Yeast strain and microbial method for production of pentacyclic triterpenes and/or triterpenoids
10011838 ยท 2018-07-03
Inventors
Cpc classification
C12N9/0071
CHEMISTRY; METALLURGY
C12P5/007
CHEMISTRY; METALLURGY
C12Y106/02004
CHEMISTRY; METALLURGY
International classification
C12P5/00
CHEMISTRY; METALLURGY
Abstract
The invention relates to a yeast strain and to a method for microbial production of pentacyclic triterpenes and/or triterpenoids in yeast. More particularly, the invention relates to a modified yeast strain for production of pentacyclic triterpenoids comprising at least one copy of a gene for encoding an oxidosqualene cyclase, at least one copy of a gene for encoding an NADPH-cytochrome P450 reductase and/or at least one copy of a gene for encoding a cytochrome P450 monooxygenase.
Claims
1. A modified yeast strain for production of pentacyclic triterpenoids, comprising: i. at least one copy of a gene for encoding an oxidosqualene cyclase, wherein the oxidosqualene cyclase has an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 55; ii. at least one copy of a gene for encoding a NADPH-cytochrome P450 reductase, wherein the NADPH-cytochrome P450 reductase has an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 66, 68 or 69; and iii. at least one copy of a gene for encoding a cytochrome P450 monooxygenase, wherein the cytochrome P450 monooxygenase has an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 83, 84 or 88.
2. The modified yeast strain according to claim 1, wherein the oxidosqualene cyclase has an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 55; wherein the NADPH-cytochrome P450 reductase has an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 66; and wherein the cytochrome P450 monooxygenase has an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 83.
3. The modified yeast strain according to claim 1, wherein the oxidosqualene cyclase has an amino acid sequence of SEQ ID NO: 55; wherein the NADPH-cytochrome P450 reductase has an amino acid sequence of SEQ ID NO: 66; and wherein the cytochrome P450 monooxygenase has an amino acid sequence of SEQ ID NO: 83.
4. The modified yeast strain according to claim 1, wherein the oxidosqualene cyclase has an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 55; wherein the NADPH-cytochrome P450 reductase has an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 66; and wherein the cytochrome P450 monooxygenase has an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 84.
5. The modified yeast strain according to claim 1, wherein the oxidosqualene cyclase has an amino acid sequence of SEQ ID NO: 55; wherein the NADPH-cytochrome P450 reductase has an amino acid sequence of SEQ ID NO: 66; and wherein the cytochrome P450 monooxygenase has an amino acid sequence of SEQ ID NO: 84.
6. The modified yeast strain according to claim 1, wherein the oxidosqualene cyclase has an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 55; wherein the NADPH-cytochrome P450 reductase has an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 66; and wherein the cytochrome P450 monooxygenase has an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 88.
7. The modified yeast strain according to claim 1, wherein the oxidosqualene cyclase has an amino acid sequence of SEQ ID NO: 55; wherein the NADPH-cytochrome P450 reductase has an amino acid sequence of SEQ ID NO: 66; and wherein the cytochrome P450 monooxygenase has an amino acid sequence of SEQ ID NO: 88.
8. The modified yeast strain according to claim 1, wherein the oxidosqualene cyclase has an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 55; wherein the NADPH-cytochrome P450 reductase has an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 68; and wherein the cytochrome P450 monooxygenase has an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 83.
9. The modified yeast strain according to claim 1, wherein the oxidosqualene cyclase has an amino acid sequence of SEQ ID NO: 55; wherein the NADPH-cytochrome P450 reductase has an amino acid sequence of SEQ ID NO: 68; and wherein the cytochrome P450 monooxygenase has an amino acid sequence of SEQ ID NO: 83.
10. The modified yeast strain according to claim 1, wherein the oxidosqualene cyclase has an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 55; wherein the NADPH-cytochrome P450 reductase has an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 68; and wherein the cytochrome P450 monooxygenase has an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 84.
11. The modified yeast strain according to claim 1, wherein the oxidosqualene cyclase has an amino acid sequence of SEQ ID NO: 55; wherein the NADPH-cytochrome P450 reductase has an amino acid sequence of SEQ ID NO: 68; and wherein the cytochrome P450 monooxygenase has an amino acid sequence of SEQ ID NO: 84.
12. The modified yeast strain according to claim 1, wherein the oxidosqualene cyclase has an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 55; wherein the NADPH-cytochrome P450 reductase has an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 68; and wherein the cytochrome P450 monooxygenase has an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 88.
13. The modified yeast strain according to claim 1, wherein the oxidosqualene cyclase has an amino acid sequence of SEQ ID NO: 55; wherein the NADPH-cytochrome P450 reductase has an amino acid sequence of SEQ ID NO: 68; and wherein the cytochrome P450 monooxygenase has an amino acid sequence of SEQ ID NO: 88.
14. The modified yeast strain according to claim 1, wherein the oxidosqualene cyclase has an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 55; wherein the NADPH-cytochrome P450 reductase has an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 69; and wherein the cytochrome P450 monooxygenase has an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 83.
15. The modified yeast strain according to claim 1, wherein the oxidosqualene cyclase has an amino acid sequence of SEQ ID NO: 55; wherein the NADPH-cytochrome P450 reductase has an amino acid sequence of SEQ ID NO: 69; and wherein the cytochrome P450 monooxygenase has an amino acid sequence of SEQ ID NO: 83.
16. The modified yeast strain according to claim 1, wherein the oxidosqualene cyclase has an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 55; wherein the NADPH-cytochrome P450 reductase has an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 69; and wherein the cytochrome P450 monooxygenase has an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 84.
17. The modified yeast strain according to claim 1, wherein the oxidosqualene cyclase has an amino acid sequence of SEQ ID NO: 55; wherein the NADPH-cytochrome P450 reductase has an amino acid sequence of SEQ ID NO: 69; and wherein the cytochrome P450 monooxygenase has an amino acid sequence of SEQ ID NO: 84.
18. The modified yeast strain according to claim 1, wherein the oxidosqualene cyclase has an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 55; wherein the NADPH-cytochrome P450 reductase has an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 69; and wherein the cytochrome P450 monooxygenase has an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 88.
