High-throughput hybridization and reading method for biochips and system thereof

Abstract

A high-throughput hybridization and reading method for biochips uses probes with different marks to specifically connect single nucleotide loci by conducting connection between the probes and target genes at different temperatures, and performing hybridization at the same temperature after the probes are connected, thereby achieving hybridization detection for various loci in a single chip. The method enables fast detection for multiple loci as required by personalized medicine. The detection is high-throughput and systematized and provides highly visualized and highly accurate results. The method allows detection for different loci at different hybridization temperatures to be done simultaneously. The method features highly uniform and repeatable detection, making biochips more efficient and utility in terms of detection. Besides, the chip is easy to prepare and use, thus having a good promotional value.

Claims

1. A high-throughput hybridization and reading system for a chip, which simultaneously detects plural SNP loci in a single chip, the system at least comprising: an amplification unit, for performing PCR amplification on a double-stranded DNA; a separation unit, for separating amplified double-stranded DNA and keeping a DNA strand labeled with a marker which is a to-be-detected DNA strand; a polymerase chain reaction unit, for introducing the to-be-detected DNA strand, a first probe, a second probe, and a third probe into one reaction system for polymerase chain reaction, wherein the 3′-end through 5′-end of the first probe comprise a first hybridization region and a first complementary region, respectively, and the 5′-end is an A base or a G base; the 3′-end through 5′-end of the second probe comprise a second hybridization region and a second complementary region, respectively, and the 5′-end is a C base or a T base; and the 5′-end of the third probe is attached to a fluorescent molecule or a chromophore; and: neither of the first and the second hybridization regions is complementary to the to-be-detected DNA, both of the first and the second complementary regions are complementary to the to-be-detected DNA strand, the 5′-end of the second or the first probe is complementary to an SNP locus of the to-be-detected DNA, the first probe and the second probe have at least 10 same bases from their 5′-ends to the 3′-ends and have different intervals, which comprise at least 50% of all bases of each probe; and a chip hybridization detection unit comprising one or more chips, which has a chip that is fixed with oligonucleotide fragments for detection of a plurality of SNP loci, wherein a single SNP locus has said fragments on the chip that are complementary to the first hybridization region of the first probe and the second hybridization region of the second probe, wherein the first probe further comprises a sequence that is specific for a nucleotide base of a first SNP locus and the second probe further comprises a sequence that is specific for a different nucleotide base of the first SNP locus; and a detection system for detecting hybridization of one or more probes to the complementary sequences on the chip, which system detects the chromophore or the fluorescent molecule.

2. The system of claim 1, wherein the marker includes but is not limited to: a biotin, an avidin, and a streptavidin.

3. The system of claim 1, wherein the fluorescent molecule includes 6-carboxyfluorescein sold under the trademark FAM™, hexachlorofluorescein sold under the trademark HEX™, tetrachlorofluorescein sold under the trademark TET™, 5′ dichloro-dimethoxy-fluorescein sold under the trademark JOE™, carboxytetramethylrhodamine sold under the trademark TAMRA™, sold under the trademark Texas Red®, sulforhodamine sold under the trademark ROX™, cyanine-3 (CY3) or cyanine-5 (CY5).

4. The system of claim 1, wherein the surface of the chip is fixed with a large number of label-complementary probes corresponding to different single-nucleotide polymorphism loci.

5. The system of claim 1, wherein the marker is a biotin, an avidin or a streptavidin.

6. The system of claim 1, wherein the chromophore includes: electrochemical light (ECL), nitro blue tetrazolium chloride, 5-bromo-4-chloro-3-indolyl-phosphate (NBT/BCIP) or diamoinobenzidine (DAB).

7. The system of claim 1, wherein the number of the bases in each of the first and second hybridization regions is 15 to 25.

8. The system of claim 1, wherein the number of the bases in each of the first and second complementary regions is 15 to 25.

9. The system of claim 1, wherein detection system comprises detection channels for FAM: 465 to 510 nm; CY3: 533 to 580 nm; HEX: 533 to 580 nm; TET: 533 to 580 nm; JOE: 533 to 580 nm; Texas Red: 533 to 610 nm; ROX: 533 to 610 nm; CY5: 618 to 660 nm; or TAN/IRA: 533 to 580 nm, or a combination thereof.

