REGULATORY ELEMENTS IN THE GENOME
20230100105 · 2023-03-30
Assignee
Inventors
Cpc classification
C12N15/635
CHEMISTRY; METALLURGY
International classification
Abstract
The invention, in part, relates to assessing interactions between gene transcription enhancers and gene transcription repressor, identifying agents that modulate transcription, and use of methods and identified agents to prevent and treat diseases and conditions, such as cancers.
Claims
1. A method of identifying a candidate agent for modulating a condition; the method comprising: (a) detecting, with a means comprising a ChIA-PET method, a gene regulation system (GRS), wherein an activity of the GRS comprises a physical interaction between a transcription-factor binding (TFB) element, a transcription factor (TF) complex, and a gene modifier element in a cell; (b) identifying a target gene whose transcription is modified by the activity of the GRS as a condition-inducer gene or a condition-suppressor gene; (c) determining an effect of the activity of the GRS on repression and de-repression of the transcription of the identified target gene, wherein: (i) if the target gene is a condition-suppressor gene and the effect of the activity of the GRS is de-repression of the transcription of the target gene, the activity of the GRS inhibits the condition; (ii) if the target gene is a condition-suppressor gene and the effect of the activity of the GRS is repression of the transcription of the target gene, reducing the activity of the GRS inhibits the condition; (iii) if the target gene is a condition-inducer gene and the effect of the activity of the GRS is repression of the transcription of the target gene, the activity of the GRS inhibits the condition; (iv) if the target gene is a condition-inducer gene and the effect of the activity of the GRS is de-repression of the transcription of the target gene, reducing the activity of the GRS inhibits the condition; and (d) identifying one or more candidate agents that modify the activity of the GRS.
2. The method of claim 1, wherein the TFC comprises 1, 2, 3, or more subunits, wherein the physical interaction between the TFB element, the TF complex, and the gene modifier element comprises an interaction between at least one of the subunits and the TFB element and an interaction between at least one of the subunits and the gene modifier element.
3. The method of claim 1, wherein the TFB element is a gene silencer element.
4. The method of claim 1, wherein the TF complex comprises a polycomb repressor complex 2 (PRC2).
5. The method of claim 4, wherein the GRS activity transcriptionally represses expression of the target gene.
6. The method of claim 1, wherein the TFB element is a gene activator element.
7. The method of claim 6, wherein the GRS activity transcriptionally de-represses expression of the target gene.
8. The method of claim 1, wherein the condition comprises at least one of: a cancer, cell differentiation, cell de-differentiation, embryonic development, development, organ development, cell death, cell division, and a genetic disease.
9. The method of claim 1, wherein the condition is a cancer and the target gene is a cancer-inducer gene.
10. The method of claim 1, wherein the condition is a cancer and the target gene is a cancer suppressor gene.
11. The method of claim 1, further comprising identifying a function of the identified target gene.
12-13. (canceled)
14. The method of claim 1, wherein the cell is a cancer cell.
15-17. (canceled)
18. The method of claim 1, further comprising determining a level of transcription of the target gene and optionally comparing the determined level to a control level of transcription.
19. The method of claim 18, further comprising determining an effect of one of the candidate agent on the determined level of transcription of the target gene, and optionally comparing the determined level to a control level of transcription, and optionally wherein determining the effect of one of the candidate agents comprises contacting the cell with a composition comprising the candidate agent.
20. (canceled)
21. The method of claim 1, further comprising, testing the one or more identified candidate agents of claim 1(d) as a determination of the presence or absence of an inhibitory effect of the agent(s) on the condition.
22. The method of claim 1, further comprising testing the one or more identified candidate agent of claim 1(d) as a determination of the presence or absence of an enhancing effect of the agent(s) on the condition.
23. A method of identifying a candidate agent for inhibiting a cancer; the method comprising: (a) detecting, with a means comprising a ChIA-PET method, a gene regulation system (GRS), wherein an activity of the GRS comprises a physical interaction between a transcription-factor binding (TFB) element, a transcription factor (it) complex, and a gene modifier element in a cancer cell; (b) identifying a target gene whose transcription is modified by the activity of the GRS as a cancer-inducer gene or a cancer-suppressor gene; (c) determining an effect of the activity of the GRS on repression and de-repression of the transcription of the identified target gene, wherein: (i) if the target gene is a cancer-suppressor gene and the effect of the activity of the GRS is de-repression of the transcription of the target gene, the activity of the GRS inhibits the cancer; (ii) if the target gene is a cancer-suppressor gene and the effect of the activity of the GRS is repression of the transcription of the target gene, reducing the activity of the GRS inhibits the cancer; (iii) if the target gene is a cancer-inducer gene and the effect of the activity of the GRS is repression of the transcription of the target gene, the activity of the GRS inhibits the cancer; (iv) if the target gene is a cancer-inducer gene and the effect of the activity of the GRS is de-repression of the transcription of the target gene, reducing the activity of the GRS inhibits the cancer; and (d) identifying one or more candidate agents that modify the activity of the GRS.
24. The method of claim 23, wherein the TFC comprises 1, 2, 3, or more subunits, wherein the physical interaction between the TFB element, the TF complex, and the gene modifier element comprises an interaction between at least one of the subunits and the TFB element and an interaction between at least one of the subunits and the gene modifier element.
25. The method of claim 23, wherein the TFB element is a gene silencer element.
26. The method of claim 23, wherein the TF complex comprises a polycomb repressor complex 2 (PRC2).
27-40. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0006]
[0007]
[0008]
[0009]
[0010]
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
BRIEF DESCRIPTION OF THE SEQUENCES
[0019] SEQ ID NO: 1 is agatcggaagagc.
[0020] SEQ ID NO: 2-122 are shown in Table 1.
[0021] SEQ ID NO: 123-134 are shown Table 6.
DETAILED DESCRIPTION
[0022] Polycomb repressive complex 2 (PRC2) is a key regulator inducing transcriptional gene silencing and chromatin interaction analyses of PRC2 have now been performed to identify silencers and their associated chromatin connectivity. Deletion of silencers in mice results in transcriptional de-repression of differentiation genes and embryonic lethality. While functioning as silencers in pluripotent cells, silencers can transition into active enhancers during development, suggesting their regulatory versatility. Integrative analysis of three-dimensional genome organization and spatial clusters of PRC2-chromatin hubs has now revealed the compact assembly as the structural basis of the silencing compartments. As described herein, the molecular nature of silencers and their associated chromatin architectures have now been determined, and certain methods described herein can be used to identify means and agents for altering transcription for treatment of diseases and conditions such as, but not limited to cancers. Certain embodiments of methods of the invention comprise identifying and using candidate agents to treat a disease or condition, such as a cancer, cell differentiation, etc.
[0023] Key elements important in mechanisms of gene regulation in eukaryotes comprise transcription factor binding (TFB) elements, transcription factor (TF) complexes, and gene modifier elements, the interaction of which modulates transcription of a target gene. The elements, complexes, and their interactions are components of what is referred to herein as a “gene regulation system” or GRS. The interactions of GSRs are involved in temporal regulation of gene transcription in cells and are important factors in regulating cell identity. TFB elements such as enhancer elements and silencer elements are involved in temporal and cell type-specific activation and deactivation of gene expression and have a role in regulating cell growth and cell differentiation.
Gene Regulatory Systems
[0024] In some aspects of the invention methods are provided to identify agents capable of selectively regulating gene transcription in cells and subjects. Agents that modulate regulation of gene transcription can alter transcription of genes and be used to treat a disease or condition associated with a level of transcription of the gene. For example, the onset of a cancer, a developmental disorder, and/or other disease or condition may result from a level of transcription of a particular gene, and an agent capable of modulating regulation of the particular gene's transcription can be used to inhibit the onset of the cancer, developmental disorder, and/or other disease or condition, respectively. An agent capable of modulating regulation of a particular gene's transcription may be an agent that increases a level of the gene's transcription or may be an agent that decreases a level of the gene's transcription. An agent may be used to modify activity of a gene regulation system (GRS). The term GRS, as used herein means a system through which transcription of a particular gene is regulated, wherein by modulating an activity of the GRS one can modulate transcription of the particular gene.
[0025] A GRS comprises the following components that physically interact: (1) a transcription factor binding (TFB) element, (2) a transcription factor complex (TFC), and (3) a gene modifier element. As used herein the term “transcription factor binding element” means a genetic element, the activity of which regulates transcription of a specific gene, which may also be referred to herein as a “target” gene.
[0026] A TFB element may be referred to in the art as a: “gene activator” or “gene silencer” element. A TFB element may also be referred to in the art as a non-coding distal regulatory element (DRE) that directs transcription repression or de-repression of a gene. Transcriptional enhancer elements and silencer elements are cis-regulatory sequences that recruit transcription factor (TF) elements and are centrally involved in regulating transcription of their target gene(s), including regulating characteristics such as, but not limited to: timing of the start of transcription, timing of the end of transcription, and the level of transcription of their target gene(s). See, for example, Maston, G. A., et al., (2006) Ann. Rev. Genomics Hum. Genet. 7, 29-59, the content of which is incorporated by reference herein. A TFB element may, but need not be, in close physical proximity its target gene. In some embodiments, a TFB element is physically distant from its target gene. Enhancers and silencers communicate with their target gene(s) through physical interactions with their gene modifier elements, mediated by transcription factor complexes.
[0027] As used herein the term: “transcription factor complex” refers to a complex of molecules positioned between a TBF and a gene modifier element. A TF complex interacts with other GRS elements to regulate transcription of a target gene so the GRS target gene is expressed in the right cell at the right time. A TF complex may function alone, or two or more TF complexes may function in conjunction with other to direct activities such as, but not limited to: cell division, cell growth, cell-migration, and cell death. A TF complex comprises at least one DNA-binding domain (DBD), which attaches to a specific sequence of DNA that is adjacent to the target gene or genes regulated by the GRS. A TF complex comprises a protein complex capable of associating with DNA by direct binding, or via other DNA-binding proteins or complexes, and regulating transcription of a target gene or genes. A TF complex may be positioned between a TFB element and a gene modifier element and interactions with those elements to promote or block recruitment of RNA polymerase to a target gene or genes of a GRS. A non-limiting example of a TFC is a PRC2 complex, which may be physically positioned between a TFB element and a gene modifier element. A TFC positioned between a TFB element and a gene modifier element and is not considered to include elements of either the TFB element or the gene modifier element. The term transcription factor may also be referred to in the art as a sequence-specific DNA-binding factor. See for example, Reiter F, Wienerroither S & Stark A. (2017) Curr Opin in Genet Dev 43, 73-81, the content of which is incorporated by reference herein.
[0028] As used herein, a “gene modifier element” refers to an element that controls transcription of a gene of interest (also referred to herein as a target gene). In a non-limiting example, a target gene is a specific cancer suppressor gene and a gene modifier element is a promoter that controls transcription of the cancer suppressor gene. See for example, Haberle V. & Stark A. (2018) Nat Rev Mol Cell Biol 19(10): 621-637, the content of which is incorporated by reference herein.
[0029] A GRS is a system of physically interacting components that regulates transcription of specific target genes. A first GRS may regulate transcription of one or more target genes and a second GRS may regulate transcription of (1) one or more of the same target gene(s), (2) none of the one or more target gene(s), or (3) one or more target gene(s) other than those regulated by the first GRS. It has now been identified that agents can be used to modulate an activity of a GRS, and thus can be used to alter transcription of target genes whose transcription is regulated by the GRS.
[0030] In some embodiments of the invention, modulating an activity of a GRS includes altering an interaction between two or more of (1) a TFB element, (2) a TF complex, and (3) a gene modifier element of the GRS. In some embodiments of the invention an agent targets and interferes with an interaction between a TFB element and a TF complex of a GRS. In certain embodiments of the invention an agent targets and interferes with an interaction between a TF complex and a gene modifier element of a GRS. In some embodiments of the invention an agent targets and interferes with an interaction between two or more components of a TF complex. In each instance, the agent is capable of interfering with the interaction and the interference reduces or eliminates an activity of the GRS.
Effects of Modulating a GRS
[0031] In certain embodiments of methods of the invention a GRS is contacted with an agent capable of modulating an activity of the GRS. Cellular processes involved in cell development, cancer onset, cancer metastases, tissue growth, cell differentiation, cell de-differentiation, and other physiological changes in cells, tissues, and subjects are regulated, at least in part, by a balance between activation and silencing of particular target genes. For example, using an embodiment of a method of the invention, a GRS is identified and the GRS contacted with an agent that alters an activity of the GRS. The change in the activity of the GRS modulates transcription of a target gene of the GRS. In some embodiments of the invention, modulating transcription of a target gene comprises repressing transcription of the target gene. In certain embodiments of the invention, modulating transcription of a target gene comprises de-repressing transcription of the target gene.
[0032] An activity of the GRS includes one or more physical interactions between and/or amount: a TFB element, a TF complex, and a gene modifier element in a cell. In some embodiments of the invention, a target gene—the transcription of which is modified by the activity of the GRS—is identified as a condition-inducer gene or a condition-suppressor gene. The term, “condition” as used herein in reference to condition-inducer genes and condition suppressor genes includes genes whose transcription is capable of associated with one or more of: cell differentiation, cell growth, cell de-differentiation, cell division, cell death, a disease, a cancer, a genetic disease, etc. As used herein the term “associated with” means the transcription or lack of transcription of the gene impacts the presence or absence of the condition. Non-limiting examples of condition-inducer and condition-suppressor genes are cancer-inducer and cancer-suppressor genes, respectively. Additional condition-inducing genes and/or condition-suppressor genes to which methods of the invention can be applied are known in the art. It will be understood that the term “condition” as used herein may be a condition of interest to promote or may be a condition of interest to prevent, depending on the nature of the condition. For example, if a condition is a cancer, it is of interest to prevent or reduce the condition in a cell and/or subject, and if a condition is cell differentiation, it may be of interest to promote the condition in a cell and/or subject.
[0033] In certain embodiments of methods of the invention, an effect of the activity of a GRS on repression and de-repression of transcription of a target gene is determined. It will be understood that depending on the effect of transcription of a target gene on a condition, it may be desirable to repress or de-repress transcription of the target gene. For example, though not intended to be limiting: if a target gene is a cancer-suppressor gene and the effect of the activity of the GRS is de-repression of the transcription of the target gene, it may be desirable to increase or enhance the activity of the GRS to inhibit (treat) the cancer. In another non-limiting example, if a target gene is a cancer-suppressor gene and the effect of the activity of the GRS is repression of the transcription of the target gene, it may be desirable to reduce the activity of the GRS to inhibit (treat) the cancer. In another non-limiting example if a target gene is a cancer-inducer gene and the effect of the activity of the GRS is repression of the transcription of the target gene, the activity of the GRS inhibits the cancer; it may be desirable to increase or enhance the activity of the GRS to inhibit (treat) the cancer. In yet another non-limiting example, if a target gene is a cancer-inducer gene and the effect of the activity of the GRS is de-repression of the transcription of the target gene, it may be desirable to reduce the activity of the GRS to inhibit (treat) the cancer.
Identifying Candidate Agents and Selecting Treatments
[0034] Certain embodiments of the invention can be used to identify elements of a GRS and an effect of transcription of a target gene modulated by an activity of the GRS. This information can be used in methods of the invention to determine one or more candidate agents that modify an activity of the GRS and a cell or plurality of cells may be contacted with the identified agent to increase or decrease transcription of a condition-inducer gene that is a target gene of the GRS or condition-suppressor gene that is a target gene of the GRS. The term “agent” may be used herein interchangeably with the term “candidate agent”.
[0035] Methods of the invention can be used alter a level of transcription of one or more GRS target genes, wherein the altered level of transcription results in the presence, absence, and/or status of a condition in the cell, plurality of cells, and/or a subject comprising the cell or cells.
[0036] In some embodiments of the invention, a plurality of cells having a condition, a non-limiting example of which are cancer cells, can used in comparative studies and to test candidate agents capable of modulating one or more interactions of a GRS. In a non-limiting example, two sets of cancer cells may be maintained in the same environment (for example, both in culture or both in a subject) and one set of cells is contacted with a candidate agent. An effect of the contact on an activity of a GRS in the cells is determined and compared to the activity of the GRS in the second set of cells, which has not been contacted with the candidate agent. In some embodiments of the invention one or more cancer cells from such a culture or subject are included in a method of the invention to assess the cells' status with respect to a candidate agent. As used herein the term “cell status” means the status of the cells with respect to a condition, such as those described herein. For example, if a condition is cell differentiation the status of a cell may be determined to be not differentiated or differentiated. It will be understood that cell status will depend on the specific condition being assessed and that art-known means of assessing and determining the status of a cell are suitable for use in conjunction with methods of the invention.
[0037] Some embodiments of methods of the invention include selecting an agent to interfere at a preselected interaction in a GRS. For example in some embodiments of the invention, a candidate agent is selected at least in part because it interferes with an interaction between a TFB element and a TF complex of a GRS. In certain embodiments of the invention, a candidate agent is selected at least in part because it interferes with an interaction between two or more TF complex components. In some embodiments of the invention, a candidate agent is selected at least in part because it interferes with an interaction between a TF complex and a gene modifier element.
[0038] In some embodiments of the invention, identifying a target gene of a GRS provides information that can be used to aid in selecting a treatment for a subject with condition. In some embodiments, a cell or subject may be screened for a condition, assess to identify the presence or absence of the condition, or may be recognized as developing the condition at a future time. For example, if the condition is a cancer, a subject or cell may be identified as having the cancer or at risk of having the cancer. In another example, information on the age of a cell or subject can provide information on the developmental status of the cell or subject, thus providing information on the status of differentiation of a cell, plurality of cells, and/or subject. The identification of the presence and/or absence of a condition or stage in a cell or subject permits use of one or more methods of the invention to identify an agent with which to treat the condition in the cell and/or subject.
Conditions
[0039] Embodiments of methods of the invention can be used for identifying one or more characteristics of a condition and its regulation by a GRS. In non-limiting examples, certain embodiments of methods of the invention can be used to: (1) identify a GRS that modulates transcription of a target gene associated with the condition; (2) identify one or more interactions in a GRS having a target gene whose transcription is associated with the condition; (3) identify a an agent capable of interfering with one or more interactions in the GRS, the result of which alters regulation of transcription of the GRS target gene associated with the condition; (4) identify an agent that can be used to a condition associated with transcription of a target gene of a GRS; (5) identify a treatment for a cell and/or subject predicted to have, suspected of having, known to have, and/or known to have had a condition; and (6) selected and/or administer a treatment to a cell and/or subject predicted to have, suspected of having, known to have, and/or known to have had a condition. Non-limiting examples of condition associated with transcription of a target gene of a GRS, include: cell differentiation, cell growth, cell de-differentiation, cell division, cell death, a disease, a genetic disease, a cancer.
[0040] As used herein, the term “cancer” is used in reference to a malignant neoplasm. Exemplary cancers include, but are not limited to, acoustic neuroma; adenocarcinoma; adrenal gland cancer; anal cancer; angiosarcoma; appendix cancer; biliary cancer (e.g., cholangiocarcinoma); bladder cancer; breast cancer (e.g., adenocarcinoma of the breast, papillary carcinoma of the breast, mammary cancer, medullary carcinoma of the breast); brain cancer (e.g., meningioma, glioblastomas, glioma (e.g., astrocytoma, oligodendroglioma), medulloblastoma); cervical cancer (e.g., cervical adenocarcinoma); colorectal cancer (e.g., colon cancer, rectal cancer, colorectal adenocarcinoma); connective tissue cancer; epithelial carcinoma; ependymoma; endotheliosarcoma (e.g., Kaposi's sarcoma, multiple idiopathic hemorrhagic sarcoma); endometrial cancer (e.g., uterine cancer, uterine sarcoma); esophageal cancer (e.g., adenocarcinoma of the esophagus, Barrett's adenocarcinoma); Ewing's sarcoma; eye cancer (e.g., intraocular melanoma, retinoblastoma); familiar hypereosinophilia; gall bladder cancer; gastric cancer (e.g., stomach adenocarcinoma); gastrointestinal cancer; head and neck cancer (e.g., head and neck squamous cell carcinoma, oral cancer), throat cancer; hematopoietic cancers (e.g., leukemia such as acute lymphocytic leukemia (ALL); lymphoma such as Hodgkin lymphoma (HL) and non-Hodgkin lymphoma (NHL); multiple myeloma (MM); hemangioblastoma; kidney cancer (e.g., nephroblastoma a.k.a. Wilms' tumor, renal cell carcinoma); liver cancer (e.g., hepatocellular cancer (HCC), malignant hepatoma); lung cancer (e.g., bronchogenic carcinoma, small cell lung cancer (SCLC), non-small cell lung cancer (NSCLC), adenocarcinoma of the lung); leiomyosarcoma (LMS); mastocytosis (e.g., systemic mastocytosis); malignant mesothelioma; muscle cancer; myeloproliferative disorder (MPD); neuroblastoma; neurofibroma; neuroendocrine cancer; osteosarcoma; ovarian cancer; papillary adenocarcinoma; pancreatic cancer; penile cancer; prostate cancer; rectal cancer; rhabdomyosarcoma; salivary gland cancer; skin cancer; melanoma; small bowel cancer; soft tissue sarcoma; sebaceous gland carcinoma; small intestine cancer; sweat gland carcinoma; synovioma; testicular cancer; thyroid cancer; urethral cancer; vaginal cancer; and vulvar cancer.
[0041] A cancer may be a primary cancer or a metastatic cancer, and may be considered an early or late stage cancer, or a cancer stage in a subject may be characterized with one or more cancer staging classifications known and routinely practice in the art. In some aspects of the invention a cancer is a first cancer in a subject and in certain aspects of the invention a cancer may be a relapse or recurrence of a prior cancer. In some instances, an embodiment of a method of the invention may be used to assess a status of a cancer in a subject who has not been treated with a cancer therapeutic. In certain embodiments, a method of the invention is used to identify a GRS in which transcription of a target gene of the GRS is associated with the cancer. In some embodiments of the invention a cell and/or subject is administered an agent of the invention that interferes with an activity of the GRS and as a result modulates transcription of a target gene of the GRS that is associated with the cancer. In some embodiments the subject administered the agent has been or is currently being treated with one or more cancer therapeutics. Non-limiting examples of cancer therapeutics include: surgery, radiotherapy, chemotherapy, immunotherapy, dietary treatment, or other art-known therapeutic approach.
[0042] Certain embodiments of the invention include methods to assist in determining and/or selecting one or more therapeutic protocols for a subject. For example, though not intended to be limiting, some embodiments of the invention may be used to assist in selecting a treatment for a cancer or condition in a subject based, at least in part, on an identified activity of a GRS that regulates transcription of a gene whose transcription is associated with the cancer or condition. Identifying a GRS and its target gene associated with a cancer or condition in a subject using an embodiment of a method of the invention, permits selection of one or more therapeutics based on interactions in identified GRS and the effect on transcription of the GRS target gene resulting from interfering with tone or more of the GRS interactions. Methods of the invention may also be used to identify one or more specific GRS interactions, assess an effect on a GRS target gene of interfering with the one or more specific GRS interactions, and to aid in selecting a treatment for a condition associated with the transcription of the target gene.
[0043] For example, in a subject with ovarian cancer, interactions between a TFB element and a TF complex are identified as part of a GRS that regulates a cancer-promoter target gene associated with the ovarian cancer, the information can assist in selecting a treatment for the ovarian cancer that comprises administering to the subject an effective amount of an agent to interfere with the interaction TFB element and the TF complex to reduce transcription of the cancer promoter target gene and treat the ovarian cancer. In certain embodiments of the invention methods are provided that permit determining an efficacy of a candidate agent administered to a cancer cell or to a subject having a cancer, suspected of having a cancer, or at increased risk of having a cancer. Following administration of a selected treatment to the subject, a status of the cancer can be determined in the subject and compared to a control to assess the efficacy of the candidate agent in treating the cancer in the subject.
