VECTORS

Abstract

We disclose dumbbell-shaped vectors adapted for efficient expression in mammalian cells. We also disclose a novel method allowing the efficient synthesis of dumbbell-shaped vectors at low cost for delivery of recombinant DNA and RNA into host cells; and the use of dumbbell-shaped vectors for transient expression in, for example, primary human cells.

Claims

1.-35. (canceled)

36. A dumbbell-shaped expression vector wherein said vector comprises: i) one or more linear or hairpin-shaped transcription cassettes each comprising a nucleotide sequence encoding a nucleic acid molecule to be expressed; ii) a nucleotide sequence comprising a DNA nuclear targeting sequence; iii) a nucleotide sequence comprising an enhancer nucleotide sequence and optionally at least one intron associated with said enhancer nucleotide sequence to enhance expression of said expressed nucleic acid molecule; iv) a nucleotide sequence comprising a post-transcriptional regulatory element or a constitutive nuclear transport element; and v) a nucleotide sequence comprising a sequence with homology to a part of a mammalian genome that can serve as repair template which is either single or double stranded for RNA-guided genome editing.

37. The vector according to of claim 36 wherein the one or more linear or hairpin-shaped transcription cassettes each comprising a nucleotide sequence encoding a nucleic acid molecule to be expressed is linked to a minimal transcription promoter nucleotide sequence.

38. The vector according to claim 37 wherein said minimal transcription promoter sequence further comprises a transcription termination nucleotide sequence wherein transcription initiation and termination nucleotide sequences are operatively coupled.

39. The vector according to claim 36 wherein said vector comprises at least one internal loop domain.

40. The vector according to claim 39 wherein said loop domain comprises an abasic site or nucleotide mismatch.

41. The vector according to claim 40 wherein said abasic site comprises one or more apurinic/apyrimidinic abasic sites.

42. The vector according to 40 wherein said nucleotide mismatch comprises a tetrahydrofuran-based mimic of an abasic site.

43. The vector according to 36 wherein said post-transcriptional regulatory element is the WPRE.

44. The vector according to 36 wherein said nucleic acid molecule to be expressed encodes a therapeutic protein or peptide.

45. The vector according to claim 44 wherein said therapeutic protein or peptide is selected from the group consisting of: antigen, Cas9, Cas9n, hSpCas9, hSpCas9n, HSVtk, a cell death trigger protein, cholera toxin, diphtheria toxin, alpha toxin, anthrax toxin, exotoxin, pertussis toxin, shiga toxin, shiga-like toxin Fas, TNF, caspases, initiator caspases, caspase 2, 8, 9, 10, 11, 12, and effector caspases, caspase 3, 6, 7 and purine nucleoside phosphorylase. (antigen disclosed on page 18, lines 28-31)

46. The vector according to 36 wherein said expressed nucleic acid molecule is a therapeutic nucleic acid molecule.

47. The vector according to claim 46 wherein said therapeutic nucleic acid is selected from the group consisting of: a microRNA, a siRNA or shRNA, an antisense RNA oligonucleotide, an antisense miRNA, a trans-splicing RNA, a guide RNA, single-guide RNA, crRNA, or tracrRNA, a trans-splicing RNA, a pre-mRNA or mRNA, hsa-mir-30 stem, hsa-mir-125b, and hsa-mir-21. (microRNA disclosed in Example 2, page 45; hsa-mir-30 stem disclosed on page 20, line 25-26; hsa-mir-125b disclosed on page 22, description of FIG. 5; hsa-mir-21 disclosed on page 23, description of FIG. 7)

