PROCESS FOR THE BIOLOGICAL PRODUCTION OF METHACRYLIC ACID AND DERIVATIVES THEREOF
20180171368 ยท 2018-06-21
Inventors
- Graham Ronald Eastham (Wilton, Redcar, GB)
- Gill STEPHENS (Nottingham, GB)
- Andrew Yiakoumetti (Nottingham, GB)
Cpc classification
C08F120/14
CHEMISTRY; METALLURGY
Y02E50/10
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12P5/026
CHEMISTRY; METALLURGY
C12P7/40
CHEMISTRY; METALLURGY
C12Y301/02023
CHEMISTRY; METALLURGY
C08F120/06
CHEMISTRY; METALLURGY
C12N9/1029
CHEMISTRY; METALLURGY
Y02E50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
International classification
C12P7/40
CHEMISTRY; METALLURGY
C08F120/06
CHEMISTRY; METALLURGY
C08F120/14
CHEMISTRY; METALLURGY
Abstract
A process of producing methacrylic acid and/or derivatives thereof including the following steps: (a) biologically converting isobutyryl-CoA into methacrylyl-CoA by the action of an oxidase; and (b) converting methacrylyl-CoA into methacrylic acid and/or derivatives thereof. The invention also extends to microorganisms adapted to conduct the steps of the process.
Claims
1-54. (canceled)
55. A process of producing methacrylic acid and/or derivatives thereof comprising the following steps: (a) biologically converting isobutyryl-CoA into methacrylyl-CoA by action of an oxidase; and (b) converting methacrylyl-CoA into methacrylic acid and/or derivatives thereof.
56. The process according to claim 55, wherein step (b) is conducted biologically or chemically.
57. The process according to any of claim 55, wherein the derivatives thereof of methacrylic acid are methacrylic acid esters.
58. The process according to claim 57, wherein the methacrylic acid esters are butyl methacrylates.
59. The process according to claim 57, wherein the methacrylic acid esters are formed biologically by action of a transferase.
60. The process according to claim 59, wherein the transferase is an alcohol acyltransferase.
61. The process according to claim 60, wherein the alcohol acyltransferase is derived from a fruit origin.
62. The process according to claim 60, wherein the alcohol acyltransferase acts in the presence of an alcohol.
63. The process according to claim 55, wherein the process further comprises step (c) of converting methacrylic acid formed in step (b) into a methacrylic acid ester.
64. The process according to claim 63, wherein step (c) is conducted biologically or chemically.
65. The process according to claim 63, wherein step (c) is conducted biologically by action of an esterase or hydrolase.
66. The process according to claim 55, wherein the oxidase is an acyl-CoA oxidase.
67. The process according to claim 66, wherein the acyl-CoA oxidase is selected from any of the following enzymes: ACX4 from Arabidopsis thaliana, short chain acyl-CoA oxidase from Arthrobacter Nicotianae, a peroxisomal acyl-CoA oxidase from Vigna radiate., acyl-CoA oxidase from Candida sp. and acyl-CoA oxidase 4 from Candida tropicalis.
68. The process according to claim 66, wherein the acyl-CoA oxidase is ACX4 from Arabidopsis thaliana.
69. The process according to claim 55, wherein methacrylyl-CoA is converted into methacrylic acid by the action of a thioesterase, transferase, synthetase, and/or a phosphotransacylase and a short chain fatty acid kinase.
70. The process according to claim 69, wherein methacrylyl-CoA is converted into methacrylic acid by action of a thioesterase.
71. The process according to claim 69, wherein methacrylyl-CoA is converted into methacrylic acid by action of a thioesterase and the thioesterase is acyl-CoA thioesterase 4HBT from Arthrobacter sp. Strain SU.
72. A process of producing methacrylic acid comprising the following steps: (a) converting isobutyryl-CoA into methacrylyl-CoA; and (b) biologically converting methacrylyl-CoA into methacrylic acid by the action of a thioesterase, transferase, synthetase, and/or a phosphotransacylase and a short chain fatty acid kinase.
73. A method of preparing polymers or copolymers of methacrylic acid or methacrylic acid esters, comprising the steps of: (i) preparation of methacrylic acid and/or derivatives thereof in accordance with claim 1; (ii) optional esterification of the methacrylic acid prepared in (i) to produce the methacrylic acid ester; (iii) polymerization of the methacrylic acid and/or derivatives thereof prepared in (i) and/or, if present, the ester prepared in (ii), optionally with one or more comonomers, to produce polymers or copolymers thereof.
74. The method according to claim 73, wherein the derivatives thereof of methacrylic acid are methacrylic acid esters.
Description
EXAMPLES
[0243] The invention will now be illustrated with reference to the following non-limiting examples and figures in which:
[0244]
[0245]
[0246]
[0247]
[0248]
[0249]
[0250]
[0251]
[0252]
[0253]
[0254]
[0255]
[0256]
[0257]
[0258]
[0259]
[0260]
[0261]
[0262]
[0263]
[0264]
[0265]
[0266]
[0267]
[0268] Example 1: The selective hydrolysis of methacrylyl-CoA [0269] Example 2: The oxidation of isobutyryl-CoA to methacrylyl-CoA and the in vitro conversion of isobutyryl-CoA to methacrylic acid and coenzyme A in an enzyme coupled reaction. [0270] Example 3: The whole cell biotransformation of isobutyric acid to methacrylic acid. [0271] Example 4: The whole cell production of methacrylic acid from glucose via a 2-ketoisovalerate intermediate. [0272] Example 5: The whole cell production of butyl methacrylate from 2-ketoisovalerate by recombinant Escherichia coli
1.1 Materials for Examples 1 to 4
[0273] The bacterial strains used throughout examples one to four are listed, as well as the growth media and agar plates used throughout the experiments. A table of primers lists all the primers used in this study, and a table of plasmids lists all the plasmids used and constructed during this study.
[0274] 1.1.1 Bacterial Strains
[0275] E. coli JM107 was used as a plasmid cloning host whilst E. coli BL21 (DE3) pLysS was used as a gene expression host.
[0276] 1.1.2 Bacterial Growth Media and Nutrient Agar Plates
[0277] 1.1.2.1 Luria Bertani Broth (LB Media)
[0278] Luria Bertani high salt media (Melford) (25 g.Math.L.sup.?1) was used wherever LB media is referred to, whereby 25 g of LB high salt media in 1 litre consists of peptone from casein digest (10 g.Math.L.sup.?1), yeast extract (5 g.Math.L.sup.?1) and sodium chloride (10 g.Math.L.sup.?1). LB media was often supplemented with carbenicillin (50 ?g.Math.ml.sup.?1), chloramphenicol (34 ?g.Math.ml.sup.?1) and/or glucose (1% w/v). LB media was sterilised by autoclave, whilst stock solutions of glucose (20% w/v) in water, carbenicillin (100 mg.Math.ml.sup.?1) in water and chloramphenicol (34 mg.Math.ml.sup.?1) in ethanol were filter sterilised and added separately.
[0279] 1.1.2.2 MSX Minimal Media
[0280] MSX media was prepared by combining MSA media (760 ml.Math.L.sup.?1), MSB media (200 ml.Math.L.sup.?1) and a 12.5% (w/v) glucose stock solution (40 ml.Math.L.sup.?1) at room temperature. MSB media was composed of NH.sub.4C1 (15 g.Math.L.sup.?1) and MgSO.sub.4.7H.sub.2O (2.0 g.Math.L.sup.?1) and was sterilised by autoclave. MSA media was composed of KH.sub.2PO.sub.4 (7.89 g.Math.L.sup.?1), vishniac trace elements (2.63 ml.Math.L.sup.?1) and KOH solution was added until the pH reached 7.0 before MSA was sterilised by autoclave. Vishniac trace elements were prepared as previously described (Vishniac W, Santer M. THE THIOBACILLI, Bacteriological Reviews 1957; 21(3):195-213.) but using only 3.9 g.Math.L.sup.?1 of ZnSO.sub.4.7H.sub.2O. The glucose was filter sterilised using a 0.22 ?m sterile filter. MSX media was sometimes supplemented with riboflavin (1 mg.Math.L.sup.?1) and this was achieved by dissolving riboflavin into MSB media first (5 mg.Math.L.sup.?1). This solution was then filter sterilised and the MSB+Riboflavin solution was then mixed with MSA and glucose in the same volumetric as for MSX media alone, to form MSX supplemented with riboflavin. Both MSX and MSX supplemented with riboflavin were always supplemented with carbenicillin (50 ?g.Math.ml.sup.?1) and chloramphenicol (34 ?g.Math.ml.sup.?1), prepared as previously described for LB media.
[0281] 1.1.2.3 Luria Bertani Agar Plates
[0282] Luria Bertani agar plates were prepared using Luria Bertani high salt media (Melford) (25 g.Math.L.sup.?1) and agar (20 g.Math.L.sup.?1). The LB and agar mixture was sterilised by autoclave and allowed to cool for 1 h in a 50? C. water bath prior to pouring. The LB agar plates were often supplemented with carbenicillin (50 ?g.Math.ml-1), chloramphenicol (34 ?g.Math.ml-1) and/or glucose (1% w/v). The carbencillin, chloramphenicol and glucose stock solutions were prepared as previously described for Luria Bertani liquid broth and added to the LB agar solution just prior to pouring. The glucose stock solution was pre-warmed in a 50? C. water bath for 1 h prior to its addition to the LB agar.
