Compositions and Methods
[0040] Transgenic animals suitable for use in xenotransplantation and methods of producing mammals suitable for use in xenotransplantation are provided. Specifically, the present application describes the production of homozygous triple transgenic pigs with decreased expression of alpha 1,3 galactosyltransferase (Gal), cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMAH) and a swine leukocyte antigen (SLA). The present application describes homozygous transgenic pigs with increased expression of a Class I HLA polypeptide and decreased expression of alpha 1,3 galactosyltransferase (Gal), cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMAH) and a swine leukocyte antigen (SLA) or decreased expression of alpha 1,3 galactosyltransferase (Gal) and a swine leukocyte antigen (SLA).
[0041] In embodiments of the present invention, pigs and porcine organs, tissues and cells therefrom are provided in which the Gal, SLA and CMAH genes are less active, such that the resultant Gal, CMAH and SLA products no longer generate wild-type levels of 1,3-galactosyl epitopes, SLA epitopes or Neu5Gc on a cell surface, glycoprotein or glycolipid. In an alternative embodiment the Gal, SLA and CMAH genes are inactivated in such a way that no transcription of the gene occurs. Various embodiments encompass a triple alphaGal/SLA/CMAH transgenic product. Triple transgenic (GT/SLA/CMAH-KO) cells are encompassed by the embodiments. Methods of making transgenic pigs, and the challenges thereto, are discussed in Galli et al 2010 Xenotransplantation 17(6) p. 397-410. Methods and cell cultures of the invention are further detailed below herein.
[0042] The term transgenic mammal refers to a mammal wherein a given gene has been altered, removed or disrupted. It is to be emphasized that the term is to be intended to include all progeny generations. Thus, the founder animal and all F1, F2, F3 and so on progeny thereof are included, regardless of whether progeny were generated by somatic cell nuclear transfer (SCNT) from the founder animal or a progeny animal or by traditional reproductive methods. By single transgenic is meant a transgenic mammal wherein one gene has been altered, removed or disrupted. By double transgenic is meant a transgenic mammal wherein two genes have been altered, removed or disrupted. By triple transgenic is meant a transgenic mammal wherein three genes have been altered, removed or disrupted. By quadruple transgenic is meant a transgenic mammal wherein four genes have been altered, removed or disrupted.
[0043] In principle transgenic animals may have one or both copies of the gene sequence of interest disrupted. In the case where only one copy or allele of the nucleic acid sequence of interest is disrupted, the transgenic animal is termed a heterozygous transgenic animal. The term null mutation encompasses both instances in which the two copies of a nucleotide sequence of interest are disrupted differently but for which the disruptions overlap such that some genetic material has been removed from both alleles, and instances in which both alleles of the nucleotide sequence of interest share the same disruption. In various embodiments disruptions of the three genes of interest may occur in at least one cell of the transgenic animal, at least a plurality of the animal's cells, at least half the animal's cells, at least a majority of animal's cells, at least a supermajority of the animal's cells, at least 70%, 75, 80%, 85%, 90%, 95%, 98%, or 99% of the animal's cells.
[0044] The term chimera, mosaic or chimeric mammal refers to a transgenic mammal with a transgenic in some of its genome-containing cells. A chimera has at least one cell with an unaltered gene sequence, at least several cells with an unaltered gene sequence or a plurality of cells with an unaltered sequence.
[0045] The term heterozygote or heterozygotic mammal refers to a transgenic mammal with a disruption on one of a chromosome pair in all of its genome containing cells.
[0046] The term homozygote or homozygotic mammal refers to a transgenic mammal with a disruption on both members of a chromosome pair in all of its genome containing cells. A homozygous alteration refers to an alteration on both members of a chromosome pair.
[0047] A non-human mammal of the application includes mammals such as rodents, sheep, dogs, ovine such as sheep, bovine such as beef cattle and milk cows, and swine such as pigs and hogs. Although the application provides a typical non-human animal (pigs), other animals can similarly be genetically modified.
[0048] A mutation is a detectable change in the genetic material in the animal that is transmitted to the animal's progeny. A mutation is usually a change in one or more deoxyribonucleotides, such as, for example adding, inserting, deleting, inverting or substituting nucleotides.
[0049] By pig is intended any pig known to the art including, but not limited to, a wild pig, domestic pig, mini pigs, a Sus scrofa pig, a Sus scrofa domesticus pig, as well as in-bred pigs. Without limitation the pig can be selected from the group comprising Landrace, Yorkshire, Hampshire, Duroc, Chinese Meishan, Chester White, Berkshire Goettingen, Landrace/York/Chester White, Yucatan, Bama Xiang Zhu, Wuzhishan, Xi Shuang Banna and Pietrain pigs. Porcine organs, tissues or cells are organs, tissues, devitalized animal tissues, or cells from a pig.
[0050] The alpha 1,3 galactosyltransferase (Gal, GGTA, GGT1, GT, GT, GGTA1, GGTA-1) gene encodes an enzyme (GT, Gal, 1,3 galactosyltransferase). Ensemble transcript ENSSSCG00000005518 includes the porcine GGTA1 nucleotide sequence. Functional 1,3 galactosyltransferase catalyzes formation of galactose-1,3-galactose (Gal, Gal, Gal, gal1,3gal, gal1-3gal) residues on glycoproteins. The galactose-1,3-galactose (Gal) residue is an antigenic epitope or antigen recognized by the human immunological system. Removing Gal from transgenic organ material does not eliminate the human immunological response to transplant of foreign material, suggesting an involvement of additional antibodies in the rapid immunological response to xenotransplant. (Mohiudden et al (2014), Am J. Transplantation 14:488-489 and Mohiudden et al 2014 Xenotransplantation 21:35-45). Disruptions of the Gal gene that result in decreased expression of functional Gal may include but are not limited to a 3 base pair deletion adjacent to a G to A substitution, a single base pair deletion, a single base pair insertion, a two base pair insertion, a six base pair deletion, a ten base pair deletion, a seven base pair deletion, an eight base pair insertions for a five base pair deletion and a five base pair insertion (see Table 1). The Crispr target sequence is in exon 3 of the gene, near the start codon.
[0051] Swine produce swine leukocyte antigens (SLA) from multiple SLA genes. Humans and non-human primate CD8+ and CD4+ T cells can be activated by SLA Class I and II, respectively. SLA's are characterized in a class selected from the group comprising Class I and Class II. SLA genes include, but are not limited to SLA-1, SLA-2, SLA-3, SLA-4, SLA-5, SLA-9, SLA-11, SLA-DQ and SLA-DR. SLA-1, SLA-2 and SLA-3 are SLA Class I (SLA1) genes. SLA-DQ and SLA-DR are SLA Class II genes. Anti-SLA class 1 (anti-SLA1) antibodies may react with products of the SLA-1, SLA-2 and SLA-3 genes. The SLA-1*0702 allele sequence is available as Genbank Acc. No: EU440330.1. The SLA-1*1201 allele sequence is available as Genbank Acc. No: EU440335.1. The SLA-1*1301 allele sequence is available as Genbank Acc. No: EU440336.1. The SLA-2 1001 allele sequence is available as Genbank Acc. No: EU432084.1. The SLA-2 2002 allele sequence is available as Genbank Acc. No: EU432081.1. The SLA-3*0402 allele sequence is available as Genbank Acc. No: EU432092.1. The SLA-3*0502 allele sequence is available as Genbank Acc. No: EU432094.1. Transgenic pigs expressing a dominant negative version of the human class I transactivator (CIITA), a transcription factor critical for expression of SLA class II have been created. The CIITA expressing pigs appeared healthy and viable. In the CIITA pigs, class II SLA expression was reduced by 40-50%. See Hara et al 2013, Human dominant-negative class II transactivator transgenic pigs-effect on the human anti-pig T-Cell immune response and immune status, Immunol 140:39-46, herein incorporated by reference in their entirety.
[0052] Human Leukocyte Antigens (HLA) molecules are the cell surface receptors of the major histocompatibility complex (MHC) in humans. Class I and Class II MHC's are significantly involved in transplant recognition and rejection. Matching HLA genes between donors and recipients reduces transplant rejection. An embodiment of the application provides HLA on porcine cells reduce transplant rejection.