48. A pharmaceutical composition comprising a dumbbell-shaped vector according to claim 36.

49. A method to generate a dumbbell-shaped vector substantially free of bacterial nucleotide sequences comprising: i) providing a preparation comprising a first single stranded nucleic acid template comprising a target nucleic acid molecule comprising a nucleotide sequence of interest; ii) contacting said first single stranded nucleic acid template with an first oligonucleotide primer comprising a 5-phosphate and a 3-hydroxyl group that is complementary to at least part of the 3 terminal nucleotide sequence of said single stranded nucleic acid template and further comprising a 5 nucleotide sequence not complementary to the target nucleic acid molecule wherein said oligonucleotide primer comprises a modified nucleotide sequence that prevents extension of the 5 nucleotide sequence not complementary to the target nucleic acid molecule; iii) providing polymerase chain reaction components and primer extending the 3 annealed oligonucleotide primer to form a second template; iv) contacting said second template with a second oligonucleotide primer comprising a 5-phosphate and a 3-hydroxyl group that is complementary to at least part of the 3 terminal nucleotide sequence of said second template and further comprising a 5 nucleotide sequence not complementary to the second template wherein said oligonucleotide primer comprises a modified nucleotide sequence that prevents extension of the 5 nucleotide sequence not complementary to the second template; v) providing polymerase chain reaction components and primer extending the 3 annealed oligonucleotide primer to form a double stranded nucleic acid; vi) polymerase chain amplify the double stranded nucleic acid to synthesize a pool of template DNA and annealing said templates to create double stranded nucleic acid comprising a 5 nucleotide sequence not complementary to the target nucleic acid molecule; and vii) contacting the annealed template nucleic acid with a DNA ligase to link the terminal 5-phosphate of the non-complementary 5 nucleotide sequence to the 3-OH of said amplified template nucleic acid to create a terminal loop structure.

50. The method according to claim 49 wherein said oligonucleotide primer comprises a nucleotide sequence that is non-complementary with said target nucleic acid molecule but includes a region of internal complementarity over part of its length that forms a stem loop structure.

51. The method according to claim 50 wherein said oligonucleotide primer includes a palindromic nucleotide sequence over part of its length as a modification.

52. The method according to claim 51 wherein said oligonucleotide primer modification is the inclusion of an abasic site in said primer.

53. The method according to claim 52 wherein said abasic site is an apurinic/apyrimidinic site, for example a tetrahydrofuran.

54. The method according to claim 49 wherein said abasic site separates the region complementary to the 3 terminal nucleotide sequence of said single stranded nucleic acid template and the 5 nucleotide sequence not complementary to the target nucleic acid molecule.

55. The method according to 49 said DNA ligase is a phage DNA ligase or a circligase.

Description

[0140] An embodiment of the invention will now be described by example only and with reference to the following figures:

[0141] FIG. 1: Generation of novel minimised shRNA or miRNA expressing dumbbell vectors. A, Schematic drawing of novel minimised (lower part) and conventional (upper part) small RNA expressing dumbbell vectors. Structures of hairpin (hp) template-transcribing dumbbells (db) containing the minimal H1 promoter (mH1), an inverted transcriptional terminator (A.sub.5) which for some constructs is integrated into the mH1 promoter forming an integrated promoter-terminator element (iPT), and a hairpin-structured shRNA transcription template in sense-loop-antisense (s/as) or antisense-loop-sense (as/s) orientation. The hairpin template of construct db-miR-hp-s/as harbours a hsa-miR-30 stem (miR) extension. Conventional dumbbells harbour a linear expression cassette and separated mH1 promoter and terminator elements. B, Implementation of the inverted transcriptional terminator into the mH1 promoter for the different constrcuts. C, Novel protocol for the generation of minimised small RNA expressing dumbbells. The promoter is PCR-amplified using a 5-phosphorylated forward primer introducing a Nb.Bpu10I cleavage site and a reverse primer introducing a sticky end producing endonucleolitic cleavage site. After enzymatic cleavage, the upstream loop forms by intramolecular ligation of the overhang. Ligation of a chemically synthesised hairpin structure-forming oligonucleotide completes the downstream portion of the dumbbell. D, Agarose gel electrophoresis analyses of the ligated dumbbells before (?) and after (+) exonuclease treatment. Different variations of the protocol trigger different indicated conversion yields. Variant (1): no purification step; variant (2): binding of an antisense oligonucleotide to the released single-stranded Nb.Bpu10I cleavage product suppresses religation; variant (3): small enzymatic cleavage products are removed by gel permeation chromatography; variant (4): combination of variants (2) and (3). HEK293T cells (E) or HepG2 cells (F) were co-transfected in 24-wells with 400 ng pGL3 and 100 ng dumbbell DNA and luciferase knock-down was monitored 48 h post transfection. Error bars indicate mean deviations from average of three to five independent experiments. Significance was tested using one-way ANOVA with Newman-Keuls post hoc test.