19. The modified yeast strain according to claim 1, wherein the oxidosqualene cyclase has an amino acid sequence of SEQ ID NO: 55; wherein the NADPH-cytochrome P450 reductase has an amino acid sequence of SEQ ID NO: 69; and wherein the cytochrome P450 monooxygenase has an amino acid sequence of SEQ ID NO: 88.
20. The modified yeast strain according to claim 1, wherein the strain is capable of producing betulin with an intracellular concentration of more than 1 mg per gram of dry biomass.
21. The modified yeast strain according to claim 1, wherein the strain is capable of producing betulin with an intracellular concentration of more than 3 mg per gram of dry biomass.
22. The modified yeast strain according to claim 1, wherein the strain is capable of producing betulin with an intracellular concentration of more than 10 mg per gram of dry biomass.
23. The modified yeast strain according to claim 1, wherein the strain is capable of producing betulin with a concentration of more than 50 mg per liter of culture medium.
24. The modified yeast strain according to claim 1, wherein the strain is capable of producing betulin aldehyde with an intracellular concentration of more than 1 mg per gram of dry biomass.
25. The modified yeast strain according to claim 1, wherein the strain is capable of producing betulin aldehyde with an intracellular concentration of more than 2 mg per gram of dry biomass.
26. The modified yeast strain according to claim 1, wherein the strain is capable of producing betulin aldehyde with an intracellular concentration of more than 3 mg per gram of dry biomass.
27. The modified yeast strain according to claim 1, wherein the strain is capable of producing betulin aldehyde with a concentration of more than 25 mg per liter of culture medium.
28. The modified yeast strain according to claim 1, wherein the strain is capable of producing betulinic acid with an intracellular concentration of more than 1 mg per gram of dry biomass.
29. The modified yeast strain according to claim 1, wherein the strain is capable of producing betulinic acid with an intracellular concentration of more than 2 mg per gram of dry biomass.
30. The modified yeast strain according to claim 1, wherein the strain is capable of producing betulinic acid with an intracellular concentration of more than 5 mg per gram of dry biomass.
31. The modified yeast strain according to claim 1, wherein the strain is capable of producing betulinic acid with a concentration of more than 25 mg per liter of culture medium.
32. The modified yeast strain according to claim 1, wherein the yeast strain comprises a tHMG1 expression cassette.
33. The modified yeast strain according to claim 1, wherein this strain is Saccharomyces cerevisiae.
34. The modified yeast strain according to claim 1, wherein the strain is a Saccharomyces cerevisiae GEN.PK, CEN.PK111-61A or AH22tH3ura8 strain.
35. A method for producing the modified yeast strain according to claim 1 comprising: a) providing a Saccharomyces cerevisiae strain, b) transforming the strain with a vector comprising a gene for encoding an oxidosqualene cyclase, wherein the oxidosqualene cyclase has an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 55; c) transforming the strain with a vector comprising a gene for encoding an NADPH-cytochrome P450 reductase, wherein the NADPH-cytochrome P450 reductase has an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 66, 68 or 69; and d) transforming the strain with a vector comprising a gene for encoding a cytochrome P450 monooxygenase, wherein the cytochrome P450 monooxygenase has an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 83, 84 or 88.
36. A method for producing a triterpene and/or triterpenoid, comprising cultivating the modified yeast strain according to claim 1 in a medium.
Description
(1)
(2)
(3) In order to ensure high conversion rates of the heterologous genes or the enzymes formed and thus also to ensure high titers of pentacyclic triterpenoids, a plurality of genes were tested for each heterologous enzyme reaction in different combinations for determination of the optimal genes and combination therewith with high productivity.
(4) The cyclic triterpenoids have been extracted from yeast and examined by means of GC-MS.
(5) Strain Construction
(6) The construction of the strains is based on the strain CEN.PK111-61A (MATalpha; ura3-52; leu2-3_112; TRP1; his3deltaI; MAL2-8C; SUC2) and also on the strain AH22tH3ura8 (Polakowski et al., 1998).