[0044] In some embodiments of the invention a candidate agent may be administered in combination with a second therapeutic agent and/or treatment. In some embodiments, a candidate agent is administered in combination with a second cancer therapeutic agent or in combination with another cancer treatment such as but not limited to one or more of: radiotherapy, chemotherapy, surgery, etc., and a time that is before, after, or interspersed with doses or administration of the candidate agent. In some embodiments, a candidate agent of the present invention is administered to a subject undergoing conventional chemotherapy and/or radiotherapy. In some embodiments the cancer therapeutic agent is a chemotherapeutic agent. In some embodiments the cancer therapeutic agent is an immunotherapeutic agent. In some embodiments the cancer therapeutic agent is a radiotherapeutic agent.
[0045] In addition to conditions comprising a cancer, methods of the invention can also be used to identify candidate agents to enhance or inhibit other conditions such as, but not limited to: cell differentiation, cell growth, cell de-differentiation, cell division, cell death, a disease, and a genetic disease.
Cells
[0046] It will be understood that a cell included in a method of the invention may be one of a plurality of cells. As used herein the term, “plurality” of cells may mean a population of cells. A plurality of cells may be all of the same type and/or may all have the same condition. As a non-limiting example, a cell may be obtained from a population of liver cells, and other cells obtained from this population of cells will also be liver cells. In some embodiments of the invention, a plurality of cells may be a mixed population of cells, meaning all cell are not of the same type. In another non-limiting example, a cell may be a cancer cell obtained from a plurality of cancer cells. In another non-limiting example, a cell may be a cell obtained from a plurality of cells at a preselected age or developmental stage. A cell used in an embodiment of a method of the invention may be one or more of: a single cell, an isolated cell, a cell that is one of a plurality of cells, a cell that is one in a network of two or more interconnected cells, a cell that is one of two or more cells that are in physical contact with each other, etc.
[0047] In some aspects of the invention a cell may be in a subject; may be obtained from a living animal, e.g., a mammal, a vertebrate, an invertebrate; or may be an isolated cell. An isolated cell may be a primary cell, such as those recently isolated from an animal (e.g., cells that have undergone none or only a few population doublings and/or passages following isolation), or may be a cell of a cell line that is capable of prolonged proliferation in culture (e.g., for longer than 3 months) or indefinite proliferation in culture (immortalized cells). In some embodiments of the invention, a cell is a somatic cell. Somatic cells may be obtained from an individual, e.g., a human, and cultured according to standard cell culture protocols known to those of ordinary skill in the art. Cells may be obtained from surgical specimens, tissue or cell biopsies, etc. Cells may be obtained from any organ or tissue of interest, including but not limited to: skin, lung, cartilage, brain, breast, blood, blood vessel (e.g., artery or vein), fat, pancreas, liver, muscle, gastrointestinal tract, heart, bladder, kidney, urethra, and prostate gland. In some embodiments of the invention a cell is a HF-3035 cell, or an HF-2354 cell.
[0048] In some embodiments, a cell used in conjunction with the invention may be a healthy normal cell, which is not known to have a disease, disorder or abnormal condition. In some embodiments a cell is a normal cell known to have a condition (for example to be at a particular developmental stage, etc. that is not an abnormal condition). In some embodiments, a cell used in conjunction with methods and compositions of the invention is an abnormal cell, for example, a cell obtained from a subject diagnosed as having a disorder, disease, or abnormal condition, including, but not limited to a degenerative cell, a neurological disease-bearing cell, a cell model of a disease or condition, an injured cell, etc. In some embodiments of the invention, a cell may be a control cell. In some aspects of the invention a host cell can be a model cell for a condition.
[0049] A cell that may be used in certain embodiments of the invention is a human cell. Non-limiting examples of a cell that may be used in an embodiment of a method of the invention are one or more of: eukaryotic cells, vertebrate cells, which in some embodiments of the invention may be mammalian cells. Non-limiting examples of cells that may be used in methods of the invention are: vertebrate cells, invertebrate cells, and non-human primate cells. Additional, non-limiting examples of cells that may be used in an embodiment of a method of the invention are one or more of: rodent cells, dog cells, cat cells, avian cells, fish cells, cells obtained from a wild animal, cells obtained from a domesticated animal, and other suitable cell of interest. In some embodiments a cell is an embryonic cell, an embryonic stem cell, or embryonic stem cell-like cell. In some embodiments the cell is a neuronal cell, a glial cell, or other type of central nervous system (CNS) or peripheral nervous system (PNS) cell. In some embodiments of the invention a cell is a natural cell and in certain embodiments of the invention a cell is an engineered cell.
[0050] Cells that may be used in embodiments of methods of the invention may be maintained in cell culture following their isolation. Cells may be genetically modified or not genetically modified in various embodiments of the invention. Cells may be obtained from normal or diseased tissue. In some embodiments, cells are obtained from a donor, and their state or type is modified ex vivo using a method of the invention. In certain embodiments of the invention a cell may be a free cell in culture, a free cell obtained from a subject, a cell obtained in a solid biopsy from a subject, organ, or solid culture, etc.
[0051] A population or plurality of isolated cells in any embodiment of the invention may be composed mainly or essentially entirely of a particular cell type, cells in a particular state, cells in a specific developmental stage, cells of a specific age, etc. In some embodiments, an isolated population of cells consists of at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% cells of a particular type or state (i.e., the population is at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% pure), e.g., as determined by expression of one or more markers or any other suitable method.
Controls
[0052] Certain embodiments of methods of the invention used to identify a candidate agent for modulating a condition, selecting a candidate agent to treat a condition, and treating a subject with a candidate agent to treat a condition. Methods of the invention, in some embodiments, comprise assessing transcription of GRS target gene(s) in cells, tissue, and/or subjects to determine one or more interactions between or among one or more of a TFB element, a TF complex, and a gene modifier element. Such assessments may comprise comparing results obtained in a sample cell, tissue, or subject with results obtained in a control cell tissue, or subject respectively. As a non-limiting example, some embodiments of the invention include determining an activity of a GRS in a sample cell and in a control cell, wherein the sample sall and control cell have a condition, and comparing the results as a measure of the difference in status of the sample cell and the control cell. In another non-limiting example, a status of an interaction in a GRS having a target gene associated with a condition is identified in a subject having the condition, the subject is subsequently administered a candidate agent intended to alter the identified interaction. The status of the subject can be determined before and after administration of the candidate and any change identified. It will be understood that results obtained from the subject not yet contacted with the candidate agent may be referred to as “control results” and the non-contacted subject as “a control subject”.
[0053] As used herein a control may be as described above and also may be a predetermined value, which can take a variety of forms. It can be a single cut-off value, such as a median or mean. It can be established based upon comparative groups. Other examples of comparative groups may include cells or subjects that have a specific condition and cells or subjects without the specific condition. Another comparative group may be a subject from a group with a family history of a condition and a subject from a group without such a family history. Another comparative group may comprise a cell at a specific age or developmental stage and cell at a different age or developmental stage. A predetermined value can be arranged, for example, where a tested population is divided equally (or unequally) into groups based on results of testing. Those skilled in the art are able to select appropriate control groups and values for use in comparative methods of the invention.
[0054] Candidate agent identification methods of the invention may be carried out in a cell or cells that are in a subject or in cultured or in vitro host cells. Candidate agent identification methods of the invention that are performed in a subject may include administration of a candidate agent to the subject, wherein the candidate agent is intended to disrupt an activity of a GRS in a cell in the subject. One or more interactions of the GRS may be determined, for example though not intended to be limiting by assessing the interactions themselves and/or by determining a transcription level of a target gene of the GRS, before and/or after administering the candidate agent. A result of contacting a cell, tissue, and/or subject with a candidate agent can be measured and compared to a control value as a determination of an efficacy of the candidate agent in disrupting regulation of a target gene by a GRS.
Compositions
[0055] A composition used in a method of the invention can but need not be a pharmaceutical composition. The term “pharmaceutical composition” as used herein, means a composition that comprises at least one pharmaceutically acceptable carrier that is useful in preparing a pharmaceutical composition that is generally safe, non-toxic, and neither biologically nor otherwise undesirable. A pharmaceutical composition may be used in certain embodiments of methods of the invention, a non-limiting example of which is for administering a candidate agent to a cell or subject to disrupt an activity of a GRS and alter regulation of a target gene of the GRS.
[0056] In certain aspects of the invention a pharmaceutical composition comprises one or more candidate agents, with one or more additional molecules, therapeutic agents, candidate agents, candidate treatments, and therapeutic regimens that are also administered to a cell and/or subject. A pharmaceutical composition used in an embodiment of a method of the invention may include an effective amount of a candidate agent to do one or more of: reduce an activity of a GRS; alter transcription of a target gene of the GRS in a cell and/or subject; alter a status of a condition in a cell and/or subject, etc. In some embodiments of the invention, a pharmaceutical composition of the invention may include a pharmaceutically acceptable carrier.
[0057] Pharmaceutically acceptable carriers include diluents, fillers, salts, buffers, stabilizers, solubilizers and other materials that are well-known in the art. Exemplary pharmaceutically acceptable carriers are described in U.S. Pat. No. 5,211,657 and others are known by those skilled in the art. In certain embodiments of the invention, such preparations may contain salt, buffering agents, preservatives, compatible carriers, aqueous solutions, water, etc.
[0058] Delivery of a candidate agent to a cell or a subject may be achieved by various means described herein and other art-known means. Such administration may be done once, or a plurality of times. If administered multiple times to a subject, one or more therapeutic agents may be administered via a single or by different routes. For example, though not intended to be limiting: a first (or the first few) administrations may be made directly into a tissue in the subject to be treated, and later administrations may be systemic.
[0059] The amount of a candidate agent delivered to a cell or subject may, in certain embodiments of the invention, be an amount that statistically significantly reduces an interaction in a GRS and alters a level of transcription of a target gene of a GRS. Suitable amounts can be readily determined by a practitioner using teaching provided herein in conjunction with art-known methods, for example clinical trials, and without a need for undue experimentation.
[0060] The following examples are provided to illustrate specific instances of the practice of the present invention and are not intended to limit the scope of the invention. As will be apparent to one of ordinary skill in the art, the present invention will find application in a variety of compositions and methods.
EXAMPLES
Example 1
Methods for Examples 2-4
Cell Culture
[0061] Mouse embryonic stem cells (ESC) E14 were cultured under feeder-free conditions on 0.1% gelatin coated dishes in Knockout DMEM (Life Technologies) supplemented with 15% FBS (Hyclone), 2 mM L-glutamine (Life Technologies), 0.1 mM non-essential amino acids (Life Technologies), 100 U/ml Penicillin/Streptomycin (Life Technologies), 0.05 mM 2-mercaptoethanol (Sigma), 1,000 U/ml ESGRO mouse LIF Medium Supplement (Leukemia Inhibitory Factor) (Millipore) and maintained at 37° C. with 5% CO2. Cells were fed daily. Primary wild type WT B6 Neo and CRISPR knockout ES cell lines were cultured on irradiated mouse embryonic fibroblast (MEF) feeder layer with high glucose DMEM (Sigma) supplemented with 15% ES Cell FBS (Gibco), 1×non-essential amino acids (Gibco), 1×Glutamax (Thermo Fisher), 100 U/ml Penicillin/Streptomycin (Gibco), 1 mM sodium pyruvate (Gibco), 0.1 mM 2-mercaptoethanol (Gibco) and further supplemented with PD0325901 and CHIR99021 (Selleckchem). Cells were cultured onto feeder-free 0.1% gelatin coated dishes in Knockout DMEM (Life Technologies) prior to harvest.
Chromatin Immunoprecipitation (ChIP)
[0062] Cells were harvested with trypsin (Invitrogen) and suspended in KO-DMEM (Gibco). Cross-linking was performed with 1.5 mM EGS (ethylene glycolbis succinimidylsuccinate) (Sigma) for 45 min followed by 1% formaldehyde for 10 min at room temperature with constant shaking. The reaction was quenched with 0.2M Glycine (Sigma). The cells were washed with PBS (Ambion) supplemented with Protease Inhibitor (Roche). Cells were lysed twice in Lysis buffer (0.1% SDS, 50 mM HEPES-KOH pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% sodium deoxycholate) for 15 min in 4° C. and centrifuged at 1000×g for 10 min. The cells were then sonicated (Branson) in Shearing Buffer (1.0% SDS, 50 mM HEPES-KOH pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% sodium deoxycholate) for 3 min. The sheared chromatin was pre-cleared in 50 μl of Protein A and G Dynabeads (Invitrogen). The pre-cleared chromatin was incubated on the antibody containing Dynabeads overnight in 4° C. for immunoprecipitation. Antibodies used are anti-SUZ12 (ab12073, Abcam), anti-EED (ab4469, Abcam), EZH2 (#39875, Active Motif), H3K27me3 (ab6002, Abcam), RNAPII (MMS126R, clone 8WG16, Covance) and CTCF (ab70303, Abcam). The beads were washed three times in Lysis Buffer, one time in High Salt Lysis Buffer (50 mM HEPES-KOH pH 7.5, 350 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% sodium deoxycholate, 0.1% SDS), followed by a wash in Washing Buffer (10 mM HEPES-KOH pH 7.5, 250 mM LiCl, 1 mM EDTA, 0.5% NP-40, 0.5% Sodium deoxycholate) and finally resuspended in TE buffer.
ChIP-Seq Library Construction
[0063] Immunoprecipitated DNA was treated with end-repair, A-tailing, and ligation of Illumina compatible adapters (IDT, Inc) using the KAPA-Illumina library creation kit (KAPA biosystems). The ligated product was amplified with 8 cycles of PCR (KAPA biosystems). Libraries were sequenced on Illumina Miseq, Nextseq and Hiseq platforms.
ATAC-seq
[0064] ATAC-seq was performed on E14 cell lines as previously reported [Buenrostro, J. D., et al., Nat Methods 10, 1213-8 (2013)]. Libraries were sequenced on Illumina Miseq.
ChIA-PET Library Construction
[0065] ChIA-PET library was prepared as previously describe [Fullwood, M. J. et al. Nature 462, 58-64 (2009)] with the following modifications. The proximity ligated chromatin complex was eluted with 1% SDS (Ambion) and de-crosslinked using proteinase K (Invitrogen) and purified using Zymo ChIP DNA Clean & Concentrator (Zymo Research). The purified fragments were tagmented using the Nextera DNA Sample Preparation Kit (Illumina). The linker ligated ChIA-PET constructs were selected using Sera-Mag Speed Beads Streptavidin-Blocked Magnetic Particles (GE Healthcare). The magnetic beads were blocked with yeast tRNA (Ambion) prior to the selection. The streptavidin selected constructs were amplified with 8-10 cycles of PCR and purified using Ampure XP beads (Beckman Coulter). For the primary mES B6NJ and KO cell clones, the library were prepared with an in situ approach where crosslinked cells were lysed and digested with AluI enzyme (NEB). Fragmented DNA ends were A-tailed and ligated with biotinylated linker overnight [Tang, Z. et al. Cell 163, 1611-27 (2015)]. The ligated chromatin were then sheared by sonication and immunoprecipitated with anti-Ezh2 antibody. The immunoprecipitated DNA were subjected to tagmentation, biotin selection and amplification. Libraries were sequenced on Illumina Nextseq, Hiseq and Novaseq platforms.
RNA-Seq Library Construction
[0066] Total RNA was extracted using the RNeasy Mini Kit (Qiagen). RNA-seq libraries were generated using the Illumina Truseq Stranded RNA LT kits. mRNA was purified from of total RNA using magnetic beads containing poly-T oligos. RNA was fragmented using divalent cations and high temperature. The fragmented RNA was reversed transcribed using random hexamers and reverse transcriptase Superscript II (Invitrogen) followed by second strand synthesis. The fragmented cDNA was treated with end repair, A-tailing, adapter ligation and 10 cycles of PCR. Libraries were sequenced on the Illumina Hiseq and Novaseq.
CRISPR/Cas9 Targeted Knockout Mouse Generation and Characterization
[0067] The target regions screened are listed in Table 1. Cas9 RNP including Cas9 protein and sgRNA were electroporated into around 100 C57BL/6NJ mouse zygotes using the ZEN (zygote electroporation of nucleases) technology [Wang, W., et al., Methods Mol Biol 1605, 219-230 (2017)]. After electroporation, 15 zygotes were transferred to a pseudo-pregnant mouse to generate KO mice, 4 transfers for each gene locus. The remaining zygotes were kept in culture in vitro. When these zygotes entered blastocyst stage, they were plated into 96-well plates with MEF feeder cells to generate mouse ES cells. Around 80% of the plated blastocytes successfully generated ES cells. The ES cells were kept in culture, expanded and genotyped for genomic loci KO using the established genotyping strategies. With this method, the brightness of the intermediate band approximately indicate the amount of cells with gene KO. The mouse ES cells with the brightest intermediate band were used for single cell clone screening as described before. Briefly, the ES cells were diluted and plated on a 10 cm dish with MEFs cells as the feeder layer. The single clones grew after plating and were picked and transferred to 96-well plates. The ES cells from single clones were expanded and genotyped using similar strategies (
[0068] For KO mice generation, Founder (F0) mice were genotyped to screen for deletion events by PCR across the cutting sites of expected deleted regions and the confirmed heterozygous female were bred with wild-type male to expand the knockout lines. For embryonic analysis, a single allele from the chr9 line was expanded, timed mating performed, and embryos dissected and examined at embryonic day 9.5 (E9.5). For assessing viability, only viable (visible heartbeat) embryos with unambiguous genotypes were considered.
TABLE-US-00001 TABLE 1 Target regions screened identified as #s 1-18, 20, and 21 and primers used with each. target Successful Successful span KO ES Connecting # Actual CRISPR target (bp) mice clones genes Gene name 1 chr19: 44741648- 10252 12 1700039E22Rik; Pax2; Gm20467; Nkx2- 44751900 3; Hpse2; Kazald1; Lbx1; Lzts2; Pdzd7; Tlx1; Tlx1os; Wnt8b 2 chr11: 119051389- 10295 ✓#1 20 2810410L24Rik; Cbx2; Cbx4; Cbx8; Gm11754; 119061684 Gm26508; Ccdc40; Tbc1d16; Gm11762; Nptx1; Gm26888; Gm29292; Sphk1; Rnf213; Myh4; Otx1; Rbfox3; Wnt3; Hoxb3; Hoxb3os 3 chr2: 18603995- 10465 13 A930004D18Rik; Gm13330; Alx4; Bmi1; 18614460 Commd3; Carlr; Gm13344; Gm45314; Nebl; Ptf1a; Ptf1aos; Spag6; Skida1 4 chr5: 28113078- 10223 ✓#2 5 9530036O11Rik; Gm26894; Shh; En2; Mnx1 28123301 5 chr9: 37451506- 10215 ✓#3 ✓ 13 B230323A14Rik; Foxb1; Esam; Msantd2; 37461721 Nrgn; Siae; Vsig2; Pknox2; Robo3; Gm10715; Gm10717; Gm17535; Gm26870 6 chr5: 67225652- 10638 8 Shisa3; Hmx1; 4930458D05Rik; Gpat3; 67236290 Limch1; Nkx3-2; Phox2b; Slc5a1 7 chr8: 92455488- 10714 12 AV026068; Gm28063; Hand2; Crnde; Irx5; 92466202 Gm45450; Irx3; Irx3os; Gm45505; Irx6; Mmp2; Slc6a2 8 chr3: 107577997- 10327 ✓#4 ✓ 10 AI504432; Gm27008; Kcna3; Alx3; Csf1; 107588324 Gm43120; Tbx15; Kcna2; Kcnc4; Slc6a17 9 chr5: 33690271- 10445 6 Fgfr3; Nat8l; Gm43851; Nkx1-1; Nkx6- 33700716 1; Nsd2 10 chr5: 147216884- 10404 8 Cdx2; Flt3; Gm26597; Gsx1; Pdx1; Plut; 147227288 Uncx; Urad 11 chr7: 44423075- 10478 4 Aspdh; Lrrc4b; Shank1; Clec11 a 44433553 12 chr7: 143440438- 10278 ✓#5 ✓ 10 Ascl2; Cdkn1c; Gm44732; Igf2; Igf2os; Kcnq1; 143450716 Phhkla2; Asphd1; Gm21984; Sez6l2 13 chr9: 89874601- 10369 Adamts7; B230323A14Rik; Foxb1; Gm17226; 89884970 Isl2; Gm29478; Zic4; Rasgrf1; Zic1; 4930524O08Rik 14 chr15: 103082922- 10448 14 D930007P13Rik; Gm10830; Gm28265; 103093370 Gm28876; Hoxc10; Hoxc11; Hoxc12; Hoxc13; Hoxc4; Hoxc8; Hoxc9; Hotair; Hoxc5; Hoxc6 15 chr15: 103056055- 10170 15 Fignl2; Gm10830; Gm28265; Gm28876; Hoxc10; 103066225 Hoxc12; Hoxc13; Hoxc4; Hoxc6; Hoxc8; Hoxc9; Krt77; Plec; Hoxc11; Hoxc5 16 chr1: 78213447- 10179 17 Asic4; BC035947; Mogat1; Cdk5r2; Gm16582; 78223626 Dock10; En1; Erbb4; Gm16076; Fev; lhh; Hlx; Pantr1; Pax3; Sgpp2; Speg; Tfap2b 17 chr5: 119656273- 10308 12 1700021F13Rik; Gm16063; Tbx3os1; Gm16064; 119666581 Tbx3; Tbx3os2; Gm27199; Lhx5; Tesc; Gm43050; Tbx5; Hrk 18 chr15: 99092298- 4273 14 Adcy6; Aqp2; B130046B21Rik; Ddn; C1ql4; 99096571 Dnajc22; Cacnb3; Dhh; Kcnh3; Prph; Wnt1; Wnt10b; Troap; Tuba1c 20 chr2: 18690135- 5418 ✓#6 ✓ 18 1810010K12Rik; 4930426L09Rik; Pip4k2a; 18695553 A930004D18Rik; Gm13330; Bmi1; Commd3; Spag6; C130021l20Rik; Lmx1b; Carlr; Gm13344; Lhx2; Nr5a1; Nr5a1os; Ptf1a; Ptf1aos; Skida1 21 chr19: 45221437- 8348 15 Atrnl1; Fgf8; Gm15491; Npm3; Gm20467; 45229785 Nkx2-3; Gm29595; Kazald1; Lbx1; Pax2; Pdzd7; Sfxn3; Psd; Tlx1; Tlx1os SEQ SEQ SEQ ID ID ID # NO gRNAup NO gRNAdown NO PCR primer F1 1 2 TTTCGCCGCGGAAGC 22 GCTCGGCGCTAGTA 42 ACGATGCTAATTACGGGGT AGATT CTATTC GC 2 3 GGCTCTCACAGGTATA 23 GTCCATGGGATTCT 43 GTGTCTGTAGCTCCCATCCC GACC ACTCCT T 3 4 GTGCTGTCACGCTAAA 24 TACCCTAGGCCCTG 44 CTCCTTAAACATGCTATGGC GAAT GTGAAC ACTGC 4 5 GTCATTTGAACATGGC 25 CCGTGCGTGTCACA 45 GAGAGAGTGATTTCTGGCAT TACC CCGTAC GGG 5 6 GGACCCTACACAGATA 26 AAGTAACTAGGTTG 46 CTGGTACCCACCATATACAT GGCT TCTGAT AGGACA 6 7 TTCCTGAAGTCTGTTG 27 CATCCATGGGATGC 47 ATGTAACCCTGGCAGAGAT TCGC TATTTA CTGC 7 8 GACTAAGCCCTCTTTC 28 ACTCTGCGTTGAAC 48 GGCATGAAGGTGTACATGC CCCA CATTCT AGA 8 9 GCTGCTGGCCCACAA 29 GCAAGCTTATCATA 49 AAGGCACAGCTGTATTGCCT TCTGG CAACTG G 9 10 AGCCACCAGCTTATGC 30 GCTCCGGTGTTGAC 50 TGACGTTCCCATTTCCTGAC CCGG TTACCT CTT 10 11 TGTGGTCCCCGCCAT 31 GCAGCGTGCGGGG 51 CCATATGATCTGGCTCCTTC AATCC AATGAGT CAC 11 12 GACCCCAGGCACAGT 32 CCAATAAGTCACTA 52 AGATTCTAGGCAGGAGCTC CTTAT GGGGCG TACCA 12 13 GTCAACCGTCTTGGCT 33 GTGATGCATAAATG 53 GGTTGTTGTTGCTGCTGCTA TCGA CAGTGC CT 13 14 TTAAGTGTCACCGGTA 34 GGCTAGACGAGAAC 54 TCTCAGATGCTAAGAGGATC GCCA TAGTGA CCTC 14 15 ACTCTTGCTGACCATC 35 TTGGAGAAGGGTAG 55 CTTAGGGTTCATCCTGGGTC ACCG TAAGAC TCT 15 16 CTGCTCCATATCCTTG 36 TAGGCCTTTCAGAT 56 CTCACTGATAGTGGCCATCA GAGC GATGCC CAAG 16 17 CAATCTCTGTAGTGAA 37 CTCTTCGCCGCACA 57 GATGGCACACACCTTTGATT GGTA GTACTC CCAG 17 18 ATTTGCTATCAGGCTA 38 TCAGAGAACTCTTTT 58 GACTCAGGCAGTTTACCTG AGGC TGGAC GATG 18 19 CATCGTATTCTTTTGC 39 CCGTCGCTTTTCATT 58 GCAGTCAGTGCTCTTAACCA ATCC CCGGG CTGA 20 20 GCTCAAGGCGCGAAC 40 CTAGACCCTTAAGA 60 GGAACTGGGAACCTAAACT ACCCG CATACG GTGG 21 21 AGGACAGCCTGCGTA 41 AGCGATCAAGGAAC AGCTTAAAGCGGCTACTGC CATCA TCTGGG ATG SEQ SEQ SEQ SEQ ID ID ID ID PCR primer # No PCR primer R1 NO PCR primer F2 NO: PCR primer R2 NO R26 1 62 GAGAGGGGAAG 82 TTCCTGTAGGCTG 102 AAAGGGGCCTCA GGAGTTATCGT TAGGGTGAA TACTGGCA TT 2 63 TTCCACTAGGA 83 AGACTCCAGGAC 103 CCCTCTTTCCAT GTGTCCATGGT ATTCCCTGAT CCAGGAAACTCA 3 64 TGGTAGAAAGA 84 CCTCAGACCACTG 104 GCCAGCAGGAA AGACAGCCTCA GAGCCATTT CCAAATCTGTT GC 4 65 GGCTGTGAGCT 85 TTCTATCAAAGAG 105 CGAAGTACGAGC GTAGAGTTATCT TCGCCAGGGG AAGGTAAGTCG AGG 5 66 ACATCCTCTGTA 86 AAGCCCTCTGTGA 106 TTACCATACTAG 122 AGGGTGGCA GGACTTAGGGG TGACCCT TCACCCGGCAG GACTGTCAC A AGTCTC 6 67 TTCACACTGTCA 87 TCTCTACTTAGGG 107 GCCTGCACAGTT TTGTCCGCG GCAGTGAGAC CTGCACTT 7 68 TCTGTGCCTCA 88 CCTGTTCATGATG 108 CTGTCATCTTCC CTGTTGATGAG CATCTCTGTCA ACAGACCTGTCA A 8 69 GGAAGCAGGTT 89 AGAGAAGAGCTG 109 ATGGCAAGCAAG AGTCCTGTAGT CTGTGCATGT CCTCAAACTAG CC 9 70 AGTTAGCAGCT 90 GCTTCCTGATCAG 110 ATCTTCCCAAGC CTCATGAACCC ATGGCAACA GGTCCACAT A 10 71 ACATACCACAG 91 ACTCTAAGCCATA 111 AAGCTGGACTTC AGGGCATTGGA GTTGCCCACC TCCCAAGCTT T 11 72 TGTGGAAAGAG 92 TGCTGACTAGAGT 112 GCAAAACTCTAC TGTTGCATCAT CTCTCAGGGA CTCTGAGCCAC GG 12 73 TGGCAGAGTGA 93 CCACTGATGAAG 113 CACAAAATAACA TACTGCTGCA GCTCTTGGATT GCAAGCTCCCCT 13 74 CTGGGCCATAT 94 ATGGACATATGCG 114 TGGCTCTCCTCA CTATTGGTAGC AAGGGTGAGT GAAGCATGAT CT 14 75 GGTGTAGAAAG 95 GGACACATTCAAT 115 GGATTGAACCCA TGACAGACTCC CATCCAAATCCCT AGGCTTTGAGC ACA 15 76 ACACAGAGTAT 96 CCCACTCTTCCTG 116 AGCTCTAAGGCC GATCCGATCCA TTACACTATCTGC AGTGGATATACC CC 16 77 TAGATGCCATTT 97 CCGTTACATCTGA 117 GACGACTCTGAA GTAGCTCAGCC ACCTGTGTTGA TTCTGCTCATTG G 17 78 CAACTTTGGAG 98 GGTGCTAGGGAC 118 TGGTGCTTTGAG ACCAGAGACTG AGAAATGGAAC GAAGCATCCT C 18 79 TTCATCCCTCCT 99 AGCAGAGGTAGA 119 GCTTCCCAATCA TTTCCTGTACCC GCTTCCTTGTTG GGAATATCGACC 20 80 CAGATACAGAA 100 GGAATAGGGAAA 120 TGAGCACACCAT GCTCAATCCCG GCCATGTGTTGG TCAGTTGTGC AAG 21 81 CATCCTGAAGG 101 AGGAACCGAAAG 121 GAACTCCAGGTT GCATGAGGGAT TGGTCTGCA TCACCGAAGAG A
Phenotyping Screening
[0069] Systematic mouse phenotyping screen was conducted for five homozygous silencer KO strains using a broad-based phenotyping pipeline [Dickinson, M. E. et al. Nature 537, 508-514 (2016) and Meehan, T. F. et al. The International Mouse Phenotyping Consortium. Nat Genet 49, 1231-1238 (2017)] established by the Knockout Mouse Phenotyping Program (KOMP2) and the International Mouse Phenotyping Consortium (IMPC). The JAX KOMP2 pipeline assessed 14 major domains of 126 traits associated with development, behavior and physiology. To determine the significance of the phenotypes changes, cohorts of at least five age-matched, sex-matched wild-type C57BL6/NJ mice were phenotyped alongside for each test. Statistical analysis was performed using PhenStat R package [Kurbatova, N., et al., PLoS One 10, e0131274 (2015)]. For categorical data including eye and shirpa procedure, Fisher's Exact test was used, while continuous data analysis was performed using Linear Mixed Model framework in PhenStat which uses linear mixed models in which batch (date of test) was included as a random effect and body weight as a covariate. The association of significance were adjusted for multiple testing using the Benjamini-Hochberg procedure [Benjamini, Y. & Hochberg, Y. Journal of the Royal Statistical Society. Series B (Methodological) 57, 289-300 (1995)] to control the FDR at 5%.