[0053] The cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMP-Neu5Ac hydroxylase gene, CMAH) gene encodes an enzyme (CMAH). Functional CMAH catalyzes conversion of sialic acid N-acetylneuraminic acid (Neu5Ac) to N-glycolylneuraminic acid (Neu5Gc). The Neu5Gc residue is an antigenic epitope or antigen recognized by the human immunological system. The Ensembl database id Gene: ENSSSCG00000001099 includes the porcine CMAH nucleotide sequence. The Crispr target area is near exon 6. Disruptions of the CMAH gene that result in decreased expression of functional CMAH may include but are not limited to a four base pair insertion, a one base pair deletion, a two base pair deletion, a three base pair deletion, a five base pair deletion, an eight base pair deletion, an eleven base pair deletion, a twelve base pair deletion, a single base pair insertion, a two base pair insertion for single base pair deletion, and a three base pair deletion for a five base pair insertion
TABLE-US-00001 TABLE1 ExamplesofDisruptionsofGenesofInterestinViablePigswithDecreased FunctionalGeneProduct Disruption Class wildtype disruption Descriptor GGTA1-GTCATCTTTTACATCATGGTGGAT GGTA1- 3basepair GATATCTCCAGGATGCC GTCATCTTTTACATCATG___ deletion AATGATATCTCCAGGATGCC adjacentto aGtoA substitution GGTA1- GGTA1- Singlebase CTTTTCCCAGGAGAAAATAATGAATGTCAAA CTTTTCCCAGGAGAAAATAAT pair GGAAGAGTGGTTCT GAATGT_AAAGGAAGAGTGG deletion TTCT GGTA1- GGTA1- 6basepair CTTTTCCCAGGAGAAAATAATGAATGTCAAA CTTTTCCCAGGAGAAAATAAT deletion GGAAGAGTGGTTCT _______CAAA GGAAGAGTGGTTCT GGTA1- GGTA1- 2basepair CTTTTCCCAGGAGAAAATAATGAATGTCAAA CTTTTCCCAGGAGAAAATAAT insertion GGAAGAGTGGTTCT GAATGTATCAAA GGAAGAGTGGTTCT GGTA1- GGTA1- 10base CTTTTCCCAGGAGAAAATAATGAATGTCAAA CTTTTCCCAGGAGAAAATAA_ pair GGAAGAGTGGTTCT _________A deletion GGAAGAGTGGTTCT GGTA1- GGTA1 7basepair CTTTTCCCAGGAGAAAATAATGAATGTCAAA CTTTTCCCAGGAGAAAATAAT deletion GGAAGAGTGGTTCT GAA_______ GGAAGAGTGGTTCT GGTA1- GGTA1 7basepair GAGAAAATAATGAATGTCAAAGG GAGAAAATAATG_______ deletion AAGG GGTA1- GGTA1 8basepair CTTTTCCCAGGAGAAAATAATGAATGTCAAA CTTTTCCCAGGAGAAAATAAT substitution GGAAGAGTGGTTCT GAAGGAATAATAA for5base GGAAGAGTGGTTCT pair deletion GGTA1- GGTA1- Singlebase CTTTTCCCAGGAGAAAATAATGAATGTCAAA CTTTTCCCAGGAGAAAATAAT pair GGAAGAGTGGTTCT GAATGTTCAAA insertion GGAAGAGTGGTTCT GGTA1- GGTA1- 5basepair GAGAAAATAATGAATGTCAAAGG GAGAAAATAAT_____ insertion TCAAAGG CMAH- CMAH- 4basepair AAACTCCTGAACTACAAGGCTCGGCTGGTG AAACTCCTGA insertion AAGGA ACTACAAGGAAGGC TCGGCTGGTGAAGGA CMAH- CMAH- 2basepair CAGGCGTGAGTAAGGTACGTGATCTGTTGGA CAGGCGTGAGTAAGGTACGT deletion AGACAGTGAGATTCAGATGAT GATC__TTGGAAGACAGTGA GATTCAGATGAT CMAH- CAGGCGTGAGTAAGGTACGT 8basepair CAGGCGTGAGTAAGGTACGTGATCTGTTGGA G________GA deletion AGACAGTGAGATTCAGATGAT AGACAGTGAGATTCAGATGAT CMAH- CAGGCGTGAGTAAGGTACGT 5basepair CAGGCGTGAGTAAGGTACGTGATCTGTTGGA G_____TTGGA deletion AGACAGTGAGATTCAGATGAT AGACAGTGAGATTCAGATGAT CMAH- CAGGCGTGAGTAAGGTACGT 3basepair CAGGCGTGAGTAAGGTACGTGATCTGTTGGA GA___GTTGGA deletion AGACAGTGAGATTCAGATGAT AGACAGTGAGATTCAGATGAT CMAH- CAGGCGTGAGTAAGGTACGT 2basepair CAGGCGTGAGTAAGGTACGTGATCTGTTGGA GATCACGTTGGA insertionfor AGACAGTGAGATTCAGATGAT AGACAGTGAGATTCAGATGAT singlebase pair deletion CMAH- CAGGCGTGAGTAAGGTACGT 20base CAGGCGTGAGTAAGGTACGTGATCTGTTGGA GAT_______________ pair AGACAGTGAGATTCAGATGAT _____TCAGATGAT deletion CMAH- CAGGCGTGAGTAAGGTACGT 1basepair CAGGCGTGAGTAAGGTACGTGATCTGTTGGA GATCTTGTTGGA insertion AGACAGTGAGATTCAGATGAT AGACAGTGAGATTCAGATGAT CMAH- CAGGCGTGAGTAAGGTACGT 1basepair CAGGCGTGAGTAAGGTACGTGATCTGTTGGA GATC_GTTGGAAGACAGTGA deletion AGACAGTGAGATTCAGATGAT GATTCAGATGAT CMAH CMAH 11base GAGTAAGGTACGTGATCTGTTGGAAGACAGT GAGTAAGG__________ pair _TTGGAAGACAGT deletion CMAH CMAH 12base GAGTAAGGTACGTGATCTGTTGGAAGACAGT GAGTAAGGTACGTGA____ pair ________CAGT deletions CMAH CMAH 3basepair GAGTAAGGTACGTGATCTGTTGGAAGACAGT GAGTAAGGTACGTGAGTAAG deletion5 TTGGAAGACAGT basepair insertion SLA-1*0702 SLA-1 276base GCCTCCAAAGACACATGTGACCCGCCACCCCAGC pair TCTGACCTGGGGGTCACCTTGAGGTGCTGGGCCC deletionin TGGGCTTCTACCCTAAGGAGATCTCCCT exon4 GACCTGGCAGCGGGAGGGCCAGGACCAGAGCCA GGACATGGAGCTGGTGGAGACCAGGCCCTCAGG GGATGGGACCTTCCAGAAGTGGGCGGCCC TGGTGGTGCCTCCTGGAGAGGAGCAGAGCTACAC CTGCCATGTGCAGCACGAGGGCCTGCAGGAGCCC CTCACCCTGAGATGGGA SLA-1*0702 SLA-1 4basepair GGCCCAGGACCAGAGCCAGGACATGGAGCTGGT GGCCCAGGACCAGAGCCA__ deletion GG __ATGGAGCTGGTGG SLA-1*1301/*1001recombinant GGCCCAGGACCAGAGCC__ 2basepair GGCCCAGGACCAGAGCCAGGACATGGAGCTGGT GACATGGAGCTGGTGG deletion GG SLA-1*1001/SLA-12recombinant GGCCCAGGACCAGAGCCAGG 1basepair GGCCCAGGACCAGAGCCAGGACATGGAGCTGG gACATGGAGCTGG insertion
[0054] Transgenic Animals. The present invention provides a transgenic animal lacking any expression of functional Gal and CMAH genes and reduced expression of one or more SLA genes. The animal can be any mammal suitable for xenotransplantation. In a specific embodiment, the animal is a pig. CMAH/GAL double knockout, CMAH/GAL DKO, CMAH/Gal, CMAH/Gal DKO, CMAH.sup.//GAL.sup./, Gal/CMAH DKOs, GAL/CMAH double knockouts, GGTA1/CMAH DKO, GT1/CMAH DKO, GGTA1.sup.//CMAH.sup./, GGT1.sup.//CMAH.sup./, CMAH/GGTA DKO, GT/CMAH-KO, GGTA1/CMAH KO, DKO (Gal/CMAH), DKO (GAL & CMAH), CMAH-/Gal-, Gal-/CMAH-, CMAH-/GAL- and variants thereof refer to animals, cells, or tissues that lack expression of functional alpha 1,3 galactosyltransferase and cytidine monophosphate-N-acetylneuraminic acid hydroxylase. A triple transgenic product or pig may be created in a wild-type background or in a CMAH/Gal double knockout background.
[0055] The phrase disrupted gene is intended to encompass insertion, interruption, or deletion of a nucleotide sequence of interest wherein the disrupted gene either encodes a polypeptide having an altered amino acid sequence that differs from the amino acid sequence of the endogenous sequence, encodes a polypeptide having fewer amino acid residues than the endogenous amino acid sequence or does not encode a polypeptide although the nucleotide sequence of interest encodes a polypeptide.
