IMPROVEMENTS IN AND RELATING TO NUCLEIC ACID PROBES AND HYBRIDISATION METHODS
20180171398 ยท 2018-06-21
Assignee
Inventors
Cpc classification
C12Q2563/125
CHEMISTRY; METALLURGY
C12Q2563/131
CHEMISTRY; METALLURGY
International classification
Abstract
The invention provides a method of nucleic acid sequence hybridisation comprising the steps of: a) hybridising one or more samples comprising nucleic acids containing a region of interest with at least one probe nucleic acid sequence; and b) adding to the samples a non-deoxy ribonucleic acid molecule, before or during step a). and use of non-deoxy ribonucleic molecules to block or mask a surface or to block or mask repetitive DNA sequences.
Claims
1: A method of blocking or masking repetitive DNA sequences wherein the method comprises mixing sample derived nucleic acids that include a region of interest with non-deoxy ribonucleic molecules comprising the same or substantially similar repetitive sequences.
2: A method of blocking or masking a surface comprising contacting the surface with non-deoxy ribonucleic acid molecules.
3: A method of nucleic acid sequence hybridisation comprising the steps of: a) hybridising one or more samples comprising nucleic acids containing a region of interest with at least one probe nucleic acid sequence; and b) adding to the samples a non-deoxy ribonucleic acid molecule, before or during step a).
4: A method of hybridisation of sample derived nucleic acid containing one or more sequence regions of interest, the method comprising the step of hybridising each sample material to a plurality of non-overlapping nucleic acid probes.
5: A method as claimed in claim 3, wherein at least one probe is a probe comprising multiple labels.
6: A method as claimed in claim 3 wherein step a) comprises hybridising the nucleic acid sequence with a plurality of probes.
7: A method as claimed in claim 1 wherein the non-deoxy ribonucleic acid molecules comprise an RNA transcription product, preferably transcribed from genomic DNA sequences from the same species as the sample being processed.
8: A method as claimed in claim 7 wherein the RNA transcription product comprises a transcription product of one or more fragments of human genomic DNA, human Cot-1 DNA or salmon DNA.
9: A method as claimed in claim 3 wherein each probe comprises at least 35 nucleic acid bases.
10: A method as claimed in claim 3 wherein the method comprises a method of hybridisation target enrichment, wherein each sample derived nucleic acid comprises a region of interest fragmented into a plurality of sequence fragments, with the method comprising the step of hybridising the fragments to a plurality of non-overlapping probes.
11: A method as claimed in claim 3 comprising a method of detection of sequences from a region of interest, comprising the step of hybridising each sample sequence to a plurality of substantially non-overlapping probes.
12: A method as claimed in claim 3 wherein the method comprises hybridising at least 3 substantially non-overlapping probes per 1 kb of nucleic acid target region of interest.
13: A method as claimed in claim 3 wherein the sequences represented in the probes correspond to and so can hybridise to at least 50% of the region of interest.
14: A method as claimed in claim 3 wherein the sequence of at least one of the probes partly corresponds to region of interest sequences next to a junction between a part of the region of interest and a neighbouring region of non-interest, and also partly corresponds to sequences as far as 300 bp into this region of non-interest.
15: A method as claimed in claim 14 wherein the sequence of at least one of the probes partly corresponds to region of interest sequences and also partly corresponds to sequences as far as 300 bp into a flanking region of non-interest.
16: A method as claimed in claim 3 further comprising immobilising the probes onto a surface to provide a plurality of immobilised probes, then hybridising the immobilised probes with one or more sample derived nucleic acids containing one or more regions of interest.
17: A method as claimed in claim 3 wherein the probes and sample containing one or more regions of interest are hybridised together in solution.
18: A method as claimed in claim 3 in which all of the probes being used in the method are non-overlapping.
19: A method as claimed in claim 3 wherein one or more sample derived nucleic acids containing one or more regions of interest are hybridised with a plurality of partially or completely overlapping probes in addition to a plurality of non-overlapping probes.
20: A target-probe duplex comprising a nucleic acid sequence representing a region of interest, or a fragment thereof, hybridised with a plurality of corresponding non-overlapping probes.
21. (canceled)
22: A target-probe duplex as claimed in claim 20 comprising a region of interest within a sample DNA fragment having at least 500 bases and at least three non-overlapping probes annealed thereto.
23: A probe comprising a nucleic acid sequence comprising a plurality of labels.
24: A probe as claimed in claim 23 comprising at least 10 labels per molecule.
25: A probe as claimed in claim 23 comprising a label within 10 bases from an end of the probe nucleic acid sequence.
26: A probe as claimed in claim 23 comprising a non-targeting sequence region at either or both ends that does not correspond to any region of interest sequence, arranged such that it will not hybridise specifically with a nucleic acid region of interest when used, the non-targeting end or ends including at least one label.
27: A probe as claimed in claim 23 wherein each label comprises a moiety that facilitates physical recovery, or a fluorescent moiety, or a luminescent moiety, or a radioactive moiety, or a combination thereof.
28: A probe as claimed in claim 23, wherein the or each marker label comprises biotin.
29: A method as claimed in claim 3, wherein at least one probe is a probe comprising a nucleic acid sequence comprising a plurality of labels.
30: A method as claimed in claim 29 comprising hybridising a plurality of overlapping probes, wherein at least one probe is a probe comprising a nucleic acid sequence comprising a plurality of labels, with the sample derived nucleic acid that includes a region of interest.
31. (canceled)
32: A method of amplification of nucleic acid probes comprising the steps of: a) providing between around 1 fg (femtogram) to around 500 pg (picogram), though preferably between around 1 pg to around 250 pg, of a complex pool of 1.5 kb long single-stranded, nucleic acid probes having at least one common sequence at their 5 ends and having at least one common sequence at their 3 ends, b) mass amplifying the nucleic acid sequences within the complex pool.
33. (canceled)
34: A method as claimed in claim 32, further comprising a step c) of hybridising the amplified probes with sample derived nucleic acids that include a region of interest.
35. (canceled)
36: A method as claimed in claim 4 further comprising the step of blocking or masking repetitive DNA sequences with a non-deoxy ribonucleic acid molecule.
37: A method as claimed in claim 36 wherein the non-deoxy ribonucleic molecule is an RNA transcription product transcribed from human Cot-1 DNA, human genomic DNA or salmon DNA.
38: A method as claimed in claim 1, comprising adding a mixture of two or more non-deoxy ribonucleic acid molecules.
39: A method as claimed in claim 38 wherein the mixture comprises a transcription product of mammalian genomic DNA and a transcription product of a DNA selected from fish, bird, reptile, amphibian, plant or fungus.
40: A method as claimed in claim 39 wherein the mixture comprises an RNA transcription product of human genomic DNA and an RNA transcription product of salmon DNA.
41: Use of non-deoxy ribonucleic molecules to block or mask a surface or to block or mask repetitive DNA sequences.
42. (canceled)
43: A target-probe duplex as claimed in claim 20, wherein at least one probe is a probe comprising a nucleic acid sequence comprising a plurality of labels.
Description
DETAILED DESCRIPTION OF THE INVENTION
[0081] Embodiments of the various aspects of the invention will now be described by way of example only, with reference to the accompanying drawings of which:
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
EXAMPLE 1IN-SOLUTION COMPLEX POOL PCR
[0090] An optimised method for the amplification of complex pools containing array-synthesised short (<200 bp) single-stranded DNA molecules was developed. A model pool (produced by conventional long oligonucleotide synthesis) was used to evaluate various reaction parameters. The model pool as shown in
Selecting a Suitable System for Complex Pool PCR
[0091] All PCRs were prepared on ice. 30-50 l PCRs contained 1 of the supplied PCR Buffer, 0.15 pmols/l ProAmpF04E, 0.15 pmols/l ProAmpR01D, 0.2 mM dNTPs, 0.025 U/l of the required DNA Polymerase, and the required mass of mixtures of full length and truncated single-stranded DNA molecules. Reactions were sealed with a heat sealable PCR film or PCR strip-caps (Thermo fisher Scientific, Loughborough, Leics, UK).
[0092] Optimal thermal cycling conditions were determined to entail the following: 98 C. for 30 sec, 5 (98 C. for 30 sec, 65 C. for 10 sec), 25 (unless stated elsewhere) (98 C. for 10 sec, 70 C. for 10 sec) 72 C. for 1 minute then held at 15 C. Following cycling, 10 l of the PCRs were subject to electrophoresis alongside 1 g 50 bp ladder (NEB, Hitchin, Herts, UK) on a 2.5% LE agarose gel stained with 0.2 g/ml EtBr. Completed PCRs were stored at 20 C. The 5 C. reduction in annealing temperature for the first 5 PCR cycles allowed the primers to initially anneal to the primer annealing sites <20 nt in length. Once these had been extended by polymerase extension, the annealing temperature could be raised to 70 C.
[0093] A wide range of DNA polymerases were evaluated including: Amplitaq Gold (Applied Biosciences), Pfu Ultra high fidelity DNA polymerase (Agilent), Phusion high fidelity DNA polymerase (NEB), iProof high fidelity DNA polymerase (BioRad) and Velocity (Bioline). These investigations showed that iProof High-Fidelity DNA polymerase (BioRad) worked particularly well for complex pool amplification, along with Phusion and Velocity.
[0094] These methods produced a robust and greatly improved method for complex pool amplification. But beyond the PCR conditions, other factors (complex pool quality and complex pool quantity) were also found to be of great importance, as described below.