TABLE-US-00001 SEQ REF PRIMERSEQUENCE(5 to3) ID HHT.F TATACATATGCACCGTACCTCTAACGGTTCTCACGC 2 HHT.R CTCGAGTCCGTCACGACGCGGACG 3 OE.A.F ACATATGCACCGTACCTCTAACGGTTC 7 OE.A.R CTGCCATATCTATATCTCCTGTTAGTCACGACGCGG 8 ACG OE.B.F GTGACTAACAGGAGATATAGATATGGCAGTTCTGAG 9 CAGC OE.B.R CTCGAGATATTATAGCTAGCTTACAGACGGCTACGG 10 GTTG BCKAD.F GGCCTGTCATGAGTGATTACGAGCCG 16 BCKAD.R CGGCCCTGCAGGTTCGCGGGAATCAGATGTGC 17 AAT.F AGGAGATATACCATGAAAAGCTTTTCTGTACTC 18 AAT.R AGCAGCCGGATCCCCTGCAGGACTAGTTTACTGGCT 19 GGTGCTAC ACX4.F CACCAGCCAGTAAGCTAGCAAGGAGATATACCATGG 20 CTG ACX4.R TCCCCTGCAGGACTAGTTTACAGGCGAGAACGGGTAG 21
[0283] SEQ ID NO.1codon optimised gene sequence for 4-Hydroxybenzoyl-CoA Thioesterase (4HBT) from Arthobacter sp. strain SU for expression in Escherichia coli.
[0284] SEQ ID NO.4The product of the polymerase chain reaction performed to modify the 4HBT gene such that sub-cloning the PCR product into the pET20b(+) plasmid to form the pET20b(+)::CtHis-4HBT plasmid.
[0285] SEQ ID NO.5The gene encoding the carboxy-terminal histidine tagged 4HBT enzyme in the pET20b(+)::CtHis-4HBT plasmid.
[0286] SEQ ID NO. 6codon optimised gene encoding short chain acyl-CoA oxidase (ACX4) from Arabidopsis thaliana for expression in Escherichia coli.
[0287] SEQ ID NO.11The product of the overlap extension polymerase chain reaction to concatenate 4HBT and ACX4 into one polynucleotide
[0288] SEQ ID NO.12codon optimised gene encoding acyl-CoA synthetase (AcsA) from Pseudomonas chlororaphis B23 for expression in Escherichia coli.
[0289] SEQ ID NO.13The sequence between, and inclusive of, the NdeI and XhoI restriction sites in pET20b(+)::4HBT-ACX4-AcsA.
[0290] SEQ ID NO 14The ppBCKD polynucleotide synthesised by Biomatik containing the four genes encoding the subunits of the Pseudomonas putida KT2440 branched chain keto acid dehydrogenase, delivered in the pBSK::ppBCKD plasmid.
[0291] SEQ ID NO.15The sequence between, and inclusive of, the NdeI and XhoI restriction sites in the pET20b(+)::4HBT-ACX4-ppBCKD plasmid.
[0292] SEQ ID NO. 22The sequence of the pET16b (Sse) expression vector containing a modified Sse8387I restriction site.
[0293] SEQ ID NO. 23codon optimised gene encoding short chain acyl-CoA oxidase (ACX4) from Arabidopsis thaliana for expression in the pET16b (Sse) expression vector.
[0294] SEQ ID NO. 24codon optimised gene encoding alcohol acyl transferase (AAT) from Apple for expression in the pET16b (Sse) expression vector.
TABLE-US-00002 Table of plasmids PLASMID REFERENCE SOURCE DESCRIPTION pBMH::4HBT Biomatik A cloning vector Corporation conferring resistance to ampicillin containing a codon optimised gene encoding 4HBT flanked by the NdeI and NotI restriction sites. pBMH::AcsA Biomatik A cloning vector Corporation conferring resistance to ampicillin containing a codon optimised gene encoding AcsA flanked by a 3 XhoI restriction site and a 5 sequence containing an NheI restriction site, a ribosome binding site, a spacer sequence and an NdeI restriction site. pBSK::ppBCKD Biomatik A cloning vector with the Corporation four genes encoding the branched chain keto acid dehydrogenase complex of Pseudomonas putida KT2440, flanked by a 3 XhoI restriction site and a 5 sequence composed of an XbaI restriction site, a spacer sequence, an NheI restriction site, a ribosome binding site and a second spacer sequence. pMA-RQ::ACX4 Life A cloning plasmid Technologies conferring resistance to ampicillin, and containing a codon optimised gene encoding ACX4 from Arabidopsis thaliana, flanked by a 5 NdeI and a 3 XhoI restriction site. pJET1.2 Thermo The pJET1.2 linearised Scientific blunt end cloning vector by Thermo Scientific. pJET1.2::CtHIS- This work The pJET1.2 cloning vector 4HBT containing the product of a polymerase chain reaction to replace the stop codon of 4HBT with a 5-GGA-3 sequence followed by a XhoI site, such that on sub-cloning the insert into pET20b(+), the gene formed encodes 4HBT with a C-terminal His-tag appended to the end, with a tripeptide linker in between. pJET1.2::4HBT- This work The pJET1.2 cloning vector ACX4 containing the product of an overlap extension polymerase chain reaction that linked the 4HBT and ACX4 genes into a single polynucleotide with a new ribosome binding site in between the two genes. pET20b(+) Novagen The pET20b(+) expression vector by Novagen. pET20b(+)::4HBT This work The pET20b(+) expression vector containing the codon optimised gene encoding 4HBT from Arthrobacter sp. strain SU between the NdeI and NotI restriction sites. pET20b(+)::CtHIS- This work The pET20b(+) expression 4HBT vector with the insert from pJET1.2::CtHIS-4HBT subcloned in between the NdeI and XhoI restriction sites, for the expression of 4HBT with a Gly-Leu- Glu-His-His-His-His-His- His peptide appended to the carboxy-terminus of each subunit. pET20b(+)::ACX4 This work The pET20b(+) expression vector containing the codon optimised gene encoding short chain acyl- CoA oxidase from Arabidopsis thaliana, cloned in between the NdeI and XhoI restriction sites. pET20b(+)::AcsA This work The pET20b(+) expression vector containing the codon optimised gene encoding AcsA, cloned in between the NdeI and XhoI restriction sites. pET20b(+)::4HBT- This work The pET20b(+) expression ACX4 vector containing the 4HBT and ACX4 genes subcloned as a single polynucleotide from the pJET1.2::4HBT- ACX4 plasmid into the pET20b(+) plasmid in between the NdeI and XhoI restriction sites, such that an expression unit is formed for the co- expression of both 4HBT and ACX4, and capable of accepting a second insert between the newly introduced NheI site and the XhoI site. pET20b(+)::4HBT- This work The pET20b(+)::4HBT-ACX4 ACX4-AcsA expression vector containing the AcsA gene subcloned from the pBMH::AcsA plasmid in between its NheI and XhoI sites. pET20b(+)::ppBCKD This work The pET20b(+) expression vector containing the four genes encoding the ppBCKD complex, subcloned from the pBSK::ppBCKD plasmid in between the XbaI and XhoI restriction sites. pET20b(+)::4HBT- This work The pET20b(+)::4HBT-ACX4 ACX4-ppBCKD expression vector containing the four genes encoding the ppBCKD complex, subcloned from the pBSK::ppBCKD plasmid into it in between its NheI and XhoI restriction sites. pET16b (Sse) This work The pET16b expression vector with a modified Sse8387I restriction site. pMMA121 This work The pET16b (Sse) expression vector containing the ACX4 gene from A. thaliana optimised for expression in pET16b (Sse) between its XbaI and Sse8387I restriction sites. pWA008 This work The pET16b(Sse) expression vector containing the operon which encodes the BCKAD complex from P. aeruginosa PA01 strain inserted between its NcoI and Sse8387I restriction sites. pAAT212 This work The pET(Sse) expression vector containing the AAT gene from Apple optimised for expression in pET16b (Sse) inserted between its NcoI and Sse8387I restriction sites pMMA133 This work The pAAT212 plasmid further containing the ACX4 gene from A. thaliana optimised for expression in the pET16b (Sse) vector inserted between the SpeI restriction site and the AAT gene. pMMA134 This work The pMMA133 and the pWA008 plasmids ligated together and containing the ACX4 gene from A. thaliana optimised for expression in the pET16b (Sse) vector, the AAT gene from Apple optimised for expression in the pET16b (Sse) vector, and the BCKAD complex from P. aeruginosa PA01 strain inserted between the XbaI and Sse8387I restriction sites.
1.2 General Methods for Examples 1 to 4
[0295] 1.2.1 Transformation of Plasmids into E. coli JM107 Cloning Host.
[0296] Plasmids (1 ng) were transformed into E. coli JM107 (541) that was made competent using the Fermentas TransformAid? bacterial transformation kit. Freshly transformed cells were incubated on ice for 5 min, then plated on prewarmed LB agar plates supplemented with carbenicillin (50 ng.Math.?l.sup.?1). Plates were incubated at 37? C. for 16 h.