Confirmation of the Deletion Regions in the KO ES Clones
[0070] DNA was extracted using All Prep DNA/RNA Mini kit (Qiagen) according to manufacturer's instruction. PCR was performed using with 2×Kapa HiFi HotStart Ready Mix (Kapa Biosystems) with 3 min denaturation at 95° C., followed by 25-30 cycles of 20 s at 98° C., 15 s at 65° C. and 15 s at 72° C. and a final elongation of 1 min at 72° C. Primer sequences used are listed in Table 1.
[0071] To detect the deletion events in the target loci, a strategy using two pairs of primers (F1/R1/F2/R2) was used. In the control group, when the two pairs of primers are used in the PCR reaction, the first pair (F1/R1) yields a PCR product around 600 bp and the second pair yields a PCR product around 200 bp. In the electrophoresis analysis, there will be two bands at 600 bp and 200 bp respectively. If a deletion event is generated, primers R1 and F1 lost their binding site. Only F1 and R2 are functional to generate a PCR product around 400 bp in length (
ChIA-PET Data Processing, Interaction Calling and Annotation
[0072] ChIA-PET data was processed with ChIA-PET Utilities, a scalable re-implementation of ChIA-PET Tools [Li, G. et al. Genome Biol 11, R22 (2010)] (see code availability). Briefly, sequencing adaptors incorporated during the tagmentation reaction in the library construction process were removed from the paired reads. To distinguish chimeric ligation events from intra-molecular ligation, two types of linker-ligated chromatin fragments (linkers A and B) were used at equal amounts in the proximity ligation [for details see Zhang, Y. et al. Nature 504, 306-310 (2013)]. The paired reads were binned into either intra-molecular (A-A or B-B) or inter-molecular (A-B) PETs based on their linker sequence and only the intra-molecular ligated PETs were analyzed. Tags identified (>=18 bp) were mapped to mouse genome (mm10) using BWA alignment [Li, H. & Durbin, R. Bioinformatics 25, 1754-60 (2009)] and mem [arXiv:1303.3997 [q-bio.GN], //arxiv.org/abs/1303.3997] according to their tag length. The duplicated pair-end tags arising from clonal PCR amplification were filtered and the uniquely mapped, non-redundant PETs were calssified as inter-chromosomal (L tags and R tags mapped onto different chromosomes), intra-chromosomal (L tags and R tags mapped onto the same chromosome with genomic distance >8 Kb) and self-ligation PETs (L tags and R tags mapped onto the genome <8 Kb). Multiple intra-chromosomal PETs whose respective ends found within 1 Kb were then clustered as iPET-2, 3 . . . . The 1 Kb distance was chosen because of the broader PRC2 binding profile in distance. Further statistical assessment of the PET clusters interaction significance was performed using ChiaSigScaled (see code availability), a scalable re-implementation of ChiaSig [Paulsen, J., et al., Nucleic Acids Res 42, e143 (2014)]. Interaction clusters with member size 3 and above (iPET 3+) and FDR<0.05 were reported.
[0073] In the process of constructing ChIA-PET libraries, Tn5 transposon mediated tagmentation was applied to generate chromatin fragments with compatible ends for Illumina library adaptors. Tn5 has known tagmentation bias towards certain sequence context, which resulted in excess sequence coverage and false-positive interaction calls at specific genomic locations. These regions can be defined by their exceptionally high level of ChIP enrichment defined by reads from ChIA-PET sequences regardless of the protein factors used. To distinguish these regions, peak calling was applied onto approximate 600 million reads collected from multiple ChIA-PET libraries using MACS2 (see Binding peak calling in ChIP-seq analysis) and normalized by ChIP-seq input data, to derive 52,964 peak regions with fold-enrichment ranging between 1.2 to 12144 (median: 2.3; 99.sup.th percentile: 22.7). Based on the distribution of the fold-enrichment scores, 53 most enriched regions (minimum fold-enrichment is 115, top 0.1% ranked in enrichment scores) were defined followed by visual inspection of their read coverage profiles across multiple tagmentation based ChIA-PET libraries. These regions (See Table 2) were treated as the blacklist regions and used to remove any interactions with whose anchors overlapped from further analysis.
TABLE-US-00002 TABLE 2 Fifty three most enriched regions, Numbers 1-53, with chromosomal (Chr) location included start (Chr start) and end (Chr end). Fold enrichment results shown in final column. Fold Number Chr ChrStart ChrEnd enrichment 1 chr2 98,666,024 98,667,551 12144.41 2 chr8 25,227,103 25,227,590 11375.78 3 chr2 98,662,003 98,663,209 3356.67 4 chr9 3,021,878 3,028,024 1901.89 5 chr6 103,648,861 103,649,501 1646.09 6 chr2 98,664,665 98,665,405 1618.29 7 chr12 3,109,648 3,110,338 1386.80 8 chr9 35,304,988 35,305,818 1156.19 9 chrX 143,482,782 143,483,325 935.76 10 chr2 61,265,121 61,265,604 911.77 11 chr9 2,999,794 3,006,174 745.21 12 chr10 60,445,607 60,446,088 733.63 13 chr9 3,006,314 3,007,746 633.36 14 chrX 129,348,231 129,348,497 541.41 15 chr14 45,812,598 45,813,065 539.53 16 chr12 79,729,401 79,729,882 501.03 17 chr18 51,252,579 51,252,832 476.15 18 chr11 74,700,383 74,700,868 454.40 19 chr14 19,415,533 19,419,929 430.53 20 chr13 104,999,507 104,999,987 367.32 21 chr11 34,085,202 34,085,463 365.04 22 chr4 57,768,187 57,768,440 321.74 23 chr2 179,753,826 179,754,308 317.05 24 chr16 93,685,746 93,687,407 311.99 25 chr2 123,634,730 123,634,989 262.27 26 chr7 90,441,768 90,442,225 246.70 27 chrUn_GL456389 7,936 14,143 235.83 28 chr10 8,649,716 8,650,194 222.84 29 chr2 158,316,180 158,317,622 221.49 30 chr17 93,046,209 93,046,741 219.62 31 chr9 3,028,556 3,029,026 213.83 32 chrUn_JH584304 87,803 88,520 211.69 33 chrUn_JH584304 103,306 104,047 200.95 34 chrUn_GL456392 14,421 23,718 191.95 35 chr10 121,763,017 121,763,489 188.31 36 chr2 173,268,039 173,268,464 186.51 37 chr4 79,115,927 79,116,405 162.63 38 chrUn_GL456396 8,118 15,827 158.50 39 chr8 98,154,789 98,155,039 150.52 40 chr3 74,382,342 74,382,602 144.98 41 chr19 12,050,100 12,050,358 144.06 42 chr1 129,209,097 129,209,572 139.94 43 chrUn_JH584304 72,619 73,538 138.91 44 chr9 3,015,051 3,016,561 130.27 45 chr17 72,058,977 72,059,256 129.16 46 chr5 133,533,159 133,533,412 124.00 47 chr9 24,541,804 24,542,376 123.59 48 chr17 67,741,184 67,741,803 122.74 49 chr9 3,018,126 3,020,756 116.76 50 chr14 93,623,941 93,624,494 116.13 51 chr3 76,527,193 76,527,450 115.41 52 chr10 72,297,019 72,297,568 115.36 53 chr9 3,031,653 3,032,932 115.05
[0074] Next, the interactions were classified based on their anchors overlapped with gene models in gencode.vm14.grcm38 (accessed date 2017 Oct. 3). Each anchor was annotated with gene that overlapped at 1 bp overlap. To classify each anchor, priority was given to promoter (P) region (defined as ±2.5 kb of TSS) followed by gene region (G). Anchors that do not overlap with any gene or promoter region were classified as intergenic (I). The interaction classification is just the combination of its anchors classification with additional prefix “s” should both anchors overlap common gene(s).
ChIP-Seq Data Analysis
[0075] Single-end reads were quality trimmed along with the adapter if present using cutadapt (options: -e 0.2 -a AGATCGGAAGAGC (SEQ ID NO: 1) --minimum-length 20 --trim-n -n 3). The trimmed-reads were mapped on the mm10 genome using ‘bwa aln’, and only the reads mapped uniquely onto the genome were collected followed by removing duplicates. Peak calling was performed on ChIP-seq and ChIA-PET reads using MACS2.1.0.20151222 [Liu, T. Methods Mol Biol 1150, 81-95 (2014] with flags --keep-dup all --nomodel --extsize 250 -B -SPMR -g mm. Narrow peaks results were collected for all factors, except H3K27me3 where broad peaks were called. Besides the data generated, ENCODE public data sets were also included. Using the same pipeline, H3K27ac (ENCFF001KFX) and H3K4me1 (ENCFF001KFE) were processed with ENCFF071UWJ as the input control. The procedures included downloading and using the pre-calculated fold-change enrichment data for H3K9me3 (Encode bigWig file ENCFF857TIJ).
Consistency Between ChIA-PET Biological Replicates
[0076] To assess the consistency of ChIA-PET replicates, correlation analysis among replicates was performed. First, interaction matrix with 500 kb binning containing iPET counts was constructed for each library. Blacklist regions were excluded from computation. In addition, a matrix aggregated from all libraries with the same protein factor was calculated to select the bins representing frequent interacting regions. This selection was made to minimize effect of predominant sparse interactions (zero elements in the matrices) when calculating the correlation. The sums of every bin in the aggregate matrix were computed. The 20% bins with the highest counts were selected to be included in correlation computation. Pairwise Pearson's correlation coefficient, r, was computed for libraries within the same protein factor. r values were influenced by the sequencing depth so replicates with lower numbers of sequencing reads generally yielded lower r values.
RNA-Seq and Differential Gene Expression Analysis of the KO ES Lines
[0077] Reads were trimmed using Trim Galore! [//github.com/FelixKrueger/TrimGalore] to remove adapters and low-quality portion of the reads. Trimmed reads were aligned to mm10 genome and gencode.vm14.grcm38 transcripts with hisat2 (version 2.1.0) [Kim, D., et al., Nat Methods 12, 357-60 (2015)]. To ensure accuracy in read-to-transcript assignment, gene models known as not transcribed by RNA polymerase II like pseudogenes, snoRNA, snRNA, miscRNA and riboRNA were removed to yield 30,517 gene models for subsequent RNA-seq analysis. HTSeq [Anders, S., et al., Bioinformatics 31, 166-9 (2015)] was used to quantify the mapped transcripts, with parameters for reverse strandedness (-s=reverse) and assigning reads that are assigned to more than one feature to all aligned featured (−nonunique=all). Using these counts, differential gene expression analysis was performed with R package DESeq2 [Love, M. I., et al., Genome Biol 15, 550 (2014)]. The following analysis was performed for each dataset—si-Δchr9 (N.sub.si-Δchr9-F1=2, N.sub.si-Δchr9-G9=3) and wildtype (N.sub.wildtype=3) or si-Δchr7 (N.sub.si-Δchr7-F4=3, N.sub.si-Δchr7-D4=3) and wildtype (N.sub.wildtype=3)—separately. First, the counts were normalized using DESeq2's built-in count normalization approach (e.g. counts(dds, normalized=TRUE)). Then, differential expression analysis was performed using DESeq2 between knock out and wildtype and applied shrinkage for log 2 fold change estimation using lfcShrink from the DESeq2 package. P-values were adjusted using the method of Benjamini and Hochberg [Benjamini, Y. & Hochberg, Y. Journal of the Royal Statistical Society. Series B (Methodological) 57, 289-300 (1995)]. Genes were considered dysregulated (differentially expressed) when the adjusted p-value <0.05 and either log 2 fold change >2 or log 2 fold change <−2.
Feature Analysis of PRC2 Bound Distal Regulatory Elements (DRE)
[0078] The features explored were open chromatin, TFBS and enhancer frim the ENSEMBL regulatory build [Zerbino, D. R., et al., Genome Biol 16, 56 (2015)], the key pluripotent TFBS [Chen, X. et al. Cell 133, 1106-17 (2008)], and CGI from UCSC Genome Browser [Gardiner-Garden, M. & Frommer, M. J Mol Biol 196, 261-82 (1987)]. Specifically, the fold enrichment is the fraction of observed overlap between the 1800 DREs and the feature against the expected background established from 1000 simulations. For each simulation, the DREs were randomly permuted on the chromosome with shuffleBed disallowing overlapping amongst the permuted DREs, the N regions and blacklist. The number of the shuffled DREs that overlap the features is recorded to establish the average and standard deviation of the expected background. The Z-score/standard score is computed as the signed fractional number of the background standard deviations by which the empirical observations is above the background mean.
Gene Ontology Analysis
[0079] GO enrichment analysis was performed on 5,825 genes that were involved in BA-interactions against the 24,692 genes without BA-interactions using GOrrilla (//cbl-gorilla.cs.technion.ac.il) with “Mus musculus” selected as reference. The set of 5,825 genes was uploaded as the target, and the set of 24,692 genes was uploaded as the background.
Hi-C Data Processing
[0080] The mESC Hi-C data (GSE35156) [Dixon, J. R. et al. Nature 485, 376-80 (2012)] was processed with Juicer tools [Durand, N.C. et al. Cell Syst 3, 99-101 (2016)] and produced the hic file. Using HiTC (R Bioconductor package) [Servant, N. et al. Bioinformatics 28, 2843-4 (2012)], the AB compartments were then called using gene density data (in R library BSgenome.Mmusculus.UCSC.mm10) by calling ‘pca.hic.regular’ function.
[0081] To investigate the interaction between si-Δchr9 to the 29 derepressed genes in the KO clones, the most recent high resolution Hi-C data on mESC (GEO number: GSE96107; all 14 runs of HiC_ES_1 SRX2636666) [Bonev, B. et al. Cell 171, 557-572 e24 (2017)] were interrogated. A total of over 2.5 billion read was processed with Juicer tools [Durand, N.C. et al. Cell Syst 3, 99-101 (2016)]. The processed reads resulted 1.2 billion Hi-C contacts, then an interaction matrix with 100 kb resolution was generated and ICE-normalized for analysis. The bins where those gene loci were located in the interaction frequency (IF) matrix were identified. In this analysis, the only focus was on trans-chromosomal interactions: si-Δchr9 on chr9 with 26 derepressed genes on different chromosomes (3 genes on chr9 were excluded). The average trans-chromosomal interaction frequencies (TIF) of si-Δchr9 bin to the bins that housed these genes was computed. This value was then compared with random picked genes. The distribution of random bins on different chromosomes followed the distribution of chromosomes in the real case. The random picks were permuted 100,000 times, and the average TIF between si-Δchr9 and random picks was computed for each permutation. It was observed that the average TIF of si-Δchr9 to the derepressed genes was significantly higher than that of the random picks (Wilcoxon tests' p-values <2.2E-16). Another background model that was tested comprised of all bins that contained genes but excluding bins where repressed genes resided. The random permutation was repeated 100,000 times, and it was concluded that the average TIF between si-Δchr9 and derepressed genes was significantly higher than that of random background (Wilcoxon test p-values <2.2E-16).