EXAMPLE 2: EMULSION-BASED COMPLEX POOL PCR
[0095] Emulsion PCR (EMPCR) has been proposed as a means to improve troublesome PCRs, especially if they involve complex template DNA mixtures. EMPCR entails creating, in one tube, millions of femtolitre sized droplets of oil-coated water (including PCR buffer, primers etc), such that each of these volumes acts as a separate reaction vessel within which PCR amplification can occur starting from a few template molecules. Since this arrangement reduces the chances of cross-priming and other undesirable interactions between different templates and their products, there is theoretically a limited risk of generating many different false products. Also, should cross-priming occur, the encapsulation limits the resources available to the un-desirable product thus preventing over amplification. This does not, however eliminate the possibility of false internal priming within synthesized strands (by primers or products strands), or concatamerisation between single-stranded amplification products, within each sub-reaction. Nevertheless, EMPCR has been adopted by many researchers to try to improve the effectiveness of challenging complex pool amplifications in order to enhance product quality.
[0096] To test the actual effectiveness of EMPCR for complex pool amplification, 30 l PCRs were seeded with 10 ng of the model complex pools, and standard HF buffer (BioRad) was replaced with a detergent free formulation of the same buffer (BioRad) to prevent dispersal of the emulsion. Emulsification was performed by overlaying the reactions with 170 l of a pre-prepared and chilled mixture containing 73% Tegosoft DEC (Evonik, Essen, Germany) 3% Abil WE09 (Evonik, Essen, Germany) and 20% Light mineral Oil (Sigma Aldrich, Gillingham, Dorset, UK), followed by transfer into a 4 C. constant temperature room and shaking at maximum speed on a vortex device for 10 min. EMPCRs were then performed for 20 to 30 thermal cycles.
[0097] The emulsions were broken by addition of 500 l Butanol (Thermo Fisher Scientific) and the samples briefly vortexed. Then, 150 l of buffer PB (Qiagen, Crawley, West Sussex, UK) was added and mixed into each sample by brief vortexing. Products were recovered from the whole sample by purification upon Qiagen MinElute PCR columns according to the manufacturer's protocols. Purified reaction products were eluted in 30 l buffer EB (Qiagen).
[0098] Agarose gel electrophoretic analysis of the products revealed that the amplified DNA fragments were all of the desired size range (a single gel band), but that each 10 l PCR volume was able to generate only a few ng of material, no matter whether the reactions were seeded with a high quality (100% equivalent to 10 ng of amplifiable full-length molecules) or a low quality (0.1% equivalent to 100 pg of amplifiable full-length molecules) complex pool template.
[0099] Another downside with EMPCR relates to the unavoidable cost, time and complexity of the process of emulsion breaking and subsequent product purification. Solution phase PCRs can be de-salted and purified by running through a chromatography column (e.g., Microbiospin, BioRad) or micro filter column (e.g., Amicon Ultra, Millipore). But to purify EMPCRs, special columns are required to remove the emulsion oils. Such columns are more likely to allow passage of contaminants such as ethanol and chaotropic salts into the eluted product.
[0100] These results show that EMPCR can amplify 10 ng of a complex pool without generating excessive amounts of spurious product, however the poor PCR dynamics within the emulsion cause the approach to generate far too little material for the needs of most downstream applications.
EXAMPLE 3IMPROVED COMPLEX POOL PCR ACCORDING TO THE TENTH ASPECT OF THE INVENTION
[0101] Spurious products in complex pool PCR may be caused by over-cycling; especially since the problem worsens as the total number of thermal cycles increases. The concentration of genuine product will rise so high in the later cycles that DNA strands can; a) start to cross-prime onto each other, generating false longer products, and b) become available for internal priming by the common primers, generating false shorter products. However this hypothesis fails to explain why the same type of events would not also occur for many of the amplified target sequences within their individual droplets in EMPCR.
[0102] The problem may be triggered by events that occur towards the start rather than at the end of the PCR, especially in PCRs with an excessive starting concentration of complex single-stranded DNA molecules. These events then create a low background of various artefacts some of which could amplify as efficiently as genuine products, such that they come to dominate the genuine products as more and more reaction cycles are performed. The nature of these initial trigger events would also have to be such that they cannot occur (or are very much minimized) in the EMPCR context, wherein the target molecules are mostly isolated from one another into small clusters within the oil droplets.
[0103] A PCR seeded with 10 ng of human genomic DNA will have within it few free 3 ends and only 610.sup.3 amplifiable target strands (10 ng/3 pg (Mass of a single haploid genome)2 (to convert to single-stranded molecules)). In contrast, a PCR seeded with 10 ng of an complex pool of short single-stranded DNA molecules (which is perhaps up to 10% of the original pool that will have been supplied/purchased) will contain 210.sup.11 amplifiable molecules, with an equally large number of free 3 ends. This >>10.sup.7 fold relative excess is enormous, and it means the starting situation of an complex pool PCR is analogous to the situation that will exist in a regular genomic DNA target PCR at the end of the whole reaction (25 cycles). These almost 1 trillion targets therefore represent a mass of diverse sequence primers which can diffuse quickly and use their free 3 ends to prime on other molecules, and since it is also composed of a myriad of different sequences there will be great potential for internal cross-priming of one sequence onto another. It is therefore believed that the cross-priming and mis-priming events towards the end of an over-loaded complex pool PCR probably start happening excessively in the very first few cycles of such PCRs. This creates various artefacts that then further amplify and can eventually outnumber the desired products as the amplification of the desired products plateaus during the later stages of the PCR. This problem does not exist in EMPCR, since the original templates are physically separated from one another from the start, and the resources contained within each reaction droplet are very limited Furthermore, the overall negative impact of this undesirable mis-priming and inter-molecule priming is likely to be proportional to the fraction of target molecules that are full length (not truncated at their 5 end), as only this class of original template can be internally primed and copied to generate an artefact with a common priming site at its newly synthesised (3) end.
[0104] In order to overcome these problems with complex pool PCR a method was performed according to the tenth aspect of the invention in which a significantly reduced amount of template pool was used.
[0105] Duplicate PCRs were performed in 30 l volumes seeded with 1 l of 10 serial dilutions of each of the different quality model pools, using 30 thermal cycles. The input pools contained 10 ng, 1 ng, 100 pg, 10 pg and 1 pg of, single-stranded DNA molecules. Example results from such experiments using the optimum enzyme and reaction conditions, detailed above in Example 1, are shown in
[0106] As can be seen in
[0107] For reactions seeded with 10 pg of total template, the 1%-100% quality models amplified the desired fragment mixture very cleanly. Thus 0.1-10 pg of full length target was sufficient, and 9.9 pg of truncated target did not compromise these reactions.
[0108] For reactions seeded with 100 pg of total template, the 0.1%-1% quality models amplified the desired fragment mixture very cleanly. Thus 0.1-1 pg of full length target was sufficient, and 99.9 pg of truncated target did not compromise these reactions. However, the reaction with 10 pg of full length target was compromised (overtaken by artefacts) by the presence of 90 pg of truncated target. The reactions with 50 pg and 100 pg of full length target also generated a lot of artefacts.
[0109] These results suggest that the main factor that determines whether artefacts are formed in an complex pool PCR is the absolute amount of full-length target present at the start of the reaction. To ensure good quality amplifications, this quantity should be of the order of 1 pg, though it is quite robust to an order of magnitude difference up or down. The amount of 5 truncated target has a far smaller influence of the reaction fidelity, even up to the 10-100 pg rangethough if more than this is present in the starting reaction then more artefacts will be produced, and a mild excess of truncated template seems to cooperate with a mild excess of full length template in generating undesirable products.
Optimisation to Reduce PCR Cycle Number
[0110] Performing fewer PCR cycles reduces the likelihood of errors within the amplified sequences. Q5 polymerase (NEB) has an error rate >100 fold lower than Taq DNA polymerase which relies on efficient 3 to 5 exonuclease activity. However, the efficient 3 to 5 exonuclease activity also degrades primers during PCR (Pers. Comm, NEB technical support). Using a single Phosphorothioate bond at the 3 end of PCR primers would prevent 3 to 5 exonuclease activity but would also block desirable exonuclease activity e.g. 2 exonuclease.
[0111] A series of PCRs with differing primer concentrations in which complex pools with quality scores of 10 and 1% were carried out using the following conditions: 50 l PCRs contained 1 of the supplied PCR Buffer, 1.5 pmols/l ProAmpF04E, 1.5 pmols/l ProAmpR01, 0.2 mM dNTPs, 0.025 U/l of Q5 DNA Polymerase, and the required mass of template pool). Reactions were sealed with a heat sealable PCR film or PCR strip-caps (Thermo fisher Scientific, Loughborough, Leics, UK). The reactions were cycled as follows: 98 C. for 30 sec, 5 (98 C. for 30 see, 65 C. for 10 sec), 20 (98 C. for 10 sec, 70 C. for 10 sec) 72 C. for 1 minute then held at 15 C. Additionally, the PCRs were performed with and without supplementing with 0.01 U/l of Thermostable Pyrophosphatase (NEB)
[0112] Increasing the primer concentration in the PCRs and supplementing with Thermostable Pyrophosphatase increased the yield that could be generated per 50 l PCR from 0.2 g to >0.5 g using 5 to 6 fewer PCR cycles and 10 fold less template.
[0113] Further optimisations showed that equivalently high yields could be achieved by seeding PCRs with 10 pg to 20 pg of the complex pool and performing 15 to 17 PCR cycles (
Comparison with EMPCR
[0114] The above in-solution complex pool PCR technique of the invention is shown to be more efficient than EMPCR.
