VITAMIN B6-COUPLED POLYOL-BASED POLYDIXYLITOL GENE TRANSPORTER COMPRISING PEPTIDE BINDING SPECIFICALLY TO CANCER STEM CELL AND CANCER STEM CELL-TARGETED THERAPY TECHNIQUE

Abstract

Provided is a polydixylitol polymer gene transporter (VBXYP-P) containing vitamin B6 and a cancer stem cell-targeting peptide (TR-7) and a method for preparing the same. In addition, provided is a nucleic acid delivery complex in which a therapeutic nucleic acid is conjugated to the gene transporter, and a pharmaceutical composition for gene therapy containing the complex as an active ingredient. In addition, provided is the gene transporter, a gene delivery complex, and gene therapy using the same. It was observed that VBXYP-P of the present disclosure had a remarkably higher nucleic acid delivery rate to cancer stem cells than the pre-existing nucleic acid transporter, and when VBXYP-P was conjugated with DNA, the complex was almost free of cytotoxicity and permeated a blood brain barrier to exhibit remarkably high transformation efficiency for cancer stem cells inside a brain tumor.

Claims

1.-19. (canceled)

20. A polydixylitol polymer gene transporter (dixylitol diacrylate VB-PEI-TR7 peptide copolymer, VBXYP-P) comprising vitamin B6 and TR-7, wherein the polydixylitol polymer gene transporter is represented by the following Chemical Formula 1: ##STR00008##

21. The polydixylitol polymer gene transporter of claim 20, wherein the transporter permeates a blood brain barrier (BBB).

22. A nucleic acid delivery complex in which a therapeutic nucleic acid is bound to the polydixylitol polymer gene transporter of claim 20.

23. The nucleic acid delivery complex of claim 22, wherein siRNA is bound as a therapeutic nucleic acid to the polydixylitol polymer gene transporter.

24. The nucleic acid delivery complex of claim 22, wherein the therapeutic nucleic acid and the polydixylitol polymer gene transporter are bound to each other at a molar ratio of 1:0.5 to 1:100.

25. The nucleic acid delivery complex of claim 22, wherein the nucleic acid delivery complex has an average particle size of 50 to 200 nm.

26. The nucleic acid delivery complex of claim 22, wherein the nucleic acid delivery complex has a zeta potential of 25 to 40 mV.

27. The nucleic acid delivery complex of claim 22, wherein the therapeutic nucleic acid is one plasmid composed of CRISPR sgRNA and Cas9 gene.

28. The nucleic acid delivery complex of claim 23, wherein the therapeutic nucleic acid is selected from the group consisting of small interfering RNA (siRNA), small hairpin RNA (shRNA), endoribonuclease-prepared siRNAs (esiRNA), antisense oligonucleotides, DNA, single-stranded RNA, double-stranded RNA, DNA-RNA hybrids, and ribozymes.

29. The nucleic acid delivery complex of claim 24, wherein the therapeutic nucleic acid is used to knock out smoothened (SMO) in cancer stem cells.

30. The nucleic acid delivery complex of claim 24, wherein the therapeutic nucleic acid is sgRNA corresponding to a sequence of “TATCGTGCCGGAAGAACTCC” identified as SEQ ID NO:2 or “AGGAGGTGCGTAACCGCATC” identified as SEQ ID NO:3.

31. The nucleic acid delivery complex of claim 23, wherein the therapeutic nucleic acid is used to knock down smoothened (SMO) in cancer stem cells.

32. The nucleic acid delivery complex of claim 23, wherein the therapeutic nucleic acid is esiRNA corresponding to Catalog No. 4392420 that is SMO siRNA (ThermoFisher) inhibiting expression of smoothened.

33. A pharmaceutical composition for gene therapy, comprising the nucleic acid delivery complex of claim 22 as an active ingredient.

34. The pharmaceutical composition of claim 33, wherein the nucleic acid delivery complex is formulated into a formulation for inhalation administration or injection administration.

35. The pharmaceutical composition of claim 33, wherein the therapeutic nucleic acid contained in the nucleic acid delivery complex targets cancer stem cells and inhibits expression of smoothened (SMO).

36. The pharmaceutical composition of claim 35, wherein the composition has an effect of treating or preventing a cancer.

37. The pharmaceutical composition of claim 36, wherein the cancer is selected from the group consisting of glioblastoma multiforme, a lung cancer, a bone cancer, a pancreatic cancer, a skin cancer, a head and neck cancer, skin melanoma, a uterine cancer, an ovarian cancer, a rectal cancer, a colorectal cancer, a colon cancer, a breast cancer, uterine sarcoma, fallopian tube carcinoma, endometrial carcinoma, cervix carcinoma, vagina carcinoma, vulva carcinoma, an esophageal cancer, a small intestine cancer, a thyroid cancer, a parathyroid cancer, soft tissue sarcoma, a urethral cancer, a penile cancer, a prostate cancer, chronic or acute leukemia, a pediatric solid tumor, differentiated lymphoma, a bladder cancer, a kidney cancer, renal cell carcinoma, renal pelvic carcinoma, primary central nervous system lymphoma, a myelencephalon tumor, brain stem glioma, and pituitary gland adenoma.