[0056] The present specification provides a transgenic animal with reduced expression of functional Gal, SLA and CMAH genes. In one embodiment the transgenic animal lacks expression of functional Gal, CMAH and a class I SLA. In another embodiment the transgenic animal lacks expression of functional Gal, CMAH and a class II SLA. In another embodiment the transgenic animal lacks expression of functional Gal, CMAH, a class I SLA and a class II SLA. In yet another embodiment the transgenic animal lacks expression of functional Gal, CMAH and more than one SLA Class I genes or more than one SLA Class II genes. In still another embodiment, the transgenic animal lacks expression of functional Gal, CMAH, more than one SLA Class 1 gene and at least one SLA Class II gene. In yet still another embodiment, the transgenic animal lacks expression of functional Gal, CMAH, more than one SLA Class II gene and at least on SLA Class 1 gene. In another embodiment the transgenic animal lacks expression of functional Gal and at least one SLA Class I gene. In another embodiment the transgenic animal lacks expression of functional Gal and at least one SLA Class II gene. The animal can be any mammal suitable for xenotransplantation. In a specific embodiment, the animal is a pig. In an embodiment the transgenic animal has reduced expression of functional Gal, SLA, B4GaINT2 and CMAH genes. Gal, SLA and CMAH transgenic pigs may be further altered to express inhibitory or co-inhibitory molecules or by removing additional molecules including but not limited to ASGR1, vWF, Mac-1 (CR3, complement receptor 3), CD11 b or CD18.
[0057] The present invention provides a transgenic animal with increased expression of a Class I HLA polypeptide and reduced expression of functional Gal, SLA and CMAH genes. In one embodiment the transgenic animal lacks expression of functional Gal, CMAH and a class I SLA. In another embodiment the transgenic animal lacks expression of functional Gal, CMAH and a class II SLA. In another embodiment the transgenic animal lacks expression of functional Gal, CMAH, a class I SLA and a class II SLA. In yet another embodiment the transgenic animal lacks expression of functional Gal, CMAH and more than one SLA Class I genes or more than one SLA Class II genes. In still another embodiment, the transgenic animal lacks expression of functional Gal, CMAH, more than one SLA Class 1 gene and at least one SLA Class II gene. In yet still another embodiment, the transgenic animal lacks expression of functional Gal, CMAH, more than one SLA Class II gene and at least on SLA Class 1 gene. In another embodiment the transgenic animal has increased expression of a Class I HLA polypeptide and lacks expression of functional Gal and at least one SLA Class I gene.
[0058] Transgenic transplant material. Transplant material encompasses organs, tissue and/or cells from an animal for use as xenografts. Transplant material for use as xenografts may be isolated from transgenic animals with decreased expression of Gal, SLA and CMAH. Transgenic transplant material from transgenic pigs can be isolated from a prenatal, neonatal, immature or fully mature animal. The transplant material may be used as temporary or permanent organ replacement for a human subject in need of an organ transplant. Any porcine organ can be used including, but not limited to, the brain, heart, lung, eye, stomach, pancreas, kidneys, liver, intestines, uterus, bladder, skin, hair, nails, ears, glands, nose, mouth, lips, spleen, gums, teeth, tongue, salivary glands, tonsils, pharynx, esophagus, large intestine, small intestine, small bowel, rectum, anus, thyroid gland, thymus gland, bones, cartilage, tendons, ligaments, suprarenal capsule, skeletal muscles, smooth muscles, blood vessels, blood, spinal cord, trachea, ureters, urethra, hypothalamus, pituitary, pylorus, adrenal glands, ovaries, oviducts, uterus, vagina, mammary glands, testes, seminal vesicles, penis, lymph, lymph nodes and lymph vessels.
[0059] In another embodiment, the application provides non-human tissues that are useful for xenotransplantation. In various embodiments, the non-human tissue is porcine tissue from a triple Gal/CMAH/SLA transgenic pig. Any porcine tissue can be used including but not limited to, epithelium, connective tissue, blood, bone, cartilage, muscle, nerve, adenoid, adipose, areolar, brown adipose, cancellous muscle, cartilaginous, cavernous, chondroid, chromaffin, dartoic, elastic, epithelial, fatty, fibrohyaline, fibrous, Gamgee, gelatinous, granulation, gut-associated lymphoid, skeletal muscle, Haller's vascular, indifferent, interstitial, investing, islet, lymphatic, lymphoid, mesenchymal, mesonephric, multilocular adipose, mucous connective, myeloid, nasion soft, nephrogenic, nodal, osteoid, osseus, osteogenic, retiform, periapical, reticular, smooth muscle, hard hemopoietic and subcutaneous tissue, devitalized animal tissues including heart valves, skin, and tendons, and vital porcine skin.
[0060] Another embodiment provides cells and cell lines from porcine triple transgenic animals with reduced or decreased expression of Gal, SLA and CMAH. In one embodiment these cells or cell lines can be used for xenotransplantation. Cells from any porcine tissue or organ can be used including, but not limited to: epithelial cells, fibroblast cells, neural cells, keratinocytes, hematopoietic cells, melanocytes, chondrocytes, lymphocytes (B and T), macrophages, monocytes, mononuclear cells, cardiac muscle cells, other muscle cells, granulosa cells, cumulus cells, epidermal cells, endothelial cells, Islet of Langerhans cells, pancreatic insulin secreting cells, pancreatic alpha-2 cells, pancreatic beta cells, pancreatic alpha-1 cells, bone cells, bone precursor cells, neuronal stem cells, primordial stem cells, hepatocytes, aortic endothelial cells, microvascular endothelial cells, umbilical vein endothelial cells, fibroblasts, liver stellate cells, aortic smooth muscle cells, cardiac myocytes, neurons, Kupffer cells, smooth muscle cells, Schwann cells, erythrocytes, platelets, neutrophils, lymphocytes, monocytes, eosinophils, basophils, adipocytes, chondrocytes, pancreatic islet cells, thyroid cells, parathyroid cells, parotid cells, glial cells, astrocytes, red blood cells, white blood cells, macrophages, somatic cells, pituitary cells, adrenal cells, hair cells, bladder cells, kidney cells, retinal cells, rod cells, cone cells, heart cells, liver cells, pacemaker cells, spleen cells, antigen presenting cells, memory cells, T cells, B cells, plasma cells, muscle cells, ovarian cells, uterine cells, prostate cells, vaginal epithelial cells, sperm cells, testicular cells, germ cells, egg cells, leydig cells, peritubular cells, sertoli cells, lutein cells, cervical cells, endometrial cells, mammary cells, follicle cells, mucous cells, ciliated cells, nonkeratinized epithelial cells, keratinized epithelial cells, lung cells, goblet cells, columnar epithelial cells, dopaminergic cells, squamous epithelial cells, osteocytes, osteoblasts, osteoclasts, embryonic stem cells, fibroblasts and fetal fibroblasts.
[0061] In an embodiment the application provides non-human material suitable for transfusions from multiple transgenic porcine animals with reduced expression of Gal and a SLA gene. These materials suitable for transfusions may include, but are not limited to, blood, whole blood, plasma, serum, red blood cells, platelets, and white bloods cells. Such materials may be isolated, enriched or purified. Methods of isolating, enriching or purifying material suitable for transfusion are known in the art.
[0062] Nonviable derivatives include tissues stripped of viable cells by enzymatic or chemical treatment these tissue derivatives can be further processed through crosslinking or other chemical treatments prior to use in transplantation. In a preferred embodiment, the derivatives include extracellular matrix derived from a variety of tissues, including skin, bone, urinary, bladder or organ submucosal tissues. In addition, tendons, joints, and bones stripped of viable tissue to including but not limited to heart valves and other nonviable tissues as medical devices are provided. In an embodiment, serum or medium suitable for cell culture and isolated from a transgenic pig of the invention are provided. Components of porcine transgenic organs, tissues or cells are also provided. Components may also be modified through any means known in the art including but not limited to crosslinking and aldehyde crosslinking. Components may vary depending on the larger organ or tissue from which the component is obtained. Skin components may include but are not limited to stripped skin, collagen, epithelial cells, fibroblasts and dermis. Bone components may include but are not limited to collagen and extracellular matrix. Heart components may include but are not limited to valves and valve tissue.
[0063] Xenotransplantation encompasses any procedure that involves the transplantation, implantation or infusion of cells, tissues or organs into a recipient subject from a different species. Xenotransplantation in which the recipient is a human is particularly envisioned. Thus xenotransplantation includes but is not limited to vascularized xenotransplant, partially vascularized xenotransplant, unvascularized xenotransplant, xenodressings, xenobandages, xenotransfusions, and xenostructures.
[0064] In embodiments, cell culture reagents isolated from a transgenic pig comprising disrupted (1,3)-galactosyltransferase, SLA and CMAH genes are provided. Cell culture reagents are reagents utilized for tissue culture, in vitro tissue culture, microfluidic tissue culture, cell culture or other means of growing isolated cells or cell lines. Cell culture reagents may include but are not limited to cell culture media, cell culture serum, a cell culture additive, a feeder cell, and an isolated cell capable of proliferation. By an isolated cell capable of proliferation is intended a cell isolated or partially isolated from other cell types or other cells wherein the cell is capable of proliferating, dividing or multiplying into at least one additional clonal cell.