10. The system of claim 1, wherein Tm value for each SNP locus probe independently is greater than 25° C.

11. The system of claim 1, wherein the amplification unit has a 25 μL reaction system.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 illustrates the principle of hybridization and reading according to the present invention; and

(2) FIG. 2 is a biochip hybridization spectrum of an experiment according to an embodiment of the present invention.

DETAILED DESCRIPTION

(3) The invention as well as a preferred mode of use, further objectives and advantages thereof will be best understood by reference to the following detailed description of illustrative embodiments when read in conjunction with the accompanying drawings.

(4) Unless stated otherwise, the experiment methods used in the following embodiments are all those conventional. Unless stated otherwise, the experiment materials used in the following embodiments are all commercially available.

Embodiment 1

(5) I. Probe Design

(6) In the present invention, different probes correspond to different single-nucleotide loci. The present invention places no particular limitations on the location of different single-nucleotide loci in a genomic DNA. The different probes are designed according to to-be-detected single-nucleotide loci. The present invention places no particular limitations on how the probe is designed, and the design can be done using any probe design principles and software known to people skilled of the art. For example, multiple sequence alignment software such as Clustal may be used to do multiple sequence alignment, and LSPD software may be used to design probes and primers.

(7) In the present embodiment, the to-be-detected SNP loci are two SNP loci in an APOE gene, located in Locus 112 and Locus 158. The sequence is as described in SEQ ID NO: 1 and is shown below, wherein the to-be-detected SNP loci are bold and underlined:

(8) TABLE-US-00001 ggcacggctgtccaaggagctgcaggcggcgcaggcccggctgggcgcg gacatggaggacgtgtgcggccgcctggtgcagtaccgcggcgaggtgc aggccatgctcggccagagcaccgaggagctgcgggtgcgcctcgcctc ccacctgcgcaagctgcgtaagcggctcctccgcgatgccgatgacctg cagaagcgcctggcagtgtaccaggccggggcccgcgagggcgccgagc gcggcctcagcgccatccgcga

(9) As shown in FIG. 1, the first probe 1 and the second probe 2 are designed according to SNP loci of the to-be-detected fragment. Therein, the first probe 1 and the second probe 2 each have a length of 30 bp. The first probe 1 has a first hybridization region and a first complementary region from its 3′-end, and its 5′-end is an A base. The 3′-end through 5′-end of the second probe are a second hybridization region and a second complementary region, respectively, and the 5′-end is a C base. The first probe and the second probe are different in all the 12 bases in their hybridization regions, yet in the complementarity regions, their 17 bases are the same and match the amplified products. This ensures that the first probe and the second probe have at least 10 same bases from their 5′-end to 3′-end and have different intervals, which comprise at least 50% of all bases of each probe. The 5′-end of the third probe is attached to fluorescent groups or chromophoric groups. The complementary region of the second probe and the first probe hybridize with the to-be-detected fragment. The spotting probe is complementary to the hybridization region of the first or the second probe. The third probe and the first probe are complementary to the to-be-detected fragment at two sides of the to-be-detected SNP locus. After match, with the effect of Taq polymerase, a complete probe strand is formed.

(10) According to the foregoing probe design rules, the probes of the present embodiment are as shown in Table 1 below:

(11) TABLE-US-00002 TABLE 1 Locus Probe SEQ ID NO. DNA Sequence (3′-5′) APOE First Probe 1  4 gcggtagtaccatacggtacctcctgcaca Locus 112 Second Probe 2  5 acttggtctagccgacctacctcctgcacc Spotting Probe 1  6 cgccatcatggtatgcc Spotting Probe 2  7 tgccacagatcggctgg Chromogenic  8 cgccggcggaccacgtcatgg Probe 5 APOE First Probe 3  9 cgtcatgtgcaatccgactggacgtcttcg Locus 158 Second Probe 4 10 atggagcattccgaacgctggacgtcttct Spotting Probe 3 11 gcagtacacgttaggct Spotting Probe 4 12 tacctcgcggattcgac Chromogenic 13 cggaccgtcacatggtccggc Probe 6