Description

DESCRIPTION OF DRAWINGS

[0056] FIG. 1 is a view illustrating a procedure of synthesizing a polydixylitol polymer gene transporter (PdXYA) of the present disclosure to be used as an initial backbone.

[0057] FIG. 2 is a view illustrating a procedure of synthesizing a vitamin B6-coupled polydixylitol polymer gene transporter (VB-PdXYA) of the present disclosure to be used as a backbone.

[0058] FIG. 3a is a view illustrating a procedure of synthesizing Sulfo-SANPAH and a transporter in order to couple TR-7 (SEQ ID NO:1) that is a cancer stem cell target marker to the gene transporter of the present disclosure.

[0059] FIG. 3b is a view illustrating a procedure of synthesizing TR-7 (SEQ ID NO:1) that is a cancer stem cell target marker with the Sulfo-SANPAH-coupled transporter of the present disclosure.

[0060] FIG. 4 illustrates a result of a gel retardation experiment for an ability to form a polyplex by electrostatically binding siRNA or pDNA to VBXYP-P that is the polymer gene transporter of the present disclosure, and is a view illustrating a result of gel electrophoresis on a PdXYP-P/siRNA polyplex formed by reacting VBXYP-P with siRNA at molar ratios (N/P) of 0.05, 0.1, 0.3, 0.5, and 1.0.

[0061] FIG. 5 illustrates results of comparing sizes and zeta potentials of VBXYP used as the backbone of the polymer gene transporter of the present disclosure and VBXYP-P to which TR-7 is coupled.

[0062] FIG. 6 illustrates a procedure of intracellular uptake and degradation of VBXYP-P of the present disclosure and a green fluorescent protein gene (tGFP plasmid) complex in cancer stem cells.

[0063] FIG. 7 is a view illustrating results of evaluating cytotoxicity of VBXYP-P of the present disclosure in vitro in cancer stem cells (CSCs) and glioblastoma multiforme (GBM) by an MTT assay and comparing the results with those of PEI 25 kDa and VBXYP.

[0064] FIG. 8 is a view illustrating results of comparison of expression of fluorescence of cancer stem cells and glioblastoma multiforme cell lines treated with a VBXYP/DNA polyplex formed by reacting VBXYP-P of the present disclosure with DNA at various weight ratios (w/w) (2:1, 4:1, 6:1, 8:1, 10:1, and 20:1).

[0065] FIG. 9 is a view illustrating results of comparison of expression of fluorescence of cancer stem cells and glioblastoma multiforme cell lines treated with nucleic acid delivery complexes obtained by binding a green fluorescent protein gene (tGFP gene) to each of the gene transporter and various other gene transporters (lipofectamin, PEI 25 kD, and VBPEA) in order to examine transformation efficiency of the VBXYP-P gene transporter of the present disclosure.

[0066] FIG. 10 illustrates results of comparative assay of a degree of cancer stem cell targeting of VBXYP-P of the present disclosure using a fluorescence-activated cell sorting flow cytometry (FACS).

[0067] FIG. 11 illustrates results of a cell live/dead assay to examine that when a polyplex of VBXYP-P of the present disclosure and a smoothened (SMO) CRISPR-cas9 plasmid is delivered to cancer stem cells, how it affects proliferation of the cancer stem cells.

[0068] FIG. 12 is a view illustrating comparison of differences in cell proliferation evaluated in cancer stem cells (CSCs) by a WST-1 assay when a polyplex of VBXYP-P of the present disclosure and SMO CRISPR (SMOcr) is delivered to the cancer stem cells.

[0069] FIG. 13 is a view illustrating comparison of the degrees of cell proliferation evaluated by a 5-ethynyl-2′-deoxyuridine (EdU) cell proliferation assay when a polyplex of VBXYP-P of the present disclosure and SMO CRISPR (SMOcr) is delivered to the cancer stem cells.

[0070] FIG. 14 illustrates results of evaluating apoptosis by a TUNEL assay after SMO CRISPR is delivered to cancer stem cells using VBXYP-P of the present disclosure.

[0071] FIG. 15 illustrates results of evaluating apoptosis by an Annexin V assay after SMO CRISPR is delivered to cancer stem cells using VBXYP-P of the present disclosure.

[0072] FIG. 16 illustrates results of evaluating and assaying a change in expression of each of smoothened (SMO) and sonic hedgehog (Shh) by immunocytochemistry staining (ICC staining) after SMO CRISPR is delivered to cancer stem cells using VBXYP-P of the present disclosure.