[0115] Considering a complex pool with a quality score of 70% and a yield of 300 ng: [0116] 1. Optimised EMPCRs would be seeded with a few ng of complex pool and yield 200 ng per PCR. The maximum expected yield from PCR of the whole complex pool would be 120 g. [0117] 2. The PCRs produced using the inventive method of Example 3 would be seeded with 1 pg to 20 pg of the template complex pool and yield >500 ng per PCR. The maximum expected yield from PCR of the whole complex pool would be >1 mg
[0118] The inventive technique is also faster to set up, as EMPCR requires a long emulsification step prior to thermal cycling, and a long demulsification step following thermal cycling.
[0119] The inventive technique allows easier purification of PCR products, as it is compatible with a wide range of purification platforms e.g. Silica membrane columns (Qiagen), Silica coated beads (Qiagen), AmPure XP beads (Beckman), and Polyacrylamide gel buffer exchange (BioRad) etc. The emulsifying oils used for EMPCR limit compatibility with some of these purification platforms.
[0120] EMPCR is also intolerant of soap containing buffers, iProof polymerase has a soap free buffer available, but many other polymerases such as Q5 polymerase are optimised for use in soap containing buffers. The inventive technique is compatible with a range of buffers. The inventive technique may be adapted to amplify ng masses of complex pools. Finally, since EMPCR compartmentalises the reaction, it is possible that the separate compartments might consume their resources at different rates and may result in an un-even product.
EXAMPLE 5GENERATING MULTI-BIOTINYLATED DOUBLE-STRANDED PCR AMPLICONS OF THE THIRD ASPECT OF THE INVENTION
[0121] Complex pool PCRs were performed using standard optimised conditions but with substitution of dCTP for differing ratios of 17 Biotin-16-Aminoallyl-2-dCTP and dCTP (Trilink). Biotin-16-Aminoallyl-2-dCTP has a flexible linker arm making it more efficient for use in PCR than other biotinylated nucleotides. It was found that a ratio of 0.65 17 Biotin-16-Aminoallyl-2-dCTP gave an optimal balance between yield and biotin incorporation.
EXAMPLE 6PRODUCING A MULTI-BIOTINYLATED PROBE LIBRARY FROM A TEMPLATE COMPLEX POOL
[0122] PCR amplified complex pools are double-stranded. To generate multi-biotinylated probes for a hybridisation based target capture, the multi-biotinylated double-stranded pool was transformed into a single-stranded pool. To achieve this, the 3 primer site was removed with the Bts I restriction enzyme (NEB) and the unwanted strand removed with 2-exonuclease (NEB).
[0123] To allow direct PCR recovery of captured DNA fragments following targeted enrichment, it was necessary to protect the 3 end of the probes from primer extension by DNA polymerases. Terminal Transferase (NEB) was used to add di-deoxy ATP (ddATP, Trilink) to the 3 end of the probe strands prior to the removal of the un-desired strand by -exonuclease.
[0124] The output from processing is a pool comprising single-stranded multi-biotinylated probe with a non-target end as shown in
[0125] The multi-biotinylated DNA probe of the third aspect of the invention produced for example by the method described above has several potential advantages over existing DNA and RNA probes: [0126] 1. DNA probes are less vulnerable to environmental nucleases than RNA probes. [0127] 2. DNA probes are more compatible with many blocking or masking agents including those described in relation to the fourth to eighth aspect of the invention. [0128] 3. Multi-biotinylation presents numerous targets for Streptavidin binding making capture more efficient. [0129] 4. The non-target end region ensures that at least one biotin is distal to the targeting region.
[0130] The method of producing the multi-biotinylated probe library was as follows:
a. PCR Amplification of a Template Probe Library
[0131] The template probe was diluted in 10 mM Tris HCl (pH 8.5). A PCR master mix sufficient for 100 PCRs was prepared containing 1Q5 high fidelity PCR buffer (NEB), 1.5 to 3 pmol/l of 5 biotinylated ProAmp-F primer, 1.5 to 3 pmol/ul 5 phosphorylated ProAmp-F primer, 3 M dGTP, 3 M dATP, 3 M dTTP, 105 M dCTP, 195 M Biotin-16-AA-CTP (Trilink), 0.02 U/l Thermostable inorganic Pyrophosphatase (NEB), 0.05 U/l Q5 hot start high fidelity DNA polymerase (NEB). The master-mix was vortexed.
[0132] Several 49 l DNA free controls were aliquoted to which 1 l of water was added. The template pool was added to the remaining master-mix to a concentration of 0.02 to 0.4 pg/l. Following vortexing, the master-mix was aliquoted into 50 l reactions and the PCR tubes sealed. The reactions were cycled as follows: 98 C. for 30 see, 5 (98 C. for 30 sec, 65 C. for 10 see), 10 to 20 (98 C. for 10 see, 70 C. for 10 sec) 72 C. for 1 minute then hold at 15 C. Following PCR, samples are stored at 20 C.
b. Purification and Concentration of PCRs
[0133] Several PCRs were pooled and vortexed. 200 to 500l aliquots of the pooled PCRs were purified using MinElute columns (Qiagen) using the standard operating procedure, ensuring that the binding capacity of the column was not exceeded, with the following exceptions: All centrifugations were performed at 16000 RCF. Elution buffer (EB10 mM Tris HCl pH 8.5) was heated to 70 C. 10 l of heated EB was added directly to each column followed by a 5 min incubation at 70 C. The eluate was recovered by centrifugation. A further 10 l of pre-heated EB was added to each column, incubated for 1 min at 70 C. and the eluate recovered by centrifugation. Following purification, all eluates were pooled and vortexed.
c. Quantification and Quality Assessment of PCR
[0134] A DNA 1000 chip for the bioanalyser 2100 (Agilent) was used to assess the quality of the amplification. A single broad peak (broad due to the random incorporation of Biotin-16-AA-CTP) was identified with the crest of the peak at 200 bp. The increased peak size was caused by retardation of the PCR fragments due to incorporation of Biotin-16-AA-CTP.
[0135] Following bioanalyser 2100 analysis, the concentration of the amplified complex pool was determined using a NanoDrop spectrophotometer (Thermo).
d. Resolution of PCR into a Single-Stranded Probe Library
[0136] The total Mass of the amplified complex pool was determined. A reaction was prepared on ice such that every 20 l contained 2 g amplified complex pool, 1 Terminal Transferase buffer (NEB), 1 CoCl.sub.2 (NEB), 0.125 U/l BtsI, 0.2 g/l BSA (NEB) and 500 M ddATP (Trilink). The reaction was mixed by vortexing and incubated for 30 min at 55 C. The reaction was incubated on ice for 5 min.
[0137] 3 l of a mixture containing 2.5 l of Terminal Transferase at 20,000 U/ml (NEB) in 1 Terminal Transferase buffer was added per 20 l of the reaction. The reaction was vortexed to mix and incubated for 60 min at 37 C. The reaction was incubated on ice for 5 min.
[0138] 3 l of a mixture containing 2.5 l of k exonuclease at 5000 U/ml (NEB) in 1 Terminal Transferase buffer was added per 20 l of the initial reaction volume. The reaction was vortexed to mix and incubated for 20 min at 37 C. and 20 min at 80 C.
e. Purification of the Probe Library
[0139] Sufficient MicroBioSpin p6 columns (BioRad) were warmed to room temperature such that 75 l of un-purified probe library could be passed through each column. The probe library was purified according to the manufacturer's standard operating procedure. Following purification, the eluates were pooled and gently vortexed.
e. Quantification and QC of the Purified Probe Library
[0140] The purified probe library was analysed using an RNA 6000 nano chip for the Bioanalyser 1100 (Agilent) and quantified using a NanoDrop spectrophotometer (Thermo) An ideal probe library should have a concentration of 50 ng/l and an OD 260:280 of 1.7-2.0.
Preparation of Human gDNA Fragment Libraries
gDNA Fragmentation
[0141] This method describes fragmentation using a Bioruptor sonicator. Note: Other DNA fragmentation options may be implemented, for example the Covaris system (Covaris), nebulisation (Roche), or by NEBNext dsDNA Fragmentase (NEB).
[0142] The gDNA was diluted in 10 mM Tris HCl (pH 8.5) to a concentration of 20 ng/l. 110 l of the diluted DNA was aliquoted into separate 1.5 ml sonication tubes (Diagenode), vortexed and centrifuged briefly prior to incubation on ice until the Bioruptor (Diagenode) was prepared.
[0143] To prepare the Bioruptor, the shearing bath was chilled for 30 min with water containing an 0.5 cm layer of crushed ice. Following preparation, the aliquots of gDNA were placed into the Bioruptor's sample cradle and device assembled according to the manufacturers guidelines.
The samples were sonicated as follows:
TABLE-US-00001 Power setting Low Sonication cycle 15 sec on followed by 90 sec off Number of cycles 5-25 (dependant on the required level of sonication)
[0144] Following sonication the fragmented DNAs were pooled and stored at 20 C.
Small Fragment Removal Purification of the DNA Fragments
[0145] Aliquots of the pooled sheared gDNA were purified using 1.2 to 1.8 AmpureXP beads (Beckman Coulter), dependant on the required fragment size, according to the manufacturers standard operating procedure. Finally the DNA was eluted in 10 mM Tris HCl (pH 8.5) with incubation at 65 C. for 5 min prior to removal of the magnetic beads. Purified sheared gDNAs were quantified using a NanoDrop spectrophotometer and the fragment size determined using a DNA 7500 chip for the bioanalyser 2100 (Agilent). Purified sheared gDNA was stored at 20 C.
