Method and means for culturing osteoblastic cells
10010649 ยท 2018-07-03
Assignee
Inventors
Cpc classification
A61L27/3821
HUMAN NECESSITIES
A61L27/3895
HUMAN NECESSITIES
A61P19/08
HUMAN NECESSITIES
A61L27/3834
HUMAN NECESSITIES
A61L2430/02
HUMAN NECESSITIES
C12N5/0663
CHEMISTRY; METALLURGY
C12N5/0654
CHEMISTRY; METALLURGY
International classification
Abstract
A method of culturing human or mammalian mesenchymal stem cells (MSC) or osteoblastic cells to form corresponding cell aggregates evenly distributed in the culturing medium having a reduced content of cells with fibroblast morphology comprises contacting MSC or OC with a water-soluble cellulose derivative over a period of from 1 day to one or two weeks. Also disclosed are a corresponding aggregates, a culture medium and a pharmaceutical composition, and uses of the aggregate, the culturing medium and the composition.
Claims
1. A culture medium for culturing of mammalian mesenchymal stem cells or osteoblastic cells consisting essentially of (a) a water-soluble cellulose derivative selected from the group consisting of hydroxyethyl cellulose, hydroxypropyl cellulose, methyl cellulose, ethyl cellulose, hydroxyethyl-methyl cellulose, hydroxyethyl-ethyl cellulose, and hydroxypropyl-methyl cellulose, (b) at least one cell growth promoting or sustaining agent, (c) water, (d) optionally a pharmaceutical, (e) a source of calcium and a source of phosphate, (f) optionally a water-insoluble particulate material, and (g) optionally a proteinaceous enamel matrix derivative for periodontal tissue regeneration.
2. The culture medium of claim 1, wherein the source of calcium comprises a calcium salt, and the source of phosphorous comprises a phosphate.
3. The culture medium of claim 2, wherein the source of calcium is selected from the group consisting of calcium mono-phosphate, calcium hydrogen phosphate, calcium pyrophosphate, and calcium citrate, and the source of phosphorous is selected from calcium monophosphate, calcium hydrogen phosphate, and calcium pyrophosphate.
4. The culture medium of claim 1 wherein the source of calcium is a water-insoluble particulate material selected from the group consisting of calcium hydroxy apatite, a water-insoluble calcium phosphate, and bone meal.
5. The culture medium of claim 4, wherein the water-insoluble particulate matter has a diameter, and the diameter of 95% by weight or more of the particulate material is from 2 m to 50 m.
6. The culture medium of claim 1, wherein the proteinaceous enamel matrix derivative for periodontal tissue regeneration is present.
7. A culture medium for culturing of mammalian mesenchymal stem cells or osteoblastic cells consisting (a) a water-soluble cellulose derivative selected from the group consisting of hydroxyethyl cellulose, hydroxypropyl cellulose, methyl cellulose, ethyl cellulose, hydroxyethyl-methyl cellulose, hydroxyethyl-ethyl cellulose, and hydroxypropyl-methyl cellulose, (b) at least one cell growth promoting or sustaining agent, (c) optionally a pharmaceutical, and (d) a source of calcium and a source of phosphate, (e) optionally a water-insoluble particulate material, and (f) optionally a proteinaceous enamel matrix derivative for periodontal tissue regeneration.
8. The culture medium of claim 7, wherein the source of calcium is a calcium salt, and the source of phosphorous is a phosphate.
9. The culture medium of claim 8, wherein the source of calcium is selected from the group consisting of calcium mono-phosphate, calcium hydrogen phosphate, calcium pyrophosphate, and calcium citrate, and the source of phosphorous is selected from calcium monophosphate, calcium hydrogen phosphate, and calcium pyrophosphate.
10. The culture medium of claim 7, wherein the proteinaceous enamel matrix derivative for periodontal tissue regeneration is present.
Description
SHORT DESCRIPTION OF THE FIGURES
(1)
(2)
(3)
(4)
(5)
DESCRIPTION OF PREFERRED EMBODIMENTS OF THE INVENTION
(6) Cell Cultures.