[0073] FIG. 17 illustrates results of evaluating and assaying a change in expression of each of smoothened (SMO) and sonic hedgehog (Shh) by a western blot protein quantitative assay after SMO CRISPR is delivered to cancer stem cells using VBXYP-P of the present disclosure.

[0074] FIG. 18 illustrates results of a cell live/dead assay to examine that when a polyplex of VBXYP-P of the present disclosure and smoothened (SMO) siRNA is delivered to cancer stem cells, how it affects proliferation of the cancer stem cells.

[0075] FIG. 19 is a view illustrating comparison of differences in cell proliferation evaluated in cancer stem cells (CSCs) by a WST-1 assay when a polyplex of VBXYP-P of the present disclosure and SMO siRNA is delivered to the cancer stem cells.

[0076] FIG. 20 is a view illustrating comparison of the degrees of cell proliferation evaluated by a 5-ethynyl-2′-deoxyuridine (EdU) cell proliferation assay when a polyplex of VBXYP-P of the present disclosure and SMO siRNA (siSMO) is delivered to the cancer stem cells.

[0077] FIG. 21 illustrates results of evaluating apoptosis by a TUNEL assay after SMO siRNA is delivered to cancer stem cells using VBXYP-P of the present disclosure.

[0078] FIG. 22 illustrates results of evaluating apoptosis by an Annexin V assay after SMO siRNA is delivered to cancer stem cells using VBXYP-P of the present disclosure.

[0079] FIG. 23 illustrates results of evaluating and assaying a change in expression of each of smoothened (SMO) and sonic hedgehog (Shh) by immunocytochemistry staining (ICC staining) after SMO siRNA is delivered to cancer stem cells using VBXYP-P of the present disclosure.

[0080] FIG. 24 illustrates results of evaluating a change in expression of each of smoothened (SMO) and sonic hedgehog (Shh) by a western blot protein quantitative assay after SMO siRNA is delivered to cancer stem cells using VBXYP-P of the present disclosure.

[0081] FIG. 25 illustrates results of observing whether VBXYP-P and VBXYP of the present disclosure permeate a blood brain barrier (BBB) using a microfluidic chip having the inside in which brain astrocytes are cultured and the outer passage in which human umbilical vein endothelial cells (HUVECs) are cultured and simulating a three-dimensional BBB structure in vitro, and illustrates results of qualitatively assaying the degree of transfection by delivery of tGFP to cells inside BBB.

[0082] FIG. 26 illustrates results of comparative assay of whether a polyplex of VBXYP-P and tGFP permeates BBB and whether genes are delivered to cancer stem cells after a BBB model is formed using the three-dimensional microfluidic BBB model chip having the inside in which only cancer stem cells are cultured and the outer passage in which HUVECs are cultured.

[0083] FIG. 27 illustrates results of comparative assay of whether VBXYPd and VBXYP-P deliver genes targeting cancer stem cells in glioblastoma multiforme after a BBB model is formed using the three-dimensional microfluidic BBB model chip having the inside in which only glioblastoma multiforme cell lines are cultured and the outer passage in which HUVECs are cultured.

BEST MODE FOR INVENTION

[0084] As an exemplary embodiment, the present disclosure provides a gene transporter (VBXYP-P) to which vitamin B6 is coupled using the previously invented polydixylitol polymer (PdXYP) (Chemical Formula 3) as an initial backbone and in which a peptide (TR-7 peptide) binding specifically to a CD133 protein that is a marker for cancer stem cells is contained. The present disclosure is designed to target cancer stem cells and thus to deliver genes by improving the polydixylitol polymer gene transporters (PdXYP and VB-PdXYP (VBXYP)) that are the previously developed gene transporters. The gene transporter of the present disclosure may have a structure of the following Chemical Formula 1.

##STR00007##

[0085] Sulfosuccinimidyl-6-[4′-azido-2′-nitrophenylamino]hex anoate (sulfo-SANPAH) has a structure of Chemical Formula 2. A polydixylitol polymer gene transporter (dixylitol diacrylate VB-PEI-TR7 peptide copolymer, VBXYP-P) in which a cancer stem cell-specific peptide (TR-7 peptide, SEQ ID NO:1) is coupled to the previously developed VB-PdXYP (VBXYP) gene transporter using this linker was prepared.

Mode for Invention

[0086] Hereinafter, the present disclosure will be described in more detail with reference to Inventive Examples. These Inventive Examples are only to illustrate the present disclosure and are not to be interpreted that the scope of the present disclosure is limited to these Inventive Examples.

Inventive Example 1: Used Reagents and Materials

[0087] In the present disclosure, a polydixylitol polymer gene transporter (VBXYP-P) in which vitamin B6 was contained and to which TR-7 that was a cancer stem cell-specific peptide was coupled was prepared, and the following materials and reagents were used to confirm the following Inventive Examples.