(7) TABLE-US-00024 TABLE 4 Overall view of the plasmids used for the strain construction CYP gene Plasmid name Marker OSC gene CPR gene CYP gene accession pTT1-leer URA3 pTT1-OEW URA3 OEW (Oe) pTT1-GuLUP1 URA3 GuLUP1 (Gu) pTT1-RcLUS1 URA3 RcLUS1 (Rc) pTT2-leer LEU2 pTT2-LjCPR1-A15 LEU2 LjCPR1 (Lj) CYP716A15 (Vv) AB619802 pTT2-LjCPR1-A17 LEU2 LjCPR1 (Lj) CYP716A17 (Vv) AB619803 pTT2-LjCPR1-A12 LEU2 LjCPR1 (Lj) CYP716A12 (Mt) DQ335781 pTT2-LjCPR1-AL1 LEU2 LjCPR1 (Lj) CYP716AL1 (Cr) JN565975 pTT2-LjCPR1-A9 LEU2 LjCPR1 (Lj) CYP716A9 (Pt) XM_002331391 pTT2-LjCPR1-B2 LEU2 LjCPR1 (Lj) Predicted: XM_003525274 Cytochrome P450 716B2-like (LOC100801007) (Gm) pTT2-LjCPR1-A41 LEU2 LjCPR1 (Lj) CYP716A41 (Bc) JF803813 pTT2-LjCPR1-B1 LEU2 LjCPR1 (Lj) Predicted: XM_004139039 cytochrome P450 716B1-like (Cs) pTT2-ATR1-AL1 LEU2 ATR1 (At) CYP716AL1 (Cr) JN565975 pTT2-ATR1-A15 LEU2 ATR1 (At) CYP716A15 (Vv) AB619802 pTT2-ATR1-A17 LEU2 ATR1 (At) CYP716A17 (Vv) AB619803 pTT2-ATR1-A9 LEU2 ATR1 (At) CYP716A9 (Pt) XM_002331391 pTT2-ATR1-B2 LEU2 ATR1 (At) Predicted: XM_003525274 Cytochrome P450 716B2-like (LOC100801007) (Gm) pTT2-CrCPR-AL1 LEU2 CrCPR (Cr) CYP716AL1 (Cr) JN565975 pTT2-CrCPR-A15 LEU2 CrCPR (Cr) CYP716A15 (Vv) AB619802 pTT2-CrCPR-A17 LEU2 CrCPR (Cr) CYP716A17 (Vv) AB619803 pTT2-CrCPR-A9 LEU2 CrCPR (Cr) CYP716A9 (Pt) XM_002331391 pTT2-CrCPR-B2 LEU2 CrCPR (Cr) Predicted: XM_003525274 Cytochrome P450 716B2-like (LOC100801007) (Gm) pTT2-MTR-A15 LEU2 MTR_3g100160 (Mt) CYP716A15 (Vv) AB619802 pTT2-MTR-A17 LEU2 MTR_3g100160 (Mt) CYP716A17 (Vv) AB619803 pTT2-MTR-A9 LEU2 MTR_3g100160 (Mt) CYP716A9 (Pt) XM_002331391 pTT2-MTR-B2 LEU2 MTR_3g100160 (Mt) Predicted: XM_003525274 Cytochrome P450 716B2-like (LOC100801007) (Gm) pTT2-MTR-A12 LEU2 MTR_3g100160 (Mt) CYP716A12 (Mt) DQ335781 pTT2-NCP1-A15 LEU2 NCP1 (Sc) CYP716A15 (Vv) AB619802 pTT2-NCP1-A17 LEU2 NCP1 (Sc) CYP716A17 (Vv) AB619803 pTT2-NCP1-A9 LEU2 NCP1 (Sc) CYP716A9 (Pt) XM_002331391 pTT2-NCP1-B2 LEU2 NCP1 (Sc) Predicted: XM_003525274 Cytochrome P450 716B2-like (LOC100801007) (Gm) Gu, Glycyrrhiza uralensis; Oe, Olea europaea; Rc Ricinus communis; Lj, Lotus japonicas; Cr, Catharanthus roseus; Vv, Vitis vinifera; Pt, Populus trichocarpa; Gm, Glycine max; Bc, Bupleurum chinense, Cs, Cucumis sativus; Mt, Medicago truncatula; At, Arabidopsis thaliana; Sc, Saccharomyces cerevisiae
(8) Gu, Glycyrrhiza uralensis; Oe, Olea europaea; Re Ricinus communis; Lj, Lotus japonicas; Cr, Catharanthus roseus; Vv, Vitis vinifera; Pt, Populus trichocarpa; Gm, Glycine max; Be, Bupleurum chinense, Cs, Cucumis sativus; Mt, Medicago truncatula; At, Arabidopsis thaliana; Sc, Saccharomyces cerevisiae
(9) TABLE-US-00025 TABLE 5 Overall view of the basic strains for the strain construction Name Genotype CEN.PK111-61A MATalpha; ura3-52; leu2-3_112; TRP1; his3delta1; MAL2-8C; SUC2 CEN.PK2U CEN.PK111-61A ura3::tHMG1 AH22tH3ura8 MATa; leu2-3,112; can1; ura3::tHMG1
Example 1: Overexpression of the Gene tHMG1 in the Gene Locus URA3
(10) The tHMG1-integration module (cADH1pr-tHMG1-TRP1t-loxP-kanMX-loxP) has been synthesized by GeneArt and cloned in a pMK vector by means of the restriction sites AseI and PacI. The tHMG1-gene (t=truncated) codes for a truncated HMG-CoA reductase, which consists only of the catalytic sub-unit of the protein consists and thus is no longer subject to the feedback inhibition by sterol intermediates. A pMK-vector with a kanamycin resistance was used. For the genomic integration the tHMG1 module from the pMK plasmid was amplified by means of PCR with the following primers:
(11) TABLE-US-00026 URA3_tHMG1_fw: 5ATGTCGAAAGCTACATATAAGGAACGTGCTGCTACTCATCCAGTCAG GCACCGTGTATGAAATC URA3_tHMG_rev: 5TTAGTITTGCTGGCCGCATCTICTCAAATATGCTTCCCAGGGATCTG ATATCACCTAATAACTTC
(12) The 4.5 kbp fragment contains the KanMX-marker (for the resistance of geneticin G418 in yeasts) flanked by loxP-sides (for the recovery of the marker), the tHMG1-gene under the control of a constitutive ADH1 promoter and TRP1 terminator as well as homologous sequences for the URA3 gene locus (the first and last 40 bp to the coding region of the URA3). The strain Saccharomyces cerevisiae CEN.PK111-61A was used for the transformation by means of homologous recombination at the gene locus URA3. After the transformation by means of the lithium-acetate method according to Gietz et al. (1992), the strain was plated for selection on YE agar plates with geneticin 418. The strain CEN.PK2U is constructed in this way.
(13) YE medium: 0.5% yeast extract; 2% glucose; pH 6.3. For agar plates 1.5% agar was added to the medium. The glucose is produced as a 40% glucose solution and autoclaved separately. After the autoclaving are being 25 ml glucose solution are added to the medium.
Example 2: Expression of the Gene GuLUP1 for the Production of Cyclic Triterpenes (for Example, Lupeol)
(14) The gene GuLUP1 optimized by GenScript codon was synthesized for the yeast and cloned in a pUC57 vector by means of the restriction site EcoRV. The pUC57 vector contains an ampicillin resistance gene and an origin of replication pMB1 for the replication in E. coli. For the cloning the gene GuLUP1 from the pUC57 plasmid was amplified by means of PCR with the following primers:
(15) TABLE-US-00027 GuLUP_SacI_fw: 5GACTGACTGAGCTCAAAAATGIGGAAATTAAAAATCGGTGAAGGTGGT GC GuLUP_NotI_rev: 5GACTGACTGCGGCCGCCTATTAGTAAGAATGGGCGCACAAGACTTGTC
(16) The amplified fragment has a size of 2.277 kbp.