(12) In the present embodiment, the probes match the to-be-detected fragment from its 5′-end. In other words, the first probe has from its 3′-end the first hybridization region and the first complementary region successively, and the 5′-end is an A base or G base. The 3′-end through 5′-end of the second probe are the second hybridization region and the second complementary region, respectively, and the 5′-end is a base C or T. The 5′-end of the third probe is connected with fluorescent groups or chromophoric groups. In a different design scheme, the probes match the to-be-detected fragment from its 3′-end instead. In other words, the first probe has from its 5′-end the first hybridization region and the first complementary region successively, and the 3′-end is an A base or a G base. The second probe has from its 5′-end the second hybridization region and the second complementarity region successively, and the 3′-end is a base C or T. The third probe has is 5′-end phosphorylated, and has its 3′-end connected with fluorescent groups or chromophoric groups. This forms a design directionally opposite to the present embodiment, yet similarly achieving match and hybridization.

(13) II. Double-Stranded PCR Amplification

(14) PCR double-stranded amplification is performed on the to-be-detected fragment, and one strand of the amplified product is connected with biotin microspheres to facilitate strand separation.

(15) TABLE-US-00003 Primers are designed as below according to the to-be-amplified fragment: ApoE-primer-1 (as described in SEQ ID NO: 2): tcgcggatggcgctga ApoE-primer-2 (as described in SEQ ID NO: 3): biotin-ggcacggctgtccaagga Therein, one end of Primer 2 is connected with biotin microspheres.

(16) The PCR amplification system is a 25 μL reaction system, which comprises: 10×PCR buffer solution 2 μL, 25 mM MgCl 1.5 μL, 0.2 mM×dNTPs 0.5 μL, 5 U/μL Taq DNA polymerase 0.25 μL, 100 μM forward primer 0.1 μL, 100 μM reverse primer 0.1 μL, and ddH20 making up to 25 μL. Therein, the 5′-end of the forward primer is connected with biotin label.

(17) The PCR polymerase chain reaction is performed with the following conditions: 95° C. initial denaturation 5 min; 95° C. 2 s; 58° C. 10 s; 60° C. 1 min, 40 cycles in total.

(18) In the present invention, the forward primer and reverse primer are primers designed according to the to-be-detected SNP locus. The present invention places no particular limitations on how the primers are designed, and the design may be done using any primer design method known to people skilled of the art. The present invention places no particular limitations on the conditions of the polymerase chain reaction, and conventional PCR reaction conditions known to people skilled of the art may be used.

(19) III. DNA Strand Separation

(20) DNA strand separation may be realized by filtration separation using a DNA strand separation device, or using other known methods. The DNA strand separation device uses polyethylene microspheres as its membrane filter material, with gaps between the microspheres preferably being 10 μm, smaller than the diameter of the biotin, so that by direct physical filtration, single strands with affinity linker can be kept on the membrane, the strands without the affinity linker are filtered off. The device provides good adsorption and elution, and has a high DNA recovery rate. Besides, the material is inexpensive and environmentally friendly.

(21) The separation process involves: adding 0.4M NaOH and 1M NaCl to unwind the double stranded helix, gently blowing and agitating for homogenization, centrifuging at 12000 rmp for 1 min; washing off residual NaOH, neutralizing to neutrality in pH, centrifuging at 12000 rmp for 1 min; with the to-be-detected fragment retained by the membrane filter, adding a collecting liquid such as ultrapure water, then gently blowing and agitating until the DNA strand fully suspend, collecting the strand, sealing up and storing at 4° C. for later use.

(22) IV. Integrated Reaction for Hybridization and Reading

(23) Hybridization of the first probes 1, 3 and the second probes 2, 4 and the third probes 5, 6 with the single-stranded DNA is performed using a DNA ligase. The hybridization system works with the following conditions: 95° C. 30 s, 60° C. 30 s, 72° C. 30 s, 35 cycles in total. For hybridization, the DNA ligase may be T4 DNA ligase or a thermostable DNA ligase. For better ligation, a thermostable DNA ligase is preferred. The buffer solution used in the hybridization system may be formulated similarly as to that for amplification.

(24) The chromogenic probes are diluted to 5 pmol/μl. The first probe or the second probe has a concentration of 0.25 to 1 pmol/μl. For preparing the hybridization solution, 1 μl of the first probe or the second probe, and 1 μl of the chromogenic probe are added into 250 μl hybridization buffer. The resulting hybridization solution and the amplified products go through hybridization reaction together.