[0088] Products manufactured by Sigma-Aldrich (St. Louis, Mo., USA) were used as reagents such as branched poly(ester imine) (bPEI) (Mn: 1.2 k and 25 k), dimethyl sulfoxide (DMSO), acryloyl chloride, xylitol, pyridoxal 5-phosphate (PLP), 4′-deoxypyridoxine hydrochloride, sodium cyanoborohydride (NaCNBH4), genistein, chlorpromazine, bafilomycin A1, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), and [0089] sulfosuccinimidyl-6-[4′-azido-2′-nitrophenylamino]hexanoate (Sulfo-SANPAH). TR-7 that was a peptide to which CD133, which was a cancer stem cell marker, was bound was synthesized through A&PEP Inc. In addition, Luciferase reporter coding for firefly (Photonus pyralis), a pGL3-vector, and an enhancer were obtained from Promega Corporation (Madison, Wis., USA). Green fluorescent protein (GFP) genes were obtained from Clontech Laboratories, Inc. (Palo Alto, Calif., USA). Tetramethylrhodamine isothiocyanate (TRITC) and YOYO-1 iodide (Molecular Probes, Invitrogen, Oregon, USA) dyes were used for confocal microscope analysis. Scrambled siRNA (siScr) was obtained from Genolution Pharmaceuticals Inc. (Republic of Korea), and smoothened siRNA (siSMO) was obtained from Thermo Fisher Scientific (USA). In addition, smoothened SMO CRISPR (SMOcr) was obtained from GenScript Biotech Corp. (USA). Finally, a 3D BBB microfluidic chip was obtained from SynVivo, Inc. (USA).

Inventive Example 2: Preparation of Polyol-Based Osmotic Polydixylitol Polymer Gene Transporter to which Vitamin B6 and TR-7 Peptide are Coupled

[0090] A polyol-based osmotic polydixylitol polymer gene transporter (VBXYP-P) to which vitamin B6 and a TR-7 peptide were coupled according to the present disclosure was synthesized by the following five steps. The gene transporter of the present disclosure was invented by improving the patent materials previously invented by the inventors. Therefore, the registered patent (10-1809795) was cited up to the step 4.

[0091] 2-1. Synthesis of Dixylitol

[0092] The present inventors have noticed that the number and stereochemistry of hydroxy groups affect the intracellular delivery, and thus, have tried to develop materials for gene delivery having enhanced delivery efficiency into the cells by controlling osmotically active hydroxy groups. Since sugar alcohols having 8 hydroxy groups were not commercially available, the present inventors have directly synthesized a xylitol dimer and dixylitol as an analogue of an octamer by the procedure illustrated in FIG. 1.

[0093] Specifically, xylitol was first crystallized into diacetone xylitol (Xy-Ac) crystals by an acetone/xylitol condensation method of Raymond and Hudson. The terminal hydroxy group of diacetone xylitol was reacted with trifluoromethyl sulfonyl chloride (CF.sub.3SO.sub.2—O—SO.sub.2CF.sub.3) to produce trifluoromethane sulfonyl xylitol (TMSDX). The prepared trifluoromethane sulfonyl xylitol was reacted in the same molar amount of diacetone xylitol in the presence of dry THF to form dixylitol diacetone (Xy-Ac dimer). The reaction product was finally converted into the xylitol dimer by opening the chemical rings in a HCl/MeOH solution ((a) of FIG. 1).

[0094] 2-2. Synthesis of Dixylitol Diacrylate

[0095] A dixylitol diacrylate (dXYA) monomer was synthesized by esterifying dixylitol with 2 equivalents of acryloyl chloride. An emulsion was prepared by dissolving dixylitol (1 g) in DMF (20 ml) and pyridine (10 ml) and adding dropwise an acryloyl chloride solution (1.2 ml dissolved in 5 ml of DMF) to the mixture at 4° C. while constantly stirring the mixture. After completion of the reaction, the HCl-pyridine salt was filtered and the filtrate was added dropwise to diethyl ether. The product was precipitated with a syrup liquid and dried under vacuum.

[0096] 2-3. Synthesis of Polydixylitol Polymer (PdXYP)

[0097] The polydixylitol polymer (PdXYP) of the present disclosure was prepared by a Michael addition reaction between low molecular weight polyethyleneimide (bPEI) (1.2 k) and dixylitol diacrylate (dXYA).

[0098] Specifically, the synthesized dXYA (0.38 g) dissolved in DMSO (5 ml) was added dropwise to 1 equivalent of bPEI (1.2 kDa, dissolved in 10 ml of DMSO) and reacted at 60° C. while constantly stirring the mixture for 24 hours. After completion of the reaction, the mixture was dialyzed with distilled water using a Spectra/Por membrane (MWCO: 3,500 Da; Spectrum Medical Industries, Inc., Los Angeles, Calif., USA) at 4° C. for 36 hours.