[0065] Cells grown in culture may synthesize or metabolically incorporate antigenic epitopes into a compound of interest produced by the cultured cell. The antigenic epitopes may result in increased binding by human antibodies and decreased efficacy of the compound of interest. See Ghaderi et al 2010 Nature Biotechnology 28(8):863-867, herein incorporated by reference in its entirety. Growing the producing cell in a cell culture reagent with an altered epitope profile such as a reduced level of Gal, SLA or Neu5Gc may reduce the level of Gal antigens, SLA antigens, or Neu5Gc antigens, or Gal, SLA Neu5Gc antigens combined on the compound of interest. Compounds of interest may include but are not limited to glycoproteins and glycolipids. Glycoproteins of interest may include but are not limited to an antibody, growth factor, cytokine, hormone or clotting factor. Glycolipids of interest may include but are not limited to therapeutics, antigens, and bio-surfactants.
[0066] The word providing is intended to encompass preparing, procuring, getting ready, making ready, supplying or furnishing. It is recognized that methods of providing a cell may differ from methods of providing a subject, methods of providing an organ may differ from methods of providing a pig, methods of providing a kidney may differ from methods of providing a liver and methods of providing an organ may differ from methods of providing a material suitable for transfusion.
[0067] Transplant rejection occurs when transplanted tissue, organs, cells or material are not accepted by the recipients body. In transplant rejection, the recipient's immune system attacks the transplanted material. Multiple types of transplant rejection exist and may occur separately or together. Rejection processes included but are not limited to hyperacute rejection (HAR), acute humoral xenograft rejection reaction (AHXR), thrombocytopenia, acute humoral rejection, hyperacute vascular rejection, antibody mediated rejection and graft versus host disease. By hyperacute rejection we mean rejection of the transplanted material or tissue occurring or beginning within the first 24 hours post-transplant involving one or more mechanisms of rejection. Rejection encompasses but is not limited to hyperacute rejection, humoral rejection, acute humoral rejection, cellular rejection and antibody mediated rejection. The acute humoral xenograft reaction (AHXR) is characterized by a spectrum of pathologies including, but not limited to, acute antibody mediated rejection occurring within days of transplant, the development of thrombotic microangiopathy (TMA), microvascular angiopathy, pre-formed non-Gal IgM and IgG binding, complement activation, microvascular thrombosis and consumptive thrombocytopenia within the first few weeks post transplant. Thrombocytopenia is a quantity of platelets below the normal range of 140,000 to 440,000/l. Thrombocytopenia related symptoms include, but are not limited to, internal hemorrhage, intracranial bleeding, hematuria, hematemesis, bleeding gums, abdominal distension, melena, prolonged menstruation, epistaxis, ecchymosis, petechiae or purpura. Uptake of human platelets by pig livers contributes to the development of thrombocytopenia in xenograft recipients. Thrombocytopenia may occur upon reperfusion of the xenotransplanted organ or after the immediate post-reperfusion period.
[0068] In another embodiment, the invention provides a method of improving a rejection related symptom in a patient comprising transplanting porcine organs, tissue or cells having reduced expression of Gal, SLA and Neu5Gc on the porcine organs, tissue or cells into a human, wherein one or more rejection related symptoms is improved as compared to when tissue from a wild-type swine is transplanted into a human. By improving, bettering, ameliorating, enhancing, and helping is intended advancing or making progress in what is desirable. It is also envisioned that improving a rejection related symptom may encompass a decrease, lessening, or diminishing of an undesirable symptom. It is further recognized that a rejection related symptom may be improved while another rejection related symptom is altered. The altered second rejection related symptom may be improved or increased. A second altered rejection related symptom may be altered in a less desirable manner. Rejection related symptoms include but are not limited to hyperacute rejection related symptoms and acute humoral xenograft reaction related symptoms. Rejection related symptoms may include, but are not limited to, thrombotic microangiopathy (TMA), microvascular angiopathy, pre-formed non-Gal IgM and IgG binding, complement activation, agglutination, fibrosis, microvascular thrombosis, consumptive thrombocytopenia, consumptive coagulopathy, profound thrombocytopenia, refractory coagulopathy, graft interstitial hemorrhage, mottling, cyanosis, edema, thrombosis, necrosis, fibrin thrombi formation, systemic disseminated intravascular coagulation, IgM deposition in glomerular capillaries, IgG deposition in glomerular capillaries, elevated creatinine levels, elevated BUN levels, T cell infiltrate, infiltrating eosinophils, infiltrating plasma cells, infiltrating neutrophils, arteritis, antibody binding to endothelium, altered expression of ICOS, CTLA-4, BTLA, PD-1, LAG-3, or TIM-3, and systemic inflammation.
[0069] Hyperacute rejection related symptom is intended to encompass any symptom known to the field as related to or caused by hyperacute rejection. It is recognized that hyperacute rejection related symptoms may vary depending upon the type of organ, tissue or cell that was transplanted. Hyperacute rejection related symptoms may include, but are not limited to, thrombotic occlusion, hemorrhage of the graft vasculature, neutrophil influx, ischemia, mottling, cyanosis, edema, organ failure, reduced organ function, necrosis, glomerular capillary thrombosis, lack of function, hemolysis, fever, clotting, decreased bile production, asthenia, hypotension, oliguria, coagulopathy, elevated serum aminotransferase levels, elevated alkaline phosphatase levels, jaundice, lethargy, acidosis and hyperbilirubenemia and thrombocytopenia.
[0070] Any method of evaluating, assessing, analyzing, measuring, quantifying, or determining a rejection related symptom known in the art may be used with the claimed compositions and methods. Methods of analyzing a rejection related symptom may include, but are not limited to, laboratory assessments including CBC with platelet count, coagulation studies, liver function tests, flow cytometry, immunohistochemistry, standard diagnostic criteria, immunological methods, western blots, immunoblotting, microscopy, confocal microscopy, transmission electron microscopy, IgG binding assays, IgM binding assays, expression asays, creatinine assays and phagosome isolation.
[0071] Expression of a gene product is decreased when total expression of the gene product is decreased, a gene product of an altered size is produced or when the gene product exhibits an altered functionality. Thus if a gene expresses a wild-type amount of product but the product has an altered enzymatic activity, altered size, altered cellular localization pattern, altered receptor-ligand binding or other altered activity, expression of that gene product is considered decreased. Expression may be analyzed by any means known in the art including, but not limited to, RT-PCR, Western blots, Northern blots, microarray analysis, immunoprecipitation, radiological assays, polypeptide purification, spectrophotometric analysis, Coomassie staining of acrylamide gels, ELISAs, 2-D gel electrophoresis, in situ hybridization, chemiluminescence, silver staining, enzymatic assays, ponceau S staining, multiplex RT-PCR, immunohistochemical assays, radioimmunoassay, colorimetric assays, immunoradiometric assays, positron emission tomography, fluorometric assays, fluorescence activated cell sorter staining of permeablized cells, radioimunnosorbent assays, real-time PCR, hybridization assays, sandwich immunoassays, flow cytometry, SAGE, differential amplification or electronic analysis. Expression may be analyzed directly or indirectly. Indirect expression analysis may include but is not limited to, analyzing levels of a product catalyzed by an enzyme to evaluate expression of the enzyme. See for example, Ausubel et al, eds (2013) Current Protocols in Molecular Biology, Wiley-Interscience, New York, N.Y. and Coligan et al (2013) Current Protocols in Protein Science, Wiley-Interscience New York, N.Y.
[0072] As compared to is intended to encompass comparing something to a similar but separate thing, such as comparing a data point obtained from an experiment with a transgenic pig to a data point obtained from a similar experiment with a wildtype pig. The word comparing is intended to encompass examining character, qualities, values, quantities, or ratios in order to discover resemblances or differences between that which is being compared. Comparing may reveal a significant difference in that which is being compared. By significant difference is intended a statistically significant difference in results obtained for multiple groups such as the results for material from a transgenic pig and material from a wild-type pig or results for material from a triple transgenic product or pig and material from a double transgenic product or pig. Generally statistical significance is assessed by a statistical significance test such as but not limited to the student's t-test, Chi-square, one-tailed t-test, two-tailed t-test, ANOVA, Dunett's post hoc test, Fisher's test and z-test. A significant difference between two results may be results with a p<0.1, p<0.05, p<0.04, p<0.03, p<0.02, p<0.01 or greater.