Example 2
PRC2 Mediates Extensive Chromatin Interactions to Transcriptionally Silence Developmentally-Regulated Genes
(For Methods See Example 1)
[0082] PRC2-mediated chromatin interactions were characterized in mESCs by ChIA-PET analysis. ESC chromatin was crosslinked and genomic regions connected by PRC2 were captured by proximity ligation of crosslinked chromatin followed by ChIP using antibodies against each of the three core subunits of PRC2 complex, namely EED, EZH2 and SUZ12 in mESCs (
TABLE-US-00003 TABLE 3 Paired-read sequence information for EED, EZH2, and SUZ12. Factor EED Library ID Rep1 Rep2 Technical replicate (TR)/Run TR1 TR2 1 2 Total read pairs 48,353,975 312,336,001 272,192,222 334,956,195 2-tag read pairs 9,728,506 20.12% 68,550,539 21.95% 82,685,907 30.38% 104,400,893 31.17% uniquely mapped 4,218,290 61.03% 29,184,245 59.47% 53,897,734 68.97% 68,543,142 69.25% non-redundant 4,061,135 24,933,645 39,923,090 49,175,268 Rep3 Rep4 Rep5 Rep6 245,180,304 84,606,548 235,595,520 42,153,806 91,242,773 37.21% 29,882,917 35.32% 72,602,993 30.82% 13,542,441 32.13% 62,491,782 72.12% 14,881,120 73.35% 48,288,777 69.64% 9,487,937 71.81% 49,397,010 13,768,689 42,612,194 8,624,253 Factor EZH2 Library ID Rep1 Technical replicate (TR)/Run TR1 TR2 TR3 Rep2 Total read pairs 40,460,349 389,585,403 197,615,507 28,899,730 2-tag read pairs 9,628,197 23.80% 94,220,371 24.18% 46,576,190 23.57% 6,838,587 23.66% uniquely mapped 5,393,093 71.74% 52,215,889 70.88% 26,309,730 72.46% 4,496,424 68.27% non-redundant 5,001,006 32,251,766 19,699,788 3,874,274 Rep3 Rep4 Rep5 Rep6 Rep7 56,410,591 29,909,437 87,799,730 137,955,314 66,117,359 14,727,844 26.11% 8,807,114 29.45% 22,860,569 26.04% 46,167,491 33.47% 19,313,306 29.21% 9,615,492 66.24% 6,525,349 76.44% 16,007,876 71.30% 33,250,173 73.10% 14,145,204 75.51% 7,139,330 5,454,979 11,341,829 15,993,920 11,596,650 Factor SUZ12 Library ID Techincal replicate (TR)/Run Rep1 Rep2 Rep3 Rep4 Total read pairs 286,163,589 361,687,345 155,411,949 52,572,966 2-tag read pairs 127,134,751 44.43% 183,083,722 50.62% 76,914,049 49.49% 10,255,918 19.51% uniquely mapped 70,064,222 67.90% 93,891,712 68.46% 41,690,332 71.86% 4,819,668 64.03% non-redundant 21,007,077 84,891,257 38,717,337 4,490,198 Rep5 Rep6 Rep7 Rep8 277,326,566 118,133,687 175,145,114 106,235,993 58,087,804 20.95% 39,721,303 33.62% 35,976,589 20.54% 26,717,350 25.15% 28,429,166 64.19% 26,532,582 68.08% 19,461,510 61.12% 12,087,513 66.36% 21,424,050 10,189,027 14,635,461 9,778,416 Rep9 Rep10 1 2 1 2 Rep11 89,638,629 443,137,066 75,483,735 331,666,109 34,769,909 28,643,845 31.95% 138,130,643 31.17% 21,463,209 28.43% 93,544,913 28.20% 14,037,099 40.37% 13,618,767 72.86% 65,045,131 71.01% 10,228,794 71.73% 44,415,248 71.55% 7,730,840 76.76% 11,066,096 36,638,956 7,875,645 21,473,499 7,234,025
TABLE-US-00004 TABLE 4 Protein binding sites and significant chromatin interactions supported by EED, EZH2 and SUZ12 binding. Factor EED EZH2 SUZ12 PRC2 (combined) Number of 6 7 11 24 replicates Total reads pairs 1,575,374,571 1,034,753,420 2,507,372,657 5,117,500,648 non-redundant, 208,931,828 13% 97,936,086 9% 268,046,232 11% 574,914,146 11% non-chimeric Total binding peaks 31,366 42,189 25,467 23,368 Peaks with 10,789 34% 15,483 37% 11,678 46% 15,428 66% interactions Interaction clusters 146,066,534 57,294,283 200,505,313 397,500,613 Significant cis- 63,317 0.04% 50,819 0.09% 104,822 0.05% 261,440 0.07% interactions (FDR < 0.05, p < 0.05) Interactions with 12,130 19,302 28,310 54,173 PRC2 binding Interactions with 7,937 13% 10,718 21% 20,614 20% 40,544 16% PRC2 binding (single anchor; SA) Interactions with 4,193 7% 8,584 17% 7,696 7% 13,629 5% PRC2 binding (both anchors; BA) Interaction Types BA SA BA SA BA SA BA SA Intragenic loops 1332 1799 3390 3033 2380 3714 3686 8925 (32%) (23%) (39%) (28%) (31%) (18%) (27%) (22%) promoter anchored 1915 3573 3980 4717 4305 11626 8,175 21,584 (46%) (45%) (46%) (44%) (56%) (56%) (60%) (53%) P-P 951 483 1,991 587 2,381 1,425 4,694 2,998 P-I 593 1,820 1,248 2,541 1,060 5,791 1,800 10,710 P-G 371 1,270 741 1,589 864 4,410 1,681 7,876 non-promoter 946 2,565 1214 2968 1011 5274 1768 10035 anchored (22%) (32%) (14%) (28%) (13%) (26%) (13%) (25%) I-I 427 1,184 669 1,459 449 1,875 737 4,201 G-G 189 443 169 478 202 1,124 356 1,921 G-I 330 938 376 1,031 360 2,275 675 3,913
[0083] Consistent with these three subunits functioning together in the PRC2 complex, a high degree of correlation was found among the interactomes mediated by each subunit (r=0.8-0.93,
[0084] Vast majority (95%) of the 13,629 BA-interactions are found within gene-coding regions and most (60%) of them are anchored at gene promoters (defined as ±2.5 Kb of transcription starting sites (TSS)). These are interactions between promoters (P-P, 34%), or promoter to either intergenic (P-I, 13%) or intragenic regions (P-G, 12%) of distal genes (
TABLE-US-00005 TABLE 5 Top 20 enriched Biological process in 5825 BA associated genes in relative to 24,692 non-interacting genes. Enrichment (N, B, n, b) is defined as: N—total number of genes; B—total number of genes associated with a specific GO term; n—number of genes in the top of the user's input list or in the target set when appropriate; b—number of genes in the intersection; Enrichment = (b/n)/(B/N). GO term Description FDR q-value Enrichment (N, B, n, b) GO:0032502 developmental process 2.16E−140 1.65 (21172, 4680, 4642, 1692) GO:0048856 anatomical structure 1.29E−133 1.80 (21172, 3273, 4642, 1292) development GO:0048869 cellular developmental 2.47E−99 1.75 (21172, 2861, 4642, 1096) process GO:0009653 anatomical structure 2.35E−96 2.09 (21172, 1463, 4642, 672) morphogenesis GO:0051239 regulation of multicellular 1.96E−95 1.74 (21172, 2815, 4642, 1073) organismal process GO:0048731 system development 6.42E−94 2.55 (21172, 771, 4642, 431) GO:0007275 multicellular organism 9.33E−94 2.10 (21172, 1402, 4642, 647) development GO:0050793 regulation of 1.55E−91 1.79 (21172, 2449, 4642, 959) developmental process GO:0030154 cell differentiation 4.62E−86 1.83 (21172, 2108, 4642, 847) GO:2000026 regulation of multicellular 1.11E−82 1.87 (21172, 1891, 4642, 775) organismal development GO:0045595 regulation of cell 6.73E−78 1.90 (21172, 1687, 4642, 703) differentiation GO:0048518 positive regulation of 1.77E−74 1.43 (21172, 5348, 4642, 1673) biological process GO:0048522 positive regulation of 4.90E−73 1.46 (21172, 4789, 4642, 1529) cellular process GO:0048513 animal organ 3.12E−66 1.97 (21172, 1281, 4642, 553) development GO:0007267 cell-cell signaling 8.51E−60 2.61 (21172, 464, 4642, 266) GO:0023052 signaling 3.20E−59 2.47 (21172, 547, 4642, 296) GO:0051094 positive regulation of 4.53E−59 1.87 (21172, 1386, 4642, 569) developmental process GO:0060284 regulation of cell 6.54E−58 2.08 (21172, 935, 4642, 426) development GO:0051960 regulation of nervous 1.86E−57 2.09 (21172, 904, 4642, 415) system development GO:0051240 positive regulation of 2.14E−57 1.78 (21172, 1633, 4642, 638) multicellular organismal process
Example 3
PRC2-Interaction Anchors Act as Transcriptional Silencers
(For Methods See Example 1)
[0085] It was hypothesized that silencers can repress the transcription of their target genes through chromatin looping when bound by the repressors like PRC2, similar to how enhancers activate target gene expression [Brand, A. H., et al., Cell 41, 41-8 (1985) and Gray, S. & Levine, M. Curr Opin Cell Biol 8, 358-64 (1996)] (
TABLE-US-00006 TABLE 6 Sequences from generated KO clones. SEQ SEQ ID KO clone Sequence ID NO Sequence NO Si-Δchr11 ggaggggctcaaggtggctctcacagg 123 ccccagtccatgggattctactccttttgga 124 tatagaccggggc. ggcagcaat Si-Δchr5 cctccggtcccaccagtcatttgaacatg 125 tctacccgtgcgtgtcacaccgtacaggg 126 gctaccatcca cgagatgtcat Si-Δchr9 gaaatggagggtccaggaccctacac 127 aggggaagtaactaggttgtctgatgggtt 128 agataggcttaatc cgttggcttc Si-Δchr3 ccacaccccgccaaagctgctggccca 129 gacctgcaagcttatcatacaactgtggc 130 caatctgggggag ctcccttccac Si-Δchr7 ggaggtggctatctggtcaaccgtcttgg 131 agccagtgatgcataaatgcagtgcgcat 132 cttcgagggaa gtgcaggaagc Si-Δchr2 cgggggagcaccctgctcaaggcgcg 133 cactactagacccttaagacatacgaggt 134 aacacccgggacg tgaccgtaaaa
[0086] To evaluate the effects of interaction anchor deletion on chromatin organization, local interactions and PRC2 occupancy, particularly regions adjacent to the deleted loci and their targeted genes, the ChIA-PET analysis was performed in two of the KO ESC lines (si-Δchr9 and si-Δchr7) and the interaction maps were compared with those detected in the WT ES cells. ChIA-PET uncovered broad spatial topologically associating domains, similar to Hi-C-based approaches (
[0087] To determine the transcriptional effect associated with the deletion of the PRC2-bound silencers and their tethered interactions, the gene expression was compared between the homozygous deletion and wild type ESCs from multiple biological replicates. Genes interacting with the PRC2-bound interacting regions were overall upregulated (log 2 fold change >0) in the KO lines while the non-connected local genes (resided within ±500 Kb or ±1 Mb from the KO loci) were not (
TABLE-US-00007 TABLE 7 Gene derepression results from certain experiments. clone F1 clone G9 Gene log2fold adjusted log2fold adjusted Proposed name change p-value change p-value Gene ID function 170001 2.281553573 6.61E−34 3.696246467 1.51E−88 protein_ 9A02Rik coding C3ar1 2.325252249 2.38E−39 2.558583473 8.98E−53 protein_ complement coding component 3a receptor 1, promote both basal and ischemia-induced neurogenesis Capn11 2.216764438 1.13E−102 2.138405728 5.23E−114 protein_ Calcium-activated coding neutral proteinase 11, Expressed exclusively in testis Cd200 2.946214999 1.78E−42 2.784811496 3.78E−41 protein_ plays a central coding role in macrophage fusion and osteoclast formation Cd36 2.9649528 2.35E−85 2.602919469 3.02E−74 protein_ Multifunctional coding glycoprotein that acts as receptor for a broad range of ligands Cd3d 3.252751916 2.90E−66 3.783961921 2.58E−92 protein_ T-CELL coding ANTIGEN RECEPTOR COMPLEX, mediates signal transduction Cd3g 3.397570639 3.34E−63 3.459383036 6.80E−69 protein_ T-CELL coding ANTIGEN RECEPTOR COMPLEX, mediates signal transduction DazI 2.375817442 0 3.088839536 0 protein_ spermatogenesis, coding initiate meiosis in response to retinoic acid Ddr2 2.587225653 2.42E−97 2.359328388 4.05E−96 protein_ receptor protein coding tyrosine kinase (RTK) Gm13128 2.584927875 2.10E−34 2.305280485 1.39E−30 protein_ coding Gm15446 2.974328714 3.82E−135 3.05368027 4.64E−165 lincRNA Gm21761 2.907711389 3.65E−102 2.013782045 1.11E−55 protein_ coding Gm38947 2.466786906 2.50E−15 3.819167637 1.41E−24 lincRNA Gpnmb 2.719217797 1.45E−189 2.472351242 1.57E−188 protein_ Transmembrane coding glycoprotein, Could be a melanogenic enzyme H19 3.598108666 0 3.128991068 0 lincRNA imprinted maternally expressed transcript, a developmentally regulated gene with putative tumor suppressor activity H2-Eb1 2.210094937 4.12E−102 2.370884401 5.55E−139 protein_ histocompatibility coding 2, class II antigen E beta Htr5a 2.304618236 2.83E−34 2.407481173 3.50E−42 protein_ Serotonin coding receptor 5A Iqca 2.61897153 3.17E−64 3.639807313 1.24E−134 protein_ IQ motif coding containing with AAA domain Lyz2 2.203479922 2.30E−152 2.308409158 2.41E−203 protein_ Lysozymes coding Mgl2 2.179740885 2.04E−25 3.212728771 9.40E−52 protein_ macrophage coding galactose N- acetyl- galactosamine specific lectin 2 Mmp12 2.742575289 2.56E-34 2.102254365 3.17E−24 protein_ matrix coding metallopeptidase 12, May be involved in tissue injury and remodeling Mpeg1 2.129075611 6.65E−41 2.223885002 8.27E−52 protein_ macrophage coding expressed gene 1 Nefm 3.334944451 9.05E−226 3.175011114 7.90E−233 protein_ an intermediate- coding sized cytoskeletal neurofilament that localizes to neuronal axons and dendrites Nlrp4c 2.783692971 1.40E−95 3.71114131 5.83E−190 protein_ May be involved coding in inflammation Platr13 3.305886456 8.24E−97 2.336061956 3.37E−55 lincRNA Plek 2.523194075 1.25E−38 2.664333714 3.29E−47 protein_ Major protein coding kinase C substrate of platelets Pramel6 4.586419884 6.59E−286 4.402792745 3.58E−284 protein_ preferentially coding expressed antigen in melanoma like 6 Pramel7 4.15461037 8.64E−264 3.985107654 3.14E−267 protein_ preferentially coding expressed antigen in melanoma like 7 Rcsd1 2.724573694 7.26E−82 2.75999872 7.96E−96 protein_ actin filament coding binding
[0088] To characterize of the in vivo function of the PRC2-bound silencers, the phenotypes associated with the homozygous silencer deletions in mice were assessed. From total six PRC2-bound silencer KOs for which heterozygous mice were successfully established, viable homozygous KO mice were derived from five of them (
TABLE-US-00008 TABLE 8 Results of eight different procedures on five silencer KO lines. Phenotype Domain Ctrl.F.N Ctrl.M.N Mt.F.N si-Δchr11 bmc_over_bw bodycmp 17 17 8 corrected_percent_pp2_vmax ppi 9 10 8 distance_traveled_slope oft 9 10 8 hr ekg 9 10 8 number_of_rears_total oft 9 10 8 plasma_glucose_120_min gtt 8 10 5 rr ekg 9 10 8 white_blood_cells_wbc cbc 6 7 6 si-Δchr2 center_average_speed oft 10 10 8 fore_and_hind_limb_grip_mean grip 10 10 8 fore_and_hind_limb_grip_meanbody_weight grip 10 10 8 white_blood_cells_wbc cbc 11 11 6 si-Δchr3 fore_and_hind_limb_grip_mean grip 10 10 8 mean_platelet_volume_mpv cbc 7 7 5 neutrophils_neut cbc 7 7 5 pct_time_in_dark ldbox 9 10 7 pcttime_corners_slope oft 10 10 8 red_cell_hem_con_mean_chcm cbc 7 7 5 white_blood_cells_wbc cbc 7 7 5 si-Δchr5 bmc_over_bw bodycmp 5 5 7 bone_area bodycmp 5 5 7 right_side_mobile_time_spent Id box 10 si-Achr7 hr ekg 15 13 8 left_side_mobile_time_spent Id box 5 5 8 pct_time_in_dark Id box 5 5 8 right_side_mobile_time_spent Id box 5 5 8 rr ekg 15 13 8 side_changes Id box 5 5 8 Genotype Mt.M.N genotype_estimate genotype_estimate_SE genotype_p_value si-Δchr11 8 −0.001128945 0.000339138 0.015828883 8 0.231692166 0.071607205 0.002954166 8 −22.06182628 7.144488997 0.004226459 8 34.33584332 10.17519574 0.002057098 8 42.26867958 9.249997718 7.35E−05 4 −33.71823562 9.508565339 0.001811997 8 −4.091566262 1.201050086 0.001890186 6 2.34425926 0.738755484 0.004578783 si-Δchr2 6 1.569932351 0.419727662 0.000839142 8 −26.50865941 5.983285476 0.000109041 8 −1.308548081 0.290549084 9.42E−05 4 −2.703009696 1.095117243 0.020473734 si-Δchr3 8 −15.74687138 6.271782291 0.017475015 6 0.550350772 0.162738594 0.002815717 6 −1.775470317 0.481173363 0.001360421 7 −9.126204102 3.150750552 0.00710702 6 −7.006576271 1.829132347 0.000606995 6 −0.772157858 0.173165808 0.000240669 6 4.006571777 0.766822921 3.53E−05 si-Δchr5 7 −0.001611774 0.000555708 0.009537194 7 −0.741716675 0.221367015 0.003359144 10 −42.09307672 14.7626656 0.007453201 si-Δchr7 6 21.11110838 7.561917432 0.008245565 8 89.67731609 13.94183995 2.25E-06 8 −13.71477836 4.612386754 0.007247781 8 67.37489987 24.57569949 0.012578599 6 −2.246512195 0.909434524 0.018236344 8 59.87676239 10.79588332 1.67E−05 Phenotype sex_estimate sex_estimate_SE sex_p_value weight_estimate weight_estimate_SE weight_p_value si-Δchr11 −0.0041569 0.000651097 1.36E−07 −9.29E−05 7.54E−05 0.224987137 −0.064856537 0.071082243 0.368824416 NA NA NA 9.869871428 7.076509872 0.17300976 NA NA NA 25.01204824 10.14188895 0.019591092 NA NA NA −4.644404609 9.177926118 0.616407958 NA NA NA 3.634093596 15.24015927 0.813735236 5.815913785 2.196067427 0.014680922 −2.979518076 1.197118651 0.018588359 NA NA NA 4.159074074 0.738755484 1.38E−05 NA NA NA si-Δchr2 −2.190243348 0.802486125 0.010845052 0.228358393 0.13999488 0.114048634 17.34915904 5.988285341 0.006850642 NA NA NA 1.293008689 0.660424993 0.05960645 −0.476645966 0.103854632 7.40E−05 5.251835293 1.918166761 0.011007701 0.079465294 0.201182705 0.696071676 si-Δchr3 −13.21352301 13.42996833 0.332789964 4.776867191 2.046186375 0.026221486 0.107765505 0.160187843 0.508445652 NA NA NA −0.08798462 0.475925151 0.855104215 NA NA NA −3.634285699 3.11572674 0.252942591 NA NA NA 1.550932204 1.803548817 0.396645797 NA NA NA 0.354573794 0.361606795 0.338527765 −0.042257667 0.03538514 0.2463636 4.942315661 0.758471051 1.87E−06 NA NA NA si-Δchr5 −0.000372977 0.000886481 0.678926286 −0.000397638 9.48E−05 0.000544319 0.424181132 0.188183634 0.036191722 NA NA NA −24.36269874 13.65695724 0.083638056 NA NA NA si-Δchr7 16.40530651 7.358063353 0.031929124 NA NA NA −96.73656738 11.08275755 1.98E−08 NA NA NA 18.64604379 3.694985372 5.37E−05 NA NA NA −107.2136785 35.91862239 0.007320307 6.660614465 5.502550107 0.240214228 −1.723020406 0.883421498 0.058735364 NA NA NA −61.09229174 8.596171993 5.20E−07 NA NA NA
Example 4
[0089] PRC2-Associated Silencers Transition into Active Enhancers During Differentiation
(For Methods See Example 1)
[0090] To characterize the chromatin states and functional features of the PRC2-bound silencers, profiles of chromatin signatures representing open chromatin accessibility (ATAC-seq), active and repressive histone modifications (H3K4me3, H3K4me1, H3K27ac, H3K27me3, H3K9me3) as well as RNAPII and insulator CTCF binding were either downloaded from ENCODE or generated in this study (see Example 1 Methods). Their enrichment within the non-coding intergenic interaction anchors (I, n=1,800), the promoter anchors (P, n=4,120) and intragenic anchors (G, n=2,302) were examined. For all three anchor types, the enrichment of H3K4me3 and ATAC-seq signals was observed, as well as a moderate co-enrichment of H3K27me3 and H3K4me1, a signature previously identified for poised enhancers [Rada-Iglesias, A. et al. Nature 470, 279-83 (2011)] (
TABLE-US-00009 TABLE 9 Regulatory feature information. Z score log2 Fold (1000X Features Enrichment simulation) Ensembl Regulatory Open chromatin 1.05 11.58 Build TF binding 1.06 5.68 (PMID: 25887522) Enhancer −1.76 -6.86 TF binding n-Myc 4.4 26.05 (PMID: 18555785) Smad1 4 14.68 ZFX 3.8 26.32 Pou5f1 3.6 17.9 Klf4 3.5 25.7 c-Myc 3.5 8.54 Esrrb 3.4 37.51 Tcfcp2l1 3.2 33.65 STAT3 3.1 10.27 Sox2 3 14.23 E2F1 2.8 17.1 CTCF 2.6 28.21 Nanog 2.5 14.74 Sequence CGI 6.8 176.37 composition
[0091] The enrichment of poised enhancer signature within the intergenic anchors suggests that these PRC2-bound silencers could transition into enhancers during ESC differentiation. To test this hypothesis, the histone modification representing active enhancers (H3K27ac) were surveyed and two repressive marks (H3K27me3 and H3K9me3) in these silencers throughout embryonic differentiation stages from E10.5 to postnatal day 0 (P0) or day 56 (P56) across 12 major mouse tissues (See Table 10) listed all ENCODE data used). In each tissue type, H3K27ac enrichment was detected with partial reduction of H3K27me3 in a subset of these regions (