[0099] Finally, the synthesized polymer was lyophilized and stored at −70° C.

[0100] 2-4. Synthesis of Vitamin B6-Coupled Polydixylitol Polymer Gene Transporter (VB-PdXYP or VBXYP)

[0101] Pyridoxal 5′phosphate (PLP) and a polydixylitol polymer gene transporter (PdXYP) were reacted with each other to form a transient Schiff base. Thereafter, the Schiff base was reduced using NaCNBH.sub.4 to obtain a vitamin B6-coupled polydixylitol polymer gene transporter (VB-PdXYP or VBXYP) (FIG. 2).

[0102] 2-5. Synthesis of Polydixylitol Polymer Gene Transporter (VBXYP-P) to which Vitamin B6 and TR-7 are Coupled

[0103] N-Hydroxysuccinimide (NHS) of Sulfo-SANPAH formed a stable amide bond with a primary amine group of low molecular weight polyethylenimine (PEI) of the VBXYP gene transporter in a buffer solution environment with a pH 7 to 9, and nitrophenyl azide was bound to an amine group of TR-7 that was a cancer stem cell-specific peptide through a dehydroazepine intermediate by a reaction of an ultraviolet light of 300 to 460 nm. As a result, VBXYP-P was obtained (FIG. 3).

Inventive Example 3: Analysis of Properties of Polymer Gene Transporter

[0104] 3-1. Formation of Polymer Gene Transporter Nanoplex (VBXYP-P Nanoplex)

[0105] An ability of VBXYP-P of the present disclosure to form a polyplex by being bound with pDNA or siRNA was confirmed by a gel retardation experiment. Specifically, the gel retardation experiment was conducted by gel electrophoresis on a VBXYP-P/pDNA or VBXYP-P/siRNA polyplex produced by reacting PdXYP with pDNA or siRNA at molar ratios (N/P) of 0.05, 0.1, 0.3, 0.5, and 1.0. As a result, in the case of VBXYP-P/siRNA, a polyplex was formed well at molar ratios (N/P) of 0.3, 0.5, and 1 (FIG. 4a), and in the case of VBXYP-P/pDNA, a polyplex was formed well at molar ratios (N/P) of 0.5 and 1 (FIG. 4b).

[0106] 3-2. Size and Zeta Potential of Polymer Gene Transporter Nanoplex (VBXYP-P Nnoplex)

[0107] Sizes and zeta potentials of VBXYP-P of the present disclosure and VBXYP previously invented were compared and analyzed using a dynamic light scattering apparatus (FIG. 5). Asa result, the size of VBXYP-P was greater than that of VBXYP, and the zeta potential of VBXYP was greater than or similar to that of VBXYP-P. Theoretically, the zeta potential is reduced because the TR-7 peptide is bound to the amine group of PdXYP.

[0108] 3-3. Evaluation of Intracellular Uptake and Cytotoxicity of Polymer Gene Transporter Nanoplex (VBXYP-P Nanoplex)

[0109] FIG. 6 illustrates a procedure of intracellular uptake and degradation of VBXYP-P. After TRITC exhibiting red fluorescence was tagged to the VBXYP-P gene transporter, a polyplex was formed with a green fluorescent protein gene, cancer stem cells were treated with the polyplex, and changes were observed for 7 days. As a result, after 3 hours, VBXYP-P exhibiting red fluorescence was found throughout the cells. However, it was confirmed that the red fluorescence gradually disappeared and green fluorescence was expressed a lot in the cells until 7 days passed. This means that intracellular uptake of the transporter into the cancer stem cells is excellent, the gene delivery is excellent, and the transporter is degraded and does not remain in the cells. As such, when the transporter is degraded well and extracellularly released, it may be expected that cytotoxicity will be reduced.

[0110] FIG. 7 illustrates results of assay of cytotoxicity of VBXYP-P against cancer stem cells and glioblastoma multiforme cell lines. The cytotoxicity of 25 kD PEI generally used for gene delivery was compared with the cytotoxicity of VBXYP previously invented. As a result, it was confirmed that the cytotoxicity of VBXYP-P was hardly exhibited compared to 25 kD PEI exhibiting high cytotoxicity.

Inventive Example 4: Cancer Stem Cell Targeting of Polyol-Based Osmotic Polydixylitol Polymer Gene Transporter (VBXYP-P) to which Vitamin B6 and TR-7 Peptide are Coupled

[0111] As a result of confirming a ratio (w/w) of VBXYP-P having the optimal gene delivery rate to cancer stem cells to genes, the polyplex prepared at the ratio of 8:1 had the highest gene delivery ability (FIG. 8).