[0142] FIG. 2: Comparison of promoter strengths with regard to miR-125b expression. A, The miR-125b expression cassette was cloned into plasmid vectors pCDNA3.1 (CMV prometer), pSuper (H1 promoter) and a modified pSuper-mH1 (mH1 promoter) to generate pCDN3.1-125b, pSuper-125b, and pSuper-mH1-125b. B, 5?10.sup.5 cells seeded in 6-well were transfected with 1000 ng miR-125b expressing vectors or the respective empty control vectors. 24 h post transfection small RNA was isolated and absolute miR-125b levels were quantified using TaqMan-probe-based rtRT-PCR (4). C, 5?10.sup.4 cells seeded in 24-well were transfected with 300 ng miR-125b expressing vectors or the respective empty control vectors;

[0143] FIG. 3: Kinetics of cellular dumbbell (db) delivery (A), nuclear db-delivery (B), dumbbell-driven small hairpin (sh)RNA expression (C), and shRNA-dumbbell-triggered target gene knock-down in human tissue culture cells (D). HEK293T cells were co-transfected in 24-wells using Lipofectamin 2000 with a luciferase reporter vector (250 ng/well) and equimolar amounts (0.12 pmol/well) of either a db-vector (two different designs) or a plasmid expressing a luciferase targeting shRNA. 10 min, 1 hrs, 6 hrs, and 24 hrs post transfection total episomal DNA, nuclear episomal DNA or small RNA was isolated and either the shRNA gene or the shRNA was quantified by SybrGreen rtPCR (A) or TaqMan-probe-based rtPCR (B) or rtRT-PCR (C). 6 hrs, 12 hrs, and 24 hrs after transfection, shRNA-triggered luciferase knock-down was measured. Luciferase expression was not yet detectable 10 min and 1 hrs post transfection. Error bars indicate mean deviations from average of two (A) or three (B,C,D) independent experiments. Significance was tested using one-way ANOVA with Newman-Keuls post hoc test;

[0144] FIG. 4: Kinetics of cellular dumbbell (db) delivery (A), nuclear db-delivery (B), dumbbell-driven small hairpin (sh)RNA expression (C), and shRNA-dumbbell-triggered target gene knock-down in human tissue culture cells (D). HEK293T cells were co-transfected in 24-wells using Lipofectamin 2000 with a luciferase reporter vector (250 ng/well) and equimolar amounts (0.12 pmol/well) of either a db-vector (two different designs) or a plasmid expressing a luciferase targeting shRNA. 10 min, 1 hrs, 6 hrs, and 24 hrs post transfection total episomal DNA, nuclear episomal DNA or small RNA was isolated and either the shRNA gene or the shRNA was quantified by SybrGreen rtPCR (A) or TaqMan-probe-based rtPCR (B) or rtRT-PCR (C). 6 hrs, 12 hrs, and 24 hrs after transfection, shRNA-triggered luciferase knock-down was measured. Luciferase expression was not yet detectable 10 min and 1 hrs post transfection. Error bars indicate mean deviations from average of two (A) or three (B,C,D) independent experiments. Significance was tested using one-way ANOVA with Newman-Keuls post hoc test;

[0145] FIG. 5: Knock-down of firefly luciferase-miR-125b sensor reporter gene expression triggered by hsa-miR-125b-expressing dumbbells. A, Design of dumbbell db-linear-miR-125b harbouring a linear miR-125b expression cassette and the minimised dumbbell db-hairpin-miR-125b equipped with a hairpin miR-125b transcription template. db-mEnh-miR-125b: dumbbell harbouring the 72 bp minimal SV40 enhancer; db-fEnh-miR-125b: dumbbell including the 237 bp full length SV40 enhancer. Sequences coding for mature miR-125b (red) and miR-125b* (blue) are highlighted and the resulting pre-miR125b-1 RNA sequence and secondary structure is indicated. B, Sensing of plasmid vs. dumbbell-driven miR-125b overexpression in HepG2 cells. Cells were transfected in 24-wells with 250 ng sensor plasmid alone or together (+) with 250 ng miR-125b expressing dumbbells or plasmid. Dumbbell db-hairpin-miR-125b was generated either using the conventional method (ELAN) or our (New) protocol. HEK293T (C) or CL48 (D) cells seeded in 24-wells were (co-) transfected either with 100 ng pMIR-125b-Sensor alone or together with 100 ng db-hairpin-miR-125b (New) (no feeder used for this). (B) to (D), Luciferase knockdown was monitored 48 h post transfection. Error bars indicate mean deviations from average of three independent experiments. E, Knockdown of luciferase-miR-125b sensor reporter gene expression by miR-125b over-expressed from different dumbbells in HepG2 cells. Cells seeded in 24-wells were (co-)transfected with 100 ng pMIR-125b-Sensor alone or together with 1.5 pmol dumbbell DNA (feeder pUC119) and luciferase knockdown was monitored 48 h post transfection. Error bars indicate mean deviations from average of four independent experiments. Significance was tested using one-way ANOVA with Newman-Keuls post hoc test;