TABLE-US-00010 TABLE 10 Results of survey of histone modification representing active enhancers (H3K27ac) and two repressive marks (H3K27me3 and H3K9me3) in these silencers throughembryonic differentiation stages from E10.5 to postnatal day 0 (PO) or day 56 (P56) across 12 major mouse tissues. All ENCODE data used Histone Age modifications Cell (days) Encode_fileID Download_link H3K27ac forebrain 10.5 ENCFF266KHC www.encodeproject.org/files/ENCFF266KHC/@ @download/ENCFF266KHC.bigWig H3K27ac forebrain 11.5 ENCFF827WXG www.encodeproject.org/files/ENCFF827WXG/@ @download/ENCFF827WXG.bigWig H3K27ac forebrain 12.5 ENCFF541IJI www.encodeproject.org/files/ENCFF541IJI/@@ download/ENCFF541IJI.bigWig H3K27ac forebrain 13.5 ENCFF107UHG www.encodeproject.org/files/ENCFF107UHG/@ @download/ENCFF107UHG.bigWig H3K27ac forebrain 14.5 ENCFF527FOD www.encodeproject.org/files/ENCFF527FOD/@ @download/ENCFF527FOD.bigWig H3K27ac forebrain 15.5 ENCFF440SCC www.encodeproject.org/files/ENCFF440SCC/@ @download/ENCFF440SCC.bigWig H3K27ac forebrain 16.5 ENCFF826KEG www.encodeproject.org/files/ENCFF826KEG/@ @download/ENCFF826KEG.bigWig H3K27ac forebrain 20 ENCFF835DLZ www.encodeproject.org/files/ENCFF835DLZ/@ @download/ENCFF835DLZ.bigWig H3K27me3 forebrain 10.5 ENCFF063ZLI www.encodeproject.org/files/ENCFF063ZLI/@@ download/ENCFF063ZLI.bigWig H3K27me3 forebrain 11.5 ENCFF375ONW www.encodeproject.org/files/ENCFF375ONW/@ @download/ENCFF375ONW.bigWig H3K27me3 forebrain 12.5 ENCFF597HKP www.encodeproject.org/files/ENCFF597HKP/@ @download/ENCFF597HKP.bigWig H3K27me3 forebrain 13.5 ENCFF760VJL www.encodeproject.org/files/ENCFF760VJL/@@ download/ENCFF760VJL.bigWig H3K27me3 forebrain 14.5 ENCFF900BKA www.encodeproject.org/files/ENCFF900BKA/@ @download/ENCFF900BKA.bigWig H3K27me3 forebrain 15.5 ENCFF848GOF www.encodeproject.org/files/ENCFF848GOF/@ @download/ENCFF848GOF.bigWig H3K27me3 forebrain 16.5 ENCFF935NKI www.encodeproject.org/files/ENCFF935NKI/@@ download/ENCFF935NKI.bigWig H3K27me3 forebrain 20 ENCFF183CXT www.encodeproject.org/files/ENCFF183CXT/@ @download/ENCFF183CXT.bigWig H3K9me3 forebrain 10.5 ENCFF075BNF www.encodeproject.org/files/ENCFF075BNF/@ @download/ENCFF075BNF.bigWig H3K9me3 forebrain 11.5 ENCFF052RHA www.encodeproject.org/files/ENCFF052RHA/@ @download/ENCFF052RHA.bigWig H3K9me3 forebrain 12.5 ENCFF137LNV www.encodeproject.org/files/ENCFF137LNV/@ @download/ENCFF137LNV.bigWig H3K9me3 forebrain 13.5 ENCFF101ASP www.encodeproject.org/files/ENCFF101ASP/@ @download/ENCFF101ASP.bigWig H3K9me3 forebrain 14.5 ENCFF034URR www.encodeproject.org/files/ENCFF034URR/@ @download/ENCFF034URR.bigWig H3K9me3 forebrain 15.5 ENCFF718RMZ www.encodeproject.org/files/ENCFF718RMZ/@ @download/ENCFF718RMZ.bigWig H3K9me3 forebrain 16.5 ENCFF809PQF www.encodeproject.org/files/ENCFF809PQF/@ @download/ENCFF809PQF.bigWig H3K9me3 forebrain 20 ENCFF114FKU www.encodeproject.org/files/ENCFF114FKU/@ @download/ENCFF114FKU.bigWig H3K27ac hindbrain 10.5 ENCFF782RAO www.encodeproject.org/files/ENCFF782RAO/@ @download/ENCFF782RAO.bigWig H3K27ac hindbrain 11.5 ENCFF177SVC www.encodeproject.org/files/ENCFF177SVC/@ @download/ENCFF177SVC.bigWig H3K27ac hindbrain 12.5 ENCFF631JYQ www.encodeproject.org/files/ENCFF631JYQ/@ @download/ENCFF631JYQ.bigWig H3K27ac hindbrain 13.5 ENCFF923TVC www.encodeproject.org/files/ENCFF923TVC/@ @download/ENCFF923TVC.bigWig H3K27ac hindbrain 14.5 ENCFF774AQE www.encodeproject.org/files/ENCFF774AQE/@ @download/ENCFF774AQE.bigWig H3K27ac hindbrain 15.5 ENCFF121XJR www.encodeproject.org/files/ENCFF121XJR/@ @download/ENCFF121XJR.bigWig H3K27ac hindbrain 16.5 ENCFF011VMX www.encodeproject.org/files/ENCFF011VMX/@ @download/ENCFF011VMX.bigWig H3K27ac hindbrain 20 ENCFF665WCP www.encodeproject.org/files/ENCFF665WCP/@ @download/ENCFF665WCP.bigWig H3K27me3 hindbrain 10.5 ENCFF898VDV www.encodeproject.org/files/ENCFF898VDV/@ @download/ENCFF898VDV.bigWig H3K27me3 hindbrain 11.5 ENCFF352EVI www.encodeproject.org/files/ENCFF352EVI/@@ download/ENCFF352EVI.bigWig H3K27me3 hindbrain 12.5 ENCFF349EPV www.encodeproject.org/files/ENCFF349EPV/@ @download/ENCFF349EPV.bigWig H3K27me3 hindbrain 13.5 ENCFF637PDW www.encodeproject.org/files/ENCFF637PDW/@ @download/ENCFF637PDW.bigWig H3K27me3 hindbrain 14.5 ENCFF787DNX www.encodeproject.org/files/ENCFF787DNX/@ @download/ENCFF787DNX.bigWig H3K27me3 hindbrain 15.5 ENCFF408PKX www.encodeproject.org/files/ENCFF408PKX/@ @download/ENCFF408PKX.bigWig H3K27me3 hindbrain 16.5 ENCFF574LGA www.encodeproject.org/files/ENCFF574LGA/@ @download/ENCFF574LGA.bigWig H3K27me3 hindbrain 20 ENCFF156SIF www.encodeproject.org/files/ENCFF156SIF/@@ download/ENCFFI56SIF.bigWig H3K9me3 hindbrain 10.5 ENCFF672EXE www.encodeproject.org/files/ENCFF672EXE/@ @download/ENCFF672EXE.bigWig H3K9me3 hindbrain 11.5 ENCFF570FAF www.encodeproject.org/files/ENCFF570FAF/@ @download/ENCFF570FAF.bigWig H3K9me3 hindbrain 12.5 ENCFF063VTT www.encodeproject.org/files/ENCFF063VTT/@ @download/ENCFF063VTT.bigWig H3K9me3 hindbrain 13.5 ENCFF779TQD www.encodeproject.org/files/ENCFF779TQD/@ @download/ENCFF779TQD.bigWig H3K9me3 hindbrain 14.5 ENCFF463QJN www.encodeproject.org/files/ENCFF463QJN/@ @download/ENCFF463QJN.bigWig H3K9me3 hindbrain 15.5 ENCFF499LUF www.encodeproject.org/files/ENCFF499LUF/@ @download/ENCFF499LUF.bigWig H3K9me3 hindbrain 16.5 ENCFF637BYB www.encodeproject.org/files/ENCFF637BYB/@ @download/ENCFF637BYB.bigWig H3K9me3 hindbrain 20 ENCFF919CSS www.encodeproject.org/files/ENCFF919CSS/@ @download/ENCFF919CSS.bigWig H3K27ac midbrain 10.5 ENCFF773NIS www.encodeproject.org/files/ENCFF773NIS/@@ download/ENCFF773NIS.bigWig H3K27ac midbrain 11.5 ENCFF230FQZ www.encodeproject.org/files/ENCFF230FQZ/@ @download/ENCFF230FQZ.bigWig H3K27ac midbrain 12.5 ENCFF406MDW www.encodeproject.org/files/ENCFF406MDW/@ @download/ENCFF406MDW.bigWig H3K27ac midbrain 13.5 ENCFF416UPA www.encodeproject.org/files/ENCFF416UPA/@ @download/ENCFF416UPA.bigWig H3K27ac midbrain 14.5 ENCFF900XUW www.encodeproject.org/files/ENCFF900XUW/@ @download/ENCFF900XUW.bigWig H3K27ac midbrain 15.5 ENCFF616CNP www.encodeproject.org/files/ENCFF616CNP/@ @download/ENCFF616CNP.bigWig H3K27ac midbrain 16.5 ENCFF447LGJ www.encodeproject.org/files/ENCFF447LGJ/@ @download/ENCFF447LGJ.bigWig H3K27ac midbrain 20 ENCFF961KLD www.encodeproject.org/files/ENCFF961KLD/@ @download/ENCFF961KLD.bigWig H3K27me3 midbrain 10.5 ENCFF293RMV www.encodeproject.org/files/ENCFF293RMV/@ @download/ENCFF293RMV.bigWig H3K27me3 midbrain 11.5 ENCFF485WCD www.encodeproject.org/files/ENCFF485WCD/@ @download/ENCFF485WCD.bigWig H3K27me3 midbrain 12.5 ENCFF612RDE www.encodeproject.org/files/ENCFF612RDE/@ @download/ENCFF612RDE.bigWig H3K27me3 midbrain 13.5 ENCFF610HBD www.encodeproject.org/files/ENCFF610HBD/@ @download/ENCFF610HBD.bigWig H3K27me3 midbrain 14.5 ENCFF908XOQ www.encodeproject.org/files/ENCFF908XOQ/@ @download/ENCFF908XOQ.bigWig H3K27me3 midbrain 15.5 ENCFF376ZJO www.encodeproject.org/files/ENCFF376ZJO/@ @download/ENCFF376ZJO.bigWig H3K27me3 midbrain 16.5 ENCFF025FNF www.encodeproject.org/files/ENCFF025FNF/@ @download/ENCFF025FNF.bigWig H3K27me3 midbrain 20 ENCFF149AGA www.encodeproject.org/files/ENCFF149AGA/@ @download/ENCFF149AGA.bigWig H3K9me3 midbrain 10.5 ENCFF190AYI www.encodeproject.org/files/ENCFF190AYI/@@ download/ENCFF190AYI.bigWig H3K9me3 midbrain 11.5 ENCFF402XZO www.encodeproject.org/files/ENCFF402XZO/@ @download/ENCFF402XZO.bigWig H3K9me3 midbrain 12.5 ENCFF432ADZ www.encodeproject.org/files/ENCFF432ADZ/@ @download/ENCFF432ADZ.bigWig H3K9me3 midbrain 13.5 ENCFF878NXY www.encodeproject.org/files/ENCFF878NXY/@ @download/ENCFF878NXY.bigWig H3K9me3 midbrain 14.5 ENCFF966CDF www.encodeproject.org/files/ENCFF966CDF/@ @download/ENCFF966CDF.bigWig H3K9me3 midbrain 15.5 ENCFF377LTJ www.encodeproject.org/files/ENCFF377LTJ/@@ download/ENCFF377LTJ.bigWig H3K9me3 midbrain 16.5 ENCFF390PNF www.encodeproject.org/files/ENCFF390PNF/@ @download/ENCFF390PNF.bigWig H3K9me3 midbrain 20 ENCFF887HCS www.encodeproject.org/files/ENCFF887HCS/@ @download/ENCFF887HCS.bigWig H3K27ac neuralTube 11.5 ENCFF422NJA www.encodeproject.org/files/ENCFF422NJA/@ @download/ENCFF422NJA.bigWig H3K27ac neuralTube 12.5 ENCFF704GSX www.encodeproject.org/files/ENCFF704GSX/@ @download/ENCFF704GSX.bigWig H3K27ac neuralTube 13.5 ENCFF066PYN www.encodeproject.org/files/ENCFF066PYN/@ @download/ENCFF066PYN.bigWig H3K27ac neuralTube 14.5 ENCFF494OOQ www.encodeproject.org/files/ENCFF494OOQ/@ @download/ENCFF494OOQ.bigWig H3K27ac neuralTube 15.5 ENCFF789UMC www.encodeproject.org/files/ENCFF789UMC/@ @download/ENCFF789UMC.bigWig H3K27me3 neuralTube 11.5 ENCFF217EPP www.encodeproject.org/files/ENCFF217EPP/@ @download/ENCFF217EPP.bigWig H3K27me3 neuralTube 12.5 ENCFF901MQW www.encodeproject.org/files/ENCFF901MQW/@ @download/ENCFF901MQW.bigWig H3K27me3 neuralTube 13.5 ENCFF009QET www.encodeproject.org/files/ENCFF009QET/@ @download/ENCFF009QET.bigWig H3K27me3 neuralTube 14.5 ENCFF223PHS www.encodeproject.org/files/ENCFF223PHS/@ @download/ENCFF223PHS.bigWig H3K27me3 neuralTube 15.5 ENCFF386EYG www.encodeproject.org/files/ENCFF386EYG/@ @download/ENCFF386EYG.bigWig H3K9me3 neuralTube 11.5 ENCFF973ZKZ www.encodeproject.org/files/ENCFF973ZKZ/@ @download/ENCFF973ZKZ.bigWig H3K9me3 neuralTube 12.5 ENCFF197JHX www.encodeproject.org/files/ENCFF197JHX/@ @download/ENCFF197JHX.bigWig H3K9me3 neuralTube 13.5 ENCFF495VRT www.encodeproject.org/files/ENCFF495VRT/@ @download/ENCFF495VRT.bigWig H3K9me3 neuralTube 14.5 ENCFF705MSQ www.encodeproject.org/files/ENCFF705MSQ/@ @download/ENCFF705MSQ.bigWig H3K9me3 neuralTube 15.5 ENCFF987UOT www.encodeproject.org/files/ENCFF987UOT/@ @download/ENCFF987UOT.bigWig H3K27ac intestine 14.5 ENCFF251XZW www.encodeproject.org/files/ENCFF251XZW/@ @download/ENCFF251XZW.bigWig H3K27ac intestine 15.5 ENCFF803SVJ www.encodeproject.org/files/ENCFF803SVJ/@ @download/ENCFF803SVJ.bigWig H3K27ac intestine 16.5 ENCFF829GXB www.encodeproject.org/files/ENCFF829GXB/@ @download/ENCFF829GXB.bigWig H3K27ac intestine 20 ENCFF512TCI www.encodeproject.org/files/ENCFF512TCI/@@ download/ENCFF512TCI.bigWig H3K27me3 intestine 14.5 ENCFF396TSB www.encodeproject.org/files/ENCFF396TSB/@ @download/ENCFF396TSB.bigWig H3K27me3 intestine 15.5 ENCFF270YCY www.encodeproject.org/files/ENCFF270YCY/@ @download/ENCFF270YCY.bigWig H3K27me3 intestine 16.5 ENCFF893IAL www.encodeproject.org/files/ENCFF893IAL/@@ download/ENCFF893IAL.bigWig H3K27me3 intestine 20 ENCFF133XFD www.encodeproject.org/files/ENCFF133XFD/@ @download/ENCFF133XFD.bigWig H3K9me3 intestine 14.5 ENCFF814OZR www.encodeproject.org/files/ENCFF814OZR/@ @download/ENCFF814OZR.bigWig H3K9me3 intestine 15.5 ENCFF776ZXU www.encodeproject.org/files/ENCFF776ZXU/@ @download/ENCFF776ZXU.bigWig H3K9me3 intestine 16.5 ENCFF981JRQ www.encodeproject.org/files/ENCFF981JRQ/@ @download/ENCFF981JRQ.bigWig H3K9me3 intestine 20 ENCFF363IUI www.encodeproject.org/files/ENCFF363IUI/@@ download/ENCFF363IUI.bigWig H3K27ac stomach 14.5 ENCFF036PPT www.encodeproject.org/files/ENCFF036PPT/@ @download/ENCFF036PPT.bigWig H3K27ac stomach 15.5 ENCFF604BOY www.encodeproject.org/files/ENCFF604BOY/@ @download/ENCFF604BOY.bigWig H3K27ac stomach 16.5 ENCFF069OMF www.encodeproject.org/files/ENCFF069OMF/@ @download/ENCFF069OMF.bigWig H3K27ac stomach 20 ENCFF224LDB www.encodeproject.org/files/ENCFF224LDB/@ @download/ENCFF224LDB.bigWig H3K27me3 stomach 14.5 ENCFF518FTX www.encodeproject.org/files/ENCFF518FTX/@ @download/ENCFF518FTX.bigWig H3K27me3 stomach 15.5 ENCFF886OPQ www.encodeproject.org/files/ENCFF886OPQ/@ @download/ENCFF886OPQ.bigWig H3K27me3 stomach 16.5 ENCFF039QOO www.encodeproject.org/files/ENCFF039QOO/@ @download/ENCFF039QOO. bigWig H3K27me3 stomach 20 ENCFF587CHP www.encodeproject.org/files/ENCFF587CHP/@ @download/ENCFF587CHP.bigWig H3K9me3 stomach 14.5 ENCFF968CFU www.encodeproject.org/files/ENCFF968CFU/@ @download/ENCFF968CFU.bigWig H3K9me3 stomach 15.5 ENCFF417JCK www.encodeproject.org/files/ENCFF417JCK/@ @download/ENCFF417JCK.bigWig H3K9me3 stomach 16.5 ENCFF824UJK www.encodeproject.org/files/ENCFF824UJK/@ @download/ENCFF824UJK.bigWig H3K9me3 stomach 20 ENCFF591NXE www.encodeproject.org/files/ENCFF591NXE/@ @download/ENCFF591NXE.bigWig H3K27ac liver 11.5 ENCFF274AWM www.encodeproject.org/files/ENCFF274AWM/@ @download/ENCFF274AWM.bigWig H3K27ac liver 12.5 ENCFF285ZJD www.encodeproject.org/files/ENCFF285ZJD/@ @download/ENCFF285ZJD.bigWig H3K27ac liver 13.5 ENCFF289PYS www.encodeproject.org/files/ENCFF289PYS/@ @download/ENCFF289PYS.bigWig H3K27ac liver 14.5 ENCFF518VSR www.encodeproject.org/files/ENCFF518VSR/@ @download/ENCFF518VSR.bigWig H3K27ac liver 15.5 ENCFF290NHP www.encodeproject.org/files/ENCFF290NHP/@ @download/ENCFF290NHP.bigWig H3K27ac liver 16.5 ENCFF526VAG www.encodeproject.org/files/ENCFF526VAG/@ @download/ENCFF526VAG.bigWig H3K27ac liver 20 ENCFF588AKC www.encodeproject.org/files/ENCFF588AKC/@ @download/ENCFF588AKC.bigWig H3K27ac liver 56 ENCFF632VNQ www.encodeproject.org/files/ENCFF632VNQ/@ @download/ENCFF632VNQ.bigWig H3K27me3 liver 11.5 ENCFF800NSG www.encodeproject.org/files/ENCFF800NSG/@ @download/ENCFF800NSG.bigWig H3K27me3 liver 12.5 ENCFF361SUJ www.encodeproject.org/files/ENCFF361SUJ/@ @download/ENCFF361SUJ.bigWig H3K27me3 liver 13.5 ENCFF914LRA www.encodeproject.org/files/ENCFF914LRA/@ @download/ENCFF914LRA.bigWig H3K27me3 liver 14.5 ENCFF035UHY www.encodeproject.org/files/ENCFF035UHY/@ @download/ENCFF035UHY.bigWig H3K27me3 liver 15.5 ENCFF520CMB www.encodeproject.org/files/ENCFF520CMB/@ @download/ENCFF520CMB.bigWig H3K27me3 liver 16.5 ENCFF943PON www.encodeproject.org/files/ENCFF943PON/@ @download/ENCFF943PON.bigWig H3K27me3 liver 20 ENCFF633GEF www.encodeproject.org/files/ENCFF633GEF/@ @download/ENCFF633GEF.bigWig H3K27me3 liver 56 ENCFF172GJQ www.encodeproject.org/files/ENCFF172GJQ/@ @download/ENCFF172GJQ.bigWig H3K9me3 liver 11.5 ENCFF477UFW www.encodeproject.org/files/ENCFF477UFW/@ @download/ENCFF477UFW.bigWig H3K9me3 liver 12.5 ENCFF741LSB www.encodeproject.org/files/ENCFF741LSB/@ @download/ENCFF741LSB.bigWig H3K9me3 liver 13.5 ENCFF258AAD www.encodeproject.org/files/ENCFF258AAD/@ @download/ENCFF258AAD.bigWig H3K9me3 liver 14.5 ENCFF716TGN www.encodeproject.org/files/ENCFF716TGN/@ @download/ENCFF716TGN.bigWig H3K9me3 liver 15.5 ENCFF550PJQ www.encodeproject.org/files/ENCFF550PJQ/@ @download/ENCFF550PJQ.bigWig H3K9me3 liver 16.5 ENCFF947IGN www.encodeproject.org/files/ENCFF947IGN/@ @download/ENCFF947IGN.bigWig H3K9me3 liver 20 ENCFF040LFN www.encodeproject.org/files/ENCFF040LFN/@ @download/ENCFF040LFN.bigWig H3K27ac kidney 14.5 ENCFF298GLI www.encodeproject.org/files/ENCFF298GLI/@@ download/ENCFF298GLI.bigWig H3K27ac kidney 15.5 ENCFF297RMH www.encodeproject.org/files/ENCFF297RMH/@ @download/ENCFF297RMH.bigWig H3K27ac kidney 16.5 ENCFF132TLS www.encodeproject.org/files/ENCFF132TLS/@ @download/ENCFF132TLS.bigWig H3K27ac kidney 20 ENCFF873EBR www.encodeproject.org/files/ENCFF873EBR/@ @download/ENCFF873EBR.bigWig H3K27ac kidney 56 ENCFF188DKO www.encodeproject.org/files/ENCFF188DKO/@ @download/ENCFF188DKO.bigWig H3K27me3 kidney 14.5 ENCFF324UGW www.encodeproject.org/files/ENCFF324UGW/@ @download/ENCFF324UGW.bigWig H3K27me3 kidney 15.5 ENCFF201DBX www.encodeproject.org/files/ENCFF201DBX/@ @download/ENCFF201DBX.bigWig H3K27me3 kidney 16.5 ENCFF089CJB www.encodeproject.org/files/ENCFF089CJB/@ @download/ENCFF089CJB.bigWig H3K27me3 kidney 20 ENCFF460ZYC www.encodeproject.org/files/ENCFF460ZYC/@ @download/ENCFF460ZYC.bigWig H3K27me3 kidney 56 ENCFF324KCF www.encodeproject.org/files/ENCFF324KCF/@ @download/ENCFF324KCF.bigWig H3K9me3 kidney 14.5 ENCFF433RSJ www.encodeproject.org/files/ENCFF433RSJ/@ @download/ENCFF433RSJ.bigWig H3K9me3 kidney 15.5 ENCFF209XEZ www.encodeproject.org/files/ENCFF209XEZ/@ @download/ENCFF209XEZ.bigWig H3K9me3 kidney 16.5 ENCFF767LND www.encodeproject.org/files/ENCFF767LND/@ @download/ENCFF767LND.bigWig H3K9me3 kidney 20 ENCFF517QXW www.encodeproject.org/files/ENCFF517QXW/@ @download/ENCFF517QXW.bigWig H3K27ac heart 10.5 ENCFF222TEU www.encodeproject.org/files/ENCFF222TEU/@ @download/ENCFF222TEU.bigWig H3K27ac heart 11.5 ENCFF305IHU www.encodeproject.org/files/ENCFF305IHU/@@ download/ENCFF305IHU.bigWig H3K27ac heart 12.5 ENCFF937AXD www.encodeproject.org/files/ENCFF937AXD/@ @download/ENCFF937AXD.bigWig H3K27ac heart 13.5 ENCFF870SQY www.encodeproject.org/files/ENCFF870SQY/@ @download/ENCFF870SQY.bigWig H3K27ac heart 14.5 ENCFF689PCR www.encodeproject.org/files/ENCFF689PCR/@ @download/ENCFF689PCR.bigWig H3K27ac heart 15.5 ENCFF021RTZ www.encodeproject.org/files/ENCFF021RTZ/@ @download/ENCFF021RTZ.bigWig H3K27ac heart 16.5 ENCFF801FFG www.encodeproject.org/files/ENCFF801FFG/@ @download/ENCFF801FFG.bigWig H3K27ac heart 20 ENCFF804EYG www.encodeproject.org/files/ENCFF804EYG/@ @download/ENCFF804EYG.bigWig H3K27ac heart 56 ENCFF691YDA www.encodeproject.org/files/ENCFF691YDA/@ @download/ENCFF691YDA.bigWig H3K27me3 heart 10.5 ENCFF046VWN www.encodeproject.org/files/ENCFF046VWN/@ @download/ENCFF046VWN.bigWig H3K27me3 heart 11.5 ENCFF551QTH www.encodeproject.org/files/ENCFF551QTH/@ @download/ENCFF551QTH.bigWig H3K27me3 heart 12.5 ENCFF379MVJ www.encodeproject.org/files/ENCFF379MVJ/@ @download/ENCFF379MVJ.bigWig H3K27me3 heart 13.5 ENCFF972QDT www.encodeproject.org/files/ENCFF972QDT/@ @download/ENCFF972QDT.bigWig H3K27me3 heart 14.5 ENCFF129FZH www.encodeproject.org/files/ENCFF129FZH/@ @download/ENCFF129FZH.bigWig H3K27me3 heart 15.5 ENCFF044FTG www.encodeproject.org/files/ENCFF044FTG/@ @download/ENCFF044FTG.bigWig H3K27me3 heart 16.5 ENCFF280UTR www.encodeproject.org/files/ENCFF280UTR/@ @download/ENCFF280UTR.bigWig H3K27me3 heart 20 ENCFF845OXU www.encodeproject.org/files/ENCFF845OXU/@ @download/ENCFF845OXU.bigWig H3K27me3 heart 56 ENCFF344SFV www.encodeproject.org/files/ENCFF344SFV/@ @download/ENCFF344SFV.bigWig H3K9me3 heart 10.5 ENCFF172OCI www.encodeproject.org/files/ENCFF172OCI/@ @download/ENCFF172OCI.bigWig H3K9me3 heart 11.5 ENCFF207EPW www.encodeproject.org/files/ENCFF207EPW/@ @download/ENCFF207EPW.bigWig H3K9me3 heart 12.5 ENCFF797OAF www.encodeproject.org/files/ENCFF797OAF/@ @download/ENCFF797OAF.bigWig H3K9me3 heart 13.5 ENCFF637INN www.encodeproject.org/files/ENCFF637INN/@@ download/ENCFF637INN.bigWig H3K9me3 heart 14.5 ENCFF409BJZ www.encodeproject.org/files/ENCFF409BJZ/@ @download/ENCFF409BJZ.bigWig H3K9me3 heart 15.5 ENCFF921YZN www.encodeproject.org/files/ENCFF921YZN/@ @download/ENCFF921YZN.bigWig H3K9me3 heart 16.5 ENCFF637DCW www.encodeproject.org/files/ENCFF637DCW/@ @download/ENCFF637DCW.bigWig H3K9me3 heart 20 ENCFF046SEF www.encodeproject.org/files/ENCFF046SEF/@ @download/ENCFF046SEF.bigWig H3K27ac lung 14.5 ENCFF173XOV www.encodeproject.org/files/ENCFF173XOV/@ @download/ENCFF173XOV.bigWig H3K27ac lung 15.5 ENCFF018LWM www.encodeproject.org/files/ENCFF018LWM/@ @download/ENCFF018LWM.bigWig H3K27ac lung 16.5 ENCFF681GAF www.encodeproject.org/files/ENCFF681GAF/@ @download/ENCFF681GAF.bigWig H3K27ac lung 20 ENCFF924XGB www.encodeproject.org/files/ENCFF924XGB/@ @download/ENCFF924XGB.bigWig H3K27me3 lung 14.5 ENCFF164GUC www.encodeproject.org/files/ENCFF164GUC/@ @download/ENCFF164GUC.bigWig H3K27me3 lung 15.5 ENCFF024LWP www.encodeproject.org/files/ENCFF024LWP/@ @download/ENCFF024LWP.bigWig H3K27me3 lung 16.5 ENCFF749LHU www.encodeproject.org/files/ENCFF749LHU/@ @download/ENCFF749LHU.bigWig H3K27me3 lung 20 ENCFF210YRR www.encodeproject.org/files/ENCFF210YRR/@ @download/ENCFF210YRR.bigWig H3K9me3 lung 14.5 ENCFF492VCK www.encodeproject.org/files/ENCFF492VCK/@ @download/ENCFF492VCK.bigWig H3K9me3 lung 15.5 ENCFF368BVK www.encodeproject.org/files/ENCFF368BVK/@ @download/ENCFF368BVK.bigWig H3K9me3 lung 16.5 ENCFF828TZR www.encodeproject.org/files/ENCFF828TZR/@ @download/ENCFF828TZR.bigWig H3K9me3 lung 20 ENCFF399KQJ www.encodeproject.org/files/ENCFF399KQJ/@ @download/ENCFF399KQJ.bigWig H3K27ac limb 11.5 ENCFF897QOI www.encodeproject.org/files/ENCFF897QOI/@ @download/ENCFF897QOI.bigWig H3K27ac limb 12.5 ENCFF008XYM www.encodeproject.org/files/ENCFF008XYM/@ @download/ENCFF008XYM.bigWig H3K27ac limb 13.5 ENCFF402FVP www.encodeproject.org/files/ENCFF402FVP/@ @download/ENCFF402FVP.bigWig H3K27ac limb 14.5 ENCFF538TEQ www.encodeproject.org/files/ENCFF538TEQ/@ @download/ENCFF538TEQ.bigWig H3K27ac limb 15.5 ENCFF199SCG www.encodeproject.org/files/ENCFF199SCG/@ @download/ENCFF199SCG.bigWig H3K27me3 limb 11.5 ENCFF731BDW www.encodeproject.org/files/ENCFF731BDW/@ @download/ENCFF731BDW.bigWig H3K27me3 limb 12.5 ENCFF865VFL www.encodeproject.org/files/ENCFF865VFL/@ @download/ENCFF865VFL.bigWig H3K27me3 limb 13.5 ENCFF779RNO www.encodeproject.org/files/ENCFF779RNO/@ @download/ENCFF779RNO.bigWig H3K27me3 limb 14.5 ENCFF014HTI www.encodeproject.org/files/ENCFF014HTI/@@ download/ENCFF014HTI.bigWig H3K27me3 limb 15.5 ENCFF755WDT www.encodeproject.org/files/ENCFF755WDT/@ @download/ENCFF755WDT.bigWig H3K9me3 limb 11.5 ENCFF937IQZ www.encodeproject.org/files/ENCFF937IQZ/@@ download/ENCFF937IQZ.bigWig H3K9me3 limb 12.5 ENCFF951TKF www.encodeproject.org/files/ENCFF951TKF/@ @download/ENCFF951TKF.bigWig H3K9me3 limb 13.5 ENCFF577WZP www.encodeproject.org/files/ENCFF577WZP/@ @download/ENCFF577WZP.bigWig H3K9me3 limb 14.5 ENCFF033IOU www.encodeproject.org/files/ENCFF033IOU/@ @download/ENCFF033IOU.bigWig H3K9me3 limb 15.5 ENCFF367TZB www.encodeproject.org/files/ENCFF367TZB/@ @download/ENCFF367TZB.bigWig H3K27ac facial 10.5 ENCFF440LYR www.encodeproject.org/files/ENCFF440LYR/@ @download/ENCFF440LYR.bigWig H3K27ac facial 11.5 ENCFF089IXS www.encodeproject.org/files/ENCFF089IXS/@@ download/ENCFF089IXS.bigWig H3K27ac facial 12.5 ENCFF596BHZ www.encodeproject.org/files/ENCFF596BHZ/@ @download/ENCFF596BHZ.bigWig H3K27ac facial 13.5 ENCFF306YHS www.encodeproject.org/files/ENCFF306YHS/@ @download/ENCFF306YHS.bigWig H3K27ac facial 14.5 ENCFF071HGW www.encodeproject.org/files/ENCFF071HGW/@ @download/ENCFF071HGW.bigWig H3K27ac facial 15.5 ENCFF033PTH www.encodeproject.org/files/ENCFF033PTH/@ @download/ENCFF033PTH.bigWig H3K27me3 facial 10.5 ENCFF798NZC www.encodeproject.org/files/ENCFF798NZC/@ @download/ENCFF798NZC.bigWig H3K27me3 facial 11.5 ENCFF422AUK www.encodeproject.org/files/ENCFF422AUK/@ @download/ENCFF422AUK.bigWig H3K27me3 facial 12.5 ENCFF983GFL www.encodeproject.org/files/ENCFF983GFL/@ @download/ENCFF983GFL.bigWig H3K27me3 facial 13.5 ENCFF672JMP www.encodeproject.org/files/ENCFF672JMP/@ @download/ENCFF672JMP.bigWig H3K27me3 facial 14.5 ENCFF344FSI www.encodeproject.org/files/ENCFF344FSI/@@ download/ENCFF344FSI.bigWig H3K27me3 facial 15.5 ENCFF944UBT www.encodeproject.org/files/ENCFF944UBT/@ @download/ENCFF944UBT.bigWig H3K9me3 facial 10.5 ENCFF442KVI www.encodeproject.org/files/ENCFF442KVI/@@ download/ENCFF442KVI.bigWig H3K9me3 facial 11.5 ENCFF505IIX www.encodeproject.org/files/ENCFF505IIX/@@ download/ENCFF505IIX.bigWig H3K9me3 facial 12.5 ENCFF919YGD www.encodeproject.org/files/ENCFF919YGD/@ @download/ENCFF919YGD.bigWig H3K9me3 facial 13.5 ENCFF421HSW www.encodeproject.org/files/ENCFF421HSW/@ @download/ENCFF421HSW.bigWig H3K9me3 facial 14.5 ENCFF933OKD www.encodeproject.org/files/ENCFF933OKD/@ @download/ENCFF933OKD.bigWig H3K9me3 facial 15.5 ENCFF820QKT www.encodeproject.org/files/ENCFF820QKT/@ @download/ENCFF820QKT.bigWig