Fragment Polishing, dA Tailing and Linker Ligation to Produce a Raw Template Library
[0146] 25 l reactions were prepared on ice containing 500 ng to 1000 ng of fragmented gDNA, 1 Thermopol buffer (NEB), 2% PEG 4000 (Fermentas) 1.0 mM ATP (Thermo), 0.4 mM dNTPs (Promega) 0.4 U/l T4 polynucleotide kinase (Fermentas), 0.1 U/l T4 DNA polymerase (Fermentas), 0.05 U/l Taq DNA polymerase (Kapa biosystems). Reactions were vortexed briefly to mix and incubated for 20 min at 25 C. followed by 72 C. for 20 min.
[0147] The reactions were placed on ice. A 5 l solution containing 1 Thermopol buffer (NEB), 10 times (fragments >700 bp) to 30 times (fragments <700 bp) the molar equivalent of the R.Block T7 adapter and 5 units of T4 DNA ligase (Fermentas) was added directly to each reaction. Reactions were vortexed to mix and incubated for 60 min at 22 C. and for 15 min at 65 C. Similar reactions were pooled and mixed by vortexing. Samples were stored for no longer than 24 hours over night.
[0148] Reactions were fractionated on an LE agarose gel stained with 1 Cyber Green. Using a Dark Reader transilluminator, gel slices containing fragments in the range of 800 bp to 1200 bp (Illumina sequencing) or 1200 bp to 1600 bp (454 sequencing) were excised. DNA fragments were recovered using Qiagen gel extraction columns and eluted in 50 l 5 mM Tris HCl pH 8.5.
LMPCR of the Template Fragment Library
[0149] 50 l PCRs contained 1 LongAmp buffer (NEB), 1 pmol/l of each LMPCR primer, 1 g/l Ultra Pure BSA (Ambion), 0.3 mM dNTPs, 0.1 U/l LongAmp DNA polymerase (NEB) and 20 l of the purified ligated gDNA fragments.
[0150] PCRs were cycled as follows: 10 to 1695 C. for 2 min, (95 C. for 30 sec, 60 C. for 30 sec, 72 C. for 1 min to 1.5 min) 72 C. for 5 min then held at 15 C.
[0151] PCRs were purified using MinElute columns (Qiagen) using the standard operating procedure, with the following exceptions: All centrifugations were performed at 16000 RCF. Elution buffer (EB10 mM Tris HCl pH 8.5) was heated to 70 C. 10 l of heated EB was added directly to each column followed by 5 min incubation at 70 C. The eluate was recovered by centrifugation. A further 10 l of pre-heated EB was added to each column, incubated for 1 min at 70 C. and the eluate recovered by centrifugation. Following purification, all eluates were pooled and vortexed. Eluted samples were stored at 20 C.
Assessment of Fragment Size and Quantification
[0152] Fragment size and linker carry over were assessed using a DNA 7500 chip for the Bioanalyser 2100 (Agilent). The majority of fragments ranged from 800 bp to 1200 bp for Illumina NGS fragment libraries and 1200 to 1600 bp for Roche 454 NGS fragment libraries.
[0153] Each library was quantified using a NanoDrop spectrophotometer (Thermo).
EXAMPLE 7USE OF MULTI-BIOTINYLATED PROBES OF EXAMPLE 6 FOR IN-SOLUTION TARGET CAPTURE
[0154] A series of in solution target capture experiments were undertaken to test the performance of the multi-biotinylated probe. In solution target capture workflow: [0155] 1. Fragment gDNA to the required size range (average fragment size 1 kb for Illumina sequencing to 1.4 kb for Roche sequencing). [0156] 2. Ligate NGS platform specific linkers (Fragment library). [0157] 3. Perform 14 to 17 cycles of PCR to enrich correctly ligated DNA fragments [0158] 4. Hybridise ROI within the fragment library with the bait [0159] 5. Physically recover the bait and hybridised ROI by binding the bait's covalently linked biotin molecules with Streptavidin coated paramagnetic beads. [0160] 6. Wash the beads in a stringent wash buffer [0161] 7. Elute the captured ROI fragments with PCR
Hybridisation According to the First to Fourth Aspects of the Invention
[0162] Hybridisation mixes contained: 0.75 g to 1 g of a gDNA fragment library (Average fragment size 1 kb (Illumina MiSeq sequencing) or 1.4 kb (Roche 454 GS FLX plus sequencing); 5 g to 10 g of a repetitive sequence blocker (as described in Example 8); 0 to 33 pmol/l of oligonucleotides complementary to the library linkers (library blocking oligos); 1 Superase. IN RNase inhibitor; and 0.08 M (2500 individual probe sequences) to 0.13 M (16,000 individual probe sequences) of multi-biotinylated probe were diluted to 35 l in a proprietary hybridisation buffer. (0.02% Ficol, 0.04% PVP, 45 mM Tris-HCl 11 mM Ammonium Sulphate, 20 mM MgCl.sub.2, 6.8 mM 2-Mercapthoethanol and 4.4 mM EDTA. pH 8.5)
[0163] The hybridisation mixes were: incubated at 95 C. for 2 min; cooled at a rate of 1 C. every 10 sec to 10 C. above a predefined optimal annealing temperature; step-down incubated for 60 sec at every C. above the optimal annealing temperature and cooled at a rate of 1 C. every 10 sec between each C.; and incubated at the optimal annealing temperature for 24 hours.
[0164] A schematic representation of the hybridised target DNA with multiple non-overlapping multi-biotinylated probes is shown in
Referring to
[0165] Referring now to
EXAMPLE 8USE OF MULTI-BIOTINYLATED PROBES OF EXAMPLE 6 FOR ON-SURFACE TARGET CAPTURE
Binding
[0166] MyOne Streptavidin T1 paramagnetic dynabeads (Invitrogen) (1 mg) were washed twice in the proprietary hybridisation buffer (as defined in Example 7) either containing or not containing a nucleotide based blocking agent (R.block or DNA based).
[0167] The dynabeads were then re-suspended in 20 l to 65 l of the hybridisation buffer and incubated at 55 C. for 30 min prior to heating to the pre-defined optimal annealing temperature.
[0168] Hybridisation mixes were then transferred to the binding solution, mixed with gentle pipetting and incubated at the optimal annealing temperature for 20 min.
Washing
[0169] Following hybridisation, the dynabeads were concentrated, re-suspended in 150 l of a pre-heated proprietary wash buffer and incubated at a predefined washing temperature for 5 min. This was repeated once.
[0170] The dynabeads were concentrated, re-suspended in hybridisation buffer supplemented with 5 U of Hybridase thermostable RNase H (Epicentre) (total volume 50 l); incubated at 55 C. for 30 min, and finally incubated at the predefined wash temperature for 5 min.
[0171] The dynabeads were concentrated, re-suspended in 150 l of a pre-heated proprietary wash buffer (50 mM HEPES, 0.04% PVP, 10 mM MgCl.sub.2, 6.8 mM 2-MercaptoEthanol. pH 8.5) and incubated at a predefined washing temperature for 5 min.
The dynabeads were concentrated, re-suspended in 50 l 10 mM Tris HCl (pH 8.5).
Analysis
[0172] Samples were eluted from the bead-captured probes by PCR prior to purification and NGS analysis using the Roche 454 GS FLX plus sequencing platform or the Illumina MiSeq sequencing platform.
Enrichment Power
[0173] Enrichment power (EP) is a measurement of how well a target capture method performs.
Firstly, the ratio of NGS reads that overlap the targeted region over reads that do not overlap the target is calculated (fr).
[0174] Secondly, the fraction of the genome that is targeted is calculated (ft)
EP can then be calculated. EP=frft.
Results
[0175] EP of 2000 to 3000 fold was achieved.
[0176] In all cases 90-95% of the target was recovered at a depth 20% of the average per base read depth, with 80% recovered at 50% of the average.
EXAMPLE 9PREPARATION OF RNA TRANSCRIPTION PRODUCTS OF DNA FRAGMENTS FOR USE IN METHODS OF THE FIFTH TO NINTH ASPECTS OF THE INVENTION AND PREPARATION OF TARGET DNA
[0177] Eukaryotic gDNA was randomly fragmented to a range of sizes between 100 bp and 9000 bp to suit different applications. Adapters containing a T7 RNA polymerase promoter, or any other RNA polymerase promoter, were annealed to the fragmented DNAs, including Cot-1 DNA and repetitive sequence rich DNA from other eukaryotes.
[0178] The adapter ligated DNA fragments were either amplified by PCR prior to transcription to increase yield, or transcribed without amplification.
[0179] The fragments were transcribed from the promoter by T7 RNA polymerase, or any other RNA polymerase if the adapter contained a promoter other than the T7 promoter.
[0180] Following transcription, DNase I was used to remove contaminating DNA. Following DNase I treatment, Proteinase K was used to remove contaminating DNase and RNase. The RNA product was then purified and protected by the addition of a temperature reversible RNase inhibitor (SUPERase .INAmbion) or any other suitable RNase inhibitor.
The resultant product of the invention will hereinafter be called R.Block.
Three R.Block types were produced using the above methods, namely: [0181] 1. R.Block-Hg (from Human gDNA fragmented to 350 bp on average) [0182] 2. R.Block-Hc (from Human Cot-1 DNA) [0183] 3. R.Block-Sg (from Salmon gDNA fragmented to >800 bp)
Preparation of DNA Sample for R. Block Production
[0184] A sample of DNA similar to the source of DNA for ultimate enrichment must be obtained. For example, if target enrichment of a human genomic DNA sample is required, either extract human genomic DNA from an un-related donor or purchase the DNA from a trusted supplier. The desired DNA was extracted according to standard procedures, and dissolved in 10 mM Tris HCl (pH 8.5).
gDNA Fragmentation [0185] The following method describes fragmentation using a Bioruptor sonicator. Note: Other DNA fragmentation options may be implemented, for example the Covaris system (Covaris), nebulisation (Roche), or by NEBNext dsDNA Fragmentase (NEB).