[0297] 1.2.2 Restriction Digests of Plasmids
[0298] To isolate the gene or polynucleotide inserts from plasmids, restriction digests of plasmids were performed using the Fermentas FastDigest? series of restriction endonucleases, according to the instructions provided. All restriction digest reactions were performed in a water bath at 37? C. for 3 h.
[0299] 1.2.3 Preparation of Linear Expression Vector
[0300] Plasmids were linearised in restriction digestion reactions (100 ?l) containing plasmid DNA (100 ng.Math.?l.sup.?1), Fermentas FastDigest? Green buffer (1?) and Fermentas FastDigest? restriction endonucleases, as described above. Linearised vectors were purified by agarose gel electrophoresis and gel extraction without first heat-inactivating the restriction endonucleases. The 5 phosphates of the linearised vectors were then hydrolysed by Antarctic phosphatase (New England Biolabs) according to the instructions provided. The dephosphorylated vector was concentrated by ethanol precipitation, which required the addition of 3M sodium acetate, pH 5.2, to the sample (volume added: 1/10.sup.th of the original sample volume) followed by the addition of absolute ethanol (volume added: 2? the new sample volume). The precipitation mixture was incubated overnight at ?20? C. The precipitated DNA was then centrifuged in an Eppendorf miniSpin F-45-12-11 rotor at 13400 rpm for 30 min. The supernatant was discarded and the cell pellet was washed with 70% (v/v) ethanol. The DNA pellet was then centrifuged in the same rotor and at the same speed as before for a further 10 min. The supernatant was removed and the DNA pellet was air dried in a fume hood for 20 min before being resuspended in nuclease free water (50 ?l). The concentration of the linearised vector was determined by analytical agarose gel electrophoresis.
[0301] 1.2.4 Agarose Gel Electrophoresis and Gel Extraction
[0302] Linear DNA fragments from plasmid digestion or PCR amplification were purified by agarose gel electrophoresis. The digests or PCR products were loaded onto an agarose gel consisting of agarose (1% (w/v)), ethidium bromide (1.78 ?M), Tris acetate (4 mM) and ethylenediaminetetraacetic acid (EDTA) (1 mM). A potential difference of 7V per centimetre of gel length was applied across the gel to resolve the polynucleotides. DNA was visualised on the gel with a transluminator, and a gel slice containing the polynucleotide of interest was excised with a scalpel. The polynucleotide was purified from the gel slice with the QIAquick? Gel extraction kit. The concentration of the polynucleotide was determined by analytical agarose gel electrophoresis.
[0303] 1.2.5 Ligation of Inserts into Linearised Plasmids
[0304] Gene inserts were ligated into linearised plasmid in a ligation reaction (20 ?l). Ligation reactions consisted of gene insert and linear vector (50 ng) in a 3:1 molar ratio for gene inserts less than 3 kb in length, or a 1:1 molar ratio for gene inserts greater than 3 kb in length, along with T4 DNA ligase (1 unit) and Fermentas buffer for T4 DNA ligase (1?). Ligations were performed at room temperature for 20 min and ligation mixture (2.5 ?l) was used as the source of plasmid for the transformation into E. coli JM107, which was performed using the Fermentas TransformAid bacterial transformation kit, as before. Transformed cells were plated on prewarmed LB agar plates supplemented with carbenicillin and were incubated at 37? C. for 16 h.
[0305] 1.2.6 Subcloning a Polynucleotide into an Expression Vector
[0306] To sub-clone a polynucleotide into a new vector, the source vector was first amplified by transforming it (1 ng) into E. coli JM107 using the Fermentas TransformAid? bacterial transformation kit and then preparing an LB culture (5 ml) supplemented with carbenicillin for each of 5 unique colonies on the agar plate. The 5?5 ml LB+Carbenicillin cultures were incubated at 37? C. with shaking at 250 rpm for 16 h and plasmids were purified out of the culture using the QIAGEN QIAprep? Spin miniprep kit as described in the manual. The polynucleotides of interest were digested out of each plasmid preparation in restriction digest reactions (20 ?l) using 1 ?l of the required restriction endonuclease for each of the desired 5 and 3 cloning sites. The restriction digests were pooled together and the polynucleotide to be subcloned into the new vector was purified from the remainder of the source vector by agarose gel electrophoresis and gel extraction. A ligation reaction was established to ligate the polynucleotide insert into a linearised expression vector previously prepared with complementary cohesive ends to the insert. The ligation reaction (2.5 ?l) was used as the source of plasmid for transformation into E. coli JM107, as already described. The expression plasmid was amplified by inoculating an LB+Carbenicillin culture (100 ml) with a single colony from the plate of transformants, incubating the culture at 37? C. with shaking at 200 rpm for 16 h, and purifying the plasmid from the culture using the QIAGEN Plasmid MidiPrep kit.
[0307] 1.2.7 Transformation of E. coli BL21 (DE3) pLysS with Expression Vector
[0308] Expression vector (1 ng) was transformed into E. coli BL21 (DE3) pLysS expression host. Competent cells were purchased from Novagen, and ice cold circular plasmid (1 ng) was added to ice cold competent cells (20 ?l). The transformation mixture was incubated on ice for 5 min prior to a 30 s heat shock at 42? C. After the heat shock, cells were incubated on ice for a further 2 min. SOC media (Novagen) (80 ?l) was added to the transformed cells and the cells were incubated at 37? C. with shaking at 250 rpm for 60 min prior to plating on LB agar plates supplemented with carbenicillin (50 ?g.Math.ml.sup.?1), chloramphenicol (34 ?g.Math.ml.sup.?1) and glucose (1%, w/v). Plates were incubated at 37? C. for 16 h.
[0309] 1.2.8 Analytical Agarose Gel Electrophoresis
[0310] Linear DNA homogeneity and concentration was determined by analytical agarose gel electrophoresis. Agarose gels consisted of agarose (1% (w/v)), ethidium bromide (1.78 ?M), Tris acetate (4 mM) and EDTA (1 mM). A fixed volume (5 ?l) of DNA sample was loaded onto the gel alongside GeneRuler? 1 kb Plus DNA ladder (Thermo Scientific) (5 ?l). To estimate the concentration of the sample, the intensity of the sample band was visually compared to the intensities of bands of similar size and known mass in the ladder, as described in the manual for the GeneRuler? 1 kb Plus DNA ladder.
[0311] 1.2.9 Sodium-Dodecyl-Sulphate Polyacrylamide Gel Electrophoresis
[0312] Samples (1.5 ml) were taken from cell culture and cells were pelleted by centrifugation at 5000 g for 10 min. Cell pellets were resuspended in cell lysis buffer, using 100 ?l for each OD.sub.600 unit the cell culture was at when the samples were taken. Cell lysis buffer contained potassium phosphate buffer (100 mM, pH 7.5), BugBuster cell lysis detergent (Merck-Millipore) (1?), Benzonase nuclease (Sigma Aldrich) (0.01%, v/v) and protease inhibitor cocktail (Roche). Resuspended cells were incubated for 20 min with shaking at 250 rpm and centrifuged at 18,000 g for 20 min at 4? C. The insoluble fraction was re-suspended in potassium phosphate buffer (100 mM, pH 7.5) using the same volume as was used to resuspend the cell pellet. Soluble and insoluble fractions were mixed in a 1:1 ratio with 2? Laemmli sample buffer (Bio-Rad), containing ?-mercaptoethanol (5%, v/v). Samples were boiled at 100? C. for 5 min and loaded onto a Bio-Rad AnyKD TGX precast gel. Electrophoresis was performed at 200V in Tris/Glycine/SDS running buffer (Bio-Rad). Gels were washed by soaking them in double distilled water at room temperature with gentle agitation (50 rpm) for 5 min. The water was removed and the wash procedure was repeated a further four times. Gels were then stained by soaking overnight (16 h) in EZBlue? Gel Staining Reagent (Sigma-Aldrich) at room temperature with gentle agitation for 16 h.
1.3 Example 1Production of Methacrylic Acid from Methacrylyl-CoA
[0313] The enzyme 4-hydroxybenzoyl-CoA thioesterase (4HBT) from Arthrobacter sp. strain SU (Genbank accession number AAC80224.1, Uniprot accession number Q04416, EC number 3.1.2.23) was identified as a candidate thioesterase for the hydrolysis of methacrylyl-CoA after a database and literature search for thioesterases with known activity on substrates that are structurally related to methacrylyl-CoA.
[0314] A gene encoding the amino acid sequence for 4HBT was codon optimised for expression in E. coli and synthesised by Biomatik Corporation with an NdeI restriction site integrated into the 5 end and a NotI restriction site appended to the 3 end.
[0315] The synthesised polynucleotide (SEQ. ID 1) was delivered in the pBMH::4HBT cloning vector and the 4HBT gene insert was sub-cloned into a previously linearised pET20b(+) expression vector, at the NdeI and NotI restriction sites, to form pET20b(+)::4HBT. The newly constructed pET20b(+)::4HBT plasmid was then transformed into E. coli BL21 (DE3) pLysS to form E. coli BL21 (DE3) pLysS pET20b(+)::4HBT.