TABLE-US-00011 TABLE 11 Stratification of PRC2-bound silencers into four groups, I, II, III, and IV. Chr Start End Group Chr Start End Group chr3 88237599 88242602 I chr15 87543451 87546063 I chr3 88240796 88242456 I chr13 36724200 36725200 I chr7 79495660 79496915 I chr13 36723060 36725426 I chr2 152049452 152051243 I chr13 36723310 36724490 I chr2 152045878 152049156 I chr13 36723359 36724359 I chr7 140056065 140059407 I chr13 107646160 107648242 I chr7 140057319 140058701 I chr13 107644744 107646248 I chr4 22477615 22481565 I chr8 34395909 34398376 I chr4 22479779 22481611 I chr3 107534933 107540543 I chr4 22478252 22479329 I chr3 107536572 107539191 I chr4 22495434 22497568 I chr15 102734797 102735797 I chr4 22497167 22499410 I chr13 40606210 40607290 I chr4 22498504 22499504 I chr15 102735711 102736817 I chr7 79571284 79573281 I chr11 98338317 98340459 I chr7 79571386 79573917 I chr11 98336276 98340610 I chr14 122481280 122487381 I chr2 33542949 33548237 I chr9 91354259 91356307 I chr2 33542407 33547238 I chr9 91354882 91356407 I chr2 33542631 33546242 I chr9 91353458 91354923 I chr16 17833458 17834937 I chr14 122406139 122409107 I chr16 17833419 17834419 I chr14 122404897 122407214 I chr16 17833603 17835252 I chr14 122406492 122407842 I chr15 85623423 85627179 I chr14 122405894 122407296 I chr15 85625143 85626359 I chr13 83743506 83744644 I chr2 61815014 61816023 I chr13 83714136 83715976 I chr10 80208743 80209899 I chr5 120409167 120411493 I chr6 100562644 100564697 I chr5 120408996 120410747 I chr13 37311280 37312819 I chr9 37451316 37463581 I chr13 37311334 37313551 I chr9 37455214 37463261 I chr10 59955224 59957816 I chr18 76533140 76535698 I chr10 59956376 59958113 I chr9 37458935 37460874 I chr17 25555715 25557734 I chr9 37458466 37461526 I chr7 44428161 44431049 I chr9 37457887 37461983 I chr7 44425297 44431388 I chr9 37459485 37460488 I chr7 25177700 25180229 I chr9 37459175 37460601 I chr7 25178434 25180077 I chr10 110454509 110455509 I chr13 84344773 84347715 I chr4 107672657 107676006 I chr15 102745665 102748235 I chr7 65526945 65528097 I chr15 102745627 102748153 I chr7 65526781 65528108 I chr15 102746504 102748675 I chr7 78880320 78884392 I chr15 102745458 102747734 I chr7 78878009 78882819 I chr15 102745242 102747567 I chr13 54874282 54875945 I chr15 102747110 102748346 I chr15 102744338 102749614 I chr7 137317994 137320374 I chr15 102743668 102749147 I chr7 137318165 137320785 I chr15 102742832 102749181 I chr7 137317509 137319247 I chr15 102743379 102750411 I chr7 137321951 137323361 I chr15 102744542 102748391 I chr7 137321640 137322670 I chr15 102744446 102748239 I chr7 137320426 137322417 I chr15 102745224 102748663 I chr11 115370617 115375627 I chr11 119051475 119060400 I chr2 164938605 164940941 I chr10 110454669 110456423 I chr18 23309023 23311820 I chr11 119053474 119055550 I chr18 23309415 23311355 I chr11 119053894 119056314 I chr18 23310144 23311287 I chr6 51611890 51613085 I chr6 71010838 71014907 I chr13 84342223 84349697 I chr4 103619161 103621800 I chr13 84343600 84349253 I chr10 73097936 73100706 I chr2 61656443 61658061 I chr9 122567989 122569212 I chr2 61655493 61656884 I chr6 91842614 91844618 I chr2 61654203 61659205 I chr6 91842768 91843775 I chr10 127509344 127511306 I chr7 140060568 140062167 I chr15 99664201 99666374 I chr7 140060058 140062376 I chr15 99663568 99665440 I chr7 140060402 140061404 I chr15 99663480 99667403 I chr4 21688565 21689909 I chr18 47537438 47538445 I chr4 21688616 21689624 I chr2 168625733 168628354 I chr4 136861902 136864697 I chr5 149258199 149260019 I chr1 177322999 177324913 I chr11 118998640 119000545 I chr12 118853696 118855445 I chr11 118998309 119000661 I chr13 56208300 56209639 I chr11 118998697 119000345 I chr4 126619270 126620845 I chr11 118998591 119002038 I chr4 126619719 126620958 I chr11 118998890 119000769 I chr4 126619029 126622135 I chr11 118997735 118999450 I chr14 118231657 118232659 I chr5 139551680 139554926 I chr14 118230216 118232931 I chr5 139585007 139586007 I chr13 78182467 78183475 I chr5 139550788 139552340 I chr13 51916984 51921940 I chr5 139551509 139552519 I chr13 51918977 51919977 I chr14 118435372 118439845 I chr12 25124335 25125773 I chr14 118436171 118438186 I chr5 139598103 139601426 I chr8 92460003 92461646 I chr15 99092824 99093824 I chr8 92460035 92461958 I chr2 93179529 93181627 I chr8 92459329 92462073 I chr11 112871557 112873268 I chr8 92459006 92462381 I chr19 45540347 45546273 I chr11 84641628 84643767 I chr19 45539053 45543993 I chr11 84642838 84643838 I chr19 45540951 45543084 I chr11 84631435 84644718 I chr11 117027013 117028831 I chr13 97007991 97009514 I chr19 44881187 44883171 I chr6 88498292 88500513 I chr19 44878187 44883951 I chr2 115852199 115853199 I chr11 75290227 75292745 I chr2 115852096 115854082 I chr11 75289670 75295566 I chr2 115853888 115854890 I chr11 75292870 75294444 I chr19 45292734 45295019 I chr8 46214651 46222308 I chr13 71457796 71459697 I chrX 103693893 103695378 I chr13 71457685 71459685 I chr11 98457408 98458878 I chr13 71457552 71460081 I chr11 119054653 119056559 I chr17 23699127 23700370 I chr18 38145930 38149790 I chr17 23699222 23700278 I chr2 94273198 94275974 I chr2 173585229 173587260 I chr2 94272512 94274436 I chr2 173584767 173586834 I chr2 94272087 94275160 I chr2 173585436 173586948 I chr11 82970617 82972486 I chr2 173585342 173588177 I chr11 82970348 82972308 I chr2 173584342 173586280 I chr11 82969767 82972260 I chr2 173585873 173586873 I chr2 118976022 118977494 I chr2 173582386 173586900 I chr2 118976299 118977347 I chr15 103168260 103170778 I chr2 118976604 118977604 I chr15 103168268 103170503 I chr2 118975606 118977795 I chr15 103168331 103170924 I chr11 75965616 75967391 I chr15 103168029 103170055 I chr11 75966085 75967091 I chr15 103168896 103170458 I chr2 44556525 44558591 I chr15 103167289 103171251 I chr11 85843067 85844508 I chr15 103168029 103173398 I chr11 85841963 85842963 I chr15 103085244 103087794 I chr5 52474634 52479083 I chr15 103085671 103088837 I chr5 52475067 52476710 I chr15 103085688 103088056 I chr18 11351189 11354022 I chr15 103084897 103087692 I chr2 18693435 18696377 I chr15 103085387 103087590 I chr2 18692071 18695302 I chr15 103084459 103087111 I chr2 18691212 18694575 I chr15 103084871 103086852 I chr12 85485390 85487668 I chr15 103084496 103088665 I chrX 103694297 103696292 I chr15 103083799 103088860 I chr9 110778738 110782807 I chr15 103084763 103088898 I chr9 110780810 110781996 I chr15 103085348 103089069 I chr3 8765115 8769412 I chr15 103083620 103090815 I chr3 8767104 8768183 I chr15 103081143 103089904 I chr6 114967829 114970181 I chr19 45231030 45232030 I chr6 114968308 114970835 I chr11 118957059 118958577 I chr10 120550741 120554206 I chr4 130860639 130866519 I chr10 120551518 120553686 I chr4 47435307 47437721 I chr11 94883259 94884992 I chr2 36203064 36204066 I chr11 94880315 94882759 I chr11 94880086 94881741 I chr14 25316908 25319192 I chr11 94881617 94882720 I chr2 115857261 115859308 I chr6 51171759 51180651 I chr2 115857263 115858393 I chr6 51171019 51180256 I chr18 35932930 35935061 I chr6 51168120 51185559 I chr2 115859866 115860866 I chr6 51171757 51174924 I chr2 115860236 115861566 I chr6 51171574 51172574 I chr2 115859603 115861654 I chr6 51173151 51175843 I chr2 115859734 115860757 I chr6 51173180 51175528 I chr11 89297711 89298711 I chr6 51172963 51174101 I chr9 23082798 23084844 I chr9 32672531 32673969 I chrX 99567700 99570776 I chr4 136146488 136147490 I chrX 99566294 99568269 I chr17 83322383 83324166 I chr3 87958005 87959965 I chr17 47973549 47975323 I chr10 120271567 120273399 I chr15 67175684 67178096 I chr8 10922521 10923931 I chr15 67174757 67176747 I chr3 8715726 8717553 I chrX 11997155 12008971 I chr3 8716460 8718255 I chr17 83274160 83278650 I chr7 143436364 143438519 I chr17 83275647 83277252 I chr7 143437354 143439098 I chr4 97751323 97753083 I chr16 17814505 17817397 I chr6 51168264 51170573 I chr16 17814589 17816465 I chr6 51168239 51170317 I chr7 125391861 125394445 I chr6 51167002 51170726 I chr5 135275110 135278091 I chr6 51168001 51169898 I chr3 131105716 131106723 I chr13 105293298 105294772 I chr9 107735018 107737194 I chr13 105293614 105295142 I chr15 102355071 102356422 I chr13 105292984 105294355 I chr14 21982814 21983918 I chr8 88453032 88455855 I chr5 33691540 33697642 I chr8 88452591 88455347 I chr5 33691776 33700575 I chr5 33689123 33690592 I chr5 33694991 33696328 I chr5 33689049 33690638 I chr5 33694603 33696196 I chr3 95971891 95974042 I chr3 87958396 87961173 I chr17 84095656 84098450 I chr3 87957503 87961307 I chr2 25166758 25170955 I chr3 87959492 87961061 I chr15 82962714 82964805 I chr3 87959467 87960467 I chr1 178275224 178277050 I chr18 35888285 35890978 I chr5 112395190 112396466 I chr17 15829804 15830804 I chr11 119052236 119053631 I chr1 4570998 4572517 I chrX 11806186 11807576 I chr1 4571093 4572816 I chr3 130945717 130947077 I chr1 4570113 4574931 I chr5 135255234 135259451 I chr17 81669362 81671486 I chr1 165280446 165281448 I chr17 81669141 81671689 I chr14 25317278 25319610 I chr17 81668952 81669952 I chr14 78731405 78733811 I chr17 94886231 94887235 II chr7 98816167 98820265 I chr4 146049526 146051283 II chr9 67633796 67634796 I chr2 57628583 57630623 II chr9 32031389 32032988 I chr5 15673165 15674168 II chr11 119055661 119057010 I chr5 26008689 26009689 II chr11 119055004 119056811 I chr5 26069420 26070422 II chr9 72131256 72134380 I chr5 26079120 26080120 II chr14 65342719 65346277 I chr11 16514994 16516748 II chr4 44233749 44234751 I chr8 20029483 20033895 II chr4 8646714 8649686 I chr12 20195844 20197650 II chr4 97772025 97773025 I chr12 115203777 115204777 II chr9 63107452 63109561 I chr12 115503937 115505243 II chr5 149030680 149032636 I chr13 65484193 65486354 II chr4 97772648 97773677 I chr13 119965379 119966605 II chrX 11663944 11666029 I chr13 65904835 65909173 II chr6 127329224 127331603 I chr14 5899141 5901257 II chr2 18763385 18768353 I chr14 5908742 5909747 II chr2 18764419 18769914 I chr14 7657613 7659864 II chr10 59969723 59971931 I chr14 19606481 19607481 II chr2 18765345 18767356 I chr16 3349141 3350143 II chr2 18766289 18768518 I chr14 106331485 106332494 II chr2 18765766 18768600 I chrX 15261714 15262715 II chr5 142822274 142823275 I chr5 26067605 26069438 II chr2 30692932 30694859 I chr5 26074304 26076026 II chr13 28957513 28960252 I chr12 22029550 22030553 II chr2 135658304 135659305 I chr5 26077854 26080667 II chr15 85669502 85673130 I chr15 21656502 21657512 II chr15 85669731 85673988 I chr16 68986034 68987034 II chr15 85670455 85672787 I chr4 79045822 79046822 II chr14 5901693 5905693 II chr14 7243524 7245696 II chr13 120096133 120097338 II chr14 7242570 7246025 II chr14 5897793 5902102 II chr14 7244703 7245732 II chr14 6427043 6428092 II chr14 7244054 7245709 II chr14 6426053 6429024 II chr14 4018005 4020161 II chr14 7243750 7245703 II chr14 4017874 4019880 II chr12 115572035 115573698 II chr14 4018483 4019748 II chr12 22029643 22031118 II chr3 62159311 62160458 II chr12 115612696 115613696 II chr2 150500061 150502304 II chr12 115799148 115800516 II chr10 6206095 6207103 II chr13 65989825 65992049 II chr11 21990738 21991738 II chr13 120094527 120096465 II chr4 145450500 145451783 II chr17 53151566 53153518 II chr14 6426099 6428041 II chr14 7243755 7245988 II chr14 6426117 6428021 II chr14 6426127 6428037 II chr17 47107141 47108143 II chr14 6426240 6428063 II chr9 98051422 98052886 II chr14 6425769 6428060 II chr13 94705463 94706682 II chr14 7657995 7659598 II chr2 128255849 128256849 II chr14 7657615 7659347 II chr16 12930921 12931933 II chr14 7657355 7659259 II chr5 41754951 41755953 II chr14 7657583 7659631 II chr18 36256589 36257589 II chr14 7657348 7659601 II chr18 36256589 36257589 II chr14 7657326 7659580 II chr18 36256588 36257588 II chr12 115549429 115552846 II chr18 36256588 36257588 II chr12 114118469 114121030 II chr18 36256588 36257588 II chr12 115216325 115219276 II chr9 40869930 40871194 II chr12 115215315 115219471 II chr9 89882413 89883424 II chr12 115214978 115219471 II chr9 45021166 45022166 II chr10 7387867 7388950 II chr4 87604371 87605371 II chr12 115596851 115598622 II chr15 41276961 41277963 II chr3 19009182 19010182 II chr1 171084334 171086501 II chr3 19009182 19010182 II chr17 19713075 19715036 II chr5 44401339 44402341 II chr12 114803731 114805702 II chr7 95456206 95457220 II chr12 115683804 115685626 II chr12 115549048 115553855 II chr12 114649054 114650351 II chr12 115550069 115553839 II chr12 18134429 18137046 II chr12 115551376 115553785 II chr12 18134155 18137038 II chr12 115819733 115822119 II chr12 115571730 115575462 II chr12 115819387 115822572 II chr12 115571756 115574766 II chrX 137099535 137101182 II chr12 115806468 115808428 II chr16 3113730 3117330 II chr17 69075431 69077643 III chr13 60442418 60443881 II chr17 69074712 69077151 III chr9 89879817 89880818 II chr17 69075840 69078416 III chr17 36064826 36066548 II chr17 69075299 69076299 III chr10 33665981 33666981 II chr17 69073557 69078906 III chr3 140328408 140329408 II chr1 133162990 133165300 III chr17 36077430 36078996 II chr1 133163210 133165260 III chr5 15043891 15045971 II chr1 133163219 133164978 III chr2 74777822 74778822 II chr1 133164064 133165086 III chr6 51179898 51180907 II chr1 133163739 133164776 III chr6 51179264 51181061 II chr5 67227607 67229825 III chr6 51179086 51180542 II chr5 67228152 67233398 III chr12 115816407 115819495 II chr5 67228791 67229796 III chr12 115816439 115819336 II chr5 67229975 67231977 III chr12 115816507 115819095 II chr5 67230593 67231893 III chr13 56208025 56209025 II chr5 67229455 67231413 III chr13 53462697 53463697 II chr5 67215123 67217151 III chr5 67216251 67217251 III chr9 87733834 87734921 III chr5 67215533 67216825 III chr12 58214614 58215649 III chr2 118765796 118767968 III chr7 89499950 89501604 III chr2 119315402 119318225 III chr11 90416630 90421094 III chr4 100041605 100043581 III chr3 95982166 95983466 III chr6 72793312 72795443 III chr7 19315692 19316692 III chr7 130108165 130109563 III chr9 40794327 40795380 III chr4 129749953 129752554 III chr9 23034035 23037130 III chr4 129749605 129751885 III chr7 100974484 100975492 III chr4 133899417 133900417 III chr9 43269475 43276623 III chr16 55758683 55759684 III chr7 73573436 73576292 III chr16 55758426 55759686 III chr6 145275443 145276526 III chr5 29467735 29469142 III chr4 141271966 141272967 III chr12 57549306 57551066 III chr15 80571637 80572719 III chr7 96080538 96081539 III chr10 13495836 13496838 III chr11 119058237 119060036 III chr10 13495836 13496836 III chr7 90301607 90302931 III chr2 18605754 18611371 III chr13 98587623 98591025 III chr2 18606286 18610713 III chr3 145632487 145633534 III chr2 18606259 18613057 III chr3 145632751 145633920 III chr2 18608816 18610148 III chr10 22842322 22844642 III chr2 18608172 18611014 III chr10 22842479 22844439 III chr2 18606908 18609947 III chr10 22843445 22844446 III chr2 18607710 18611146 III chr10 22843592 22845927 III chr2 18607664 18610476 III chr10 22842020 22845382 III chr2 18607437 18610004 III chr19 43598155 43601213 III chr2 18608129 18610043 III chr19 43598656 43602492 III chr2 18607293 18609343 III chr19 43599603 43601720 III chr8 19979180 19983264 III chr19 43598792 43600637 III chr2 22743134 22746826 III chr19 43598114 43604067 III chr2 22743895 22746096 III chr19 43605579 43607753 III chr2 22743883 22745123 III chr1 184725265 184726386 III chr9 66051153 66052153 III chr1 184723825 184726925 III chr9 66051153 66052153 III chr10 44526333 44527917 III chr19 41441393 41442406 III chr10 44526555 44528016 III chr9 77420519 77422155 III chr10 44527094 44528747 III chr4 135204900 135207356 III chr10 44526484 44529159 III chr2 69802529 69804442 III chr19 56776119 56777562 III chr11 53563369 53564370 III chr16 91533662 91534700 III chr2 118943999 118945552 III chr16 91534629 91535659 III chr2 160361189 160362189 III chr19 45694557 45695588 III chr2 160360890 160363523 III chr6 97182072 97183075 III chr4 8682982 8684639 III chr2 32087062 32088062 III chr2 170093867 170094869 III chr2 170094811 170095811 III chr12 112802724 112804486 III chr5 135088834 135092205 III chr6 38687895 38689397 III chr5 135088230 135091014 III chr17 80009273 80010485 III chr11 121323590 121324597 III chr13 56762876 56767905 III chr8 86603018 86604018 III chr5 52112084 52113272 III chr18 64332242 64334061 III chr5 52111812 52113413 III chr18 64330943 64333781 III chr7 31176417 31179189 III chr13 23401129 23403157 III chr13 23411472 23412656 III chr2 170458764 170460717 III chr2 90890721 90891721 III chr19 45675709 45677555 III chr15 75645469 75647949 III chr19 45675561 45677079 III chr4 55473604 55476408 III chr19 45675227 45676595 III chr15 83744804 83746629 III chr19 45675230 45678011 III chr17 45226125 45227658 III chr19 45675152 45678504 III chr17 45226126 45227128 III chr5 106755978 106757793 III chr12 112696261 112702132 III chr5 106756277 106759251 III chr12 112699334 112702951 III chr2 70471386 70472387 III chr2 173514861 173518450 III chr13 48705486 48707199 III chr1 167659310 167662614 III chr5 119005364 119011638 III chr11 85994989 85996785 III chr13 51593928 51595942 III chr11 104099174 104100549 III chr16 90519084 90520750 III chr4 136080499 136082469 III chr4 124178013 124179013 III chr4 136079899 136082107 III chr4 124176075 124179602 III chr4 136080025 136082848 III chr14 118472906 118478104 III chr11 119046992 119048844 III chr2 18688853 18690202 III chr5 119705024 119708218 III chr2 18688532 18690328 