(17) Simultaneously with this a gene cassette from GeneArt was synthesized and cloned in a pMA vector via the interface Kp. This gene cassette contains a CEN/ARS sequence for an autonomous replication in yeast, the URA3 selection marker for yeast, MR sequences (URA3 recovery by means of the selection on agar plates with 5-FOA) and flanked regions which are homologous with the integration locus 5YHRCdelta14 and enable the genomic integration the gene cassette into the integration locus 5YHRCdelta14. The pMA vector contains an ampicillin resistance gene as selection marker for E. coli and an origin of replication Col El for the replication in E. coli.
(18) The amplified fragment (gene: GuLUP1) was cloned by means of the restriction sites SacI and NotI in the pMA vector under the control of a ENO1 promoter and ENO1 terminator. The resulting plasmid is designated pTT1-GuLUP1.
(19) The plasmid was transformed into competent E. coli cells. The selection took place by means of ampicillin resistance on LB agar plates.
(20) LB medium: 1% casein peptone; 0.5% yeast extract; 1% NaCl; pH 7.0. For agar plates 1.5% agar was added to the medium.
(21) Antibiotic: Ampicillin (Boehringer, Mannheim) 100 g/ml
(22) The strain Saccharomyces cerevisiae CEN.PK2U from example 1 and the strain AH22tH3ura8 were used for the episomal transformation. After the transformation by means of the lithium-acetate method according to Gietz et al. (1992), the strains were plated for selection on WMVIII agar plates without uracil.
Example 3: Cultivation Conditions for the Evaluation of the Strains
(23) Standard cultivation of the yeast S. cerevisiae
(24) 1. Preculture: 20 ml WMVIII medium: (Lang and Looman, 1995) in a 100 ml Erlenmeyer flask 0.1% (v:v) from a glycerol stock were injected. The yeasts were cultured at 28 C. and 150 rpm for 72 hours on an orbital shaker.
(25) 2. Main culture: 50 ml WMVIII medium in a 250 ml baffled flask were injected from the preculture to a start value of OD.sub.600=0.5. The yeasts were cultured at 28 C. and 150 rpm for 72 hours on an orbital shaker.
(26) Strains having the genetic background of CEN.PK111-61A and CEN.PK2U are auxotrophic for uracil, histidine and leucine. Therefore, the medium was supplemented with uracil (100 mg/l), histidine (100 mg/l) and with leucine (400 mg/l). In order to exert a selection pressure on a transformed plasmid, the corresponding supplement in the medium was omitted.
(27) Strains having the genetic background of AH22tH3ura8 are auxotrophic for uracil, histidine and leucine. Therefore, the medium was supplemented with uracil (100 mg/l) and with leucine (400 mg/l). In order to exert a selection pressure on a transformed plasmid, the corresponding supplement in the medium was omitted.
(28) Components of WMVIII medium for 1 liter according to Lang and Looman, 1995: 250 mg NH.sub.4H.sub.2PO.sub.4; 2.8 g NH.sub.4Cl; 250 mg MgCl.sub.26H.sub.2O; 100 mg CaCl.sub.22H.sub.2O; 2 g KH.sub.2PO.sub.4; 550 mg MgSO.sub.47H.sub.2O; 75 mg mesa-inositol; 10 g Na-glutamate with the following change: 50 glucose instead of sucrose are produced as a 40% glucose solution and autoclaved separately.
(29) After the autoclaving 125 ml glucose solution, 1 ml sterile filtered trace elements and 4 ml sterile filtered vitamins are added to the medium.
(30) Trace elements: 1000 concentrated: 1.75 g ZnSO.sub.47 H.sub.2O; 0.5 g FeSO.sub.47 H.sub.2O; 0.1 g CuSO.sub.45 H.sub.2O; 0.1 g MnCl.sub.24 H.sub.2O; 0.1 g NaMoO.sub.42 H.sub.2O for 1 liter.
(31) Vitamin solution: 250 concentrated: 2.5 g nicotinic acid; 6.25 g pyridoxine; 2.5 g thiamine; 0.625 g biotin; 12.5 g Ca-pantothenate for 1 liter.
(32) For agar plates 1.5% agar was added to the medium.
(33) Medium supplements: Leucine (400 mg/l); histidine (100 mg/l); uracil (100 mg/l). The stock solutions are produced and sterile filtered with a concentration of 20 mg/ml.
Example 4: Growth and Productivity Analysis (Identification and Quantification of Cyclic Triterpenes)
(34) The cultivation is carried out according to example 3.
(35) Determination of the Dry Biomass (BTS)
(36) For determination of the dry biomass, two times 2 ml culture volume were transferred into previously conditioned and balanced 2 ml reaction vessels. The cells were centrifuged at 18620g for 5 minutes and washed with 1 ml water. Then the cell pellet was dried in a drying cabinet for 24 hours at 80 C. The samples cooled in the desiccator for 30 minutes before the weighing took place.
(37) Sample Preparation a) Yeast strains transformed with the genes for a OSC, CPR and CYP on a pTT1 and pTT2 plasmid: In a duplicate determination 800 l of culture broth of a main culture are transferred into a 2 ml reaction vessel. The extraction can be continued directly or the samples can also be frozen at 20 C. and extracted at a later time. b) Yeast strains transformed with the gene for a OSC on a pTT1 plasmid: In a duplicate determination 250 l of culture broth of a main culture are transferred into a 1.5 ml reaction vessel. The extraction can be continued directly or the samples can also be frozen at 20 C. and extracted at a later time.
(38) Extraction
(39) Yeast strains transformed with the genes for a OSC, CPR and CYP on a pTT1 and pTT2 plasmid: The extraction agent chloroform/methanol (4+1) is mixed with stigmasterol to a concentration of 50 g/ml. In the first step 800 l culture broth are admixed with 80 l 1M HCl, 250 l glass beads (0.4-0.6 mm) and 800 l extraction agent and then shaken for 20 minutes in the TissueLyser II at 30 Hz. After subsequent centrifugation for 5 minutes at 18000g the organic phase is transferred into a new 1.5 ml reaction vessel. The removed organic phase is vaporized under a vacuum (SpeedVac; 35 C.; 0.1 mbar; 30 minutes). The vaporized samples are dissolved in 100 l N-methyl-N-trimethylsilyltrifluoracetamide (MSTFA, Sigma) and transferred into brown GC vials provided with glass inserts. The samples are derivatized for 1 hour at 80 C. The prepared samples and thus the identification and the quantification of cyclic triterpenes were carried out by means of GC-MS.