[0186] The gDNA was diluted in 10 mM Tris HCl (pH 8.5) to a concentration of 20 ng/l. 110 l of the diluted DNA was aliquoted into separate 1.5 ml sonication tubes (Diagenode), vortexed and centrifuged briefly prior to incubation on ice until the Bioruptor (Diagenode) was prepared.
[0187] To prepare the Bioruptor, the shearing bath was chilled for 30 min with water containing an 0.5 cm layer of crushed ice. Following preparation, the aliquots of gDNA were placed into the Bioruptor's sample cradle and device assembled according to the manufacturers guidelines.
The samples were sonicated as follows:
TABLE-US-00002 Power setting Low Sonication cycle 15 to 30 sec on followed by 90 sec off Number of cycles 5-25 (dependant on the required level of sonication)
[0188] Following sonication the fragmented DNAs were pooled and stored at 20 C.
Small Fragment Removal Purification of the DNA Fragments
[0189] Aliquots of the pooled sheared gDNA were purified using 1.2 to 1.8 AmpureXP beads (Beckman Coulter), dependant on the required fragment size, according to the manufacturers standard operating procedure. Finally the DNA was eluted in 10 mM Tris HCl (pH 8.5) with incubation at 65 C. for 5 min prior to removal of the magnetic beads. Purified sheared gDNAs were quantified using a NanoDrop spectrophotometer and the fragment size determined using a DNA 7500 chip for the bioanalyser 2100 (Agilent). Purified sheared gDNA was stored at 20 C.
Fragment Polishing, dA Tailing and Linker Ligation to Produce a Raw R.Block Template Library
[0190] 25 l reactions were prepared on ice containing 500 ng to 1000 ng of fragmented gDNA, 1 Thermopol buffer (NEB), 2% PEG 4000 (Fermentas) 1.0 mM ATP (Thermo), 0.4 mM dNTPs (Promega) 0.4 U/l T4 polynucleotide kinase (Fermentas), 0.1 U/l T4 DNA polymerase (Fermentas), 0.05 U/l Taq DNA polymerase (Kapa biosystems). Reactions were vortexed briefly to mix and incubated for 20 min at 25 C. followed by 72 C. for 20 min.
[0191] The reactions were placed on ice. A 5 l solution containing 1 Thermopol buffer (NEB), 10 times (fragments >700 bp) to 30 times (fragments <700 bp) the molar equivalent of the R.Block T7 adapter and 5 units of T4 DNA ligase (Fermentas) was added directly to each reaction. Reactions were vortexed to mix and incubated for 60 min at 22 C. and for 15 min at 65 C. Similar reactions were pooled and mixed by vortexing. Samples were stored for no longer than 24 hours over night.
[0192] Reactions were purified using 1.8 AmpureXP beads (Beckman Coulter), according to the manufacturer's standard operating procedure. Finally the DNA was eluted in 25 l 10 mM Tris HCl (pH 8.5) with incubation at 65 C. for 5 min prior to removal of the magnetic beads. Fragment size and linker carry over was assessed using a DNA high sensitivity chip for the bioanalyser 2100 (Agilent). Purified sheared gDNA was stored at 20 C.
LMPCR of the R.Block template library
[0193] 50 l PCRs contained 1 LongAmp buffer (NEB), 1 pmol/l or each LMPCR primer, 1 g/l Ultra Pure BSA (Ambion), 0.3 mM dNTPs, 0.1 U/l LongAmp DNA polymerase (NEB) and 20 l of the purified ligated gDNA fragments.
[0194] PCRs were cycled as follows: 10 to 1695 C. for 2 min, (95 C. for 30 sec, 60 C. for 30 sec, 72 C. for 1 min to 1.5 min) 72 C. for 5 min then held at 15 C.
[0195] Several pooled PCRs were purified using MinElute columns (Qiagen) using the standard operating procedure, with the following exceptions: All centrifugations were performed at 16000 RCF. Elution buffer (EB10 mM Tris HCl pH 8.5) was heated to 70 C. 10 l of heated EB was added directly to each column followed by 5 min incubation at 70 C. The eluate was recovered by centrifugation. A further 10 l of pre-heated EB was added to each column, incubated for 1 min at 70 C. and the eluate recovered by centrifugation. Following purification, all eluates were pooled and vortexed. Eluted samples were stored at 20 C.
Assessment of Fragment Size and Quantification of the R.Block Template Library
[0196] Fragment size and linker carry over were assessed using a DNA 7500 chip for the bioanalyser 2100 (Agilent). The majority of fragments ranged from 100 bp to 500 bp for R.Block-Hc (derived from human Cot-1 DNA), 200 to 700 bp for R.Block-Hg (genomic sequence derived from human DNA) and >700 bp for R.Block-Sg (genomic sequence derived from Salmon DNA).
[0197] Each library was quantified using a NanoDrop spectrophotometer (Thermo).
Transcription of the R.Block Template Library
[0198] 25 l Transcription reactions contained 1 g of an R.Block template library, 1RNAMaxx transcription buffer Agilent) 4 mM of each rNTP, 30 mM DTT (Agilent), 0.015 U/l Yeast inorganic Pyrophosphatase (Agilent), 1 U/l SUPERase .IN (Ambion) and 8 U/l T7 RNA polymerase (Agilent). Reactions were incubated for 2 hours at 37 C.
[0199] To stop the reactions 1 l Turbo DNase (2 U/l) was added to each separate reaction and incubated for 30 min at 37 C.
[0200] A mixture of 6 l RNAMaxx 5 transcription buffer, 2.5 l SUPERase. IN, 23.5 l 5 M Urea and 3 l proteinase K (recombinant) (Thermo) was added to each reaction. Reactions were incubated for 30 min at 37 C. Reactions were held on ice and were not stored until purified.
Purification of the R.Block
[0201] Sufficient MicroBioSpin p6 columns (BioRad) were warmed to room temperature such that 75 l of un-purified probe library could be passed through each column. The probe library was purified according to the manufacturer's standard operating procedure. Following purification, eluates were pooled prior to the addition of one 20.sup.th the volume of SUPERase. IN (Ambion). R.Blocks were gently mixed and stored at 80 C.
Assessing the R.Block Fragment Size and Concentration
[0202] R.Block Fragment size and linker carry over were assessed using an RNA 6000 nano chip for the bioanalyser 2100 (Agilent). A high quality R.block had the following features: The majority of fragments ranged from >100 nt for R.Block-Hc, >200 nt for R.Block-Hg and >800 nt for R.Block-Sg (genomic sequence derived from Salmon DNA); >80 g total Mass of R.Block per transcription; Very little primer or linker contamination.
R.Blocks were stored at 80 C.
EXAMPLE 10OPTIMISED PREPARATION OF R.BLOCK PRODUCTS WITH MULTI-BIOTINYLATED PROBES AND OPTIMISED HTE HYBRIDISATION PROTOCOL FOR NETWORK BLOCKING AND SURFACE BLOCKING
Materials and Methods
Probe Sequence Design
[0203] A custom oligonucleotide design software (Lancaster, O. et al., Unpublished) was used to design non-overlapping (minimum gap=5 nt) nucleotide sequences (average 60 nt). Probes were designed to have a tm between 65 C. and 75 C., and were extended or contracted by up to 10 nt to fit within the tm range. No Probes were placed within 10 bp of repetitive sequences. Each probe was permitted to match the genome 5 times. The software then calculated the average Tm of all identified sequences. Subsequently, for each kb of targeted sequence, the 10 sequences that most closely matched the average Tm were selected. The remaining sequences were discarded.
[0204] The software output the probe sequences as a FASTA file (9) which was submitted to Mycroarray (Mycroarray MI USA). We developed a custom perl script to add primer annealing sites to each sequence (5 CTGGCAGACGAGAGGCAGTG/genomic sequence/GTAGACCTCACCAGCGACGC 3). The resulting FASTA file was then converted, using the same custom perl script) into a tab delimited text based table.
[0205] The template probe pool, that contained all the sequences contained in the tab delimited text based table, was synthesised so that each individual probe was synthesised at seven different loci on a microarray (Mycroarray). Following synthesis, the probes were harvested and lyophilised by the manufacturer prior to shipping. The probes were re-constituted in 10 mM Tris Hcl (pH 8) (Qiagen) to a stock concentration of 10 ng/l. Working concentrations of 10 pg/l were prepared by serially diluting the stock probe pool with Tris Hcl (pH 8).
Generating Multi-Biotinylated DNA hTE Probes
[0206] 50 l PCRs contained 1Q5 reaction Buffer (NEB), 1.5 M ProAmpFO4E (5 phosphate-CTGGCAGACGAGAGGCAGTG 3), 1.5M ProAmpR01 (5 biotin-TEG-GCGTCGCTGGTGAGGTCTAC 3), 300 M dTTP, 300 M dATP, 300 M dGTP, 105 M dCTP (Promega), 195 M Biotin-16-Aminoallyl-2-dCTP (Trilink BioTechnologies), 1 U Thermostable Inorganic Pyrophosphatase (NEB), 0.5 U Q5 DNA polymerase (NEB), 10 pg-20 pg template probe pool (Mycroarray). Reactions were sealed with a heat sealable PCR film or PCR strip-caps (Thermo fisher Scientific). The reactions were cycled as follows: 98 C. for 2 min, 17 (98 C. for 15 sec, 72 C. for 25 sec), 72 C. for 1 minute then held at 15 C.