[0316] To express the 4-hydroxbenzoyl-CoA thioesterase enzyme, a starter culture (20 ml) of LB media supplemented with glucose, carbencillin and chloramphenicol was first inoculated with a single colony of E. coli BL21 (DE3) pLysS pET20b(+)::4HBT from an LB agar plate supplemented with glucose chloramphenicol and carbenicillin. The starter culture was incubated at 37? C. with shaking at 200 rpm until the culture reached an OD.sub.600 of 1.0. The cells were then harvested by centrifugation at 5000 g for 15 min at 4? C. and used to inoculate an intermediate culture (100 ml) of LB media, also supplemented with glucose, carbenicillin and chloramphenicol. The intermediate culture was also incubated at 37? C. with shaking at 200 rpm until an OD.sub.600 of 1.0. The cells in the intermediate culture were then harvested by centrifugation at 5000 g for 15 min at 4? C. before being re-suspended into fresh LB media (1 L), again supplemented with glucose, carbenicillin and chloramphenicol, in a 2.5 L baffled shake flask. This culture was incubated at 37? C. with shaking at 200 rpm until an OD.sub.600 of 1.0 and expression of 4HBT was then induced by the addition of isopropyl-3-D-thiogalactopyrannoside (IPTG) to a final concentration of 0.4 mM. The culture was incubated for a further 5.5 h under the same conditions. The culture was divided evenly into three centrifuge tubes and cells were then harvested by centrifugation at 5000 g for 20 min at 4? C. A sample of the culture taken prior to the cells being harvested was analysed by SDS-PAGE which showed the protein to be highly soluble and well expressed. Cell pellets in each centrifuge tube were washed three times in assay buffer (50 ml), which comprised of 2-[4-(2-hydroxyethyl)piperazin-1-yl])ethanesulfonic acid (HEPES) (50 mM), that was adjusted to pH 7.5 with potassium hydroxide. The cell pellets were frozen at ?80? C. until lysed. This process was repeated for the E. coli BL21 (DE3) pLysS pET20b(+), an empty pET20b(+) vector negative control strain.
[0317] To prepare a cell free extract of the 4HBT enzyme, one of the cell pellets of E. coli BL21 (DE3) pLysS pET20b(+)::4HBT that was prepared previously was re-suspended in HEPES (50 mM, pH 7.5) assay buffer and lysed in a Constant Systems One Shot cell disrupter. The cell lysate was centrifuged at 18,000 g for 15 min at 4? C. and the supernatant of this was centrifuged at 57,750 g for a further 60 min at 4? C. This supernatant was washed using a VivaSpin Viva6 10,000 Molecular Weight Cut-Off centrifugal concentrator, centrifuging at 10,000 g at 18? C. until a six-fold volume reduction, followed by a six-fold re-dilution in the HEPES assay buffer and a further 6-fold volume reduction in the centrifugal concentrator. The total protein concentration of the cell free extracts from E. coli BL21 (DE3) pLysS pET20b(+)::4HBT overexpression cultures was performed using the BioRad DC assay kit, using bovine serum albumin as the protein standard. The same procedure was followed in order to prepare cell free extracts from a cell pellet of the E. coli BL21 (DE3) pLysS pET20b(+), the negative control strain.
[0318] In order to assay the 4HBT enzyme for activity on methacrylyl-CoA, methacrylyl-CoA was first prepared. The synthesis of methacrylyl-CoA was performed by the reaction of coenzyme A with methacrylic anhydride. The reaction consisted of coenzyme A (20 mM) and methacrylic anhydride (40 mM) in sodium phosphate buffer (100 mM, pH 8.5). The reaction was incubated on ice and vortexed every 2 min for 30 min and the final reaction mix was acidified to pH 3.5 with hydrochloric acid. Methacrylic acid byproduct and unreacted methacrylic anhydride were removed by extraction with 4?10 ml water saturated diethyl ether. Methacrylyl-CoA was purified by reverse phase high performance liquid chromatography (RP-HPLC) on an analytical scale column (Agilent Zorbax Eclipse XDB C18 column, 4.6 mm?150 mm). Sample (75 ?l) was injected onto the C18 column, and eluted over 40 min by a linear acetonitrile gradient (1.8%-13.5%) in 0.1% trifluoroacetic acid (TFA), at a flowrate of 1 ml.Math.min.sup.?1. The main peak was the methacrylyl-CoA containing peak, and the methacrylyl-CoA containing fractions were collected and pooled. Acetonitrile was removed by rotary evaporation (21? C., 3 kPa), leaving behind an aqueous solution of methacrylyl-CoA and trifluoroacetic acid. This solution of methacrylyl-CoA and trifluoroacetic acid was brought to pH 7 by sodium hydroxide and flash frozen with liquid nitrogen prior to lyophilisation. TFA was removed by re-dissolving the freeze dried sample in nuclease free water (10 ml), and repeating the freeze-dry-redissolve cycle twice more, once in 5 ml, and finally in 1 ml nuclease free water. The concentration of methacrylyl-CoA was determined by absorbance at 260 nm with a molar extinction coefficient of 16800M.sup.?1.Math.cm.sup.?1.
[0319] Crude enzymatic assays of 4HBT were performed in cuvettes (1 ml) containing cell free protein extract (1 mg.Math.ml.sup.?1), methacrylyl-CoA (approximately 100 ?M), 55-dithiobis-(2-nitrobenzoic) acid (DTNB) (500 ?M). Reactions were started by the addition of substrate and were monitored at 412 nm. Enzymatic assays were repeated for cell free extracts of E. coli BL21 (DE3) pLysS pET20b(+). Enzyme assays for cell free extracts of both the 4HBT overexpressing strain and the empty vector control strain were repeated for isobutyryl-CoA as a substrate also.
[0320] Crude enzyme assays of 4HBT demonstrated that 4HBT catalysed the hydrolysis of methacrylyl-CoA, and exhibited a selectivity for methacrylyl-CoA over isobutyryl-CoA as a substrate.
[0321] In order to better characterise 4-hydroxybenzoyl-CoA thioesterase, the enzyme was His-tagged so that it could be assayed as a pure enzyme as opposed to as a part of a cell free extract. To His-tag the enzyme, a polymerase chain reaction was established. Forward and reverse primers for 4HBT His-tagging, HHT.F (SEQ. ID 2) and HHT.R (SEQ. ID 3), were designed to replace the (5-TAA-3) stop codon from the gene encoding 4HBT with a (5-GGA-3) sequence and to introduce a 3 XhoI restriction site immediately after. Thus, on cloning the PCR product back into pET20b(+) between the NdeI and XhoI restriction sites, an open reading frame encoding 4HBT with a glycine-leucine-glutamate spacer sequence and a carboxy-terminal hexahistidine (His) tag was created.
[0322] Polymerase chain reaction mixtures contained the pET20b(+)::4HBT plasmid as template DNA (50 pg.Math.?l.sup.?1), KOD DNA polymerase (1 unit), primer HHT.F (0.4 ?M), primer HHT.R (0.4 ?M), deoxyadenosinetriphosphate (dATP) (0.2 mM), deoxythymidine triphosphate (dTTP) (0.2 mM), deoxycytidinetriphosphate (dCTP) (0.2 mM), deoxyguanosinetriphosphate (dGTP) (0.2 mM), MgCl.sub.2 (1 mM) and Novagen buffer #1 for KOD DNA polymerase (1?). PCR mixtures were loaded into a thermocycler programmed to start at 94? C. for 3 min, then to cycle through 30 iterations of 30 s melting at 94? C., 30 s annealing at 55? C., 80 s elongation at 72? C., before ending with 5 min at 72? C.
[0323] The PCR product (SEQ. ID 4) was purified by agarose gel electrophoresis followed by gel extraction, and was blunt end ligated into the pJET1.2 cloning vector to form pJET1.2::CtHis-4HBT. The insert was then sub-cloned from pJET1.2::CtHis-4HBT into pET20b(+) in between the NdeI and XhoI restriction sites to form pET20b(+)::CtHis-4HBT. The E. coli BL21 (DE3) pLysS expression host was then transformed with pET20b(+)::CtHis-4HBT to form the C-terminal hexahistidine tagged 4HBT expression host, E. coli BL21 (DE3) pLysS pET20b(+)::CtHis-4HBT.