III chr5 119706314 119707355 III chr2 18688345 18690664 III chr6 70966210 70967722 III chr2 18688841 18693251 III chr6 71048023 71049714 III chr2 18687832 18691476 III chr11 95644445 95645445 III chr2 18688744 18691259 III chr5 37900945 37902280 III chr2 18688665 18691202 III chr17 7826561 7828386 III chr2 18688858 18691779 III chr2 118896776 118897776 III chr8 88451105 88453532 III chr1 191125447 191126893 III chr8 88450964 88452325 III chr1 191123781 191126778 III chr8 88449225 88451783 III chr19 3422180 3425537 III chr17 48093525 48098564 III chr7 99248388 99250619 III chr17 48094048 48098564 III chr7 99248304 99250291 III chr17 48094020 48102334 III chr7 99248368 99250951 III chr11 112788627 112789627 III chr14 25448419 25449999 III chr8 33516777 33518466 III chr14 25447843 25450078 III chr1 155207156 155208158 III chr1 166042655 166043919 III chr1 155207156 155208158 III chr4 136083235 136084242 III chr4 55476692 55478771 III chr4 136081171 136084808 III chr9 71399486 71401027 III chr13 98571362 98575045 III chr18 75359876 75363337 III chr13 98501311 98503619 III chr6 85408295 85411204 III chr13 98499310 98514030 III chr6 85407944 85411574 III chr13 98496248 98509799 III chr1 42416251 42417685 III chr3 107581462 107585399 III chr19 44880048 44881533 III chr3 107578723 107586104 III chr17 80846225 80848377 III chr3 107581258 107582556 III chr10 119066116 119067118 III chr3 107582095 107584154 III chr4 43719700 43720703 III chr3 107581819 107584308 III chr4 43719699 43720700 III chr3 107583134 107584134 III chr2 36008779 36013475 III chr12 33968574 33969574 III chr2 36007419 36013277 III chr1 14506052 14508276 III chr2 36010701 36013100 III chr5 37816333 37819452 III chr2 36010539 36013326 III chr5 37816304 37819206 III chr13 116710188 116711208 III chr5 37816899 37819017 III chr13 116313554 116314719 III chr5 37817592 37819012 III chr13 116704641 116712964 III chr5 37816636 37817934 III chr13 116705377 116707817 III chr5 37816395 37818090 III chr4 148769560 148771093 III chr5 37815696 37818353 III chr1 186833017 186835390 III chr5 37828309 37832387 III chr5 53257472 53258841 III chr5 37813988 37819750 III chr4 97744950 97747223 III chr5 37815387 37817294 III chr4 97745047 97746896 III chr5 37827841 37828932 III chr4 97744863 97748883 III chr5 37828045 37829595 III chr1 86017403 86018760 III chr1 78213776 78222076 III chr5 137189298 137191045 III chr1 78215490 78216988 III chr18 36319080 36321951 III chr1 78215860 78218245 III chr2 122466371 122468267 III chr1 78215590 78218083 III chr2 118971221 118979015 III chr1 78215923 78217956 III chr2 118973301 118977667 III chr1 78215467 78219179 III chr13 72636344 72640748 III chr1 78216396 78217662 III chr13 72634690 72641952 III chr1 78216603 78218404 III chr13 72638802 72640688 III chr1 78217067 78218508 III chr13 72624226 72625689 III chr9 120732884 120734634 III chr12 56301716 56302717 III chr5 111530109 111532710 III chr12 56301850 56303129 III chr13 98504198 98505198 III chr12 56299808 56302221 III chr5 135276803 135278357 III chr2 148032921 148035465 III chr8 88381790 88383927 III chr2 148033162 148035434 III chr11 85916280 85919140 III chr2 148030866 148032858 III chr13 53461075 53463916 III chr2 148030148 148032446 III chr13 53462077 53463077 III chr2 148029489 148031297 III chr13 53465649 53466868 III chr2 148028519 148030196 III chr13 53465550 53466656 III chr13 53464224 53465880 III chr6 53792945 53797308 III chr13 53463890 53464890 III chr11 4749383 4751747 III chr13 53475910 53477131 III chr18 76376933 76380675 III chr12 73050649 73052820 III chr12 80738693 80740532 III chr12 73050826 73052452 III chr4 150032284 150033576 III chr12 73052267 73054385 III chr4 150031932 150033845 III chr12 33964324 33969057 III chr19 45544624 45546161 III chr12 33965015 33967715 III chr1 190664859 190667018 III chr12 33967042 33968042 III chr9 27213192 27214192 III chr12 33961253 33964144 III chr4 150029395 150031740 III chr13 48668186 48670023 III chr19 45226634 45227646 III chr13 48668558 48669852 III chr14 68055032 68056685 III chr13 48668786 48671255 III chr19 44733799 44736426 III chr13 48658636 48660378 III chr14 104472320 104474377 III chr13 55962455 55965679 III chr19 44683024 44684762 III chr13 55961237 55963568 III chr19 44682764 44684683 III chr15 103111247 103117492 III chr19 44681637 44684408 III chr8 25354534 25355534 III chr5 101657081 101658081 III chr13 98385987 98394622 III chr5 101656870 101657872 III chr5 136892595 136896887 III chr2 169360962 169361962 III chr17 85691663 85694473 III chr13 40709747 40712092 III chr17 85691037 85693009 III chr11 33193226 33195440 III chr17 85678542 85680820 III chr9 40855287 40860529 III chr9 32547586 32548682 III chr13 94869647 94871501 III chr6 51174665 51175955 III chr12 55537685 55539538 III chrX 145515025 145516029 III chr6 52318685 52320551 III chr5 119659338 119664156 III chr5 139567643 139592672 III chr5 119662199 119664967 III chr2 9889752 9891194 III chr11 85925483 85926881 III chr5 139667338 139670435 III chr11 85925405 85926662 III chr5 139666437 139670596 III chr11 85924230 85926299 III chr5 139666542 139668659 III chr6 52253542 52254542 III chr5 139667014 139668787 III chr6 52252822 52254497 III chr5 139668419 139669419 III chr3 99240932 99242642 III chr2 9895187 9896596 III chr3 99241021 99242942 III chr2 9894908 9896254 III chr3 99240512 99243204 III chr2 9894254 9897325 III chr3 99239822 99241129 III chr19 45227689 45230361 III chr5 33538139 33543608 III chr19 45225362 45227452 III chr19 45220503 45224874 III chr11 33199003 33200666 III chr4 153188635 153190522 III chr19 45222532 45225377 III chr11 76666335 76667351 III chr19 45222096 45225300 III chr6 126700503 126702595 III chr19 45222431 45224756 III chr6 126700339 126703074 III chr18 34678442 34680611 III chr7 37438482 37439482 III chr13 94708311 94712195 III chr1 89926255 89927255 III chr13 94595178 94597176 III chr1 187604780 187605781 III chr13 94594348 94596783 III chr1 187604186 187605958 III chr13 94594207 94598138 III chr12 110372636 110376422 III chr4 44424917 44426967 III chr10 80468799 80473214 III chr4 44424094 44426480 III chr8 87036165 87039612 III chr15 99094006 99095389 III chr10 63088906 63092287 III chr5 139554124 139556568 III chr12 104637166 104639159 III chr11 84561568 84565690 III chr4 115961877 115965228 III chr11 84562710 84564016 III chr15 98795702 98797385 III chr4 143324627 143327535 III chr15 75644220 75646909 III chr2 165562145 165564071 III chr4 136904302 136906998 III chr7 143444017 143445032 III chr16 78234118 78236693 III chr15 98798064 98799064 III chr15 91077908 91078908 III chr15 98797274 98798950 III chr19 28974784 28976012 III chr1 78201423 78203111 III chr17 83544493 83545956 III chr1 78201409 78203694 III chr5 33460960 33467861 III chr1 78199873 78202500 III chr4 123991289 123992956 III chr1 78201133 78202630 III chr9 69755231 69756231 III chr1 78200758 78201995 III chr14 72531301 72533440 III chr1 78200421 78201421 III chr16 91232106 91233106 III chr9 99868717 99871465 III chr16 91300035 91303080 III chr9 99869634 99871581 III chr16 91299578 91303844 III chr9 99869941 99870941 III chr9 69668108 69672316 III chr9 99870022 99871099 III chr12 74283501 74285184 III chr9 99869589 99871048 III chr18 38023372 38027336 III chr8 78427073 78428073 III chr18 42428469 42431581 III chr9 99868588 99869829 III chr1 190688968 190692523 III chr9 99868662 99869662 III chr4 13563673 13567009 III chr9 99868083 99869639 III chr8 126138140 126141291 III chr9 99867807 99869724 III chr8 126137950 126139931 III chr9 99869969 99872234 III chr8 126138700 126140586 III chr9 99869321 99872631 III chr8 126138616 126140162 III chr9 99868089 99873492 III chr15 103161945 103190307 III chr9 99871132 99872991 III chr9 56824104 56826786 III chr9 99871123 99872855 III chr11 84598648 84600359 III chr9 99871184 99872582 III chr11 84599364 84600364 III chr9 99870956 99872410 III chr9 107376825 107384066 III chr1 120612058 120618044 III chr4 120358718 120362283 III chr5 28156013 28160871 III chr9 40858430 40859571 III chr1 120610828 120611828 III chr9 40858004 40859005 III chr5 28115577 28129068 III chr13 94710006 94711134 III chr5 28116704 28125730 III chr5 28120328 28125973 III chrX 57920123 57922642 III chr5 28124052 28125982 III chr9 37454795 37457530 III chr5 28115858 28120181 III chrX 58018871 58019871 III chr5 28117135 28118806 III chr7 44425833 44427763 III chr19 25605279 25606641 III chr9 46442366 46443883 III chr19 25606127 25607809 III chr10 80191216 80192972 III chr4 109974305 109975308 III chr6 91285452 91286452 III chr4 109974019 109975233 III chr2 180488275 180489872 III chr2 172727268 172730326 III chr2 180487384 180489838 III chr2 172727141 172729067 III chr2 73278805 73280027 III chr4 109984546 109985578 III chr2 73277675 73279245 III chr19 59465975 59472829 III chr2 73279307 73280783 III chr5 106463167 106465272 III chr11 98316530 98318564 III chr3 127641761 127642779 III chr4 125476795 125480047 III chrX 60889567 60890567 III chr11 98320188 98322141 III chr3 127638523 127641543 III chr11 98319840 98322763 III chr3 127638243 127639998 III chr11 98319437 98321176 III chr3 127625174 127629722 III chr11 119089422 119090422 III chr17 85484439 85487901 III chr11 119089603 119090604 III chr17 85484394 85487727 III chr16 34744726 34746556 III chr17 85485755 85487562 III chr3 149087246 149089223 III chr17 85483501 85490765 III chr3 149087870 149090193 III chr17 85463529 85467313 III chr3 9345650 9347553 III chr17 85462971 85467157 III chr11 101936183 101938332 III chr17 85464499 85466687 III chr14 64045546 64046939 III chr11 21992116 21994349 III chr15 28049576 28052559 III chr11 21993210 21994681 III chr9 48644682 48651288 III chr11 21992683 21993702 III chr11 119089125 119090911 III chr5 120321067 120322661 III chr11 119089110 119091724 III chr5 120321462 120323265 III chr11 119090070 119091070 III chr12 118842346 118843436 III chr13 37777638 37779454 III chr13 56257820 56259818 III chr13 37777359 37779665 III chr13 56257890 56259725 III chr13 37778688 37780011 III chr13 56257103 56259226 III chr18 11238665 11241362 III chr13 56255905 56260724 III chr18 11239798 11240979 III chr2 71542071 71543253 III chr5 136619811 136624345 III chr2 71541715 71542903 III chr4 123228438 123229560 III chr2 71540518 71543090 III chr5 74904864 74905864 III chr2 71540701 71542445 III chr1 184770605 184772410 III chr7 25180513 25181623 III chr4 130162865 130164371 III chr4 148172058 148174458 III chr3 149085360 149086360 III chr5 120301043 120302405 III chr16 38720520 38726204 III chr5 120298285 120305241 III chr5 147750554 147753347 III chr5 149020174 149021900 III chr12 109398762 109399819 III chr6 114967349 114968369 III chr7 143464459 143466013 III chr11 85844745 85845747 III chr4 106827285 106828599 III chr3 51357757 51359070 III chr17 3314101 3315102 III chr2 168049539 168051255 III chr13 48693502 48695608 III chr12 105013229 105014465 III chr13 48693140 48694468 III chr18 66474925 66476976 III chr10 89344391 89345571 III chr2 18587804 18589166 III chr15 85176787 85178747 III chr2 119318128 119319402 III chr17 26845073 26846085 III chr6 144779898 144781062 III chr10 80462344 80464877 III chr2 118749369 118752329 III chr11 52743091 52747765 III chr17 10370847 10371988 III chr1 171551940 171553649 III chr4 115052675 115053680 III chr17 26849170 26851064 III chr4 115051222 115053706 III chr17 26848888 26851172 III chr9 64059573 64061275 III chr14 63251599 63252599 III chr9 64059101 64062459 III chr14 63250188 63253351 III chr19 36347541 36350072 III chr14 63252986 63254087 III chr19 36347367 36349824 III chr14 63268801 63270764 III chr19 36347449 36350657 III chr14 63266359 63268515 III chr19 36347973 36349716 III chr14 63254072 63256124 III chr19 36347956 36348956 III chr5 119802440 119804487 III chr8 87973840 87978089 III chr5 119802056 119803633 III chr6 72184317 72192446 III chr5 119803183 119805099 III chr7 98870472 98873441 III chr5 119803666 119805264 III chr9 32548285 32550011 III chr5 119800119 119802175 III chr4 114688138 114689329 III chr12 78911053 78913373 III chr9 32544661 32546669 III chr12 78910848 78913741 III chr9 32544195 32545246 III chr3 89131790 89133464 III chr6 51173757 51178201 III chr4 115094637 115096600 III chr6 51174045 51175584 III chr4 115094154 115098468 III chr9 32408005 32410281 III chr15 80257715 80260138 III chr9 32407480 32410297 III chrX 11997824 11999913 III chr9 32406886 32411018 III chr2 36196734 36207344 III chr3 30513449 30514449 III chr17 33977675 33979787 III chr3 30513296 30514298 III chr17 33977045 33979671 III chr3 30513711 30516989 III chr17 33976936 33979287 III chr3 30513469 30515848 III chr17 33976936 33979287 III chr3 30514374 30516471 III chr17 33978039 33979422 III chr11 94871683 94873187 III chr17 33977887 33979244 III chr7 83744860 83745886 III chr17 33977453 33979419 III chr5 74943855 74945787 III chr17 33977822 33978822 III chr5 74940651 74944935 III chr17 33976391 33979443 III chr19 45079854 45082337 III chr17 33976397 33979423 III chr17 33976210 33979422 III chr11 96276958 96278147 III chr17 33975408 33979423 III chr15 102999533 103000533 III chr12 57538192 57540253 III chr15 102999019 103000954 III chr12 57534744 57539830 III chr15 103000521 103001730 III chr12 57533620 57537296 III chr11 96404538 96406957 III chr12 57534398 57538070 III chr2 169995064 169996411 III chr2 148038574 148040834 III chr11 96407027 96408823 III chr2 148039148 148041208 III chr11 96406930 96408535 III chr2 148038576 148041079 III chr11 96406508 96408850 III chr2 148039111 148040111 III chr11 96407835 96409589 III chr2 148037571 148040933 III chr11 96405565 96408835 III chr2 148037402 148040369 III chr11 96406972 96409884 III chr13 98365161 98366343 III chr11 96405730 96409095 III chr11 95595912 95597679 III chr11 96405951 96407859 III chr19 44723555 44724890 III chr17 83997149 83999110 III chr19 44722980 44724585 III chr17 83997149 83999152 III chr15 103182459 103183459 III chr11 96310871 96313241 III chr15 103181298 103183369 III chr11 96311273 96312276 III chr15 103182197 103184166 III chr11 96310752 96311752 III chr13 94607476 94608970 III chr11 18875381 18876789 III chr17 23692979 23701905 III chr11 18874868 18876796 III chr5 35312771 35315772 III chr13 107893450 107896273 IV chr17 48545386 48546426 III chr10 29970956 29971974 IV chr19 44638867 44641833 III chr4 56190502 56191502 IV chr19 44638599 44641005 III chr11 54139754 54140759 IV chr19 44639861 44641465 III chr3 8245490 8246514 IV chr19 44667929 44675418 III chr5 51358374 51359375 IV chr15 103171325 103172697 III chr13 119420680 119423683 IV chr15 103067464 103069429 III chr17 84505825 84507152 IV chr15 103177179 103178601 III chr15 102958068 102959068 IV chr15 103177291 103178916 III chr4 3232434 3233435 IV chr15 102985480 102987660 III chr16 94081408 94082408 IV chr15 103069218 103071079 III chr16 94077521 94081925 IV chr15 103068535 103069728 III chr16 94078427 94079429 IV chr15 103039542 103041595 III chr15 28067971 28072409 IV chr19 44750496 44751684 III chr13 119615604 119618288 IV chr19 44749012 44751812 III chr17 87969609 87970609 IV chr19 44740060 44743705 III chr17 87969608 87970608 IV chr19 44739325 44743791 III chr17 87968646 87970611 IV chr15 103001696 103003826 III chr3 99239053 99240055 IV chr15 102995787 102998485 III chr6 51176536 51177536 IV chr15 103004760 103005819 III chr6 51175758 51178873 IV chr11 96276654 96278470 III chr6 51176052 51178308 IV chr6 51180630 51181824 IV chr1 42430078 42432454 IV chr6 51180052 51181506 IV chr4 81479791 81480907 IV chr2 118973413 118975340 IV chr19 44648839 44651554 IV chr11 76667819 76668930 IV chr5 101364327 101367380 IV chr2 163947445 163949032 IV chr19 44638621 44639621 IV chr12 118456679 118458243 IV chr19 44675495 44678258 IV chr12 112707841 112709694 IV chr18 42416275 42419852 IV chr2 18783027 18785869 IV chr4 115974572 115975572 IV chr19 45162513 45164721 IV chr9 89814247 89816135 IV chr9 98963755 98965321 IV chr19 45239799 45241804 IV chr5 35400588 35402264 IV chr18 76846836 76849201 IV chr5 35400833 35402565 IV chr5 29484513 29486442 IV chr5 35399036 35402902 IV chr5 29484422 29486081 IV chr17 43001838 43002849 IV chr5 29484529 29487804 IV chr2 172544955 172545955 IV chr17 8428819 8431756 IV chr2 127265460 127266462 IV chr17 8428619 8430961 IV chr17 36211555 36213792 IV chr17 8429819 8431890 IV chr14 103351086 103354015 IV chr17 8428563 8429897 IV chr3 88019292 88021151 IV chr16 17221351 17223379 IV chr13 110743071 110745351 IV chr16 17222263 17223387 IV chr6 83081373 83082510 IV chr11 90938052 90939053 IV chr10 121330616 121332970 IV chr3 107462434 107463434 IV chr8 45385940 45389441 IV chr19 24895654 24896654 IV chr13 21994409 21998339 IV chr5 29469485 29470488 IV chr19 45163746 45166441 IV chr9 98971193 98972779 IV chr13 25048853 25051910 IV chr10 57446708 57448237 IV chr5 75078443 75080442 IV chr16 98022153 98024152 IV chr13 47572496 47573496 IV chr11 104196237 104199150 IV chr2 153021477 153025108 IV chr19 36350930 36352426 IV chr19 43426578 43429456 IV chr7 3204885 3206803 IV chr4 118546652 118550133 IV chr14 71073168 71074171 IV chr4 118546745 118549646 IV chr12 84719867 84720867 IV chr4 118546806 118549380 IV chr10 57447707 57448812 IV chr5 101539660 101541522 IV chr10 57447361 57448831 IV chr1 13083578 13086039 IV chr5 52109699 52110699 IV chr1 78206038 78207038 IV chr18 42403474 42404474 IV chr10 91807157 91808158 IV chr6 52153370 52154370 IV chr5 101713487 101714491 IV chr10 7233703 7234706 IV chr1 172572785 172577225 IV chr9 3257870 3259867 IV chr17 34074165 34076394 IV chr9 3257875 3259846 IV chr4 115899235 115900274 IV chr18 68691133 68692187 IV chr4 124268490 124271976 IV chr11 109010840 109011976 IV chr18 54698300 54699301 IV chr11 109010683 109011918 IV chr3 5859498 5861747 IV chr15 80443236 80444854 IV chr11 109010688 109012659 IV chr19 24897052 24898583 IV chr11 109010690 109012661 IV chr19 24896882 24897882 IV chr11 109011098 109012665 IV chr19 24895192 24898148 IV chr11 109011725 109013067 IV chr9 122476537 122477537 IV chr11 109011938 109012950 IV chr8 13151648 13152649 IV chr16 17817167 17818184 IV chr19 45241504 45245306 IV chr11 22707470 22708470 IV chr19 45241141 45245330 IV chr10 117593524 117596272 IV chr19 45242424 45244421 IV chr13 48671023 48672025 IV chr19 45241251 45242636 IV chr10 80490384 80492238 IV chr17 36205255 36207536 IV chr8 109968062 109969540 IV chr17 36205046 36207192 IV chr2 118893549 118894549 IV chr17 36204011 36206851 IV chr3 132345856 132346856 IV chr17 36205175 36206805 IV chr1 180924093 180925856 IV chr17 36205202 36206380 IV chr6 23261237 23262238 IV chr17 36204759 36208616 IV chr1 184720742 184721742 IV chr17 36204615 36208915 IV chr4 52542876 52543876 IV chr17 36204622 36208715 IV chr18 64334567 64336943 IV chr17 36205002 36209413 IV chr4 120651301 120652303 IV chr2 116560100 116562225 IV chr7 49752831 49755089 IV chr2 116560267 116561975 IV chr4 9874061 9875506 IV chr2 116560381 116562407 IV chr19 43601701 43603298 IV chr2 116560675 116561964 IV chr19 43600607 43601934 IV chr2 116560721 116561853 IV chr17 35575748 35578315 IV chr2 116560439 116562020 IV chr2 125813662 125815476 IV chr9 89880250 89882336 IV chr19 45144186 45145889 IV chr9 89880504 89882505 IV chr11 105164752 105166720 IV chr9 89880289 89881936 IV chr19 45140543 45147706 IV chr9 89881434 89882434 IV chr19 45140879 45145980 IV chr9 89881229 89882820 IV chr19 25625335 25627544 IV chr9 89879785 89881765 IV chr5 35399214 35400794 IV chr2 116549814 116551520 IV chr5 35398786 35400075 IV chr2 116549503 116551425 IV chr10 80487181 80488871 IV chr2 116549680 116551426 IV chr4 46348173 46349973 IV chr2 116549677 116550726 IV chr19 25666213 25667663 IV chr2 116550679 116552170 IV chr19 25665324 25667455 IV chr18 68358940 68359941 IV chr4 139858467 139859467 IV chr18 68358940 68359942 IV chr2 