[0073] The word isolated is intended to encompass an entity that is physically separated from another entity or group. An isolated cell is physically separated from another group of cells. Examples of a group of cells include, but are not limited to, a developing cell mass, a cell culture, a cell line, a tissue, an organ and an animal. The word isolating is intended to encompass physically separating an entity from another entity or group. Examples include physically separating a cell from other cells, physically separating a cell component from the remainder of the cell and physically separating tissue or organ from an animal. An isolated cell or cell component is separated by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, up to 100% of other naturally occurring cells or cell components. Methods for isolating one or more cells from another group of cells are known in the art. See for example Freshney (ED) Culture of Animal Cells: a manual of basic techniques (3.sup.rd Ed.) 1994, Wiley-Liss; Spector et al (Eds) (1998) Cells: a Laboratory Manual (vol. 1) Cold Spring Harbor Laboratory Press and Darling et al (1994) Animal Cells: culture and media John Wiley & Sons. Methods of isolating a tissue or an organ from an animal are known in the art and vary depending on the tissue or organ to be isolated and the desired method of transplanting the tissue or organ. Methods of isolating a transfusion product from an animal or sample are known in the art and vary depending on the desired transfusion product. Such methods include but are not limited to centrifugation, dialysis, elution, apheresis and cryoprecipitation.
[0074] A skin related product encompasses products isolated from skin and products intended for use with skin. Skin related products isolated from skin or other tissues may be modified before use with skin. Skin related products include but are not limited to replacement dressings, burn coverings, dermal products, replacement dermis, dermal fibroblasts, collagen, chondroitin, connective tissue, keratinocytes, cell-free xenodermis, cell-free pig dermis, composite skin substitutes and epidermis and temporary wound coverings. See for example Matou-Kovd et al (1994) Ann Med Burn Club 7:143, herein incorporated by reference in its entirety.
[0075] The attachment period of a skin related product is the time between application of the skin related product to a human subject and natural separation of the skin related product from the human subject. When a human subject's skin wound has sealed, a skin related product may be removed by natural separation or mechanical separation. However natural separation of a skin related product from a human subject may occur prematurely. Premature natural separation occurs before separation is desired by a medical practitioner. By way of example and not limitation, premature natural separation may occur before the wound has been sealed. Premature natural separation may also be termed sloughing, shedding, or flaking. Clinical management of premature natural separation may include reapplication of a skin related product, dressing application, bandage application, administering antibiotic, and administering fluids. A skin wound may be sealed by any means known in the art including but not limited to by growth of the subject's skin and by skin grafting. Reduced premature separation encompasses a decreased, lower, less frequent, diminished, smaller amount of natural separation of a skin related product before separation is desired by a medical practitioner. The reduced premature separation may relate to a lower number of complete, a lower number of partial premature separation events, and involvement of a smaller portion of the skin related product in a partial premature separation event than compared to a skin related product obtained from a wild-type pig. A skin related product of the instant application may also exhibit an increased, lengthened, improved, extended, or expanded attachment period. Use of a skin related product of the instant application may increase the duration of the attachment period.
[0076] A skin wound encompasses any injury to the integument including but not limited to an open wound, burn, laceration, ulcer, leg ulcer, foot ulcer, melanoma removal, cancer removal, plastic surgery, and bite.
[0077] By surgically attaching is intended joining, combining, uniting, attaching, fastening, connecting, joining or associating through any surgical method known in the art.
[0078] The efficiency of producing genetically modified pigs increases when SCNT is performed primarily with genetically modified cells. The process of making genetic modifications in pig cells is less than 100% efficient. Phenotypic sorting of targeted cells simplifies the process of isolating modified cells from the whole population of cells. Methods of phenotypic sorting include, but are not limited to, confocal microscopy, flow cytometry, Western blotting, RT-PCR, IB4 lectin binding and co-enrichment. It is understood that not all methods of phenotypic sorting are suitable for all genetic target modifications. Counter-selection with IB4 lectin binding is particularly useful for modifications of the Gal gene. Further counter-selection with IB4 lectin binding is particularly useful for multiple modifications, when at least one target is the Gal gene. In summary, xenoantigens Gal, Neu5Gc and a SLA were reduced by genetic modification. Transgenic products were produced within 5-10 months or less.
[0079] In embodiments of the present invention, cells are provided in which the Gal and CMAH genes and a SLA gene are rendered inactive, such that the resultant products can no longer generate alpha 1,3-galactosyl epitopes or Neu5Gc on the cell surface and have a reduced level of SLA epitopes on the cell surface. In an alternative embodiment, the Gal, CMAH and SLA genes can be inactivated in such a way that no transcription of the gene occurs. In an embodiment, cells are provided in which alpha-Gal and a SLA gene are rendered inactive and the cells express an HLA product.
[0080] In yet another aspect, the present invention provides a method for producing viable pigs lacking any functional expression of Gal, SLA and CMAH. In one embodiment, the pigs are produced as described below. Methods of making transgenic pigs, and the challenges thereto, are discussed in Galli et al. 2010 Xenotransplantation, 17(6) p. 397-410, incorporated by reference herein for all purposes. The methods and cell cultures of the invention are further detailed below.
[0081] The following Examples are offered for illustrative purposes only and are not intended to limit the scope of the present invention in any way. Indeed various modifications in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and the following examples and fall within the scope of the appended claims
EXAMPLES
Example 1
Design of Targeting Vectors
[0082] A CMAH Crispr construct with a sequence that is the reverse complement of a portion of the sequence listed in Ensemble transcript ENSSSCT00000001195 was created and utilized in the creation of a double transgenic product. A Gal Crispr construct with a sequence identical to a portion of that in the appropriate Ensemble transcript ENSSSCT00000006069 was created and utilized in the creation of a double transgenic product. Three SLA CRISPR constructs with sequences identical to a portion of the SLA Class I region were created and utilized in the creation of a transgenic product. SLA targeting sequences are shown in
[0083] Plasmid pX330-U6-Chimeric_BB_CBh_hSpCas9 (Addgene plasmid 42230) was used to clone the designed annealed oligonucleotides (
Example 2
Production of Transgenic Cells
[0084] Fetal fibroblast cells from a cloned pig with known class I SLA alleles were used in this study (See for example Reyes et al (2014), Tissue Antigens 84(5):484-488, herein incorporated by reference in its entirety). Fetal fibroblasts cultured in stem cell media (FFSCs) were resuspended and cultured in MEM- (Invitrogen, Carlsbad, Calif.)/EGM-MV (Lonza, Basel, Switzerland) media supplemented with 10% FBS (HyClone, Logan Utah), 10% horse serum (Invitrogen), 12 mM HEPES (Sigma-Aldrich, St. Louis Mo.), and 1% penicillin/streptomycin (Life Technologies, Grand Island N.Y.) and cultured in collagen-I-coated plates (Becton Dickinson, Bedford Mass.) at 38.5 C., 5% CO.sub.2 and 10% O.sub.2. The cells treated with SLA- specific gRNA and Cas9 contained a previously inactivated GGTA1 gene. SLA-expressing control cells were derived from GGTA1-deficient animals. The genetic backgrounds of the control and experimental animals are very similar, as they were cloned from cell originating from a single donor.
[0085] FFSC's were seeded in early passage (passage 2) onto six-well plates 24 hours before transfection. Cells were harvested and counted and 110.sup.6 cells were resuspended in 800 l fresh sterile electroporation buffer (75% cytosalt buffer: 120 mM KCl, 0.15 mM CaCl.sub.2, 10 mM K.sub.2HPO.sub.4 [pH 7.6], 5 mM MgCl.sub.2) and 25% Opti-Mem (Life Technologies). Cells were mixed with 2 g plasmid DNA in 4 mm cuvettes. Transfection was performed using the Gene Pulser Xcell (Bio-Rad, Hercules, Calif.) following the manufacturer's recommended protocols for mammalian cells. Treated cells were seeded onto six-well plates and grown until confluent. Cell screening was performed using a BD Accuri C6 flow cytometer (BD Biosciences, San Jose Calif.) using mouse anti-pig SLA class I-FITC Ab (AbD Serotec, Raleigh N.C.). Cells with low expression for SLA class I Ag were expanded and FACS was used at least twice with a FACSVantage SE. Representative results are shown in
Example 3
Flow Cytometry Analysis
[0086] For flow cytometry, porcine PBMCs were prepared using Ficoll-Paque Plus as described elsewhere (See Lutz et al, 2013 Xenotransplantation 20:27-35, herein incorporated by reference in its entirety). PBMC were stained with the following Abs: mouse anti-pig PerCP-Cy 5.5 CD3, PE CD4, FITC CD8 and mouse isotype control (BD Biosciences). Dead cells were excluded from analysis using fixable viability dye eFluor 660 (eBioscience, San Diego Calif.). Analysis was performed using an Accuri C6 flow cytometer and CFlow software (Accuri, Ann Arbor Mich.) and FlowJo software (TreeStar, Ashland Oreg.).
[0087] Primary kidney endothelial cells were isolated using 0.025% collagenase type IV from Clostridium histolyticum (Sigma-Aldrich) and cultured for 3 days in RPMI 1640 medium supplemented with 10% FBS and 100 g/ml endothelial cell growth supplement (BD Biosciences).
[0088] Fibroblasts were grown under the same conditions used to maintain fetal fibroblasts as described above.