[0207] 100 PCRs were pooled and vortexed. 200 l aliquots of the pooled PCRs were purified using MinElute columns (Qiagen) using the standard operating procedure, with the following exceptions: All centrifugations were performed at 16000 RCF. Elution buffer (EB10 mM Tris HCl pH 8.5) was heated to 70 C. 10 of heated EB was added directly to each column and incubated at 70 C. for 5 min. The eluate was recovered by centrifugation for 1 min. A further 10 l of pre-heated EB was added to each column, incubated for 5 min at 70 C. and the eluate recovered by centrifugation for 1 min. Following purification, all eluates were pooled and vortexed.
[0208] A bulk reaction was prepared on ice such that every 201 l contained 2 g amplified complex pool, 1 Terminal Transferase buffer (NEB), 1 CoCl.sub.2 (NEB), 2.5 U BtsI, 4 g BSA (NEB) and 500 M ddATP (Trilink). The reaction was mixed by vortexing and incubated for 30 min at 55 C. The reaction was incubated on ice for 5 min.
3 l of a mixture containing 50 U of Terminal Transferase (NEB) in 1 Terminal Transferase buffer (NEB) was added per 20 l of the reaction. The reaction was vortexed to mix and incubated for 60 min at 37 C. The reaction was incubated on ice for 5 min.
[0209] 3 l of a mixture containing 12.5 U of exonuclease (NEB) in 1 Terminal Transferase buffer (NEB) was added per 20 l of the initial bulk reaction volume. The reaction was vortexed to mix and incubated for 20 min at 37 C. and 20 min at 80 C.
Sufficient MicroBioSpin p6 columns (BioRad) were warmed to room temperature such that 75 l of un-purified probe library could be passed through each column. The probe library was purified according to the manufacturer's standard operating procedure. Following purification, the eluates were pooled and gently vortexed.
[0210] The purified probe library was analysed using an RNA 6000 nano chip for the Bioanalyser 1100 (Agilent) and quantified using a NanoDrop spectrophotometer (Thermo) An ideal hTE capture probe library had a concentration of 50 ng/l, an OD 260:280 of 1.7-2.0 and had an average fragment size of 150 nt (the fragment size is >100 nt due to the presence of biotin molecules retarding migration through the gel matrix).
Fragmentation of Human gDNA for Fragment Library Preparation
[0211] Human gDNA was diluted in 10 mM Tris HCl (pH 8.5) to a concentration of 20 ng/l. 110 l of the diluted DNA was aliquoted into separate 1.5 ml sonication tubes (Diagenode), vortexed and centrifuged briefly prior to incubation on ice until the Bioruptor (Diagenode) was prepared. The Bioruptor's shearing bath was chilled for 30 min with water containing an 0.5 cm layer of crushed ice. Following preparation, the aliquots of gDNA were placed into the Bioruptor's sample cradle and device assembled according to the manufacturers guidelines. The samples were sonicated as follows: Power setting Low, Sonication cycle 15 sec on followed by 90 sec off for 14 cycles to 16 cycles.
[0212] Aliquots of the pooled sheared gDNA were purified using 0.8 AmpureXP beads (Beckman Coulter) according to the manufacturers standard operating procedure. The DNA was eluted in 10 mM Tris HCl (pH 8.5) with incubation at 65 C. for 5 min prior to removal of the magnetic beads. Purified sheared gDNAs were quantified using a NanoDrop spectrophotometer and the fragment size determined using a DNA 7500 chip for the bioanalyser 2100 (Agilent). An ideally fragmented library had an average fragment size of 1200 bp with >50% of fragments falling in the range of 1000 to 2000 bp. Purified sheared gDNA was stored at 20 C.
Preparation of Human Fragment Libraries for Illumina MiSeq Sequencing
[0213] End Repair and Ligation:
[0214] Illumina TruSeq adaptors were added to 2.5 g aliquots of fragmented human gDNA using the NEBNext DNA Library Prep Master Mix Set for Illumina sequencing (E6040) and the NEBNext Multiplex Oligos for Illumina sequencing (Index Primers Set 1) (E7335).
[0215] Size Selection:
[0216] Reactions were fractionated on a 1.0% LE agarose gel stained with 0.2 mg/ml EtBr. Using a Dark Reader transilluminator (Clare Chemical Research), gel slices containing fragments in the range of 1000 bp to 2000 bp were excised. DNA fragments were recovered using Qiagen gel extraction columns and eluted in 22 l 10 mM Tris HCl pH 8.5.
[0217] Linker Mediated PCR Enrichment for Ligated Fragments:
[0218] For each ligated DNA library 4100 l PCRs contained 1Q5 High-Fidelity 2 Master Mix, 1 M NEBNext Universal PCR Primer for Illumina, 1 M NEBNext Index Primer for Illumina and 5 l of ligated fragments.
[0219] PCRs were cycled as follows: to 98 C. for 30 sec, 8 to 10 (98 C. for 10 sec, 65 C. for 1 min 15 sec) 65 C. for 1 min then held at 15 C. PCRs were pooled and purified using 0.5 AmpureXP beads (Beckman Coulter) according to the manufacturers standard operating procedure. Recovered fragment library DNA was eluted in 25 l 10 mM Tris HCl (pH 8.5) with incubation at 65 C. for 5 min prior to removal of the magnetic beads. Eluted samples were stored at 20 C.
[0220] QC:
[0221] Fragment size and linker carry over were assessed using a DNA 7500 chip for the bioanalyser 2100 (Agilent). The average fragment size was 1300 bp. Each library was quantified using a NanoDrop spectrophotometer (Thermo Fisher Scientific).
Fragmentation of gDNA Samples for R. Block Production
[0222] Human and salmon gDNA was diluted in 10 mM Tris HCl (pH 8.5) to a concentration of 20 ng/l. 110 l of the diluted DNA was aliquoted into separate 1.5 ml sonication tubes (Diagenode), vortexed and centrifuged briefly prior to incubation on ice until the Bioruptor (Diagenode) was prepared. The Bioruptor's shearing bath was chilled for 30 min with water containing an 0.5 cm layer of crushed ice. Following preparation, the aliquots of gDNA were placed into the Bioruptor's sample cradle and device assembled according to the manufacturers guidelines. The samples were sonicated as follows: Power setting Low, 15 to 30 sec on followed by 90 sec off for 2 cycles to 4 cycles for the Salmon gDNA and 22 cycles to 24 cycles for the Human gDNA
[0223] Aliquots of the pooled sheared gDNA were purified using 1.8 AmpureXP beads (Beckman Coulter), dependant on the required fragment size, according to the manufacturers standard operating procedure. Finally the DNA was eluted in 10 mM Tris HCl (pH 8.5) with incubation at 65 C. for 5 min prior to removal of the magnetic beads. Purified sheared gDNAs were quantified using a NanoDrop spectrophotometer and the fragment size determined using a DNA 7500 chip for the bioanalyser 2100 (Agilent). The average size for the human gDNA was 500 bp and for the salmon gDNA, 3000 bp. Purified sheared gDNA was stored at 20 C.
Preparation of R.Block DNA Template
[0224] End Repair:
[0225] 25 l reactions were prepared on ice containing 1000 ng of fragmented gDNA or human Cot-1 DNA, 1 Fast Digest buffer (Fermentas), 1 mM ATP (Thermo), 0.4 mM dNTPs (Promega) 10 U T4 polynucleotide kinase (Fermentas), 2.5 U T4 DNA polymerase (Fermentas), 1.25 U Taq DNA polymerase (Kapa biosystems). Reactions were vortexed briefly to mix and incubated for 20 min at 25 C. followed by incubation at 72 C. for 20 min.
[0226] Ligation:
[0227] The reactions were placed on ice. 0.4 M R.Linker (5 CGACCGACTGCCACCTGCGCTAATACGACTCACTATAGGGCTAGTGCTTCGCATC CGA*A*G*T* 3; 5 phosphate-CTTCGGATGCGAAGCACTAGGGCGTGCAGCCTGTGGC*A*G*C 3; where * denote a phosphorothioate Bond) and 5 U of T4 DNA ligase (Fermentas) was added directly to each reaction. Reactions were vortexed to mix and incubated for 20 min at 250.
[0228] Linker Removal:
[0229] Samples were purified using 1.8 Ampure XP beads. Recovered fragments were recovered in 50 l 10 mM Tris HCl (pH 8).
[0230] Linker mediated PCR enrichment for ligated fragments:
[0231] 100 l PCRs contained 1 FastStart high fidelity buffer (Roche), 1 M of each fragment library Linker Mediated PCR (LMPCR) primer (5 CGACCGACTGCCACCTGCGC 3; 5 GCTGCCACAGGCTGCACGCC 3), 2% DMSO (Sigma-Aldrich), 0.2 mM dNTPs, 5 U FastStart DNA polymerase blend (Roche) and 50 l of the ligated gDNA fragments. PCRs were cycled as follows: to 95 C. for 10 min, 12 (95 C. for 30 sec, 64 C. for 30 sec, 72 C. for 3 min) 72 C. for 7 min then held at 15 C. PCRs were purified using 1.8 AmpureXP beads (Beckman Coulter) according to the manufacturers standard operating procedure. Recovered fragment library DNA was eluted in 25 l 10 mM Tris HCl (pH 8.5) with incubation at 65 C. for 5 min prior to removal of the magnetic beads. Eluted samples were stored at 20 C.