[0146] FIG. 6: Knock-down of firefly luciferase-miR-125b sensor reporter gene expression triggered by hsa-miR-125b-expressing dumbbells. A, Design of the miR-125b sensor plasmid pMIR-125b-Sensor harbouring three miR-125b binding site in the 3 UTR and plasmid pMIR-125b. Sequences coding for mature miR-125b (red) and miR-125b* (blue) are highlighted. B, Sensing of endogenous and/or pMIR-125b-triggered miR-125b overexpression. HepG2 cells seeded in 24-wells were (co-)transfected with 400 ng pMIR or pMIR-125b-Sensor plus 400 ng pSuper feeder DNA or 100 ng pMIR-125b.

[0147] FIG. 7: Functional knockdown of hsa-miR-21 by antisense-miR-21 (anti-miR-21) expressing dumbbell vectors in CL48 cells. A, Sequences and minimum free energy RNA secondary structures of miR-21-targeting antisense RNAs (Al to A4) as predicted by mfold and RNAfold and positioning relative to the miR-21 precursor. B, Design of the miR-21 sensing luciferase reporter plasmid with three fully complementary miR-21 binding sites. C, Design of anti-miR-21-A1, -A2,-A3, or -A4-expressing dumbbell vectors. D, CL48 cells seeded in 24-wells were (co-)transfected with 100 ng pMIR-21-Sensor alone or together with 100 ng anti-miR-21-expressing dumbbell vector DNA and functional miR-21 knockdown was monitored 24 h post transfection. Error bars indicate mean deviations from average of two independent experiments. Significance was tested using one-way ANOVA with Newman-Keuls post hoc test;

[0148] FIG. 8: Enhancement of dumbbell vs. plasmid-driven luciferase expression by the 6-globin gene chimeric intron and/or the full length SV40 enhancer. A, Design of dumbbell vectors. db-luc: parental vector; db-luc-enh: SV40 enhancer dumbbell; db-int-luc: intron dumbbell; db-int-luc-enh: intron-enhancer dumbbell. Luciferase expression triggered by equimass amounts dumbbell vectors and equivalent plasmids in HEK293T (B) or HepG2 (C) cells 48 h post transfection. Error bars indicate mean deviations from average of three to five independent experiments. Significance was tested using one-way ANOVA with Newman-Keuls post hoc test;

[0149] FIG. 9: Generation of a chimeric AFP-HSVtk RNA in HepG2 cells triggered by a trans-splicing RNA expressed from a dumbbell or plasmid vector. A, Design of a dumbbell vector for the expression of a trans-splicing RNA suitable to label the AFP pre-mRNA with the HSVtk message via 3 exon labelling. BD: AFP-specific antisense binding domain; 3SS: 3 splice acceptor site. B, The trans-splicing RNA binds to intron 5 of the AFP pre-mRNA via the specific binding domain and triggers splicing in trans between the splice donor site of AFP intron 5 and the splice acceptor site of the trans-splicing RNA. Binding sites of AFP- or HSVtk-specific TaqMan probes are indicated. BP: branch point; Ppy: poly pyrimidine tract. C, HepG2 cells seeded in 24-wells were (co-) transfected with 500ng of a vector expressing an AFP minigene (encompassing exons 3 to 6 including introns 3 and 5) alone or together with 0.2 pmol of a trans-splicing RNA expressing plasmid or dumbbell vector. 24 h post transfection total RNA was isolated and relative levels of chimeric AFP-HSVtk transcripts were detected by TaqMan-probe-based rtRT-PCR using an AFP- or HSVtk-specific probe. Relative trans-splice activities were calculated by the comparative Ct method (??Ct) using ?-actin as internal control. The indicated chimeric RNA levels were calculated as 2-??Ct Error bars indicate mean deviations from average of three independent experiments. Significance was tested using one-way ANOVA with Newman-Keuls post hoc test;