(40) Yeast Strains Transformed with the Gene for a OSC on a pTT1 Plasmid:
(41) The extraction agent chloroform/methanol (4+1) is mixed with stigmasterol to a concentration of 50 g/ml. In the first step 250 l culture broth are admixed with 25 l 1M HCl, 250 l glass beads and 400 l extraction agent and then shaken for 20 minutes in the TissueLyser II at 30 Hz. After subsequent centrifugation for 5 minutes at 18000g, 250 l of organic phase are transferred into a new 1.5 ml reaction vessel. The removed organic phase is vaporized under a vacuum (SpeedVac; 35 C.; 0.1 mbar; 30 minutes). The vaporized samples are dissolved in 250 l chloroform and 100 l are transferred into brown GC vials provided with glass inserts. The prepared samples and thus the identification and the quantification of cyclic triterpenes were carried out by means of GC-MS.
(42) Production of the External Standard (ESTD)
(43) For quantitative determination of pentacyclic triterpenes such as, for example, lupeol and betulinic acid by gas chromatography, a series of dilutions is produced with the respective substances. The ESTDs, like the samples, additionally contain stigmasterol in a concentration of 50 g/ml as internal standard. The ESTDs are produced in chloroform. Similar to the samples, the ESTDs are measured in a brown GC vial with MSTFA for 1 hour at 80 C., derivatized or underivatized, by means of GC-MS.
(44) Conditions for the gas chromatography (GC)
(45) The GC analysis was carried out with an Agilent 6890N gas chromatograph (Agilent, Waldbronn) equipped with an Autosampler Agilent 7683B. An Agilent 5975 VL mass spectrometer was used as detector. The following conditions were selected: The column used was a 30 m long HP-5MS column (Agilent) with an internal diameter of 0.25 mm and a film thickness of 0.25 m. Helium served as the mobile phase. The GC/MS system was operated with a temperature program (150 C. for 0.5 min, 40 C./min to 280 C., 2 C./min to 310 C., 40 C./min to 340 C., 340 C. for 2.5 min) in the splitless mode. The injector temperature was 280 C., and the temperature of the detector (MS Quadrupole) was 150 C. The injection volume of the samples was 1 l.
Example 5: Strain-Dependent Yield of Pentacyclic Triterpenes
(46) The gas chromatographic analysis of the pentacyclic triterpenes is set out in Table 6. The dry biomass (BTS) as well as the volumetric and specific product yield are set out in the tables. The strains were cultured as in Example 3. The quantities produced using the example of lupeol, betulin, betulin aldehyde and betulinic acid are dependent upon the strain. With the same gene combination, CEN.PK strains behaved differently from AH22 strains.
(47) TABLE-US-00028 TABLE 6 Comparison of the yield of cyclic triterpenes between the CEN.PK2U and AH22tH3ura8 transformed with the plasmids pTT1-OEW and pTT2-LjCPR1-B2 OSC CPR CYP CYP gene BTS Lupeol Betulin Strain gene gene gene Accession g/l mg/l mg/g mg/l mg/g CEN.PK2U OEW LjCPR1 B2 XM_003525274 11.20 81.00 7.23 n.d. n.d. AH22th3ura8 OEW LjCPR1 B2 XM_003525274 13.82 118.29 8.56 51.43 3.72 OSC CPR CYP CYP gene betulin aldehyde betulinic acid strain gene gene gene Accession mg/l mg/g mg/l mg/g CEN.PK2U OEW LjCPR1 B2 XM_003525274 k.A. k.A. n.d. n.d. AH22th3ura8 OEW LjCPR1 B2 XM_003525274 28.79 2.08 22.25 1.61
Example 6: Influence of the HMG-CoA Reductase
(48) In Table 7 the dry biomass and the lupeol productivities of CEN.PK111-61A and CEN.PK2U are transformed with the plasmid pTT1-OEW as well as with the deregulated HMG-CoA reductase. The strains were cultured as in Example 3, but with different main cultivation times (48 hours, 72 hours and 93 hours respectively). The lupeol productivity of the CEN.PK2U is higher than that of CEN.PK111-61A. This shows that the deregulation of the HMG-CoA reductase has a positive influence on the production of triterpenoids.