[0112] In addition, in order to confirm the cancer stem cell targeting gene delivery ability of VBXYP-P, the gene delivery efficiency of VBXYP-P was compared with the gene delivery efficiency of each of the gene transporters previously invented by the inventors and various commercially available non-viral gene transporters (Lipofectamine 3000, 25 kD PEI, VBPEA, PdXYP, and VBXYP) (FIG. 9). Asa result, only the VBXYP-P transporter induced transfection of the cancer stem cells with remarkably high efficiency. VBXYP to which TR-7 that was a cancer stem cell-targeting peptide was not coupled induced about 3% of transfection, but VBXYP-P induced about 60% of transfection. It was confirmed from these results that TR-7 significantly acted on targeting of the cancer stem cells.

[0113] In addition, a very interesting result was confirmed. In the case of VBXYP to which TR-7 was not coupled, the transfection efficiency for the cancer stem cells was low, but the transformation efficiency for the glioblastoma multiforme cell lines was the highest compared to other transporters. It was confirmed that the excellent gene delivery abilities to cancer stem cells exhibited using the vitamin B6-coupled gene transporters, which have been confirmed in the previous patents (10-2015-0014399 and 10-1809795), were equally applied to other cell lines. Cancer tissues consume a high amount of vitamin B6 and thus have a high uptake rate of extracellular vitamin B6. Therefore, the vitamin B6-coupled gene transporter may have a gene delivery ability specific to cancer tissues. VBXYP-P also contains vitamin B6. However, a gene delivery efficiency of less than 5% with respect to glioblastoma multiforme cell lines was confirmed. From this, it is possible to assume that the targeted delivery by TR-7 is a higher priority than the gene delivery by the vitamin B6.

[0114] In order to more accurately confirm the cancer stem cell targeting gene delivery ability of VBXYP-P, cancer stem cells were labeled with CD133 antibodies to which allophycocyanin (APC) was bound, the cancer stem cells were treated with VBXYP-P/GFP, and then, comparison of targeting abilities was conducted by an FACS assay (FIG. 10). As a result, it was confirmed that the targeting ability of VBXYP-P was remarkably higher than that of VBXYP with no TR-7.

Inventive Example 5: Induction of Apoptosis by Induction of Knock-Out of Smoothened (SMO) in Cancer Stem Cells Using VBXYP-P and CRISPR-cas9 System

[0115] 5-1. Change in Cell Proliferation of Cancer Stem Cells by Smoothened CRISPR (SMOcr) Delivery

[0116] First, a chance in proliferative ability of cancer stem cells after treatment of VBXYP-P/SMOcr was confirmed by a cell live/dead assay (FIG. 11). Living cells exhibit green fluorescence, and dying cells exhibit red fluorescence. As a result of the experiment, it was confirmed that the percentage of dying cells was the highest in the cancer stem cell group treated with VBXYP-P/SMOcr. In addition, in the WST-1 proliferation evaluation, the same results were obtained significantly in the experimental group treated with VBXYP-P/SMOcr (FIG. 12). Finally, the proliferative ability of SMOcr delivery on the cancer stem cells was confirmed by an EdU assay in which fluorescence was exhibited by coupling of EdU to newly synthesized genes (FIG. 13). As a result, as with the above experimental results, the lowest fluorescence was exhibited in the experimental group treated with VBXYP-P/SMOcr. From these results, it was confirmed that SMOcr delivery induced a significant reduction in proliferative ability of the cancer stem cells, and the hypothesis that the SMOcr delivery induces apoptosis of the cancer stem cells was established.

[0117] 5-2. Confirmation of Induction of Apoptosis of Cancer Stem Cells by Smoothened CRISPR (SMOcr) Delivery

[0118] In order to confirm whether apoptosis of cancer stem cells were induced by SMOcr delivery, a TUNEL assay and an Annexin V assay were performed (FIGS. 14 and 15). A colorimetric tunel assay was employed in the TUNEL assay. This assay is an assay to easily observe apoptotic cells with an optical microscope by coupling uridine triphosphate (UTP) to the 3′ terminus of broken DNA using terminal deoxynucleotidyl transferase (TdT) and staining DNA to exhibit dark brown. As a result of the experiment, in the experimental group of the cancer stem cells treated with VBXYP-P/SMOcr, the dark brown color was most observed.

[0119] In the Annexin V assay, phosphatidylserine inside cells is extracellularly exposed due to disruption of a cell membrane structure at the early stage of apoptosis, and Annexin V binds to the phosphatidylserine to exhibit fluorescence, such that the early stage of apoptosis is confirmed. As with the results of the TUNEL assay, in the results of this assay, in the experimental group treated with VBXYP-P/SMOcr, the fluorescence was most exhibited. It was demonstrated through these results that apoptosis of the cancer stem cells were induced by knock-out of SMO in the cancer stem cells using SMOcr.