[0150] FIG. 10: Schematic depiction of gap-primer-PCR (gpPCR)-based formation of DNA dumbbell vectors. In step 1, 5-phosphorylated primers harboring abasic gaps are used to amplify the expression cassette of interest. The polymerase halts as soon as the gap is reached, yielding a PCR product with 5-overhangs. Two kinds of gap-primers can be used: hairpin primers (hp) which prompt the 5-overhangs to fold back and to position them close to the 3-OH groups (left panel); or unstructured (loop) primers (right panel). In step 2, the gpPCR products are ligated to form the covalently closed dumbbell structure. Hp-primer products are ligated with the double-strand-specific T4 DNA ligase; loop-primer are ligated using the single-strand-specific CircLigase. Optionally, exonuclease treatment can be considered to purify the dumbbell DNA;

[0151] FIG. 11: Design and structure of chemically-modified gap-primers. Left panel: molecular structures of the abasic gaps; right panel: sequence and structure of hairpin and loop gap-primers. A, AP1 (dSpacer1) primers harbouring a single tetrahydrofuran-based abasic site mimic. B, AP3 (dSpacer3) primers harbouring three tetrahydrofuran-based abasic site mimics. C, S9 (PEG-150) primers harbouring a triethylene glycol-based spacer;

[0152] FIG. 12: Dumbbell DNA vector formation using hairpin (hp)-gap-primer PCR. Products yielded from gpPCR using the AP1-hp, AP3-hp, and S9-hp primers were analysed before (lanes 2, 6, and 10) and after ligation (lanes 4, 8, and 12). The unligated (lanes 3, 7, and 11) and ligated products were subjected to T7 DNA polymerase (exonuclease) treatment (lanes 5, 9, and 13). Highest dumbbell yields were observed with AP1-hp primers (lane 5) followed by the AP3-hp primers (lane 9). No dumbbell DNA was detectable with the S9-hp primers (lane 13). Ethidium bromide stain of a 10% PAGE;

[0153] FIG. 13: Conversion yields from linear gpPCR products to covalently closed dumbbell DNA. gpPCR products were either treated with ligase and exonuclease or not, and subjected to 10% PAGE. Band intensities of the ethidium bromide stained gels were quantified using ImageJ 1.37v software (NIH, USA). A, hp-primer PCR products. B, AP1-loop-primer PCR product. C, Anti-GFP-shRNA expressing dumbbell db-Nick produced with the nicking enzyme method. D, Anti-luciferase-shRNA expressing dumbbell db-ELAN produced with the ELAN method;

[0154] FIG. 14: Purity of dumbbell vectors produced using different technologies. Db-AP1-hp and db-AP3-hp: gpPCR-produced dumbbells using primers AP1-hp or AP3-hp; db-ELAN: ELAN-produced dumbbell; db-Nick: egfp-targeting dumbbell produced using the nicking enzyme method. A, 10% PAGE analysis. B, High-resolution capillary gel electrophoresis. The indicated purity in % refers to the total fraction of dumbbell vector DNA in the analysed sample;

[0155] FIG. 15: Luciferase target gene knockdown in HEK293T cells triggered by shRNA expressing dumbbells and plasmids. A, Cells were co-transfected with 90 ng luciferase reporter vector pGL3 and 90 ng (equimass amounts) dumbbell or plasmid DNA. Firefly luciferase expression levels relative to the uninhibited negative control. Values are mean values ?SEM of two (d-ELAN) or three (rest) independent experiments. B, Cells were co-transfected with 90 ng luciferase reporter vector pGL3 and 0.5 pmol (equimolar amounts) dumbbell or plasmid DNA. Firefly luciferase expression levels relative to the uninhibited negative control. Values are mean values ?SEM of three independent experiments. A and B, the statistical analysis was performed using repeated one-way ANOVA plus a post-hoc Newman-Keuls test. The significance was denoted as *** p<0.001; ** p<0.01; * p<0.05. C, Structures/topology of the tested DNA vectors. All vectors harbour a 151 bp shRNA expression cassette. Hairpin loops and internal loops within the dumbbell (db) vectors are indicated as circles, i.e. small/large circles indicate small/large loops. All dumbbell vectors were tested after ligation and exonuclease treatment. Vector db-AP1-hp was additionally tested after skipping either the exonuclease treatment (exo-) or both ligation and exonuclease treatment (lig-). The pSuper plasmid vector was tested as supercoiled DNA, after linearization with KpnI (single cut), or after KpnI/BamHI digestion (double-cut). The shRNA expression cassette was contained in the smaller 194 bp KpnI/BamHI fragment. AP1 or AP3 abasic site mimics were counted as 1 or 3 nt, respectively;