(7) The mouse osteoblastic cell line MC3T3-E1 (DSMZ, ACC210, Braunschweig, Germany) was cultured in alpha-MEM (PAA Laboratories GmbH, Austria) supplemented with 20% fetal calf serum (PAA Laboratories GmbH, Austria) and 1% penicillin/streptomycin (100 g/mL penicillin and 100 g/mL streptomycin). The cells were kept in an incubator at 37 C. in a humidified atmosphere (95% air and 5% CO.sub.2). The cells were sub-cultured twice a week at 80%-90% confluent using 0.25% trypsin containing 1 mM EDTA. Human mesenchymal stem cells (MSC; Cambrex Bio Science Walkersville Inc., MD, USA) were cultured in MSC basal medium (Cambrex Bio Science Walkersville Inc., MD, USA) supplemented with 200 mM L-glutamine (Cambrex Bio Science Walkersville Inc., MD, USA) and 1% penicillin/streptomycin (Cambrex Bio Science Walkersville Inc., MD, USA). The cells were sub-cultured at 80%-90% confluent using 0.25% trypsin containing 1 mM EDTA.
(8) Experimental Design.
(9) The cells were cultured in their respective culturing media, supplemented alpha-MEM and MSC basal medium, respectively, as described above, in culture inserts in 24-well cell culture plates. Two types of culture inserts (Millipore Corp. Ireland) were tested in parallel; PCF (polycarbonate) and CM (hydrophilic poly(tetrafluoro-ethylene) with 0.4 m pore size. The cells were suspended in a preferred embodiment of the gelatinous medium of the invention (g/L: 12.0, HPMC (METHOCEL E4M, Medical Grade; Dow Chemical Company); KCl, 0.45; NaCl, 6.0; KH.sub.2PO.sub.4, 0.45; Na.sub.2HPO.sub.4.2H.sub.2O, 15.2; NaH.sub.2PO.sub.4.H.sub.2O, 2.2; water to 1 L; 1 L; =125 (mPa.Math.s)) or in the ordinary culture medium only, respectively, in two compartments of the cell culture plate, to a final concentration of 0.510.sup.6 cells/mL and gently mixed to make a homogeneous suspension. The culture inserts containing 500 l cell suspension were placed in the wells of the 24-well plate already containing 500 l of cell culture medium. The medium was changed every other day. The plates were placed in an incubator at 37 C. in a humidified atmosphere (95% air and 5% CO.sub.2) for up to 14 days.
(10) Morphology.
(11) To evaluate the morphology of the cells in the gelatinous cell medium of the invention, all cultures were examined daily using an Olympus inverted light microscope (Olympus Deutschland GmbH, Hamburg, Germany).
(12) Cell Proliferation Assay.
(13) Cell proliferation rate was determined by [.sup.3H]-thymidine incorporation after 24, 48 and 72 hours of cell culturing. MC3T3-E1 cells were cultured at concentration of 0.510.sup.6 cells/mL with and without the gelatinous medium of the invention, in both types of cell culture inserts. Cells were exposed to 1 Ci/well [.sup.3H]-thymidine for 12 hours prior to harvesting of the cells. Cells of each culture insert were transferred to 1.5 mL tubes. Both cell culture inserts and cells in the tubes were washed twice with ice-cold 1PBS and twice with ice-cold 5% trichloroacetic acid to remove unincorporated [.sup.3H]-thymidine. To ensure against losing cells during the washing steps, washing solution discarded from the inserts were collected in their respective tube material and centrifuged for 3 min. at 13,000g along with the washed cells. The cells in the tubes and potential cells left in culture inserts were solubilized in 500 l 1M NaOH. 400 l of the solubilized cell solution were transferred to 8 mL of Insta-gel II Plus liquid scintillation fluid and measured for 3 min. in a Packard liquid scintillation counter (Packard, Zurich, Switzerland). To ensure that any observed effects of HPMC gel were not due to serum dilution or variations in serum concentration, the effect of serum dilution in the HPMC gel culture on cell proliferation was investigated at various HPMC gel to serum ratios. Variations in serum concentration were not found to have a significant effect on cell proliferation in any of the cell types studied.
(14) Cell Viability.
(15) To characterize the viability status of the culture in the gelatinous medium of the invention, the lactate dehydrogenase (LDH) release of the MC3T3-E1 cell cultures into the supernatant was measured after 1, 2, 4, 7 and 14 days. The LDH release was measured for cells with and without (control) HPMC and for both above-mentioned culture inserts. Cell cultures were started at a concentration of 0.510.sup.6 cells/mL in the inserts and on the plastic plates. LDH activity was measured using the Cytotoxicity Detection Kit (LDH) (Boehringer, Mannheim, Germany). According to the protocol, 50 l cell sample was placed in a 96-well plate together with 50 l kit mixture (catalyst and colour solution), placed in the dark for 30 min., thereafter the absorbance was read on an ELISA reader at 450 nm. Low and high controls were included in all measurements. The LDH activity in fresh culture medium was measured as a low control (or as background absorbance). Maximum release amount of LDH (high control) was determined by lysing cells on a plastic plate with Triton X-100. The percentage of LDH activity was calculated using following equation:
LDH activity (%)=exp. Valuelow control/high controllow control100
(16) mRNA Isolation.