[0120] 5-3. Assay of Expression of Smoothened after Knock-Out of Smoothened

[0121] Knock-out of SMO was induced by SMOcr delivery to cancer stem cells using VBXYP-P of the present disclosure, and a change in expression of SMO was assayed by immunofluorescence (FIG. 16). As a result, in the cancer stem cells treated with VBXYP-P/SMOcr, expression of each of SMO (green) and sonic hedgehog (Shh) was the lowest compared to those in other experimental groups, and in the results of the western blot protein quantitative assay, the same results were confirmed (FIG. 17). The amount of SMO was reduced by about 86% compared to the control group, and the amount of Shh was reduced by about 92% compared to the control group. Shh is released from dispatch protein in an autocraine or paracrine manner, Shh may be incompletely released from cells undergoing apoptosis through inhibition of the expression of SMO, and thus, the amount of Shh may be naturally reduced. Shh is an important protein that initiates a sonic hedgehog signaling inducing self-renewal of cancer stem cells. However, the expression of Shh is reduced by knock-out of SMO, and accordingly, a self-renewal ability of the cancer stem cells is reduced, such that apoptosis of the cancer stem cells may be accelerated.

[0122] Based on these results, the present inventors have demonstrated that inhibition of expression of SMO in cancer stem cells treated with VBXYP-P/SMOcr induced a reduction in expression of Shh, and apoptosis of the cancer stem cells could be induced by disruption of the self-renewal pathways.

Inventive Example 6: Induction of Apoptosis by Induction of Knock-Down of Smoothened (SMO) in Cancer Stem Cells Using VBXYP-P and siRNA

[0123] 6-1. Change in Cell Proliferation of Cancer Stem Cells by Smoothened siRNA (siSMO) Delivery

[0124] In order to confirm a change in proliferative ability of cancer stem cells after treated with VBXYP-P/siSMO, a cell live/dead assay, a WST-1 cell proliferation evaluation, and an Edu assay were performed (FIGS. 18 through 20). As a result, the same results as when VBXYP-P/SMOcr was delivered were confirmed. In the three cell proliferative ability evaluations, it was confirmed that the cell proliferation was most reduced in the experimental group of the cancer stem cells treated with VBXYP-P/siRNA. From these results, it was confirmed that known-down of SMO by siSMO delivery also induced a significant reduction in proliferative ability of the cancer stem cells, and the hypothesis that the siSMO delivery induces apoptosis of the cancer stem cells was established.

[0125] 6-2. Confirmation of Induction of Apoptosis of Cancer Stem Cells by Smoothened siRNA (siSMO) Delivery

[0126] After the induction of known-down of SMO by siSMO delivery, the above-described TUNEL assay and the Annexin V assay that were used to confirm apoptosis were conducted (FIGS. 21 and 22). As a result, it was confirmed that in the experimental group in which siSMO was delivered to cancer stem cells using VBXYP-P, apoptosis occurred in the large amount of cancer stem cells.

[0127] 6-3. Assay of Expression of Smoothened after Knock-Down of Smoothened

[0128] Knock-down of SMO was induced by siSMO delivery to cancer stem cells using VBXYP-P of the present disclosure, a change in expression of SMO according to the knock-down of SMO was compared and assayed using immunofluorescence and a western blot protein quantitative assay (FIGS. 23 and 24). As a result, in the experimental group of the cancer stem cells treated with VBXYP-P/siSMO, expression of each of SMO and Shh was the lowest. After comparing the experimental group treated with VBXYP-P/siSMO with the control group subjected to no treatment by the western blot protein quantitative assay, it was confirmed that the amount of SMO was reduced by about 74% and the amount of Shh was reduced by about 63%. Based on these results, the present inventors have demonstrated through the findings described above that as with the induction of apoptosis of cancer stem cells by knock-out of SMO using SMOcr, expression of Shh was reduced by knock-down of SMO in the cancer stem cells treated with VBXYP-P/siSMO, and apoptosis of the cancer stem cells were induced by disruption of the self-renewal pathways.

Inventive Example 7: Delivery of Targeting Genes to Cancer Stem Cells in Glioblastoma Multiforme after Permeation of Blood Brain Barrier (BBB) and Brain Tumor Barrier (BTB)

[0129] 7-1. Construction of BBB and BTB Simulation Models Using Three-Dimensional BBB Microfluidic Chip

[0130] Astrocytes were cultured in the central portion of a three-dimensional BBB microfluidic chip in order to simulate brain tissues, and human umbilical vein endothelial cells (HUVECs) were cultured in the outer portion of the chip in order to simulate blood vessels, and then, a medium was continuously flowed using a syringe pump to a portion corresponding to the blood vessel (0.02 to 0.5 μL/min) to induce formation of blood vessels similar to real blood vessels. In addition, glioblastoma multiforme cells or cancer stem cells were cultured in the central portion of the chip in order to simulate BTB, and umbilical vein endothelial cells were cultured in the outer portion of the chip, and then, a medium was continuously flowed to the outer blood vessel portion (0.02 to 0.5 μL/min) to induce formation of blood vessels similar to real blood vessels.