Example 4
Evaluation of Response to Transgenic Xenograft
[0089] Porcine kidneys were obtained from GGTA1//hDAF transgenic pigs. hDAF is also known as CD55 Five rhesus macaques received donor kidneys following bilateral nephrectomy. Anti-pig IgG antibody titers were determined by flow cytometry analysis (xenograft crossmatch assay using GGTA1-/1 cells as targets) prior to transplant. Four of the five animals had low anti-pig IgG titers. T cells were depleted by treating the recipient monkeys with one dose anti-CD4/anti-CD8. Costimulation blockade was performed using either Fc-intact anti-CD154 (5C8, n=3) or belatacept (n=2). Monkeys were treated with MMF and steroids as well. The monkey with a high titer of non-Gal antibody exhibited excellent initial graft function and normal platelet counts but developed acute humoral rejection with profound thrombocytopenia (platelet count dropped from above 300,000 to less than 10,000), graft interstitial hemorrhage, and significant IgG and IgM deposition on glomerular capillaries. The two monkeys with low initial anti-pig IgG titers treated with anti-CD154 maintained normal renal function platelet counts up to at least 35 days post transplant. Of the two monkeys treated with belatacept, both maintained normal platelet counts but one monkey rejected the graft at post-operative day 14. The second belatacept treated monkey exhibited elevated creatinine post-transplant and histology indicated a T-cell infiltrate with arteritis, consistent with rejection. Results from one such experiment are shown in
Example 5
SLA Class I / Pigs
[0090] A SLA class I locus was targeted for genome editing. Porcine fetal fibroblasts were transfected with sgRNA targeted to SLA1 and Gal as described above herein according to the manufacturer's instructions. Selected treatments were used for SCNT.
[0091] SCNT was performed using in vitro matured oocytes (De Soto Biosciences Inc, St. Seymour Tenn. and Minitube of America (Mount Horeb, Wis.) as described in Estrada et al (2007) Cloning Stem Cells 9:229-236, herein incorporated by reference. Cumulus cells were removed from the oocytes by pipetting in 0.1% hyaluronidase. Oocytes with normal morphology and a visible polar body were selected and incubated in manipulation media (calcium-free NCSU-23 with 5% fetal bovine serum (FBS) containing 5 g/ml bisbenzimide and 7.5 g/ml cytochalasin B for 15 minutes. Following this incubation period, oocytes were enucleated by removing the first polar body and metaphase II plate. Single cells of site targeted SLA class I/ cells were injected into each enucleated oocyte. Electrical fusion was induced with a BTX electroporator (Harvard Apparatus, Holliston Mass.). Enucleated oocytes injected with a cell (couples) were exposed to two DC pulses of 140 V for 50 s in 280 mM mannitol, 0.001 mM CaCl.sub.2 and 0.05 mM MgCl.sub.2. After activation the oocytes were placed in NCSU-23 medium with a 0.4% bovine serum albumin (BSA) and incubated at 38.5 C., 5% CO.sub.2 in a humidified atmosphere for less than one hour. Within an hour after activation, oocytes were transferred into a recipient pig. Two hundred eleven cloned embryos were transplanted into two recipient pigs.
[0092] Recipient pigs were synchronized occidental pigs on their first day of estrus. One of the pigs became pregnant. Pregnancies were verified by ultrasound approximately day 25 or day 26 after embryo transfer. Thirty-two days after embryo transfer, three fetuses were collected. Two fetuses were well-formed and used to create fibroblast cultures. The fibroblasts were stained with a negative isotype control or with an antibody specific for class I SLA. Results from one such experiment are shown in
Example 6
Genotype Analysis of SLA Class I/ Products
[0093] Genomic DNA was isolated from pig cells using the Qiamp DNA minikit (Qiagen). RNA samples were isolated using the RNeasy Plus mini kit (Qiagen) following the manufacturer's protocol. RNA quality and quantity were affirmed by Agilent bioanalyzer analysis. RNA samples were reverse transcribed using a OneStep RT-PCR kit. PCR products were purified and ligated into the pCR4-TOPO TA (Invitrogen). Transformed bacteria were plated on Luria-Bertani agar containing 50 g/ml kanamycin for clone selection. Plasmids were isolated using the QIAprep Spin Miniprep kit (Qiagen). Nucleotide sequences were performed by the Sanger method using custom sequencing service and the primers indicated in
Example 7
SLA Class II/ Fetal Fibroblasts
[0094] Primary swine fetal fibroblasts were obtained. The fetal fibroblasts were treated with gRNA specific for SLA-DQ or SLA-DR. SLA-DQ and SLA-DR are class II SLA molecules. Cells not treated with gRNA and Cas9 were used as positive controls. Transfected and untreated cells were treated with interferon to induce expression of SLA Class II molecules. Expression of SLA class II in interferon treated cells was analyzed by flow cytometry. Results from one such experiment are shown in
Example 8
Analysis of Xenoantigen Impact on Antibody Binding
[0095] GGTA/, SLA Class 1/ double transgenic pigs have been made. A corresponding double transgenic immortalized renal endothelial cell line is produced from the double transgenic pigs. The double transgenic immortalized renal cell line is used as the background for testing of additional gene deletions. Each triple transgenic cell line is assessed using the flow-cytometry based xeno-crossmatch assay to quantify the impact of deleting the additional gene on antibody binding. Sera from several rhesus macaques (n=10) are used to generate an antibody binding profile. A cell line lacking only the GGTA1 and SLA class I is used as a control. Changes in antibody binding are analyzed using a paired t-test.
Example 9
IB4 Counterselection of Triple Transgenics
[0096] Cells are transfected with three sets of targeting constructs (Gal, SLA and CMAH). Cells are selected with IB4, a substance that binds Gal. The bulk population of cells that survive IB4 counterselection are used directly in SCNT to make pregnant pigs. Fetuses are collected and analyzed. Fetal fibroblasts are obtained from one such fetus and used in SCNT.
Example 10
Production of Transgenic Pigs (Triple)
[0097] Somatic cell nuclear transfer (SCNT) is performed using in vitro matured oocytes (DeSoto Biosciences Inc., St. Seymour Tenn. and Minitube of America (Mount Horeb Wis.). Cumulus cells are removed from the oocytes by pipetting in 0.1% hyaluronidase. Oocytes with normal morphology and a visible polar body are selected and incubated in manipulation media (calcium-free NCSU-23 with 5% fetal bovine serum (FBS) containing 5 g/ml bizbenzimide and 7.5 g/ml cytochalasin B for 15 minutes. Following this incubation period, oocytes are enucleated by removing the first polar body and metaphase II plate. For the triple transgenic pigs, single cells of site-targeted liver derived cells (LDC) that survive IB4 counterselection are injected into each enucleated oocyte. Electrical fusion is induced with a BTX electroporator (Harvard Apparatus, Holliston Mass.). Enucleated oocytes injected with a cell (couples) are exposed to two DC pulses of 140 V fo 50 s in 280 mM mannitol, 0.001 mM CaCl.sub.2 and 0.05 mM MgCl.sub.2. After activation the oocytes are placed in NCSU-23 medium with 0.4% bovine serum albumin (BSA) and incubated at 38.5 C., 5% CO.sub.2 in a humidified atmosphere for less than one hour. Within an hour after activation, oocytes are transferred into a recipient pig. Recipient pigs are synchronized occidental pigs on their first day of estrus. Pregnancies are verified by ultrasound at day 25 or day 26 after embryo transfer. Fetal fibroblasts are taken from one triple transgenic fetus for SCNT. Other pregnancies are allowed to culminate in the production of viable liters of genetically modified pigs.
[0098] All animals used in this study are approved by the Institutional Biosafety Committee (IBC) and Institutional Animal Care and Use Committee (IACUC).
Example 11
Ex Vivo Perfusion of Human Platelets Through Transgenic Liver
[0099] A triple transgenic GGTA1/CMAH/SLA pig is anesthetized and intubated. A midline abdominal incision is made. The liver is removed and placed in a perfusion device under normothermic conditions. A continuous perfusion circuit contains a heated buffer reservoir, three pumps (1, continuous venous return; 2 pulsatile arterial supply; 3 continuous portal vein supply), an oxygenator (O.sub.2), two bubble traps (BT) and flow (F) and pressure (P) monitors. The system is computer controlled to maintain perfusion with specific parameters. A diagram of an ex vivo perfusion device is shown in
[0100] Human platelets are obtained from healthy volunteer subjects or purchased commercially less than six days from isolation and are stored at 20-24 C. Approximately 110.sup.11 human platelets are washed in sterile phosphate buffered saline (PBS) containing the anti-coagulant citrate dextrose. Platelets may be labeled with CFSE according to the manufacturer's protocol.
[0101] Pig livers are perfused two hours prior to the addition of platelets. Platelet samples are obtained prior to addition to the perfusion system and after the addition of the platelets at pre-determined time points. Platelet levels in the pre-perfusion and post-perfusion samples are evaluated. Pre and post-perfusion evaluation of the pig liver are performed. Wild-type pig livers are obtained, and the livers are perfused under similar conditions.