(17) All cell culture media from each well was carefully collected and stored at 20 C. Cells were lysed in a lysis/binding buffer (100 mM Tris-HCl, pH 8.0, 500 mM LiCl, 10 mM EDTA, pH 8.0, 0.5 mM dithiothreitol (DTT), and 1% sodium dodecyl sulfate (SDS)). mRNA was isolated using magnetic beads, Dynabeads Oligo(dT).sub.25 as described by the manufacturer (Dynal AS, Oslo, Norway). Beads containing mRNA were re-suspended in 10 mM Tris-HCl, pH 8.0, and stored at 70 C. until use. 1 L of the mRNA-containing solution was applied directly to obtain a first-strand complementary DNA (cDNA) using the iScript cDNA Synthesis Kit which contains both Oligo(dT).sub.25 and random hexamer primers (Bio-Rad, Hercules, Calif., USA).
(18) Real-time PCR. Reactions were performed and monitored using iCycler iQ (Bio-Rad, Hercules, Calif., USA). The 2iQ SYBR Green Supermix was based on iTaq DNA polymerase (Bio-Rad, Hercules, Calif., USA). The amplification program consisted of a pre-incubation step for denaturation of the template cDNA (3 min., 95 C.), followed by 50 cycles consisting of a denaturation step (15 s, 95 C.), an annealing step (15 s, 60 C.) and an extension step (30 s, 72 C.). After each cycle, fluorescence was measured at 72 C. A negative control without the cDNA template was run in each assay. Samples were run in duplicate. To allow relative quantification after the PCR, standard curves were constructed from the standard reactions for each target and housekeeping genes by plotting Ct values, i.e. the cycle number at which the fluorescence signal exceeds background, versus log cDNA dilution. The Ct readings for each of the unknown samples were then used to calculate the amount of either the target or housekeeping relative to the standard. mRNA levels were calculated as the ratio of relative concentration for the target genes relative to that for the mean between housekeeping genes. cDNA was analyzed for the relative transcriptional expression of type I collagen, osteocalcin, alkaline phosphatase, CD44, bone sialoprotein, Osterix. The housekeeping gene GAPDH and oligonucleotide primer sequences used for the real-time RT-PCR and the specific parameters are shown in the Table. Real-time efficiencies were calculated from the given slopes in the iCycler software using serial dilutions, showing all the investigated transcripts high real-time PCR efficiency rates, and high linearity (r>0.99) when different concentrations were used. PCR products were subjected to a melting curve analysis on the iCycler and subsequently 2% agarose/tris-acetic acid-EDTA (TAE) gel electrophoresis to confirm amplification specificity, T.sub.m and product size, respectively (Table).
(19) TABLE-US-00001 TABLE Primers used in real-time PCR quantification Amplicon Gene Primer sequence* Species size (bp) Alkaline phosphatase S 5- AACCCAGACACAAGCATTCC -3 Mouse 151 A 5- GAGAGCGAAGGGTCAGTCAG -3 Bone sialoprotein S 5- GAAAATGGAGACGGCGATAG -3 Mouse 141 A 5- ACCCGAGAGTGTGGAAAGTG -3 CD44 S 5- CTTCCATCTTGACCCGTTGT -3 Mouse 175 A 5- ACAGTGCTCCTGTCCCTGAT -3 Collagen-I S 5- AGAGCATGACCGATGGATTC -3 Mouse 177 A 5- CGTTCTTGAGGTTGCCAGTC -3 Osteocalcin S 5- CCGGGAGCAGTGTGAGCTTA -3 Mouse 80 A 5- TAGATGCGTTTGTAGGCGGTC -3 Osterix S 5- ACTGGCTAGGTGGTGGTCAG -3 Mouse 135 A 5- GGTAGGGAGCTGGGTTAAGG -3 GAPDH S 5- ACCCAGAAGACTGTGGATGG -3 Mouse 171 A 5- CACATTGGGGGTAGGAACAC -3 *Oligonucleotide sequences of sense (S) and antisense (A) primers used in the real-time PCR of target and housekeeping gene.
(20) Statistical Analysis.
(21) Statistical analysis was performed with a one-way analysis of variance (ANOVA) for repeated measurements. The significance of difference was assessed by either the Student's t-test or the Mann-Whitney U test. Significance was set at P<0.05. Cell cytotoxicity effect. Similar values were obtained for the LDH activity in PCF and CM culture inserts for MC3T3-E1 cells (
(22) Cell Morphology.