(49) TABLE-US-00029 TABLE 7 Comparison of the productivities of CEN.PK111-61A and CEN.PK2U transformed with the plasmid pTT1-OEW 48 h 72 h 93 h OSC CPR CYP BTS Lupeol BTS Lupeol BTS Lupeol strain gene gene gene g/l mg/l mg/g g/l mg/L mg/g g/l mg/l mg/g CEN.PK111- OEW 5.50 38.61 7.02 11.32 83.18 7.35 10.55 88.38 8.38 61A CEN.PK2U OEW 10.60 92.03 8.68 11.78 129.90 11.02 11.87 125.84 10.60
(50) TABLE-US-00030 TABLE 8 Comparison of the productivities between AH22th3ura8 and AH22th3ura8are1are2 48 h 72 h 93 h OSC CPR CYP BTS Lupeol BTS Lupeol BTS Lupeol strain gene gene gene clone g/l mg/l mg/g g/l mg/L mg/g g/l mg/l mg/g AH22th3ura8 GuLUP1 K1 11.00 74.86 6.81 13.25 126.77 9.57 12.90 133.54 10.35 AH22th3ura8 GuLUP1 K1 10.43 60.96 5.84 11.90 90.37 7.59 11.82 96.74 8.19 are1are2
Example 7: Yields of Lupeol, Betulin, Betulin Aldehyde and Betulinic Acid after Episomal Expression of Different OSC, CPR and CYP Genes in Different Yeast Strains
(51) TABLE-US-00031 TABLE 9 Yield in CEN.PK2U OSC CPR CYP BTS Lupeol Betulin betulin aldehyde betulinic acid strain gene gene gene CYP gene accession g/l mg/l mg/g g/l mg/L mg/g g/l mg/l mg/g CEN.PK111-61A OEW 11.32 83.18 7.35 n.d n.d. n.d n.d. n.d n.d. CEN.PK111-61A OEW LjCPR1 A9 XM_002331391 10.68 63.14 5.91 4.56 0.43 k.A. k.A. n.d n.d. CEN.PK2U OEW 11.78 129.89 11.02 n.d n.d. n.d n.d. n.d n.d. CEN.PK2U GuLUP1 10.93 53.15 4.86 n.d n.d. n.d n.d. n.d n.d. CEN.PK2U AtLUP1 3.42 10.74 3.14 n.d n.d. n.d n.d. n.d n.d. CEN.PK2U RcLUS1 3.00 34.03 11.34 n.d n.d. n.d n.d. n.d n.d. CEN.PK2U OEW LjCPR1 A12 DQ335781 13.84 76.43 5.52 10.80 0.78 k.A. k.A. n.d n.d. CEN.PK2U OEW LjCPR1 AL1 JN565975 12.33 76.91 6.24 n.d. n.d. k.A. k.A. n.d n.d. CEN.PK2U OEW LjCPR1 A15 AB619802 11.74 65.15 5.55 43.24 3.68 k.A. k.A. 3.79 0.32 CEN.PK2U OEW LjCPR1 A17 AB619803 12.13 72.19 5.95 15.39 1.27 k.A. k.A. 4.48 0.37 CEN.PK2U OEW LjCPR1 A9 XM_002331391 12.93 82.18 6.36 6.89 0.53 k.A. k.A. 3.82 0.30 CEN.PK2U OEW LjCPR1 B1 XM_004139039 11.00 47.94 4.36 n.d n.d. k.A. k.A. n.d n.d. CEN.PK2U OEW LjCPR1 A41 JF803813 12.43 65.12 5.24 0.87 0.07 k.A. k.A. n.d n.d. CEN.PK2U OEW LjCPR1 B2 XM_003525274 11.20 81.00 7.23 n.d n.d. k.A. k.A. n.d n.d. CEN.PK2U OEW ATR1 AL1 JN565975 13.42 127.73 9.52 n.d n.d. k.A. k.A. nd nd CEN.PK 2U OEW ATR1 A15 AB619802 14.52 80.41 5.54 10.18 0.70 n.d n.d. 0.43 0.03 CEN.PK 2U OEW ATR1 A17 AB619803 14.81 78.41 5.29 7.08 0.48 3.54 0.24 0.95 0.06 CEN.PK 2U OEW ATR1 A9 XM_002331391 14.30 115.95 8.11 0.36 0.02 n.d n.d. n.d n.d. CEN.PK 2U OEW ATR1 B2 XM_003525274 14.47 106.90 7.39 n.d n.d. n.d n.d. n.d n.d. CEN.PK 2U OEW MTR A15 AB619802 13.12 47.02 3.58 101.57 7.74 26.33 2.01 27.31 2.08 CEN.PK 2U OEW MTR A17 AB619803 15.39 124.75 8.11 18.75 1.22 19.96 1.30 23.93 1.56 CEN.PK 2U OEW MTR A17 AB619803 3.58 24.78 6.91 6.30 1.76 12.08 3.37 26.82 7.48 CEN.PK 2U OEW MTR A9 XM_002331391 14.72 90.65 6.16 2.89 0.20 n.d n.d. n.d n.d. CEN.PK 2U OEW MTR B2 XM_003525274 15.48 76.08 4.92 7.03 0.45 3.62 0.23 3.46 0.22 CEN.PK 2U OEW MTR A12 DQ335781 15.18 89.38 5.89 23.99 1.58 9.07 0.60 1.56 0.10 CEN.PK 2U OEW CrCPR AL1 JN565975 15.04 119.22 7.93 n.d n.d. n.d n.d. n.d n.d. CEN.PK 2U OEW CrCPR A15 AB619802 15.88 75.50 4.76 50.28 3.17 5.74 0.36 5.70 0.36 CEN.PK 2U OEW CrCPR A17 AB619803 15.54 91.11 5.86 12.59 0.81 7.44 0.48 3.98 0.26 CEN.PK 2U OEW CrCPR A9 XM_002331391 14.56 127.42 8.75 1.23 0.08 n.d n.d. n.d n.d. CEN.PK 2U OEW CrCPR B2 XM_003525274 15.59 89.78 5.76 4.77 0.31 2.27 0.15 0.89 0.06 CEN.PK 2U OEW NCP1 A15 AB619802 15.74 94.68 6.02 2.42 0.15 n.d n.d. n.d n.d. CEN.PK 2U OEW NCP1 A17 AB619803 15.82 96.78 6.12 2.41 0.15 n.d n.d. n.d n.d. CEN.PK 2U OEW NCP1 A9 XM_002331391 15.21 94.07 6.18 0.04 0.00 n.d n.d. n.d n.d. CEN.PK 2U OEW NCP1 B2 XM_003525274 15.92 109.22 6.86 0.48 0.03 n.d n.d. n.d n.d.