[0131] 7-2. Comparison of Permeabilities of VBXYP and VBXYP-P into BBB

[0132] After VBXYP and VBXYP-P were labeled with TRITC to exhibit red fluorescence, a complex with GFP genes was formed, it was qualitatively confirmed how much of the complex permeated into the central portion in which astrocytes were cultured while the complex was flowed to the blood vessel portion of the three-dimensional BBB microfluidic model at a rate of 0.01 μL/min for 120 minutes, and a permeability of each of the transporters was calculated by image analysis. In addition, after 48 hours, it was confirmed that how much of transfection occurred by the corresponding gene transporter. As a result, both the VBXYP and VBXYP-P gene transporters permeated BBB, and the permeability of VBXYP into BBB was higher than that of VBXYP-P. The results of the degrees of transfection after 48 hours were similar to each other in both experimental groups (FIG. 25).

[0133] 7-3. Targeting Gene Delivery of VBXYP-P to Cancer Stem Cells

[0134] It was confirmed that how much of VBXYP-P/GFP permeated simulated blood vessels and delivered genes to cells in the central portion while VBXYP-P/GFP was flowed to the blood vessel portion in the three-dimensional BBB microfluidic chip in which cancer stem cells were cultured in the central portion at a rate of 0.01 μL/min for 120 minutes (FIG. 26). As a result, the permeability was significantly lower than when VBXYP-P was flowed to a simple BBB model. However, after 48 hours, a remarkably high degree of transfection was confirmed in the cancer stem cells compared to the transfection rate in the astrocytes. From this result, the fact that VBXYP-P has a high transfection ability for cancer stem cells, which was confirmed through the above experiment, was confirmed once again through the three-dimensional BTB model. It could be confirmed that although the permeability of the gene transporter into the tumor cells may be lowered as the tumor cells proliferate at a remarkably high density compared to the astrocytes, when the targeting functional gene transporter is used, desired genes maybe delivered to a target. Finally, glioblastoma multiforme was cultured in the central portion of the three-dimensional microfluidic chip, each of VBXYP-P/GFP and VBXYP/GFP was flowed to the blood vessel portion at a rate of 0.01 μL/min for 120 minutes, and the permeabilities of the gene transporters and the degrees of transfection after 48 hours were compared with each other (FIG. 27). As a result, it was confirmed that in comparison to when each transporter was applied to a general BBB model, the permeability was significantly lowered overall, but the permeability aspects of the respective transporters were similar to each other. Similarly, in the present model, the permeability of VBXYP/GFP was higher than that of VBXYP-P/GFP. However, after 48 hours, in the experimental group treated with VBXYP-P/GFP, remarkably highly transfected cells were found. It was demonstrated through these results of the present experiment that VBXYP-P not only could permeate BBB and BTB, but also could target cancer stem cells present inside the tumor in a significantly small amount and could deliver genes to the cancer stem cells.

[0135] The present inventors have invented the gene transporter called VBXYP-P capable of targeting cancer stem cells through all the exemplary embodiments, have demonstrated that apoptosis of the cancer stem cells could be induced using, for the transporter, smoothened (SMO) CRISPR and siRNA capable of disrupting the self-renewal signaling of the cancer stem cells and thus inducing apoptosis, and have identified the mechanism thereof. In addition, the present inventors have demonstrated through the three-dimensional microfluidic system that the gene transporter of the present disclosure not only could permeate BBB but also could target the cancer stem cells inside the brain tumor.

[0136] From the above description, those skilled in the art to which the present disclosure pertains will appreciate that the present disclosure may be embodied in other specific forms without changing the technical spirit or essential features of the present disclosure. In this regard, it is to be understood that the exemplary embodiments described hereinabove are illustrative rather than being restrictive in all aspects. It is to be understood that all modifications or variations derived from the meanings and scope of the claims described below and equivalents thereof are included in the scope of the present disclosure rather than the above-mentioned description.

INDUSTRIAL APPLICABILITY

[0137] It is confirmed that the polydixylitol polymer gene transporter (VBXYP-P) to which vitamin B6 and a cancer stem cell-specific peptide are coupled has a remarkably higher nucleic acid delivery rate to cancer stem cells than that of the pre-existing nucleic acid transporter, has almost no cytotoxicity in a complex when bound with DNA, and above all, permeates a blood brain barrier to target cancer stem cells in glioblastoma multiforme and thus to specifically deliver the nucleic acid, thereby inducing transfection. Therefore, the gene transporter of the present disclosure inhibits expression of cancer stem cells in a tumor in vivo, and thus may be broadly used in gene therapy for various cancer diseases.