Example 12
Evaluation of Response to a Transgenic Xenograft
[0102] Porcine livers are obtained from a triple transgenic pig (Gal, CMAH, SLA). The livers are surgically transplanted into a recently deceased human cadaver using the piggyback method. After the surgery, biological samples are obtained from the human cadaver. Clinical indicia of a rejection related response are monitored.
Example 13
Evaluation of Response to a Transgenic Xenograft
[0103] Porcine kidneys are obtained from a triple transgenic pig (Gal, CMAH, SLA). A highly sensitize human subject is administered compounds to manage preexisting and de novo donor-specific antibodies. The porcine kidneys are surgically transplanted into the subject. After the surgery, biological samples are obtained from the human cadaver. Clinical indicia of a graft rejection are monitored.
Example 14
Confocal Microscopy Analysis
[0104] Piglets (triple GGTA1, CMAH, SLA transgenics, wild type or other piglets of interest) are euthanized. Liver, heart and kidney tissue are obtained from the pig. Frozen sections of each tissue are prepared. Mounted tissues are blocked in Odyssey blocking buffer (Li-Cor Biosciences, Lincoln Nebr.) in HBSS for one hour. The slides are fixed in 4% paraformaldehyde for 10 minutes. Tissues are stained with IB4 lectin Alexa Fluor 647 (Invitrogen, Grand Island N.Y.) to visualize the presence of the Gal epitope. To visualize the Neu5Gc epitope, tissues are stained with a chicken anti-Neu5Gc antibody or with a control antibody (Sialix, Vista Calif.) for an hour. Tissues are washed three times with HBSS. Donkey anti-chicken Dylight 649 (Jackson ImmunoResearch Laboratories Inc, West Grove Pa.) secondary antibody is incubated with the tissue for approximately an hour. Tissues are washed three times with 0.1% HBSS Tween. To stain the nucleus, DAPI stain (Invitrogen, Grand Island N.Y.) is added to all the slides for 1 minute followed by two 0.1% HBSS Tween washes. Tissues are mounted in ProLong Gold (Invitrogen, Grand Island N.Y.). Confocal microscopy is performed using an Olympus FV1000.
Example 15
Crossmatch of Human Sera with Transgenic PBMCs
[0105] Porcine whole blood from transgenic (triple GGTA-1/SLA/CMAH for example) and wild-type pigs are collected in ACD. Porcine peripheral blood monocytes (PBMCs) are prepared from the whole blood using Ficoll-Paque Plus. Cell viability is assessed microscopically with Trypan Blue. Sera are obtained from healthy human volunteers. Twenty-five percent heat inactivated serum is prepared. Approximately 210.sup.6/ml porcine PBMCs are incubated with each human serum sample for two hours at 4 C. After incubation of the serum and PBMCs, the PBMCs are washed three times in 0.5% PBS Sialix Blocking agent. PBMCs are stained with DyLight 649-conjugated donkey anti-human IgM or DyLight 488 donkey anti-human IgG (Jackson Immunoresearch Laboratories Inc., West Grove Pa.) for 1 hour at 4 C. PBMCs are washed three times using 0.5% PBS Sialix blocking agent. Analyses are performed using an Accuri C6 flow cytometer and BD CFlow Plus Software (Accuri, Ann Arbor Mich.). Overlays are produced using Kaluza software from Beckman Coulter (Brea Calif.).
Example 16
Antibody-Mediated Complement-Dependent Cytotoxicity
[0106] Antibody-mediated complement dependent cytotoxic assays are known in the art. A method of Diaz et al (Diaz et al., 2004 Transplant Immunology 13(4):313-317) is performed. Human serum is obtained from healthy volunteers. Twenty-five percent heat inactivated serum is prepared. Heat-inactivated human sera are serially diluted and 100 l of each concentration is placed in a 96 well v-bottom assay plate. The sera is mixed with a 100 l aliquot of PBMC obtained from a pig of interest (GGTA1/CMAH/SLA triple or other). PBMC final concentrations are either 510.sup.6/ml or 110.sup.6/ml. Serum concentrations vary from 50%, 17%, 2%, 0.6%, 0.2%, and 0.07%. The mixtures are incubated for 30 minutes at 4 C. After 30 minutes, the plates are centrifuged for 4 minutes at 400g. The plates are decanted and washed with HBSS. Rabbit complement (150 l of a 1:15 dilution) is added to each well and incubated for 30 minutes at 37 C. PBMC are labeled with a fluorescein diacetate (FDA) stock solution, prepared fresh daily in HBSS (1 g/ml) from a 1 mg/ml stock solution in acetone and with propidium iodide (PI), prepared at 50 g/ml in phosphate buffered saline (PBS). After incubation in complement, the samples are transferred by pipette to tubes containing 250 l of HBSS and 10 l of FDA/PI for analysis using an Accuri C6 flow cytometer.
[0107] The percentage of dead cells (PI+/FDA), damaged cells (PI+/FDA+) and live cells is determined. Double negative events (PI/FDA) are excluded from calculations. The percentage of cytotoxicity in cells not exposed to serum is considered spontaneous killing. Values for cytotoxicity are corrected for spontaneous killing.
Example 17
Porcine Liver Procurement
[0108] Pigs are premedicated, intubated and anesthetized with propofol and placed in the supine position. A midline incision to the abdomen is made. Ligamentous attachments to the liver are taken down. The portal vein and hepatic artery are cannulated and flushed with 2 liters of cold histidine-tryptophan-ketoglutarate solution (Essential Pharmaceuticals, LLC). Livers are removed from pigs and stored in histidine-tryptophan-ketoglutarate solution on ice at 4 C. until being placed in a liver perfusion circuit. Cold-ischemia time varies between 45 minutes to 3 hours. In certain experiments porcine livers may be obtained from abbatoirs. Porcine livers from abbatoirs are flushed with histidine-tryptophan-ketoglutarate solution containing heparin (2000 U/L) within two minutes of exsanguinations.
Example 18
Assessment of Impact of Expression of Rhesus Class I and II
[0109] Porcine cells expressing MamuA01 as described above herein are evaluated for an impact on T cell proliferation and NK and T cell mediated cytotoxicity using standard assays.
Example 19
Assessment of Gene Deletion on the Cellular Immune Response to Xenograft
[0110] Cells are obtained from class I, class II or combined class I/II gene transgenic pigs. The T-cell proliferative response is assessed in vitro using a flow-cytometry based CFSE MLR assay. The T-cell mediated cytotoxicity of combined class I/II transgenic pig cells are evaluated in flow-based T cell cytotoxicity assays using CD107a as a measurement of degranulation and vital dyes to detect pig target cell killing. See Chan & Kaur. 2007 J. Immunol Methods 325:20-34 and Kitchens et al (2012) Am J. Transplant 12:69-80, herein incorporated by reference in their entirety. Cytolytic activity is calculated based on the percent of CD107a+ cells; cell subsets are characterized as CD4+ and CD8+ T cells, CD3-CD16+ NK cells. Proliferation and killing assay results are considered when deciding which deletion pigs to use as pig donors.
Example 20
Kidney Xenograft in NHP
[0111] Recipient non-human primates (NHP) are treated with one dose of anti-CD4/anti-CD8, anti-CD154/anti-CD28 dAbs, MMF and steroids. Rhesus macaques (Macaca mulatta) are used as the NHP. In some experiments, macaques may be 3-5 years old and less than 6 kg. Transgenic porcine kidneys (or wildtype control kidneys) are transplanted into the NHP recipients. Samples (blood, urine and kidney biopsy samples) are collected at defined time points for analysis. Renal function, serum creatinine, the presence and quantity of xenoantibodies (flow cytometry and multi-parameter flow cytometry), cytokine secretion, transcript profiles from peripheral blood, urine and graft biopsies, xenograft histology and development of anti-pig antibody (flow-based xenocrossmatch assay) are followed. The CMAH deletion is not helpful for study in NHP. For NHP studies, pigs with a wild-type CMAH gene are used. Ultrasound guided needle biopsies are performed at 2, 5 and 10 weeks post transplant.
Example 21
Veterinary Care of NHP
[0112] NHP are housed in individual cages and provided with clean, adequately sized living quarters; fed twice daily; and are checked at least twice daily by animal care technicians and once daily by clinical veterinary staff. Physical examinations are performed each time an animal is anesthetized for blood collection or other procedures.
Example 22
NHP Phlebotomy and Tissue Sampling
[0113] Phlebotomy and tissue sampling (for example: blood collections, lymph node biopsies and bone marrow aspirates) of NHP's are performed either under ketamine (10 mg/kg) or Telazol (4 mg/kg) anesthesia on fasting animals. Buprenephrine (0.01 mg/kg every 6 hrs) is administered as post-operative analgesia for animals undergoing renal transplant and as needed as determined by the attending veterinarian. Animals are monitored for irreversible critical illness such as but not limited to loss of 25% of body weight from baseline; complete anorexia for 4 days; major organ failure or medical conditions unresponsive to treatment such as respiratory distress, icterus, uremia, intractable diarrhea, self-mutilation or persistent vomiting, and surgical complications unresponsive to immediate intervention: bleeding, vascular graft/circulation failure, infection and wound dehiscence.