(23) The CM inserts allow visualization of cells using an inverted W microscope. Both MCS and MC3T3-E1 cells cultured in the gelatinous medium of the invention showed a multi-cellular aggregate morphology within 24 hours of cell growth (
(24) Cell Proliferation.
(25) The number of MC3T3-L1 cells (
(26) Expression of Osteocalcin and Collagen Type 1 Markers.
(27) mRNA expression of both osteocalcin and collagen type 1 was significantly reduced in MC3T3-E1 cells cultured in HPMC gel of the invention. In the presence of HPMC, as evident from
(28) Cell Proliferation.
(29) For MC3T3-EI cells, with PCF and CM culture inserts, proliferation showed a comparable pattern with both cell culture inserts. There was significantly higher cell proliferation at all times for cell cultures with the gelatinous medium of the invention than for the control. There was a 5-fold increase in cell growth with the gelatinous medium of the invention at day 2 (P=0.011) and day 4 (P=0.029) compared to the control. Cell growth increased 3-fold at day 1 and was significantly higher (P=0.029). However, [.sup.3H]-thymidine incorporation rate decreased during the three day experiment period. Cell proliferation for human mesenchymal stem cells was significantly increased in the gelatinous medium of the invention. There was more than a 2-fold increase at day 2 (P=0.007) and day 3 (P=0.039) in the gelatinous medium of the invention compared to the control. There was an identical rate of radioactive [.sup.3H]-thymidine incorporated at 24 hours.
(30) Gene Expression of Osteoblastic Marker.
(31) The temporal expression of collagen type I, osteocalcin and CD44 to evaluate osteoblastic phenotypic properties of MC3T3-E1 were studied. The gene expression results were similar within both cell culture inserts. In general, the expression levels of collagen type I, osteocalcin and CD44 were lower in the cell cultures in the gelatinous medium of the invention compared to the control. The expression of collagen type I was increased 5-fold in the cell cultures in the gelatinous medium of the invention and more than 2-fold in the control. The collagen type I expression was significantly lower at day 1 (n=4, P=0.035) and day 4 (n=4, P=0.029) in the cell cultures in the gelatinous medium of the invention. No significant difference was observed for the CD44 gene expression level at any point in time during culture. However, the expression level was more than 5-fold increased in the control and 1.4-fold in the cell cultures in the gelatinous medium of the invention during the 14 days of culture. The osteocalcin gene expression was significantly lower in the cell cultures in the gelatinous medium of the invention compared to control (n=4, P=0.001) at day 7. The expression profile showed a 5-fold increase in the control and a 3-fold increase in the cell cultures in the gelatinous medium of the invention with time in culture. The expression of alkaline phosphates, bone sialoprotein and Osterix genes was negative or at negligible levels in both cell culture inserts in the gelatinous medium of the invention and in the CM inserts without the gelatinous medium of the invention. However, they were detected in low levels in the PCF culture insert without the gelatinous medium of the invention, which increased with culturing time. The expressions of alkaline phosphatase, bone sialoprotein and Osterix genes on the plastic culture plates showed increasing levels with increasing culturing time.
(32) [C.sup.2+] Measurements.
(33) After harvesting the samples were lyophilized, homogenized in 3% HCl, and shaken for 24 h at room temperature. Calcium content was determined by atomic absorption spectroscopy (AAnalyst 400, PerkinElmer Instruments, Shelton, USA) in an air-acetylene flame. The interference with phosphate was suppressed by addition of 0.5% lanthanum to the standards and samples prior to measurements.
REFERENCES
(34) 1. Cukierman E et al. Science 294 (2002) 1708-1712. 2. Griffith L G and G Naughton, Science 295 (2002) 1009-1014. 3. Schmeichel K L and M J Bissell, J. Cell Sci. 116 (2003) 2377-2388. 4. Trojani C et al., Biomaterials 26 (2005) 5509-5517. 5. Yamada K M and K Clark, Nature 419 (2002) 790-791. 6. Gumbiner B M, Cell 84 (1996) 345-357. 7. Ohlstein B et al., Curr. Opin. Cell Biol. 16 (2004) 693-699. 8. Engler A J et al., Cell 126 (2006) 677-689. 9. Grimandi G et al., J. Biomed. Mater. Res. 39 (1998) 660-666. 10. Lerouxel E et al., Biomaterials 27 (2006) 4566-4572. 11. Vinatier C et al., Biomaterials 26 (2005) 6643-6651. 12. Vinatier C et al., J. Biomed. Mater. Res. Part A. 80A (2007) 66-74. 13. Jamal H H and J E Aubin, Exp. Cell Res. 223 (1996) 467-477.