(52) TABLE-US-00032 TABLE 10 Yield in AH22th3ura8 OSC CPR CYP BTS Lupeol Betulin betulin aldehyde betulinic acid strain gene gene gene CYP gene accession g/l mg/l mg/g g/l mg/L mg/g g/l mg/l mg/g AH22th3ura8 OEW 12.82 126.48 9.87 n.d n.d. n.d n.d. n.d n.d. AH22th3ura8 OEW LjCPR1 A12 DQ335781 15.17 100.59 6.63 85.13 0.56 k.A. k.A. 5.18 0.03 AH22th3ura8 OEW LjCPR1 AL1 JN565975 14.89 127.74 8.58 1.95 0.01 k.A. k.A. n.d n.d. AH22th3ura8 OEW LjCPR1 A15 AB619802 14.02 115.42 8.24 154.69 11.04 22.09 1.58 12.90 0.92 AH22th3ura8 OEW LjCPR1 A17 AB619803 14.32 103.00 7.19 38.42 2.68 44.33 3.10 28.12 1.96 AH22th3ura8 OEW LjCPR1 A9 XM_002331391 15.13 106.77 7.06 11.05 0.07 k.A. k.A. n.d n.d. AH22th3ura8 OEW LjCPR1 B1 XM_004139039 11.44 121.81 10.65 n.d n.d. k.A. k.A. n.d n.d. AH22th3ura8 OEW LjCPR1 A41 JF803813 14.90 128.53 8.63 n.d n.d. k.A. k.A. n.d n.d. AH22th3ura8 OEW LjCPR1 B2 XM_003525274 13.82 118.29 8.56 51.43 3.72 28.79 2.08 22.25 1.61 AH22th3ura8 OEW MTR A15 AB619802 14.61 61.91 4.24 276.46 18.93 63.85 4.37 92.17 6.31 AH22th3ura8 OEW MTR A17 AB619803 14.53 104.66 7.20 26.08 1.79 43.11 2.97 55.44 3.81 AH22th3ura8 OEW MTR B2 XM_003525274 14.54 108.51 7.47 32.52 2.24 25.37 1.75 29.53 2.03 AH22th3ura8 OEW CrCPR A15 AB619802 13.96 91.43 6.55 190.98 13.68 33.40 2.39 37.60 2.69 AH22th3ura8 OEW CrCPR A17 AB619803 14.28 117.76 8.25 31.22 2.19 42.71 2.99 34.90 2.44 AH22th3ura8 OEW CrCPR B2 XM_003525274 14.08 135.49 9.63 35.47 2.52 21.58 1.53 16.17 1.15 n.d.: Concentration bellow the limits of detection k.A.: no details
(53) In Tables 9 and 10 the dry biomass substances (BTS) and the formed concentrations of the triterpenoids lupeol, betulin, betulin aldehyde and betulinic acid after 72 hours' cultivation in WMVIII medium are shown. Tests were performed on the influence of the expression of different OSC, CPR and CYP genes in the strains AH22th3ura8, CEN.PK2U and CEN.PK111-61A, which were transformed with the genes for the CPR and CYP enzymes on the pTT2 plasmid and/or with the gene for the OSC enzyme on the pTT1 plasmid.
(54) In Tables 11, 12, 13 and 14 the preferred combinations of genes and the respective yields (independently of the yeast strain) of the pentacyclic triterpenoids are shown.
(55) TABLE-US-00033 TABLE 11 Lupeol yield CYP gene OSC gene CPR gene CYP gene accession mg/l mg/g GuLUP1 67.50 12.66 RcLUS1 34.03 11.34 OEW 129.89 11.02 OEW LjCPR1 B1 XM_004139039 121.81 10.65 OEW CrCPR B2 XM_003525274 135.49 9.63 OEW ATR1 AL1 JN565975 127.73 9.52 OEW CrCPR A9 XM_002331391 127.42 8.75 OEW LjCPR1 A41 JF803813 128.53 8.63 OEW LjCPR1 AL1 JN565975 127.74 8.58 OEW LjCPR1 B2 XM_003525274 118.29 8.56 OEW CrCPR A17 AB619803 117.76 8.25 OEW LjCPR1 A15 AB619802 115.42 8.24 OEW ATR1 A9 XM_002331391 115.95 8.11 OEW MTR A17 AB619803 124.75 8.11 OEW CrCPR AL1 JN565975 119.22 7.93 OEW MTR B2 XM_003525274 108.51 7.47 OEW ATR1 B2 XM_003525274 106.90 7.39 OEW LjCPR1 A17 AB619803 103.00 7.19 OEW LjCPR1 A9 XM_002331391 106.77 7.06 OEW NCP1 B2 XM_003525274 109.22 6.86 OEW LjCPR1 A12 DQ335781 100.59 6.63 OEW CrCPR A15 AB619802 91.43 6.55 OEW NCP1 A9 XM_002331391 94.07 6.18 OEW MTR A9 XM_002331391 90.65 6.16 OEW NCP1 A17 AB619803 96.78 6.12 OEW NCP1 A15 AB619802 94.68 6.02 OEW MTR A12 DQ335781 89.38 5.89 OEW ATR1 A15 AB619802 80.41 5.54 OEW ATR1 A17 AB619803 78.41 5.29 OEW LjCPR1 A41 JF803813 65.12 5.24
(56) TABLE-US-00034 TABLE 12 Betulin CYP gene OSC gene CPR gene CYP gene accession mg/l mg/g OEW MTR A15 AB619802 276.46 18.93 OEW CrCPR A15 AB619802 190.98 13.68 OEW LjCPR1 A15 AB619802 154.69 11.04 OEW LjCPR1 B2 XM_003525274 51.43 3.72 OEW LjCPR1 A17 AB619803 38.42 2.68 OEW CrCPR B2 XM_003525274 35.47 2.52 OEW MTR B2 XM_003525274 32.52 2.24 OEW CrCPR A17 AB619803 31.22 2.19 OEW MTR A17 AB619803 26.08 1.79 OEW MTR A12 DQ335781 23.99 1.58
(57) TABLE-US-00035 TABLE 13 betulin aldehyde CYP gene OSC gene CPR gene CYP gene accession mg/l mg/g OEW MTR A15 AB619802 63.85 4.37 OEW MTR A17 AB619803 12.08 3.37 OEW LjCPR1 A17 AB619803 44.33 3.10 OEW CrCPR A17 AB619803 42.71 2.99 OEW CrCPR A15 AB619802 33.40 2.39 OEW LjCPR1 B2 XM_003525274 28.79 2.08 OEW MTR B2 XM_003525274 25.37 1.75 OEW LjCPR1 A15 AB619802 22.09 1.58 OEW CrCPR B2 XM_003525274 21.58 1.53
(58) TABLE-US-00036 TABLE 14 betulinic acid CYP gene OSC gene CPR gene CYP gene accession mg/l mg/g OEW MTR A17 AB619803 26.82 7.48 OEW MTR A15 AB619802 92.17 6.31 OEW CrCPR A15 AB619802 37.60 2.69 OEW CrCPR A17 AB619803 34.90 2.44 OEW MTR B2 XM_003525274 29.53 2.03 OEW LjCPR1 A17 AB619803 28.12 1.96 OEW LjCPR1 B2 XM_003525274 22.25 1.61 OEW CrCPR B2 XM_003525274 16.17 1.15
REFERENCES