Example 23
Porcine Embryo Transfer Surgery, Phlebotomy and Harvesting Procedures
[0114] Embryo transfer surgery: Before surgery, the sow is anesthetized with TKX (Telazol (500 mg)+Ketamine (250 mg) and Xylazine (250 mg); 1 cc per 50 lbs, IM) for intubation plus isoflurane by inhalation through ET tube using a precision vaporizer and waste gas scavenging. During the recovery period, animals are monitored at least once every 15 minutes and vital signs (temperature, heart rate, respiration rate and capillary refill time) are assessed and recorded. Trained animal care technicians or veterinarians monitor the animals until they can maintain themselves in voluntary sternal recumbrance. Animals are returned to regular housing areas upon approval by the attending veterinarian. Post-operative analgesics include buprenorphine 0.01-0.05 mg/kg IM every 8-12 hours or carprofen 2-4 mg/kg SC daily. Approximately 26 days after embryo transfer, ultrasound is performed to confirm establishment of pregnancy while the sow is distracted by food. About 10 days later a second ultrasound is performed. Birth occurs through natural parturition unless clinical difficulty arises. Caesarian section is performed recommended by the veterinary staff. Standard caesarian section protocols are used with the general anesthesia protocol utilized in the embryo transfer surgery. Experimental piglets are cleaned and the umbilical cord is disinfected. Every piglet receives colostrum during the first hours after birth. Piglets are watched 24/7 until they are at least 7 days old. Farrowing crates are used to protect the piglets from their mother while maintaining the piglets ability to nurse.
[0115] All phlebotomy is performed under either ketamine (10 mg/k) or Telazol (4 mg/kg) anesthesia on fasting animals. Organ harvesting, a terminal surgical procedure, uses the anesthesia protocol (Telazol (500 mg)+ketamine (250 mg)+xylazine (250 mg); 1 cc per 50 lbs; IM)+/ pentothal (10-20 mg/kg) IV if needed for intubation and isoflurane by inhalation through ET tube using a precision vaporizer, to effect with waste gas scavenging. Swine are perfused with saline followed by removal of the heart and other tissue/organs. Alternatively swine are anesthetized with inhaled anesthetic and treated with a barbituric acid derivative (100-150 mg/kg) and a bilateral pneumothorax is performed.
Example 24
SLA Class I and II/ Pigs
[0116] Fetal fibroblasts are obtained from GGTA1/ (Gal null) swine. sgRNA and Cas9 are used to target SLA class I and class II genes (SLA-1, SLA-2, SLA-3, SLA-DQ or SLA-DR) in the GGTA1/ fetal fibroblasts. In some embodiments fetal fibroblasts are obtained from wildtype swine; sgRNA and Cas9 are used to target SLA class I, class II genes (SLA-1, SLA-2, SLA-3, SLA-DQ or SLA-DR) and GGTA1. Wildtype fetal fibroblasts treated with sgRNA and Cas9 targeted to GGTA1 are counter-selected for lectin binding. Transfected nuclei are transferred into enucleated oocytes and implanted in a receptive sow. In some instances, fetuses are harvested after thirty days. Cells are isolated from well-developed fetuses, amplified and directly used in re-cloning to generate cloned animals. Some amplified fetal cells are frozen and stored in liquid nitrogen. T cell xenoreactivity will be assessed through assays such as but not limited to the CFSE MLR assay. In the CFSE MLR assay, PBMC from rhesus macaques are incubated with PBMC's from pigs of the indicated genetic background. Dilution of CFSE will assess proliferation in CD4+ and CD8+ T cell subsets. T-cell proliferation inhibitors may or may not be used in CFSE MLR assays.
Example 25
Liver Xenograft in NHP
[0117] Rhesus macaques are treated with either an anti-CD28 dAb based immunosuppressive regimen (T cell depletion using anti-CD4/anti-CD8, single dose), anti-CD28 dAb, MMF and steroids; an anti-CD154 dAb based immunosuppressive regimen (T cell depletion using anti-CD54/anti-CD8, single dose, anti-CD154 dAb, MMF and steroids) or both regimens. Livers from transgenic pigs are transplanted into rhesus macaques treated with the indicated immunosuppressive regimen. Liver biopsies are performed at 1 hour, 1 week, 4 weeks and at times of liver graft dysfunction. Laboratory assessments include CBC with platelet count and coagulation studies; liver function tests are obtained at 6 hours after transplant, every other day for 1 week and then twice weekly as well as at any time of clinical deterioration. Rejection is characterized using standard diagnostic criteria and immunohistochemistry. NHPs express CMAH, thus the CMAH deletion is not helpful in NHP studies. Some NHP studies are performed with wildtype CMAH pig tissues.
Example 26
Transgenic Pigs Expressing PD-L1, Rhesus Class I Molecules or CD47 Molecules
[0118] PD-L1 is the ligand for PD-1 (programmed death-1), a potent T cell co-inhibitory molecule. The rhesus PD-L1 gene is used with sgRNA and Cas9 to generate Gal/, ASGR1/, PD-L1 and Gal/, ASGR1/, CMAH/, PD-L1 expressing pig LSEC's and transgenic Gal/, ASGR1/, PD-L1 and Gal/, ASGR1/, CMAH/, PD-L1 expressing pigs. The rhesus PD-L1 gene is used with sgRNA and Cas9 to generate Gal/, SLA/, PD-L1 expressing pig LSEC's and transgenic Gal/, SLA/, PD-L1 expressing pigs. Mamu A01 and Mamu E (Mamu-E-HLA-E) are two rhesus class I molecules. Gal/, ASGR1/, and either Mamu A01, Mamu E, or both pigs are created. The human CD47 (hSIRP) is used with sgRNA and Cas9 to create Gal/, SLA/, CD47 expressing pigs. Transgenes to be expressed are cloned behind appropriate promoters such as, but not limited to, RSV, CMV, elF-1 or class I MHC promoters and are flanked by endogenous swine DNA sequences. The flanked transgenes are introduced into cells and simultaneously treated with CRISPR/Cas9. The DNA regions flanking the gRNA binding sites are amplified by PCR. The PCR products are cloned into vectors and sequenced.
Example 27
Transfection of SLA I Alleles and Flow Cytometry Analysis
[0119] On the day prior to transfection, renal endothelial cells were plated on attachment factor (Gibco Life Technologies) in six-well cluster culture plates in RPMI-1640 supplemented with 10% v/v heat-inactivated FBS, 100 micrograms/mL endothelial cell growth supplement (Corning Life Sciences), and 10 mM HEPES. Cells were allowed to recover for 24 hours prior to transfection. The following day, cells were washed and fresh culture media was replaced four hours prior to transfection. DNA was complexed for transfection using Lipofectamine 2000CD (Invitrogen) using 2 micrograms of DNA per well at a ratio of 2:1 of microliters of lipid to micrograms of DNA. Cells were transfected at 80-90% confluency per manufacturer instructions. Cells were then subcultured until flow cytometric analysis.
[0120] On Days 6-10 post-transfection, cells were harvested and counted using a hemacytometer. Cells were then resuspended at a density of two million cells per milliliter of PBS containing 0.5% w/v BSA and 0.1% v/v sodium azide. Cells were incubated on ice for 30 min prior to staining. Cells were then transferred to 5 mL polypropylene culture tubes and stained with either mouse IgG.sub.1 FITC (AbD Serotec), SLA I FITC (AbD Serotec), mouse IgG.sub.1 PE (Santa Cruz Biotechnology), or B2M PE (Santa Cruz Biotechnology) at a ratio of one microgram antibody to one million cells. Cells were stained for 30 minutes on ice, washed, and analyzed on an Accuri C6 cytometer (BD Biosciences). Event limits were set at 10,000 in forward and side scatter gate. Results of one such series of experiments are shown in
[0121] The invention is not limited to the embodiments set forth herein for illustration but includes everything that is within the scope of the claims. Having described the invention with reference to the exemplary embodiments, it is to be understood that it is not intended that any limitations or elements describing the exemplary embodiments set forth herein are to be incorporated into the meanings of the patent claims unless such limitations or elements are explicitly listed in the claims. Likewise, it is to be understood that it is not necessary to meet any or all of the identified advantages or objects of the invention disclosed herein in order to fall within the scope of any claims, since the invention is defined by the claims, and since inherent and/or unforeseen advantages of the present invention may exist even though they may not be explicitly discussed herein.
[0122] Furthermore all references cited herein are hereby incorporated by reference in their entirety and for all purposes as if fully set forth herein.