[0232] QC:
[0233] Fragment size and linker carry over were assessed using a DNA 7500 chip for the bioanalyser 2100 (Agilent). Each library was quantified using a NanoDrop spectrophotometer (Thermo Fisher Scientific).
Transcription of the R.Block DNA Template Library
[0234] 25 l Transcription reactions contained 1 g of an R.Block DNA template library (human gDNA, salmon gDNA and human Cot-1 DNA), 1RNAMaxx transcription buffer Agilent) 4 mM of each rNTP, 30 mM Dithiothreitol (Agilent), 0.015 U/l Yeast inorganic Pyrophosphatase (Agilent), 25 U SUPERase .IN (Ambion) and 200 U T7 RNA polymerase (Agilent). Reactions were incubated for 2 hours at 37 C. To stop the reactions 2 U Turbo DNase (Thermo Fisher Scientific) was added to each separate reaction and incubated for 30 min at 37 C.
[0235] A mixture of 1RNAMaxx transcription buffer, 50 U SUPERase. IN, 23.5 l 3.35M Urea and 6 mg proteinase K (recombinant, PCR grade) (Thermo Fisher Scientific) was added to each reaction. Reactions were incubated for 30 min at 37 C.
[0236] Sufficient MicroBioSpin p6 columns (BioRad) were warmed to room temperature such that 75 l of un-purified probe library could be passed through each column. The probe library was purified according to the manufacturer's standard operating procedure. Following purification, eluates were pooled prior to the addition of one 20.sup.th the volume of SUPERase. IN (Ambion).
[0237] The R.Block products produced are hereinafter labelled R.Block-Hg (derived from human genome DNA), R.Block-Hc (derived from human Cot-1 DNA) and R.Block-Sg (derived from salmon genome DNA).
[0238] R.Block Fragment size and linker carry over were assessed using an RNA 6000 nano chip for the bioanalyser 2100 (Agilent). A high quality R.block had the following features: The majority of fragments ranged from >200 nt for R.Block-Hg (derived from human gDNA) and R.Block-Hc (derived from human Cot-1 DNA) and >800 nt for R.Block-Sg (derived from salmon gDNA); >80 g total Mass of R.Block per transcription; Very little primer or linker contamination. R.Blocks were stored at 80 C.
Optimised in-Solution hTE Protocol
Hybridisation
[0239] 30 l hybridisation mixes contained: 1 hybridisation buffer (0.02% Ficol, 0.04% PVP, 45 mM Tris-HCl 11 mM Ammonium Sulphate, 20 mM MgCl.sub.2, 6.8 mM 2-Mercapthoethanol and 4.4 mM EDTA. pH 8.5), 0.5 g DNA fragment library (above), R.Block (Hg, He or Sg) 10 g (unless stated otherwise), 30 U Superase. IN RNase inhibitor and 60 ng multi-biotinylated probe (as above).
[0240] The hybridisation mixes were: incubated at 98 C. for 2 min; cooled at a rate of 1 C. per second to 72 C.; step-down incubated for 60 sec at 1 C. intervals, cooled at a rate of 1 C. per second between each interval; and incubated at 62 C. for 24 hours.
[0241] In other examples the incubation steps may be performed at a temperature in the range of 50 C. to 80 C., depending on the molecules hybridised, as will be determined by the skilled person.
Binding
[0242] 0.75 mg MyOne Streptavidin C1 paramagnetic dynabeads (Invitrogen) were washed twice in 100 l 1 hybridisation buffer. The dynabeads were then re-suspended in 20 l 1 hybridisation buffer supplemented with 10 g of R.Block or other blocker (unless stated in the results). The resulting binding solutions were incubated at 55 C. for 30 min prior to heating to 62 C. The hybridisation mixes were then transferred to the binding solutions, mixed with gentle pipetting and incubated at 62 C. for 20 min.
[0243] In other examples the binding steps may be performed at a temperature in the range of 50 C. to 80 C., depending on the molecules hybridised, as will be determined by the skilled person
Washing
[0244] Following hybridisation, the dynabeads were concentrated, and the hybridisation solution removed. The samples were returned to 62 C. prior re-suspension of the dynabeads in 150 l of pre-warmed (62 C.) 1 wash solution (50 mM HEPES, 0.04% PVP, 10 mM MgCl.sub.2, 6.8 mM 2-MercaptoEthanol. pH 8.5). The samples were incubated at 62 C. for 5 min.
[0245] The dynabeads were concentrated, and the wash solution removed. The samples were returned to 62 C. prior re-suspension of the dynabeads in 50 l of 1 hybridisation buffer supplemented with 5 U of Hybridase Thermostable RNase H (Epicentre). The samples were incubated at 62 C. for 15 min.
[0246] The dynabeads were concentrated and the RNase solution was removed. The beads were washed once more (as above) in 150 l pre-heated wash solution, incubated at 62 C. for 5 min.
[0247] The dynabeads were concentrated and the wash solution was removed. The dynabeads were re-suspended, at room temperature, in 50 l 10 mM Tris HCl (pH 8.5).
[0248] In other examples, washing steps may be performed at a temperature in the range of 50 C. to 80 C., depending on the molecules hybridised, as will be determined by the skilled person.
LMPCR Elution of the Captured DNA Library Fragments for MiSeq Sequencing
[0249] 4100 l PCRs contained 1 Q5 PCR master-mix (NEB), 2 M of each library amplification primer (5 AATGATACGGCGACCACCGAG 3; 5 CAAGCAGAAGACGGCATACGAG 3) and 10 l of the bead bound captured DNA library. PCRs were cycled as follows: to 98 C. for 30 sec, 10 (98 C. for 30 sec, 65 C. for 1.5 min) 65 C. for 5 min then held at 15 C.
[0250] PCRs were purified using 0.5 AmpureXP beads (Beckman Coulter) according to the manufacturers standard operating procedure. Recovered fragment library DNA was eluted in 50 l 10 mM Tris HCl (pH 8.5) with incubation at 65 C. for 5 min prior to removal of the magnetic beads. Eluted samples were stored at 20 C.
Next Generation Sequencing of the Enriched DNA Libraries
[0251] All libraries had been prepared with linkers containing multiplex identifier sequences to allow sample pooling prior to sequencing. Illumina MiSeq sample pooling and sequencing was performed at the University of Leicester Genomics Service Facility (NUCLEUS). Sequencing was performed using the MiSeq Reagent Kit v3 (2300 nt) sequencing chemistry (Illumina).
Probe Sequence File Formats
[0252] Probe sequences were aligned to the human genome (GRCh37.p13 http://www.ncbi.nlm.nih.gov/projects/genome/assembly/grc/human/data/1 using the Bowtie 2 alignment algorithm (10), specifying the -f flag to state that the probe sequences were in the FASTA format (above) and the -S flag to indicate that the output should be written into files in the SAM format. The alignments, that were generated by Bowtie 2, in the SAM format were converted into a sorted and indexed BAM format using SAMtools (11). Finally, the bamToBed function of BEDtools (12) was used to tabulate the coordinates of each probe sequence in the BED format: chromosome number; start coordinates; and end coordinates.
NGS Sequence File Formats
[0253] FASTQ files were returned as standard from Illumina MiSeq sequencing. The Bowtie 2 alignment tool was used to align the NGS sequences to the human genome (GRCh37.p13). The -q flag was used to indicate that the sequences were in the FASTQ format, the -1 and -2 flags indicated that the NGS data comprised sequence pairs and the -S flag indicated that the output should be written into files in the SAM format. The output SAM files were converted to into sorted and indexed BAM files using SAMtools. Copies of the BAM files were made, and from these copied files, sequence duplicates were removed using the MarkDuplicates tool (Remove_Duplicates=True) of the Picard tool set (http://broadinstitute.github.io/picard/).HTE quality metrics were calculated using the Target Enrichment Quality Control (TEQC) (13) library for the R statistical package (14) (Results).
[0254] The raw BAM files were imported into TEQC. TEQC was used to filter out valid NGS sequence pairs (read-pairs) with the maximum distance permitted between reads paired sequences set to 5 kb.
The potential advantages of blocking with an R.Block molecule (such as produced by the methods of the invention, as exemplified in Examples 9 and 10) are: [0255] 1. R.Block generated from highly repetitive DNA, e.g. Cot-1 DNA, mask interspersed repetitive sequences making them unavailable for non-specific hybridisation. [0256] 2. R.Block generated from gDNA mask both interspersed repetitive sequences and non-repetitive sequences making them unavailable for non-specific hybridisation to probes. Note: The probe concentration needs to be sufficient such that it out-competes R.Block:target hybridisation. [0257] 3. Whole genome masking by R.Block generated from gDNA reduces networking between regions not found in Cot-1 DNA, e.g. Segmental Duplications and self-chain alignments. [0258] 4. RNA:DNA duplexes are more stable than DNA:DNA duplexes. Captured gDNA fragments containing repetitive sequences are more likely to hybridise to R.Block rather than other captured gDNA fragments. [0259] 5. RNA:DNA duplexes are more stable than DNA:DNA duplexes, so R.Block is more resistant to stringent conditions than equivalent DNA blockers. [0260] 6. A range of RNase species with differing properties can be used to break down the R.Block. Additional washing will remove an additional fraction of off-target fragments. This makes the R.Block versatile and useful for a range of additional applications. [0261] 7. R.Block can potentially be used in conjunction with RNA based probes and probes so long as RNase I.sub.f (NEB) is used to break down the R.Block. RNase I.sub.f preferentially cleaves single-stranded RNA rather than RNA: RNA or RNA: DNA duplexes. It may therefore be possible to optimise and use an R.Blocker in a target capture system based on RNA probes e.g. SureSelect (Agilent).