(59) WO 2011/074766 A2 WO 2011/074766 A3R4 CN 102433347 WO2012/116783 A2 Cameron, S. I. and Smith, R. F., In Proceedings of the 29th Annual Meeting of the Plant Growth Regulation Society of America (ed. Halifax, N. S.), Bringing Blue Sky Biology Down to Earth: Linking Natural Products Research with Commercialization, 2002, pp. 31-39 Chintharlapalli S, Papineni S, Lei P, Pathi S, Safe S. Betulinic acid inhibits colon cancer cell and tumor growth and induces proteasome-dependent and -independent downregulation of specificity proteins (Sp) transcription factors. BMC Cancer. 2011 Aug. 24; 11:371. PubMed PMID: 21864401 PubMed Central PMCID: PMC3170653. Fukushima E O, Seki H, Ohyama K, Ono E, Umemoto N, Mizutani M, Saito K, Muranaka T. CYP716A Subfamily Members are Multifunctional Oxidases in Triterpenoid Biosynthesis. Plant Cell Physiol. 2011 Oct. 28. [Epub ahead of print] PubMed PMID: 22039103. Holanda Pinto S A, Pinto L M, Cunha G M, Chaves M H, Santos F A, Rao V S. Anti-inflammatory effect of alpha, beta-Amyrin, a pentacyclic triterpene from Protium heptaphyllum in rat model of acute periodontitis. Inflammopharmacology. 2008 February; 16(1):48-52. PubMed PMID: 18046512. Huang et al. 2012, Molecular characterization of the pentacyclic triterpenoid biosynthetic pathwa) in Catharanthus roseu. Planta 2012, 236:1571-1581. Kirby et al. Engineering triterpene production in Saccharomyces cerevisiaebeta-amyrin synthase from Artemisia annua. FEBS J. 275(8):1852-1859, 2008 Li J, Zhang Y. Increase of betulinic acid production in Saccharomyces cerevisiae by balancing fatty acids and betulinic acid forming pathway. Appl Microbial Biotechnol. 2013 Muffler et al. Biotransformation of triterpenes. Process Biochem. 46(1): 1-15, 2011 Madsen K M, Udatha G D, Semba S, Otero J M, Koetter P, Nielsen J, Ebizuka Y, Kushiro T, Panagiotou G. Linking genotype and phenotype of Saccharomyces cerevisiae strains reveals metabolic engineering targets and leads to triterpene hyper-producers. PLoS One. 2011 Mar. 18; 6(3):e14763. PubMed PMID: 21445244; PubMed Central PMCID: PMC3060802. McNeil et al. Plant shortage leaves campaigns against malaria at risk. New York Times 14 November, 2004 Melo C M, Morais T C, Tome A R, Brito G A, Chaves M H, Rao V S, Santos F A. Anti-inflammatory effect of a,13-amyrin, a triterpene from Protium heptaphyllum, on cerulein-induced acute pancreatitis in mice. Inflamm Res. 2011 July; 60(7):673-81. Epub 2011 Mar. 12. PubMed PMID: 21400110. Philips D R, Rasbery J M, Bartel B, Matsuda S P T. Biosynthetic diversity in plant triterpenes cyclization. Current Opinion in Plant Biology. 2006 Apr. 3; 9:305-314. Pisha et al. Discovery of betulinic acid as a selective inhibitor of human melanoma that functions by induction of apoptosis. Nat Med 1(10):1046-1051, 1995 Polakowski et al. Overexpression of a cytosolic hydroxymethylglutaryl-CoA reductase leads to squalene accumulation in yeast. Appl Microbial Biotechnol. 49(1):66-71, 1998 Raskin et al. Plants and human health in the twenty-first century. Trends Biotechnol. 20(12):522-531, 2002 Ruzicka et al. Helv. Chim. Acta 21, 1076-1078, 1938 Robinson et al. Betulinic acid from Arbutus menziesii. Phytochemistry 9(4):907-909, 1970 Saleem M, Murtaza I, Tarapore R S, Suh Y, Adhami V M, Johnson J J, Siddiqui I A, Khan N, Asim M, Hafeez B B, Shekhani M T, Li B, Mukhtar H. Lupeol inhibits proliferation of human prostate cancer cells by targeting beta-catenin signaling. Carcinogenesis. 2009 May; 30(5):808-17. Epub 2009 Feb. 20. PubMed PMID: 19233958. Shanmugam M K, Rajendran P, Li F, Nema T, Vali S, Abbasi T, Kapoor S, Sharma A, Kumar A P, Ho P C, Hui K M, Sethi G. Ursolic acid inhibits multiple cell survival pathways leading to suppression of growth of prostate cancer xenograft in nude mice. J Mol Med (Berl). 2011 July; 89(7):713-27. doi: 10.1007/s00109-011-0746-2. Epub 2011 Apr. 5. PubMed PMID: 21465181. Siddique H R, Saleem M. Beneficial health effects of lupeol triterpene: a review of preclinical studies. Life Sci. 2011 Feb. 14; 88(7-8):285-93. Epub 2010 Nov. 29. Review. PubMed PMID: 21118697. Sunder et al. Use of betulinic acid and its derivatives for inhibiting cancer growth and a method for monitoring this. U.S. Pat. No. 6,048,847, 2000 Suzuki H, Achnine L, Xu R, Matsuda S P, Dixon R A. A genomics approach to the early stages of triterpene saponin biosynthesis in Medicago truncatula. Plant J. 2002 December; 32(6):1033-48. PubMed PMID: 12492844 Veen et al. Combined overexpression of genes of the ergosterol biosynthetic pathway leads to accumulation of sterols in Saccharomyces cerevisiae. FEMS Yeast Res. 4, 87-95, 2003 Wang Z, Guhling 0, Yao R, Li F, Yeats T H, Rose J K, Jetter R. Two oxidosqualene cyclases responsible for biosynthesis of tomato fruit cuticular triterpenoids. Plant Physiol. 2011 January; 155(1):540-52. Epub 2010 Nov. 8. PubMed PMID: 21059824; PubMed Central PMCID: PMC3075788.