[0324] Pure carboxy-terminal His-tagged 4HBT enzyme was then prepared by first growing cultures of E. coli BL21 (DE3) pLysS pET20b(+)::CtHis-4HBT and inducing expression in the exact same manner as was performed for E. coli BL21 (DE3) pLysS pET20b(+)::4HBT. A sample from the culture taken 5.5 h after expression showed that the carboxy-terminal His-tagged 4HBT enzyme was also very soluble and was expressed at high levels. Cells were harvested by splitting the cell culture into three centrifuge tubes and centrifuging at 5000 g for 20 min at 4? C. Cell pellets were not washed though, and were instead directly stored at ?80? C. A cell free extract of carboxy-terminal hexahistidine tagged 4HBT was prepared by re-suspending one of the E. coli BL21 (DE3) pLysS pET20b(+)::CtHis-4HBT cell pellets in binding buffer (6 ml) for a Nickel-sepharose FPLC column. Binding buffer consisted of NaH.sub.2PO.sub.4 (10 mM), Na.sub.2HPO.sub.4 (10 mM), NaCl (500 mM), imidazole (30 mM) and was adjusted to pH 7.4 with HCl. Benzonase? nuclease (0.6 ?l) was added to the re-suspended cells before they were lysed in the Constant Systems One Shot cell disrupter. The cell lysate was then clarified by centrifugation at 18,000 g for 15 min at 4? C., followed by centrifugation of the supernatant at 57,750 g for 60 min at 4? C. This supernatant was then loaded onto a GE Healthcare HisTrap? FF Crude column (1 ml) that was equilibrated with binding buffer. Unbound proteins were washed off the column with five column volumes of binding buffer, and His-tagged protein was eluted with a linear imidazole concentration gradient, from 30 mM to 500 mM over 20 column volumes. Protein elution was monitored at 280 nm and fractions were checked for the presence and purity of carboxy-terminal His-tagged 4HBT by SDS-PAGE. Fractions containing pure CtHis-4HBT protein were pooled and a buffer exchange to replace the elution buffer with potassium phosphate assay buffer (100 mM, pH 7.5) was performed in a VivaSpin Viva6 10,000 Molecular Weight Cut-Off centrifugal concentrator. To perform the buffer exchange, the pooled fractions were centrifuged through the ultrafiltration membrane of the centrifugal concentrator at 10,000 g at 18? C. until the volume of the pooled fractions was reduced to 1 ml. The remaining protein fraction was diluted six-fold in the potassium phosphate assay buffer and the samples concentrated by further centrifugation through the ultrafiltration membrane under the same conditions until a six-fold volume reduction was achieved. The latter dilution in potassium phosphate assay buffer and re-concentration was performed once more and the concentration of CtHIS-4HBT protein was determined by UV.sub.280 absorbance in a NanoDrop ND1000 spectrophotometer, using a molar extinction coefficient of 20970M.sup.?1.Math.cm.sup.?1 and a molecular weight of 17516.5 mg.Math.mmol.sup.?1 for the carboxy-terminal His-tagged 4HBT enzyme. The values for the molar extinction coefficient and molecular weight were determined using the Expasy ProtParam tool, using the amino acid translation of the gene sequence encoding the carboxy-terminal his tagged 4HBT enzyme (SEQ. ID 5) in the pET20b(+)::CtHis-4HBT plasmid.
[0325] Kinetic characterisation of the purified carboxy-terminal hexahistidine tagged 4HBT enzyme was performed for the methacrylyl-CoA that was previously prepared, and for isobutyryl-CoA (Purchased from Sigma Aldrich as isobutyryl-CoA lithium salt).
[0326] Methacrylyl-CoA hydrolysis reactions (200 ?l) were performed in Nunc 96 well plates using purified CtHis-4HBT protein (0.075 mg.Math.ml.sup.?1) and DTNB (0.5 mM) to monitor the reaction. Initial rates were determined for methacrylyl-CoA starting concentrations of 0.375 mM, 0.3 mM, 0.225 mM, 0.15 mM and 0.075 mM. The reactions were started by the addition of enzyme.
[0327] Isobutyryl-CoA hydrolysis reactions (200 ?l) were also performed in Nunc 96 well plates, using purified CtHIS-4HBT protein (1 mg.Math.ml.sup.?1) and DTNB (0.5 mM) to monitor the reaction. Initial rates were determined for isobutyryl-CoA starting concentrations of 0.5 mM, 0.4 mM, 0.3 mM, 0.2 mM and 0.1 mM. The reactions were again started by the addition of enzyme.
[0328] Lineweaver-Burke plots were plotted for the kinetic characterisation of both methacrylyl-CoA (
[0329] Thus, it has been demonstrated that 4HBT catalyses hydrolysis of methacrylyl CoA and can be used to produce methacrylic acid. Since 4HBT hydrolyses methacrylyl-CoA with lower K.sub.M values and higher V.sub.max values than for isobutyryl-CoA, the hydrolysis of methacrylyl-CoA by 4HBT is advantageously highly selective.
1.4 Example 2Formation of Methacrylyl-CoA and Methacrylic Acid from Isobutyryl-CoA
[0330] The enzyme short chain acyl-CoA oxidase (ACX4) from Arabidopsis thaliana (Genbank accession number AB017643.1, Uniprot accession number Q96329, EC number 1.3.3.6) was identified through a literature search as an acyl-CoA oxidase enzyme with detectable activity on isobutyryl-CoA as a substrate when expressed in insect cell lines.
[0331] To determine whether this oxidase could be functionally expressed in Escherichia coli with useful levels of activity on isobutyryl-CoA as a substrate for its integration into a metabolic pathway, a gene encoding the amino acid sequence for ACX4 was codon optimised for expression in E. coli by Life Technologies with an NdeI restriction site integrated at the 5 end and a XhoI restriction site at the 3 end.
[0332] The synthesised polynucleotide (SEQ. ID 6) was delivered in the ?MA-RQ::ACX4 plasmid and the gene insert was subcloned into a previously linearised pET20b(+) vector, at the NdeI and XhoI restriction sites, to form pET20b(+)::ACX4. The newly constructed pET20b(+)::ACX4 plasmid was then transformed into E. coli BL21 (DE3) pLysS to form E. coli BL21 (DE3) pLysS pET20b(+)::ACX4.
[0333] In order to test the expression of ACX4, an MSX starter culture supplemented with carbenicillin and chloramphenicol was inoculated with a single colony of E. coli BL21 (DE3) pLysS pET20b(+)::ACX4 from an LB agar plate that was supplemented with glucose, chloramphenicol and carbenicillin. The starter culture (20 ml) was incubated at 37? C. with shaking at 200 rpm for 16 h. The cells were harvested from the starter culture by centrifugation at 5000 g for 15 min at 4? C. and then re-suspended into a fresh MSX media intermediate culture (100 ml) that was also supplemented with chloramphenicol and carbenicillin. The intermediate culture was incubated at 37? C. with shaking at 200 rpm until an OD.sub.600 of 1.0. The cells were then harvested from the intermediate culture by centrifugation at 5000 g for 15 min at 4? C. and re-suspended into a fresh MSX culture (1 L) supplemented with chloramphenicol, carbenicillin and also with riboflavin, in a 2.5 L baffled shake flask. The culture was incubated at 37? C. with shaking at 200 rpm until an OD.sub.600 of 0.7 and expression was then induced by the addition of IPTG to a final concentration of 0.4 mM. The culture was incubated for a further 7 h under the same conditions before cells were split into three centrifuge tubes and harvested by centrifugation at 5000 g for 20 min at 4? C. A sample of the culture taken prior to the cells being harvested and was analysed by SDS-PAGE, which showed the ACX4 protein to be well expressed and for approximately one third of the ACX4 protein to lie in the soluble fraction and two thirds in the insoluble fraction. The cell pellets were washed three times in HEPES buffer (50 mM) that was adjusted to pH 7.5 with KOH. The cell pellets were frozen at ?80? C. until lysed. The process was repeated for the E. coli BL21 (DE3) pLysS pET20b(+) negative control strain.
[0334] To prepare a cell free extract of the ACX4 enzyme, one of the cell pellets that was prepared previously was re-suspended in HEPES (50 mM, pH 7.5) buffer (6 ml) that was supplemented with flavin adenine dinucleotide (FAD) at a final concentration of 10 ?M. The re-suspended cells were then lysed in a Constant Systems One Shot cell disrupter. The lysate was centrifuged at 18,000 g for 15 min at 4? C. and the supernatant of this was further centrifuged at 57,750 rpm for 60 min at 4? C. The supernatant was concentrated in a VivaSpin Viva6 10,000 Molecular Weight Cut-Off centrifugal concentrator, centrifuging at 10,000 g at 18? C. until a six-fold volume reduction of the retentate. The retentate was washed once by a six-fold re-dilution in HEPES buffer (50 mM, pH 7.5) that was again supplemented with FAD (10 ?M), followed by a second concentration step in the centrifugal concentrator through a six-fold volume reduction. The total protein concentration in the retentate was determined using the BioRad DC protein assay kit, using bovine serum albumin as the protein standard.