EXAMPLE 11USE OF R-BLOCK PRODUCTS IN A METHOD OF ANY ONE OF THE FIFTH TO EIGHTH ASPECT OF THE INVENTION FOR INTERSPERSED REPEAT DNA BLOCKING
[0262] A series of investigations to determine whether R.Block effectively blocks network formation via interspersed repeat DNA were performed.
The R.Block Products and multi-biotinlyated probes used, were manufactured according to the process described in Example 10. The investigation was an in solution target DNA capture.
The following R.Block preparations made according to the method of Example 10 were tested as blocking agents to block network binding of interspersed repetitive DNA sequences: [0263] 1. 5 g R.Block based on Cot-1 DNA (R.Block-Hc, h. Cot-1 in
Hybridisation was performed according to the optimised hTE procedure of Example 10.
Results
[0267] In brief it was found that R.Block based on human gDNA was a more effective network blocker than R.Block based on Cot-1 DNA. 10 g of R.Block performed more effectively than 5 g of R.Block, as shown in
EXAMPLE 12USE OF R.BLOCK PRODUCTS FOR BLOCKING A SURFACE, ACCORDING TO THE NINTH ASPECT OF THE INVENTION
Hybridisation
[0268] For this investigation, hybridisation mixes contained: 1 g of a gDNA fragment library of Example 6 (Average fragment size 1.2 kb); one blocker selected from: [0269] 1. 5 g human Cot-1 DNA. [0270] 2. 2.5 g Salmon gDNA and 2.5 g human Cot-1 DNA. [0271] 3. 5 g R.Block-Hg [0272] 4. 5 g R.Block-Sg [0273] 5. No blocking agent
33 pmol/l of oligonucleotides complementary to the library linkers (library blocking oligos); and 1 Superase. IN RNase inhibitor, diluted to 30 l in a proprietary hybridization buffer (containing 0.02% Ficol, 0.04% PVP, 45 mM Tris-HCl 11 mM Ammonium Sulphate, 20 mM MgCl.sub.2, 6.8 mM 2-Mercaptoethanol and 4.4 mM EDTA. pH 8.5) The hybridisation mixes did not contain any biotinylated probe and the R.Block products were thus made according to a similar process described in Example 9.
[0274] The hybridisation mixes were: incubated at 95 C. for 2 min; cooled at a rate of 1 C. every 10 sec to 10 C. above a pre-defined optimal annealing temperature; step-down incubated for 30 sec at every C. above the optimal annealing temperature and cooled at a rate of 1 C. every 10 sec between each C.; and incubated at the optimal annealing temperature for 24 hours.
Binding
[0275] 1 mg of streptavidin coated paramagnetic dynabeads was washed twice in the proprietary hybridisation buffer.
[0276] Two different dynabeads were used for this investigation. [0277] 1. MyOne streptavidin T1 (Invitrogen) was pre-coated with BSA by the manufacturer. [0278] 2. MyOne streptavidin C1 (Invitrogen) were un-coated
[0279] It was found that MyOne Streptavidin T1 tended to clump at temperatures 60 C., so its use was stopped.
[0280] Washing of the MyOne streptavidin C1 dynabeads at 65 C. reduced non-specific interaction between the dynabead surfaces and gDNA fragments better than washing at 55 C.
[0281] The dynabeads were then re-suspended in the hybridisation buffer and one of the following surface blocking agents was added: [0282] 1. 5 g human Cot-1 DNA. [0283] 2. 2.5 g Salmon gDNA and 2.5 g human Cot-1 DNA. [0284] 3. 5 g R.Block-Hg. [0285] 4. 5 g R.block-Hc.
[0286] The surface blocking agents act to mask or block repetitive sequence binding to the dynabeads.
[0287] These binding mixes were incubated at 55 C. for 30 min prior to heating to the pre-defined optimal annealing temperature.
Hybridisation mixes were then transferred to the binding solution, mixed with gentle pipetting and incubated at the optimal annealing temperature for 20 min.
Washing
[0288] Following hybridisation, the dynabeads were concentrated, re-suspended in a wash buffer (50 mM HEPES, 0.04% PVP, 10 mM MgCl.sub.2, 6.8 mM 2-MercapthoEthanol. pH 8.5). and incubated at a predefined washing temperature for 5 min.
[0289] The dynabeads were concentrated, re-suspended in: 1 RNase I.sub.f buffer (NEB); 50 U RNase If (NEB) (unless stated); and 1% Triton X-100 (Fluka) (total volume 50 pd); incubated at 37 C. for 15 min, and finally incubated at the predefined wash temperature for 5 min.
[0290] The dynabeads were again concentrated, re-suspended in a proprietary wash buffer and incubated at a predefined washing temperature for 5 min.
Finally, the dynabeads were concentrated, re-suspended in 50 l 10 mM Tris HCl (pH8.5).
qPCR
[0291] Control curve: An aliquot of the fragment library used for this investigation was initially diluted to 1000 ng/l. An aliquot was further diluted to 500 ng/l. These samples were serially diluted by a factor of 1 in 10 to cover the range from 1 ng/l to 0.0005 ng/l.
[0292] Primary PCR: Duplicate 25 l PCRs contained 1 Maxima SYBR Green hot start qPCR master mix (Maxima HS) (Thermo), 0.96 M Rapid A PCR primer, 0.96 M Rapid B PCR primer and 10 l vortexed test dynabeads (see above) or control DNA. PCRs were heated to 95 C. for 10 min followed by 7 cycles of (95 C. for 30 sec; 64 C. for 30 sec and 72 C. for 3 min). Finally PCRs were incubated at 72 C. for 5 min.
[0293] Secondary PCR: 25 l PCRs contained 1 Maxima HS, 0.96 M Rapid A PCR primer, 0.96 M Rapid B PCR primer and 1 l primary PCR following magnetic concentration of the beads (concentration not required for the control PCRs). PCRs were performed on the Light Cycler 480 (Roche). PCRs were heated to 95 C. for 10 min followed by 30 cycles of (95 C. for 30 sec; 64 C. for 30; 72 C. for 3 min; and imaging).
Analysis of the qPCR Data
[0294] A standard curve was plotted for the control series. The mass of gDNA library bound to each 0.2 mg of dynabeads was determined relative to the standard curve. The recovered mass was used to calculate the percentage of library fragment recovery caused by interactions with the dynabeads surface.
[0295] Results Cot-1DNA offered no significant reduction in bead surface to DNA fragment interaction when compared to un-blocked beads. Background recovery in both cases was >0.3%.
[0296] Samples containing combinations of Salmon gDNA with Cot-1DNA, R.Block-Hc or R.Block-Hg reduced background DNA fragment recovery to <0.01%. 5 g and 10 g of R.Block based on salmon gDNA (R.Block-Sg) was also tested. Results indicated that the efficacy of blocking non-specific capture of DNA was, in order, R.Block-Sg>R.Block-Hg>R.Block-Hc.
EXAMPLE 13USE OF R.BLOCK PRODUCTS VS DNA BASED BLOCKERS FOR NETWORK BLOCKING AND SURFACE BLOCKING
[0297] For this investigation, the hybridisation and binding protocol of Example 10 was used, with varying combinations of blocking agent, one for use in the hybridisation mix (as network blocker during the hybridisation step of Example 10) and the other in the surface blocking mix (binding mix during the binding step of Example 10). [0298] 1. 10 g Cot-1 DNA in the hybridisation mix (network blocker), 10 g Cot-1 DNA in the blocking mix (surface blocker). [0299] 2. 10 g Cot-1 DNA in the hybridisation mix, 10 g salmon gDNA in the blocking mix. [0300] 3. 10 g R.Block-Hg in the hybridisation mix, 10 g R.Block-Hg in the blocking mix (B1 in
[0305] The target DNA comprised 1 g of a gDNA fragment library (average fragment size 1 kb). MyOne Streptavidin C1 paramagnetic dynabeads were used instead of MyOne Streptavidin T1 (Invitrogen). The dynabeads were washed three times in 1 hybridisation buffer at room temperature. Finally the dynabeads were re-suspended in 20 l to 65 l of 1 hybridisation buffer containing 1 U/l SUPERase .IN (Ambion) and 5 g of the relevant blocking agent. This was incubated at 55 C. for 30 min prior to being heated to a pre-determined binding temperature and the addition of the hybridisation mix. Next generation sequencing was performed on the Illumina MiSeq platform.
Results
[0306] The results for mixes 1, 2, 3, 5 and 7 are shown in
The combination of network blocking with R.Block-Hg and surface blocking with R.Block-Sg was in fact approximately 4 times as effective as using Cot-1 DNA blocker alone and approximately 2 times as effective as using Cot-1 DNA and salmon DNA (as network and surface blockers respectively), as shown in
[0307] In addition, several potential advantages of the R.Block have been identified over the use of DNA based blockers. For example R.Block-Hc, -Sg and -Hg not only block surface interactions, but also mask interspersed repetitive sequences. This is beneficial when performing in solution target capture. [0308] It was also found that R.Block-Hg was at least twice as effective a network blocker as Cot-1 DNA. R.Block-Sg and Salmon gDNA worked with similar efficiencies when used as surface blockers. Cot-1 DNA did not perform particularly well as a surface blocker or a network blocker. The best combination of blockers was determined to be R.Block-Hg as the network blocker with either R.Block-Sg or Salmon gDNA as the surface blocker.
[0309] The above examples and embodiments are described by way of example only. Many variations are possible without departing from the scope of the invention as defined in the appended claims.