(25) After hybridization, a hybrid “amplified product-first probe 1-third probe 5” and a hybrid “amplified product-first probe 3-third probe 6” are formed. The hybrids are eluted and neutralized to pH7-8 using the eluate for chip hybridization detection.

(26) A spotting probe 1 matching the first probe 1 and a spotting probe 2 matching the second probe 2 are fixed to the chip. The spotting probes are diluted to 10 pmol/ul, and spot on the chip in order.

(27) The sequence of the spotting probe 1 is complementary to the first hybridization region of the first probe 1, and the sequence of the spotting probe 2 is complementary to the second hybridization region of the second probe 2. The first probe 1 and the second probe 2 are hybridized with the sequences fixed to the chip, respectively. After hybridization, the identification fragment at the end of the first probe or the second probe is used to perform SNP locus variant identification. The chip is generally made of a nylon membrane, while a glass sheet or a silicone sheet is also usable

(28) After the reaction, the reactant is washed, and a digoxin antibody is added for further reaction. After the further reaction, the reactant is washed again. Then a chromogenic solution is added for chromogenic reaction. Hybridization, antibody reaction, and chromogenic reaction each take 10 minutes.

(29) Since the signal probe exclusively has perfect match with a single genotype of the SNP locus, the type of the bases of the to-be-detected SNP locus can be identified according to chromogenic result of the chip.

(30) After hybridization of the probes and the amplified products, centrifuging is performed to remove unbound parts, and a digoxin antibody is added to react with the digoxin at the end of the hybridized third probe. After the reaction, the antibody is washed off, and catalysis is performed using BCIP/NBT to form blue-violet precipitation on the surface of the chip.

(31) Where the chromogenic probe is terminated with fluorescent groups, the foregoing antibody reaction can be eliminated and fluorescence at different sites in the chip can be directly observed.

(32) In the present embodiment, at Locus 112, the first probe 1 and the chromogenic probe 3 perfectly match the amplified products. At Locus 158, the first probe 3 and the chromogenic probe 6 perfectly match the amplified products. As shown in FIG. 2, the first column represents the spotting probe 1, the second column represents the spotting probe 2, the third column represents the spotting probe 3, and the fourth column represents the spotting probe 4. During hybridization of chips, only the first probe 1 and the first probe 3 are left in the reaction system to match the spotting probes in the chip. Therefore, the first column and the fourth column form blue-violet precipitation on the surface of the chip. This further shows that the base sequence at Locus 112 is T, and the base sequence at Locus 158 is C.

(33) In the present embodiment, each of the first and second probes is made with three different concentrations (0.25 pmol/μL, 0.5 pmol/μL, and 1 pmol/μL). Each concentration corresponds to two sets of parallel tests, amounting to 6 sets. The results of the parallel tests are shown in FIG. 1. Precipitation is formed at the same probes.

(34) The disclosed hybridization and reading system can accomplish simultaneous parallel analysis of 24 samples in merely 60 minutes. The detection results are consistent and the operation is convenient yet effective. The precipitation results are captured using external cameras and the images are automatically processed so that the signal points showing after hybridization chromogenic reaction are marked. After hybridization, the chromogenic location of reaction sites in the chip or the chromogenic intensity can be analyzed using a chip scanner and related software, and the imaging signals can be converted into data to provide the related biological information, thereby rapidly completing the entire operation from the raw samples to the desired analysis results in a closed system in a short period of time.

(35) More conditions and parameters for the disclosed hybridization and reading process claimed herein can be seen from the existing methods and systems for SNP detection using biochips. The present embodiment is focused on the characteristics of the disclosed method and the difference between the present invention and prior art, and omits unnecessary details that are known to people skilled in the art.

Embodiment 2

(36) The present embodiment is similar to Embodiment 1 with the only difference that fluorescence is used for chip reading. The results are consistent with Embodiment 1.

(37) The present invention has been described with reference to the preferred embodiments and it is understood that the embodiments are not intended to limit the scope of the present invention. Moreover, as the contents disclosed herein should be readily understood and can be implemented by a person skilled in the art, all equivalent changes or modifications which do not depart from the concept of the present invention should be encompassed by the appended claims.