[0335] An analytical HPLC method was developed to resolve isobutyryl-CoA (IB-CoA), methacrylyl-CoA (MAA-CoA), flavin adenine dinucleotide (FAD), methacrylic acid (MAA) and coenzyme A (CoA-SH). Coenzyme A, methacrylyl-CoA and isobutyryl-CoA eluted at 11.0 min, 30.8 min and 32.2 min respectively. Coenzyme A, methacrylyl-CoA and isobutyryl-CoA each had a small tailing (minor) peak assocated with the main peak at 12 min, 31.6 min and 32.9 min, respectively (
[0336] To ensure that coenzyme A, methacrylic acid, isobutyryl-CoA and methacrylyl-CoA were not be confused with peaks from the cell free extract, a no-substrate control was performed, using ACX4 cell free extract (0.8 mg.Math.ml.sup.?1), purified CtHis-4HBT (0.6 mg.Math.ml.sup.?1) and FAD (10 ?M) in HEPES buffer. No peaks were observed eluting at the coenzyme A, methacrylic acid, methacrylyl-CoA or isobutyryl-CoA elution times (
[0337] The activity test of ACX4 was performed in 1.5 ml micro-centrifuge tubes. Crude enzyme reactions consisted of cell free ACX4 protein extract (0.8 mg.Math.ml.sup.?1), isobutyryl-CoA (500 ?M) and flavin adenine dinucleotide (10 ?M) in HEPES buffer (50 mM, pH 7.5). The reaction was incubated at 30? C. in the 1.5 ml micro-centrifuge tube, with shaking at 250 rpm for 30 min and the final reaction product was analysed by analytical HPLC (
[0338] In order to confirm that the methacrylyl-CoA peak was genuine, and that it was not an isobutyryl-CoA peak with a shifted elution time, the sample was spiked with isobutyryl-CoA and analysed by HPLC again. ACX4 was inactivated when the sample was acidified and this ensured that any additional isobutyryl-CoA would not be converted to methacrylyl-CoA. Indeed, the isobutyryl-CoA spiked sample showed not only the original methacrylyl-CoA peak, but also an additional peak at 32 min with the characteristic tail peak of isobutyryl-CoA (
[0339] To determine whether methacrylic acid could be produced from isobutyric acid in an enzyme couple reaction, an experiment was established whereby crude ACX4 was incubated with purified CtHis-4HBT enzyme. The same cell free extract of ACX4 was used as the protein source for the ACX4, though pure CtHis-4HBT was prepared again, in the same manner as for its kinetic characterisation in example 1, but performing a buffer exchange into HEPES buffer (50 mM, pH 7.5) at the end, instead of the previously used phosphate buffer. Thus, crude ACX4 (0.8 mg.Math.ml.sup.?1) was co-incubated with pure CtHis-4HBT (0.6 mg.Math.ml.sup.?1) along with FAD (10 ?M) and isobutyryl-CoA (500 ?M) in HEPES buffer. The sample was incubated at 30? C. with shaking at 250 rpm for 30 min, and analysed by HPLC. Methacrylic acid and coenzyme A were the major products. The methacrylic acid peak was observed at 13.45 min whilst the coenzyme A major and minor peaks were observed at 11.1 min and 12.1 min, respectively. The concentration of methacrylic acid generated during the coupled enzyme reaction (
[0340] This confirms that ACX4 oxidises isobutyryl-CoA. It has further been demonstrated that the combination of ACX4 with 4HBT in vitro enables the conversion of isobutyryl-CoA to methacrylic acid to industrially applicable levels.
1.5 Example 3a Whole Cell Biotransformation of Isobutyric Acid to Methacrylic Acid
[0341] Further biotransformation of isobutyric acid to methacrylic acid using an acyl-CoA synthetase to activate isobutyric acid with coenzyme A to form isobutyryl-CoA is shown in the present example, and for the acyl-CoA oxidase ACX4 from Arabidopsis thaliana to oxidise isobutyryl-CoA to methacrylyl-CoA as well as for the acyl-CoA thioesterase 4HBT from Arthrobacter sp. strain SU to hydrolyse methacrylyl-CoA to methacrylic acid and coenzyme A is also shown.
[0342] The acyl-CoA synthetase AcsA from Pseudomonas chlororaphis B23 (Genbank accession number: BAD90933.1, uniprot accession number: Q5CD72) was identified from a database and literature search as an AMP-forming acyl-CoA synthetase capable of activating isobutyric acid to isobutyryl-CoA, with a published Michaelis constant (K.sub.m) of 0.14 mM, and turnover number (k.sub.cat) of 10.6 s.sup.?1.
[0343] In this example, we demonstrate the construction of a pET20b(+) based vector, pET20b(+)::4HBT-ACX4-AcsA, for the co-expression of the genes encoding 4HBT, ACX4 and AcsA from a single operon under the control of the T7 promoter of pET20b(+), and its use to encode the metabolic pathway for the whole cell biotransformation of isobutyric acid to methacrylic acid.
[0344] The construction of the operon was performed in two stages. The first stage comprised the construction of a pET20b(+) based vector, pET20b(+)::4HBT-ACX4, for the co-expression of the genes encoding just 4HBT and ACX4, whilst the second stage involved sub-cloning the gene encoding AcsA into the pET20b(+)::4HBT-ACX4 vector, with its own ribosome binding site in place, in order to construct the final pET20b(+)::4HBT-ACX4-AcsA plasmid.
[0345] In order to construct the pET20b(+)::4HBT-ACX4 vector, the genes encoding 4HBT and ACX4 were first conjoined into a single polynucleotide, with a new ribosome binding site between the gene encoding 4HBT and that encoding ACX4, in order to ensure efficient translation of the latter. To conjoin the two genes together, an overlap extension polymerase chain reaction was performed. The overlap extension polymerase chain reaction was itself performed in two steps. First, the genes encoding 4HBT and ACX4 were amplified out of their respective expression vectors, pET20b(+)::4HBT and pET20b(+)::ACX4, in two separate polymerase chain reactions, reactions A and B.
[0346] The primers used for the overlap extension polymerase chain reaction were primer OE.A.F (SEQ. ID 7), the forward primer for overlap extension polymerase chain reaction A; primer OE.A.R (SEQ. ID 8), the reverse primer for polymerase chain reaction A; primer OE.B.F (SEQ. ID 9), the forward primer for overlap extension polymerase chain reaction B and finally, OE.B.R (SEQ. ID 10), the reverse primer for overlap extension polymerase chain reaction B. The overhang of primer OE.A.F was designed to maintain an NdeI restriction site at the 5 end of the new polynucleotides. The overhangs of primers OE.A.R and OE.B.F were designed to contain complementary sequences to each other in order to enable the concatenation of the two PCR products from reactions A and B. The complementary sequence was designed such that on the concatenation of the two PCR products, an intergenic sequence between the 4HBT gene and the ACX4 gene would be introduced, containing a new ribosome binding site for the latter gene. Finally, the overhang of primer OE.B.R was designed to contain two restriction sites, an NheI restriction site and a XhoI restriction site. This allowed for the concatenated polynucletide containing the 4HBT and ACX4 genes to be cloned into the pET20b(+) plasmid at its NdeI and XhoI restriction sites to form pET20b(+)::4HBT-ACX4 and for the AcsA gene to be cloned into the pET20b(+)::4HBT-ACX4 plasmid in between the NheI and XhoI restriction sites to form the pET20b(+)::4HBT-ACX4-AcsA plasmid. An adenine and thymine rich spacer sequence was included between the NheI and XhoI restriction sites in primer OE.B.R to lower the annealing temperature of the primer such that it closer matched those of the other primers, and to enable efficient double digestion at the adjacent NheI and XhoI restriction sites.
[0347] Polymerase chain reaction A (50 ?l) contained pET20b(+)::4HBT (10 pg.Math.?l.sup.?1) as the template DNA, KOD DNA polymerase (1 unit), primer OE.A.F (0.4 ?M), primer OE.A.R (0.4 ?M), deoxyadenosinetriphosphate (dATP) (0.2 mM), deoxythymidine triphosphate (dTTP) (0.2 mM), deoxycytidinetriphosphate (dCTP) (0.2 mM), deoxyguanosinetriphosphate (dGTP) (0.2 mM), MgCl.sub.2 (1 mM) and Novagen buffer for KOD DNA polymerase (1?).
[0348] Polymerase chain reaction B (50 ?l) was composed of pET20b(+)::ACX4 (20 pg.Math.?l.sup.?1) as template DNA, KOD DNA polymerase (1 unit) primer OE.B.F (0.4 ?M), primer OE.B.R (0.4 ?M), dATP (0.2 mM), dTTP (0.2 mM), dCTP (0.2 mM), dGTP (0.2 mM), MgCl.sub.2 (1 mM) and Novagen buffer for KOD DNA polymerase (1?).
[0349] Both PCR reactions were performed in parallel and under the same conditions, commencing with an initial denaturation step at 95? C. for 3 min, followed by 25 cycles consisting of a 15 s denaturation step at 98? C., a 2 s annealing step at 50? C. and a 20 s extension step at 72? C. These 25 cycles were followed by a further 5 min extension step at 72? C. The two double stranded PCR products, product A and product B, were purified by agarose gel electrophoresis and gel extraction, and their concentrations determined by analytical agarose gel electrophoresis.
[0350] PCR products A and B were then concatenated in a second polymerase chain reaction consisting of PCR product A (15 nM), PCR product B (15 nM), dATP (0.2 mM), dTTP (0.2 mM), dCTP (0.2 mM), dGTP (0.2 mM), MgCl.sub.2 (1 mM), Novagen Buffer #1 for KOD DNA polymerase (1?), dimethylsulfoxide (5% (v/v)) and KOD DNA polymerase (8 nl/?l). The reaction was performed in a thermocycler programmed to start at 95? C. for 3 min and continue with 15 cycles of a 15 s denaturation step at 98? C., a 2 s annealing step at 50? C. and a 20 s extension step at 72? C., and to finally end with a further extension step lasting 5 min at 72? C.
[0351] After this PCR program, the outer forward primer and the outer reverse primer used in the amplification of A and B, respectively, were added directly from a concentrated stock (50 ?M) to a final concentration of 0.5 ?M. The modified PCR reaction mixture was then subjected to another round of PCR, with the thermocycler programmed to commence with an initial 3 min melting step at 95? C., and continue with 15 cycles consisting of a melting step lasting 15 s at 98? C., an annealing step lasting 2 s at 55? C. and an extension step lasting 20 s at 72? C., before finishing with a further extension step lasting 5 min at 72? C.