172545935 172546944 IV chr3 96334079 96339352 IV chr9 98929287 98933232 IV chr1 171546806 171549711 IV chr9 98928740 98932196 IV chr3 107342047 107343921 IV chr4 139849405 139855543 IV chr2 116553882 116555473 IV chr17 56149894 56151049 IV chr2 116553217 116554738 IV chr2 116552300 116554900 IV chr2 116556424 116557424 IV chr2 116551421 116554893 IV chr2 150525083 150526089 IV chr9 89879417 89881648 IV chr2 150525674 150527121 IV chr9 89878875 89881787 IV chr1 171084297 171089363 IV chr17 36214657 36216926 IV chr17 50419150 50421138 IV chr17 36214594 36217104 IV chr2 73012734 73013881 IV chr17 36214591 36217326 IV chr12 56680292 56682335 IV chr17 36213829 36217746 IV chr12 56679462 56682225 IV chr4 118778404 118779584 IV chr12 56678807 56683354 IV chr15 60141750 60142750 IV chr14 56864219 56865985 IV chr19 38088602 38089792 IV chr19 37876258 37888520 IV chr14 108158281 108159284 IV chr14 46393189 46400679 IV chr2 116548030 116549056 IV chr4 116839680 116841658 IV chr5 101539541 101540623 IV chr12 85419951 85420951 IV chr4 109988404 109989404 IV chr1 4688007 4690164 IV chr4 109988403 109989404 IV chr1 4687955 4690187 IV chr2 116557072 116558141 IV chr2 71550527 71551527 IV chr2 116552488 116553572 IV chr2 71550949 71551954 IV chr6 85525161 85526718 IV chr13 23393640 23397379 IV chr2 116557719 116559928 IV chr13 23395059 23398301 IV chr2 116558106 116559466 IV chr18 38386503 38387503 IV chr2 116556760 116559836 IV chr9 30931443 30933940 IV chr15 79963372 79964372 IV chr11 53485802 53490032 IV chr15 79963373 79964373 IV chr1 135864839 135867465 IV chr2 116559678 116560883 IV chr9 62029969 62032442 IV chr17 8259638 8262074 IV chr9 118388965 118390841 IV chr2 116560589 116562952 IV chr9 118388318 118390635 IV chr2 116560885 116563192 IV chr12 99122553 99123557 IV chr2 116560940 116563328 IV chr11 24044157 24045159 IV chr16 28563660 28567140 IV chr7 81996184 81997186 IV chr4 143387859 143391276 IV chr14 120468791 120470314 IV chr4 110016205 110026059 IV chr12 28218916 28219917 IV chr6 117994926 117998693 IV chr15 31166959 31169085 IV chr11 33173296 33182467 IV chr15 31167011 31168441 IV chr10 82952823 82955639 IV chr15 31166394 31168138 IV chr18 76842232 76846368 IV chr5 135284084 135285084 IV chr18 76842579 76846207 IV chr16 35537567 35538567 IV chr2 116555404 116556432 IV chr10 80456901 80461522 IV chr2 116554634 116556600 IV chr14 46397949 46399782 IV chr2 116555345 116558876 IV chr13 31802092 31803907 IV chr2 116555242 116558344 IV chr1 39176063 39180235 IV chr2 116556437 116557734 IV chr5 33535777 33537326 IV chr2 116556631 116557631 IV chr2 170436435 170440163 IV chr2 131811738 131814450 IV chr13 56255677 56256677 IV chr1 133171413 133172950 IV chr13 56255497 56256506 IV chr4 114668035 114669036 IV chr7 36678174 36681081 IV chr11 76698813 76701289 IV chr7 36677717 36680569 IV chr2 31879895 31883568 IV chr7 36677503 36679265 IV chr16 91219174 91221087 IV chr5 147221284 147224620 IV chr17 56146547 56148623 IV chr5 147220391 147225043 IV chr1 34634526 34636616 IV chr5 147220668 147225593 IV chr1 34634967 34635967 IV chr5 147221579 147223414 IV chr9 100398494 100399665 IV chr5 147222041 147223489 IV chr7 35922144 35923450 IV chr7 49676209 49680352 IV chr11 96380062 96381062 IV chr7 49676372 49680279 IV chr10 73101076 73102100 IV chr19 59189531 59198165 IV chr19 45063771 45068438 IV chr19 59192318 59195616 IV chr19 45064167 45067599 IV chr19 59193173 59194173 IV chr4 149808327 149812589 IV chr5 75083105 75084227 IV chr2 93579200 93581080 IV chr5 75083059 75084059 IV chr5 119694167 119696782 IV chr12 84624388 84627111 IV chr1 119397813 119400001 IV chr4 134453357 134454372 IV chr7 49660710 49662870 IV chr2 84865019 84867598 IV chr10 77664234 77665236 IV chr12 118841563 118842563 IV chr4 150034225 150035825 IV chr17 85641007 85648313 IV chr4 115977495 115978495 IV chr8 48219402 48222056 IV chr4 115977486 115979160 IV chr2 172731687 172733359 IV chr3 117450739 117451739 IV chr17 85488568 85490711 IV chr15 102760096 102762818 IV chr6 23259276 23261762 IV chr13 69488269 69489269 IV chr2 38378441 38379441 IV chr6 64732105 64734326 IV chr6 23254731 23255734 IV chr11 96124866 96125866 IV chr17 85472770 85474134 IV chr14 32491497 32494421 IV chr17 85472283 85473399 IV chr14 32492575 32494767 IV chr17 85472983 85476716 IV chr9 89869815 89870945 IV chr17 85472358 85474718 IV chr9 89869485 89871331 IV chr5 101647881 101648928 IV chr18 42430154 42431474 IV chr19 45142489 45144440 IV chr11 98312809 98314850 IV chr4 153496148 153497675 IV chr2 73281154 73282154 IV chr10 77672929 77681945 IV chr11 66566606 66569586 IV chr17 56148896 56151606 IV chr5 108688715 108689715 IV chr17 56147872 56149799 IV chr9 89867222 89871206 IV chr4 122983420 122986112 IV chr9 89867716 89869370 IV chr14 67229055 67230308 IV chr5 98292578 98294199 IV chr10 19351311 19353171 IV chr10 19361118 19362744 IV chr4 115978693 115980687 IV chr4 21689333 21690342 IV chr4 115979134 115980535 IV chr4 115978406 115981567 IV chr4 114648114 114649728 IV chr11 119034632 119035945 IV chr4 114647988 114648996 IV chr11 119035177 119036177 IV chr4 114647936 114650374 IV chr11 119034379 119035770 IV chr4 114647976 114650903 IV chr11 119034586 119035586 IV chr4 114647674 114650746 IV chr11 119033800 119035521 IV chr4 114645755 114651069 IV chr17 36231465 36232523 IV chr4 114646099 114649813 IV chr17 36230274 36233468 IV chr19 44885901 44890181 IV chr17 36231272 36232562 IV chr17 83228411 83232498 IV chr3 149518866 149520825 IV chr5 120088456 120089931 IV chr1 154883547 154885538 IV chr5 120087652 120090293 IV chr9 54675990 54677882 IV chr4 89523887 89525602 IV chr1 6441580 6442580 IV chr4 89524166 89525607 IV chr6 85408057 85410352 IV chr4 89524528 89525992 IV chr6 85407494 85410061 IV chr4 89523041 89525005 IV chr4 115943227 115945200 IV chr17 35357252 35359926 IV chr2 91921707 91924677 IV chr17 35357235 35359925 IV chr2 91922238 91924135 IV chr17 35357627 35360126 IV chr2 91920525 91922286 IV chr17 35358021 35359925 IV chr10 13059693 13062683 IV chr17 35357553 35359575 IV chr10 13059160 13062454 IV chr17 35357134 35360816 IV chr10 13060821 13062470 IV chr17 35356086 35359925 IV chr6 88240985 88243037 IV chr17 35358536 35360837 IV chr6 88240430 88243750 IV chr10 7390399 7394503 IV chr18 75360587 75362020 IV chr10 7390347 7393757 IV chr4 109393395 109395721 IV chr10 7390822 7392570 IV chr2 118884227 118886826 IV chr10 7390114 7391759 IV chr10 80444903 80451684 IV chr10 7389837 7391418 IV chr10 80444917 80447800 IV chr10 7390755 7395438 IV chr10 80446151 80447650 IV chr10 7388873 7396681 IV chr5 101538158 101539523 IV chr4 46367862 46374015 IV chr5 101538150 101539514 IV chr13 56417414 56419906 IV chr4 114664801 114670653 IV chr15 35325796 35327538 IV chr4 114665145 114668994 IV chr17 36237146 36239080 IV chr4 114664251 114669541 IV chr11 95200142 95203333 IV chr4 114664903 114666973 IV chr11 95200593 95203708 IV chr4 114666151 114668461 IV chr11 95200122 95205103 IV chr4 114666471 114667471 IV chr9 98972559 98974225 IV chr5 67213185 67235435 IV chr3 154546630 154549341 IV chr5 67226306 67227306 IV chr2 172737839 172739611 IV chr6 64734276 64735644 IV chr4 46352110 46353636 IV chr6 64734631 64735636 IV chr13 48671682 48673610 IV chr6 64733310 64735674 IV chr2 172786513 172788231 IV chr2 172786759 172788874 IV chr17 3013135 3014135 IV chr13 48728962 48736332 IV chr13 53381624 53385084 IV chr13 48729387 48733915 IV chr9 88315272 88322083 IV chr13 48730828 48731828 IV chr1 167667315 167675101 IV chr11 64953236 64956879 IV chr4 114921403 114922416 IV chr7 3200731 3202509 IV chr16 61055406 61056457 IV chr16 17731594 17734074 IV chr16 61055420 61057377 IV chr13 31791963 31794862 IV chr18 3005311 3006661 IV chr15 35291978 35292996 IV chr18 3004684 3006836 IV chr5 119659467 119661885 IV chr2 181917723 181919038 IV chr5 119664647 119666851 IV chr2 181917471 181919230 IV chr5 37829108 37830808 IV chr2 181917447 181918472 IV chr3 154334774 154336726 IV chr3 8245528 8247499 IV chr1 78218320 78220146 IV chr3 8244441 8246973 IV chr1 91777326 91780675 IV chr15 75084798 75086425 IV chr14 61688764 61691803 IV chr15 75085207 75086751 IV chr14 61688821 61690568 IV chr15 75084631 75087099 IV chr3 3022017 3024041 IV chr18 3005868 3006874 IV chr3 3015073 3016890 IV chr2 181930303 181931900 IV chr3 3011605 3013738 IV chr2 181930329 181931356 IV chr17 21777707 21779720 IV chr2 182011784 182013944 IV chr5 8628249 8629249 IV chr17 36181488 36182531 IV chr4 89302574 89303574 IV chr17 36181394 36184455 IV chr12 116007629 116009368 IV chr17 36181512 36182771 IV chr11 3103976 3104977 IV chr17 36181362 36182847 IV chr10 57445228 57448880 IV chr17 36181519 36182815 IV chr10 57444837 57446622 IV chr17 36181480 36182865 IV chr1 171542303 171544548 IV chr17 36181490 36183513 IV chr4 89300151 89301331 IV chr17 36181497 36183582 IV chr4 89300151 89301151 IV chr7 47935613 47938581 IV chr17 36133786 36135874 IV chr6 18157699 18163236 IV chr17 36133669 36135297 IV chr9 17986836 17988795 IV chr2 11061353 11062353 IV chr10 57437938 57439674 IV chr6 126054275 126055275 IV chr6 21209646 21212250 IV chr6 67513178 67515033 IV chrX 101694925 101696799 IV chr5 98190823 98192261 IV chr16 18681091 18682913 IV chr4 147598078 147599081 IV chr19 11877606 11878913 IV chr11 96205109 96210021 IV chr12 110317029 110320491 IV chr17 85660972 85673674 IV chr2 116550902 116553412 IV chr2 18690999 18692993 IV chr12 110319147 110321325 IV chr17 36213941 36215594 IV chr17 36203290 36212761 IV chr10 114824360 114826908 IV chr9 89874649 89886318 IV chr10 73379012 73380221 IV chr17 22875494 22877825 IV chr17 36135982 36139687 IV chr2 116547329 116548349 IV chr2 116548794 116558522 IV chr2 11872988 11873993 IV chr2 116548361 116554300 IV chr11 49588947 49591129 IV chr2 116544177 116564653 IV chr15 86194184 86196243 IV chr17 36076834 36079730 IV chr4 3162691 3166509 IV chr16 16197505 16198506 IV chr18 3112479 3116898 IV chr17 36093147 36095636 IV chr12 18135430 18137555 IV chr17 36093059 36095581 IV chr10 7488326 7493776 IV chr17 36093113 36094261 IV chr9 24951782 24953650 IV chr17 13551234 13554126 IV chr1 171083539 171087723 IV chr15 75084626 75085628 IV chr5 26067920 26072400 IV chr3 5859539 5860540 IV chr5 26067513 26072396 IV chr3 3032044 3033280 IV chr5 26068809 26071631 IV chr3 3032124 3033274 IV chr12 115555477 115558972 IV chr17 36064976 36068689 IV chr12 115555441 115557747 IV chr17 36064992 36067511 IV chr12 115635482 115642910 IV chr17 36065055 36067205 IV chr12 115635165 115643703 IV chr17 35354991 35357112 IV chrX 137102625 137108125 IV chr17 35355098 35356423 IV chrX 137097194 137101671 IV chr12 116008756 116013215 IV chrX 137125016 137129931 IV chr4 147516278 147520430 IV chr5 14960243 14962687 IV chr11 3198329 3199329 IV chr17 36207325 36208608 IV chr11 3197295 3199081 IV chr12 115618204 115619432 IV chr3 3007595 3013693 IV chr14 124800835 124802567 IV chr13 119611894 119615490 IV chr12 115797460 115798460 IV chr7 47931811 47935119 IV chr5 15496969 15499005 IV chr12 116005734 116008989 IV chr5 15496533 15498662 IV chr4 145560826 145564324 IV chr12 115808317 115811035 IV chr4 3057608 3070576 IV chr12 115807564 115809249 IV chr4 3078557 3086780 IV chr12 115551722 115558904 IV chr8 20948036 20951110 IV chr5 15003811 15010112 IV chr17 15574526 15576915 IV chr8 20986326 20994317 IV chr12 115061407 115063367 IV chr7 47727159 47743852 IV chr4 147522902 147525112 IV chr6 67672075 67684570 IV chr4 147522929 147525392 IV chr12 115521502 115524746 IV chr4 147523258 147526238 IV chr12 115516609 115529572 IV chr4 147524239 147525239 IV chr5 15050735 15055766 IV chr12 115636114 115639113 IV chr5 26009354 26012163 IV chr12 115635082 115638855 IV chr5 26074297 26078079 IV chr12 115634535 115638745 IV chr12 115635115 115637695 IV chr4 145563699 145565604 IV chr4 145563638 145565494 IV
[0092] Taken together, the PRC2 dependent chromatin connectivity configures the genome structures as the transcription silencing foci in the pluripotent genomes. Within the interaction networks, the PRC2 bound DREs can act as transcription silencers in a target-specific way to maintain the lineage specification genes in a repressive but poised chromatin state. Upon differentiation, these DREs can either remain bound by PRC2 in the silencing foci or convert into tissue specific enhancers, and the transitions between two regulatory states would be dependent on the chromatin conformation and the expression of stage- or tissue-specific transcription factors (
Discussion—Examples 2-4
[0093] In the experiments described herein, PRC2 chromatin interaction analysis was used to reveal the widespread, highly precise and remarkably complex silencer associated chromatin connectivity networks in mESC genome. Acting as a repressor complex, PRC2 bound to the silencer regulatory elements to induce chromatin compaction and sequester developmentally regulated genes into the condensed, sub-nuclear microenvironments where transcription silencing can be facilitated by increasing the local concentration of specific repressive factors, PRC2 complexes and coregulated gene clusters. Within the silencing hubs, these silencers are presumed to function as the nucleation sites to initiate extensive chromatin looping.
[0094] In the last decade, transcriptional enhancers have emerged as the dominant class of regulatory elements in the non-coding portion of the mammalian genome [Consortium, E. P. Nature 489, 57-74 (2012)]. The experiments and results presented herein, provide a dual-activity model that provide genomes with maximal versatility in expression regulation. The non-coding regulatory sequences can function as both enhancers and silencers and the dynamic transcriptional regulatory activities of these functional elements are critically dependent on the nature of associated protein complexes, local sequence context and chromatin conformation. In contrast to thousands of protein-encoding gene knockouts in mice [Guan, C., et al., Genesis 48, 73-85 (2010) and Lloyd, K. C. Ann N Y Acad Sci 1245, 24-6 (2011)], only few of the regulatory elements have been subjected to knockout analysis [Osterwalder, M. et al. Nature 554, 239-243 (2018); Shim, S., et al., Nature 486, 74-9 (2012); and Sur, I. K. et al. Science 338, 1360-3 (2012)]. It is noteworthy that the pleiotropic patterns of phenotypical aberration associated with the deletion in PRC2-bound silencers highlight the influence of these PRC2-bound silencers in multiple lineages of organismal development. This is similar to the effects of numerous variants found in the noncoding regulatory elements measured by the GWAS studies in many human diseases. Moreover, such results may have implications in the mechanisms involved in the silencing of tumor suppressor genes which predispose cells to tumor progression [Kazanets, A., et al., Biochim Biophys Acta 1865, 275-88 (2016)]. The delineation of silencer sequence contexts, their distribution, and diversity underscores the versatility of epigenetic-based transcription regulation. Studies have now provided a basis for targeted re-expression of epigenetically silenced genes in therapeutics.
Example 5
[0095] Experiments are performed in which a candidate agent for inhibiting cancer is identified. In the experiments, a means that includes a ChIA-PET method is used to identify a gene regulation system (GRS). An activity of the GRS includes a physical interaction between a gene regulator element, a gene regulator complex, and a gene modifier element in a cancer cell. In addition, a gene whose transcription is modified by the detected gene interaction is identified as a cancer-inducer gene or a cancer-suppressor gene. An effect of the activity of the GRS on repression and de-repression of the transcription of the identified gene is determined. It is determined that: [0096] (a) if the identified gene is a cancer-suppressor gene and the effect of the activity of the GRS is de-repression of the transcription of the identified gene, the activity of the GRS inhibits the cancer; [0097] (b) if the identified gene is a cancer-suppressor gene and the effect of the activity of the GRS is repression of the transcription of the identified gene, reducing the activity of the GRS inhibits the cancer; [0098] (c) if the identified gene is a cancer-inducer gene and the effect of the activity of the GRS is repression of the transcription of the identified gene, the activity of the GRS inhibits the cancer; [0099] (d) if the identified gene is a cancer-inducer gene and the effect of the activity of the GRS is de-repression of the transcription of the identified gene, reducing the activity of the GRS inhibits the cancer.
Next, one or more candidate agents that modify an activity of the GRS are identified and based on (a)-(d) above, an agent is selected that has a desired effect on the activity of the GRS.
[0100] In a circumstance described in (a), the identified gene is a cancer-suppressor gene and a selected agent inhibits GRS activity, which reduces the repression of the transcription of the identified gene and inhibits the cancer. In some embodiments, in a circumstance described in (b), the identified gene is a cancer-suppressor gene and a selected agent inhibits GRS activity, which increases the transcription of the identified gene and inhibits the cancer. In some embodiments, in a circumstance described in (c), the identified gene is a cancer-inducer gene and a selected agent increases GRS activity, which increases the repression of the transcription of the identified gene and inhibits the cancer. In some embodiments, in a circumstance described in (d), the identified gene is a cancer-inducer gene and a selected agent inhibits GRS activity, which reduces the de-repression of the transcription of the identified gene and inhibits the cancer.
[0101] At least one selected agent is administered to a subject having the cancer as a treatment for the cancer and the cancer is effectively treated.
EQUIVALENTS
[0102] Although several embodiments of the present invention have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and/or structures for performing the functions and/or obtaining the results and/or one or more of the advantages described herein, and each of such variations and/or modifications is deemed to be within the scope of the present invention. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and/or configurations will depend upon the specific application or applications for which the teachings of the present invention is/are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto; the invention may be practiced otherwise than as specifically described and claimed. The present invention is directed to each individual feature, system, article, material, and/or method described herein. In addition, any combination of two or more such features, systems, articles, materials, and/or methods, if such features, systems, articles, materials, and/or methods are not mutually inconsistent, is included within the scope of the present invention.
[0103] All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and/or ordinary meanings of the defined terms. The indefinite articles “a” and “an,” as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean “at least one.”
[0104] The phrase “and/or,” as used herein in the specification and in the claims, should be understood to mean “either or both” of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Other elements may optionally be present other than the elements specifically identified by the “and/or” clause, whether related or unrelated to those elements specifically identified, unless clearly indicated to the contrary.
[0105] All references, patents and patent applications and publications that are cited or referred to in this application are incorporated herein in their entirety herein by reference.