[0352] The product of this concatenation step (SEQ. ID 11) was purified by agarose gel electrophoresis and gel extraction, and was blunt end ligated into the pJET1.2 cloning vector to form pJET1.2::4HBT-ACX4. The polynucleotide containing the concatenated 4HBT and ACX4 genes were then sub-cloned into pET20b(+), forming pET20b(+)::4HBT-ACX4. The pET20b(+)::4HBT-ACX4 plasmid was then linearised by restriction digestion at the NheI and XhoI restriction sites.
[0353] For the next phase in the construction of the pET20b(+)::4HBT-ACX4-AcsA plasmid, a gene encoding the amino acid sequence of AcsA was codon optimised for expression in E. coli and synthesised by Biomatik corporation with a XhoI restriction site appended to the 3 end, and a short sequence appended to the 5 end. This sequence contained an NheI restriction site, a ribosome binding site, and a spacer sequence ending in a cytosine-adenine-thymine trinucleotide, which together with the start codon of AcsA encoded an NdeI restriction site.
[0354] The synthesised codon optimised AcsA polynucleotide (SEQ. ID 12) was delivered in the pBMH::AcsA cloning plasmid and the AcsA gene was sub-cloned along with its 5 ribosome binding site into the linearised pET20b(+)::4HBT-ACX4 vector, between the NheI and XhoI restriction sites, forming the pET20b(+)::4HBT-ACX4-AcsA plasmid (
[0355] In order to construct a strain for the expression of just the AcsA gene, the AcsA gene alone was sub-cloned out of the pBMH::AcsA cloning vector and into the pET20b(+) plasmid, in between the NdeI and XhoI restriction sites, forming pET20b(+)::AcsA. The pET20b(+)::AcsA plasmid was then transformed into E. coli BL21 (DE3) pLysS, forming E. coli BL21 (DE3) pLysS pET20b(+)::AcsA.
[0356] The co-expression of 4HBT, ACX4 and AcsA by E. coli BL21 (DE3) pLysS pET20b(+)::4HBT-ACX4-AcsA was confirmed by incubating cultures (100 ml) of E. coli BL21 (DE3) pLysS pET20b(+)::4HBT-ACX4-AcsA in MSX media supplemented with riboflavin (1 mg.Math.L.sup.?1) at two different test temperatures, 37? C. and 28? C. Cultures were grown to an OD.sub.600 of 0.5 and expression was induced with the addition of IPTG (0.4 mM). Samples were taken just prior to the induction of expression, as well as 1 h, 3 h, 5 h and 20 h post induction. Control strains E. coli BL21 (DE3) pLysS pET20b(+)::ACX4, as prepared in example 2, and E. coli BL21 (DE3) pLysS pET20b(+)::AcsA were also cultured under the same conditions. Samples taken during the co-expression of 4HBT, ACX4 and AcsA in E. coli BL21 (DE3) pLysS pET20b(+)::4HBT-ACX4-AcsA, as well as those taken during the expression of just ACX4 in E. coli BL21 (DE3) pLysS pET20b(+)::ACX4 and AcsA in E. coli BL21 (DE3) pLysS pET20b(+)::AcsA were analysed by sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE).
[0357] Analysis by SDS-PAGE (
[0358] To test the ability of E. coli BL21 (DE3) pLysS pET20b(+)::4HBT-ACX4-AcsA to convert isobutyric acid to methacrylic acid, an MSX pre-culture (20 ml), supplemented with carbenicillin and chloramphenicol, was inoculated from a single colony of E. coli BL21 (DE3) pLysS pET20b(+)::4HBT-ACX4-AcsA on an LB agar plate supplemented with glucose carbenicillin and chloramphenicol, and was incubated at 37? C. with shaking at 200 rpm for 16 h. The cells were harvested by centrifugation at 5000 g for 15 min at 4? C., and the cells were re-suspended in MSX media (100 ml) supplemented with carbenicillin, chloramphenicol and riboflavin, in a 250 ml shake flask and this culture was incubated at 37? C. with shaking at 200 rpm. The co-expression of genes was induced with the addition of IPTG (0.4 mM) at an OD.sub.600 of 0.5. The culture was incubated for a further 1 h prior to the addition of potassium isobutyrate (pH 7.0) from a concentrated stock concentration of 500 mM to a final concentration of 5 mM in the culture media. Samples were taken immediately after the addition of isobutyric acid (0 h sample) and then at 1 h, 2 h, 4 h, 6 h, 8 h and 19.5 h after that.
[0359] Samples taken throughout the biotransformation of isobutyric acid to methacrylic acid were centrifuged in an Eppendorf miniSpin F-45-12-11 rotor for 5 min at 6000 rpm. The supernatants were filtered through 0.2 ?m Sartorius RC 4 mm filters and then acidified to pH2.5 with 5M HCl.
[0360] Acidified supernatant was injected onto an Agilent Zorbax Eclipse XDB C18 column (4.6 mm?150 mm). HPLC was performed at 0.4 ml.Math.min.sup.?1 and methacrylic acid was resolved from isobutyric acid by an isocratic elution with 14% acetonitrile in KH.sub.2PO.sub.4 that was adjusted to pH 2.5 with HCl. The column was washed between runs by increasing the flowrate to 1 ml.Math.min.sup.?1 and the acetonitrile concentration to 75% for 15 min before the conditions were returned to a flow-rate of 0.4 ml.Math.min.sup.?1 and 14% acetonitrile for the next sample. The column was allowed allowed to equilibrate for 20 min prior to the injection of next sample.
[0361] Three negative controls were also performed and analysed. The first control was the negative control strain, E. coli BL21 (DE3) pLysS pET20b(+), which did not contain the 4HBT-ACX4-AcsA co-expression operon and was cultured with no isobutyric acid added to the media after IPTG was added to culture media. The second control used the same strain as that used in the first control, but isobutyric acid (5 mM) was added 1 h after the addition of IPTG to the culture media. The third control used the same E. coli BL21 (DE3) pLysS pET20b(+)::4HBT-ACX4-AcsA as used in the main biotransformation culture, but no isobutyric acid was added to the culture media after the co-expression of 4HBT, ACX4 and AcsA was induced.
[0362] A summary of the HPLC traces observed in
[0363]
[0364] In this example, a whole cell process to convert isobutyric acid feedstock to methacrylic acid at industrially applicable levels has been demonstrated, by co-expressing 4HBT, ACX4 and AcsA in vitro in recombinant E. coli.
1.6 Example 4Formation of Methacrylic Acid from Glucose
[0365] The branched chain keto acid dehydrogenase complex from Pseudomonas putida KT2440 was previously shown to catalyse the oxidative decarboxylation of 2-ketoisovaleric acid to isobutyryl-CoA in a recombinant metabolic pathway for the production of isobutyric acid in E. coli (Zhang, K., Xiong, M. and Woodruff, A. P. 2012, Cells and methods for producing isobutyric acid, International Patent Number WO 2012/109534 A2). The genes encoding the branched chain keto acid dehydrogenase alpha subunit (bkdA1), the branched chain keto acid dehydrogenase beta subunit (bkdA2), the lipoamide acyltransferase component (bkdB) and the lipoamide dehydrogenase component (IpdV) of the branched chain keto acid dehydrogenase complex are grouped adjacent to each other and are all found under the control of a single promoter in the Pseudomonas putida KT2440 genomic DNA (genbank accession number AE015451.1).
[0366] The entire wild-type sequence encoding bkdA1, bkdA2, bkdV and IpdV genes, as they appeared in the Pseudomonas putida KT2440 genomic DNA between nucleotides 4992042 and 4996988, was synthesised by Biomatik corporation as a single, ppBCKD, polynucleotide (SEQ. ID 14). The ppBCKD polynucleotide contained a XhoI restriction site at the 3 end, and a short sequence at the 5 end, immediately prior to the start codon of the bkdA1 gene. This 5 appended sequence contained an XbaI restriction site, a spacer sequence, an NheI restriction site, a ribosome binding site, and a second spacer sequence. The XbaI site was included to enable the insertion of the ppBCKD polynucleotide into the pET20b(+) plasmid for the construction of pET20b(+)::ppBCKD, capable of expressing just the four genes of the Pseudomonas putida KT2550 branched chain keto acid dehydrogenase. The first spacer sequence was included in order to maintain the same number of base-pairs between the T7 promoter and the ribosome binding site in the pET20b(+)::ppBCKD plasmid as exists in the pET20b(+) plasmid, and with the exception of the six nucleotides encoding the NheI site just prior to the ribosome binding site, the spacer sequence is identical to that between the XbaI site and the ribosome binding site in the pET20b(+) plasmid. The NheI restriction site was included to enable the insertion of the ppBCKD polynucleotide into the pET20b(+)::4HBT-ACX4 plasmid to construct the pET20b(+)::4HBT-ACX4-ppBCKD plasmid. The ribosome binding site and the spacer sequence were identical to those used just prior to the bkdA1 gene when the BCKD genes were expressed for the production of isobutyric acid that was previously reported (Zhang, K., Xiong, M. and Woodruff, A. P. 2012, Cells and methods for producing isobutyric acid, International Patent Number WO 2012/109534 A2).
[0367] The single polynucleotide containing the four genes of the Pseudomonas putida KT2440 branched chain keto acid dehydrogenase was delivered in the pBSK plasmid (pBSK::ppBCKD). The four genes were sub-cloned out of the pBSK::ppBCKD plasmid and into the pET20b(+)::4HBT-ACX4 plasmid from example 2, in between the NheI and XhoI restriction sites, to form pET20b(+)::4HBT-ACX4-ppBCKD (
[0368] An MSX pre-culture (10 ml) supplemented with carbenicillin and chloramphenicol was inoculated with E. coli BL21 (DE3) pLysS pET20b(+)::4HBT-ACX4-ppBCKD from a single colony on an LB agar plate supplemented with glucose, carbenicillin and chloramphenicol. Cultures were incubated at 37? C. with shaking at 250 rpm for 16 h. The cells were harvested by centrifugation at 5000 g for 15 min at 4? C. and then re-suspended in fresh MSX media (100 ml) which was supplemented with riboflavin as well as carbenicillin and chloramphenicol, in a 500 ml shake flask. The fresh cultures were incubated at 37? C. with shaking at 250 rpm and expression was induced in each culture at an OD.sub.600 of 0.5 by the addition of IPTG (0.4 mM). The cultures were incubated for a further 17 h before samples were taken for analysis by reverse phase high performance liquid chromatography (RP-HPLC). A repeat culture was performed for the E. coli BL21 (DE3) pLysS pET20b(+) negative control culture.
[0369] Samples were centrifuged in an Eppendorf miniSpin F-45-12-11 rotor for 5 min at 6000 rpm. The supernatants were filtered through 0.2 micron Sartorius RC 4 mm filters and then acidified to pH2.5 with 5M HCl. Acidified supernatant was injected onto an Agilent Zorbax Eclipse XDB C18 column (4.6 mm?250 mm). HPLC was performed at 1 ml.Math.min.sup.?1 and analytes were eluted by isocratic elution with 14% acetonitrile in 50 mM KH.sub.2PO.sub.4 that was adjusted to pH 2.5 with HCl. The column was washed between runs by increasing the acetonitrile concentration to 75% for 15 min before being returned to 14% acetonitrile for a 20 min re-equilibration step.
[0370] Standards of methacrylic acid (0.2 mM), isobutyric acid (5 mM) and 2-ketoisovaleric acid (5 mM) eluted at 3.6 min, 8.3 min and 8.6 min, and with peak areas 5980 mAU.Math.min, 330 mAU.Math.min and 1580 mAU.Math.min, respectively. The HPLC analysis of a cocktail of 2-ketoisovaleric acid (5 mM), isobutyric acid (5 mM) and methacrylic acid (200 ?M) is shown in
[0371] The HPLC analysis of the sample taken from the E. coli BL21 (DE3) pLysS pET20b(+) negative control culture, show in
[0372] To confirm that the peak was indeed representative of methacrylic acid, the sample was spiked with an additional 0.24 mM of methacrylic acid from a 10 mM stock solution, and this spiked sample was also analysed by HPLC, show in
[0373] To determine whether supplementing the cultures with 2-ketoisovaleric acid could boost methacrylic acid production, two MSX pre-cultures (10 ml) supplemented with carbenicillin and chloramphenicol were again prepared, inoculating one with E. coli BL21 (DE3) pLysS pET20b(+)::4HBT-ACX4-ppBCKD and the other with E. coli BL21 (DE3) pLysS pET20b(+) as before. The pre-cultures were incubated at 37? C. with shaking at 250 rpm for 16 h before the cells were pelleted and re-suspended in fresh MSX media (100 ml) supplemented with riboflavin, chloramphenicol and carbenicillin, in a 500 ml shake flask. Expression was induced in each culture at an OD.sub.600 of 0.5 by the addition of IPTG (0.4 mM), and cultures were incubated for a further 3 h prior to the addition of 2-ketoisovalerate (pH 7.0) to a final concentration of 5 mM in each culture. The cultures were incubated for a further 14 h. Culture samples were taken and analysed by high performance liquid chromatography with isocratic elution as described for the cultures that were not supplemented with 2-ketoisovaleric acid.
[0374] The HPLC analysis of the sample taken 14 h after 2-ketoisovalerate was added to the empty E. coli BL21 (DE3) pLysS pET20b(+) negative control culture, shown in
[0375] When the sample taken 14 h after 2-ketoisovalerate was added to the culture expressing the genes for the conversion of 2-ketosivaleric acid to methacrylic acid, the E. coli BL21 (DE3) pLysS pET20b(+)::4HBT-ACX4-ppBCKD culture, a peak at 8.4 min with peak area 1890 mAU.Math.min appeared on the HPLC trace (
[0376] The sample was spiked with an additional 0.24 mM methacrylic acid and the analysis of the spiked sample (
[0377] In this example, the branched chain keto acid dehydrogenase, namely BCKD from Pseudomonas putida KT2440, was co-expressed with an acyl-CoA oxidase, namely ACX4 from Arabidopsis thaliana, and a thioesterase enzyme, namely 4HBT from Arthrobacter sp. strain SU in a cellular system. It was demonstrated that production of methacrylic acid from a key feedstock like glucose which is readily available from biomass using recombinant E. coli is possible, and furthermore that production of said methacrylic acid can be boosted by supplementing the growth medium with 2-ketoisovaleric acid.
1.7 Example 5: The Whole Cell Production of Butyl Methacrylate from 2-Ketoisovalerate by Recombinant Escherichia coli
[0378] The ACX4 gene from A. thaliana was codon-optimized for E. coli, synthesized and cloned into pET16b (Sse) vector. The gene was digested with NheI/Sse8387I and ligated into pET16b (Sse) digested with XbaI/Sse8387I. The resultant plasmid, pMMA121 (see
[0379] Cells were harvested by centrifuge and suspended in 0.1M sodium phosphate buffer (pH7.0), then disrupted by sonication. The disrupted E. coli cells were centrifuged to supernatant and pellet fractions, and both the vector control and the cells containing pMMA121 were analysed for ACO (acyl-CoA oxidase) activity (see
[0382] A plasmid for expressing BCKAD, AAT and ACX4 were constructed as follows. Plasmid pMMA133 was digested with restriction enzymes SpeI and Sse8387I, and the linearized DNA fragment was obtained. Plasmid pWA008 was digested with restriction enzymes XbaI and Sse8387I and the 5.0 kb fragment containing BCKAD complex gene was isolated. Both fragments were ligated using DNA Ligation Kit Mighty Mix (manufactured by Takara Bio Inc.). The resultant plasmid pMMA134 (see
[0383] E. coli BL21(DE3)/pMMA134 was cultured in essentially the same manner as described above in relation to expression of ACX4. Cells were harvested by centrifuge, washed with 0.1M sodium phosphate buffer (pH7.0) and suspended in the same buffer to obtain cell suspension. By using the cell suspension, about 1 ml of a resting cell reaction solution was prepared in each vial, which contained 40 mM 2-ketoisovalerate (2-oxoisovalerate), 60 mM butanol, 0.05 M sodium phosphate buffer (pH7.0) and cells (OD.sub.650=12.5). The reactions were carried out at 30? C., 180 rpm for 3 to 44 hours, and 1 ml acetonitrile was added to the vials and mixed well for stopping the reaction. After filtration using a syringe filter DISMIC/hole diameter 0.45 micron (manufactured by ADVANTEC), analysis was made by HPLC on ODS column.The HPLC conditions were as follows: Apparatus: Waters 2695, Column: CAPCELL PAK C18 UG120, 2.0 mml.Math.D.?250 mm, Mobile phase: 0.1% phosphoric acid/65% methanol, Flow amount: 0.25 ml/min, Run time: 12 min, Column temperature: 35C and Detection: UV 210 nm.
[0384] This example demonstrates viable in vivo production of a derivative of methacrylic acid, the methacrylate ester butyl methacrylate, from the biochemical intermediate 2-ketoisovalerate (2-oxoisovalerate) which is produced directly from glucose, and the reagent butanol which is a common industrial feedstock. The production of butyl methacrylate is demonstrated at industrially applicably levels from culturing of recombinant E. coli cell expressing the BCKAD operon to convert 2-ketoisovalerate into isobutyryl CoA, ACX4 oxidase to convert isobutyryl coA into methacrylyl coA, and AAT to convert methacrylyl CoA into butyl methacrylate by reaction with butanol.
[0385] Attention is directed to all papers and documents which are filed concurrently with or previous to this specification in connection with this application and which are open to public inspection with this specification, and the contents of all such papers and documents are incorporated herein by reference.
[0386] All of the features disclosed in this specification (including any accompanying claims, abstract and drawings), and/or all of the steps of any method or process so disclosed, may be combined in any combination, except combinations where at least some of such features and/or steps are mutually exclusive.
[0387] Each feature disclosed in this specification (including any accompanying claims, abstract and drawings) may be replaced by alternative features serving the same, equivalent or similar purpose, unless expressly stated otherwise. Thus, unless expressly stated otherwise, each feature disclosed is one example only of a generic series of equivalent or similar features.
[0388] The invention is not restricted to the details of the foregoing embodiment(s). The invention extends to any novel one, or any novel combination, of the features disclosed in this specification (including any accompanying claims, abstract and drawings), or to any novel one, or any novel combination, of the steps of any method or process so disclosed.