[0156] FIG. 16: gpPCR-generated dumbbells harbour abasic sites that trigger the formation of internal loops close to the ends of the dumbbells. Abasic sites can be cleaved by the apurinic/apyrimidinic enzyme 1 (APE1) in human cells prior to base excision and/or nucleotide incision repair;

[0157] FIG. 17: Model describing facilitated NPC entry by dumbbell vectors with flexible ends. A,

[0158] Internal loops generated by hairpin-gap-primer PCR trigger increased flexibility of dumbbell ends. B, Rigid dumbbells might enter the NPCs only when approaching them in nearly perpendicular orientation to the nuclear membrane. C, The more flexible ends of the gpPCR-dumbbells could facilitate dumbbell entry into the NPCs even from more oblique angles. D, Dumbbells harbouring small loop might freely pass through the medium-sized NPC channels; however, larger loops may enlarge the DNA effective diameter beyond the cut-off value for passage through midsize NPC meshes, forcing them to enter the nucleus via the much less abundant larger channels;

[0159] FIG. 18: Nuclear vector delivery (A) and transcriptional vector activity (B) measured by qPCR or qRT-PCR respectively. Values in B refer to the control value 1. Values are mean values ?SEM of three independent experiments. The statistical analysis was performed using repeated one-way ANOVA plus a post-hoc Newman-Keuls test. The significance was denoted as *** p<0.001; ** p<0.01; * p<0.05;

[0160] FIG. 19: Scheme of the generation of the dumbbell-shaped DNA vector. The eGFP expression cassette was cut out from an eGFP expression vector using the restriction enzymes NdeI and XhoI. Though the vector used in this example uses a retroviral LTR as promoter, it is not an integrating vector because it lacks the integrase as well as any other coding viral sequences. Subsequently loops were ligated to the eGFP expression cassette using T4 DNA ligase. Ligation was supported by the restriction enzymes which can cleave mis-ligated products but not the correct dumbbell. The dumbbell structure was then purified by exonuclease digestion using DNA polymerase I which protects the covalently closed dumbbell but hydrolyses all unligated DNA;

[0161] FIG. 20: Sustained eGFP expression in primary human PBMCs triggered by the dumbbell-shaped DNA vector measured using flow cytometry. Equimolar and equimass amounts of the dumbbell vector were compared with the corresponding parental plasmid vector and a buffer control (Mock). A, Mean intensity of eGFP-positive cells; B, median intensity of eGFP-positive cells; C, percentage of eGFP-positive cells;

[0162] FIG. 21: Design of db-vectors for RNA-guided genome editing. A, Basic vector expressing one gRNA and either Cas9 or Cas9n. Two vectors expressing different gRNAs are needed if the nickase is used. Basic vector equipped with WPRE (A1), an enhancer/nuclear targeting signal (A2), or both functional elements (A3). B, Nickase vector with two gRNA genes. Nickase vectors following designs C1 to D2 will also be tested with two gRNA genes. C1/C2, vector as A to B including the double-stranded DNA donor template upstream/downstream of the caspase gene. D1 and D2, vectors harboring a single-stranded donor template embedded in one of the respective terminal loops. E, vector amalgamating all functional elements/those confirmed to improve genome editing activity.

[0163] FIG. 22: Design and generation of dumbbell vector for CRISPR/Cas-based RNA-guided genome editing. A, Basic dumbbell vector as described in FIG. 12 expressing one G6PD-Mahidol-targeting gRNA and either Cas9 or Cas9n. Generation of Cas9 or Cas9n-expressing dumbbells harbouring different guide RNAs using the ELAN method before (B) or after (C) exonuclease treatment. Ethidium bromide stain of 1% agarose gel.

[0164] FIG. 23: A, Cutter assay results for Cas9 editing. Real-time PCR relative quantification of remaining intact pVAX1-Mahidol in episomal DNA extract after co-transfection with Cas9-expressing plasmid or dumbbell constructs in 293T cells, with respect to pVAX1-Mahidol-only control. g4/g16/g17/g20: guide sequence candidates. g(?ve): universal negative control guide sequence, which does not bind the target region but still gives rise to a guide RNA transcript folding the necessary secondary structure for Cas9 recruitment. Guide RNAs containing guide sequences 4, 16 and 17 were found to be effective cutters, when used in conjunction with wild type Cas9. (*: p<0.05, two-tailed t-test, n=3; error bars represent SEM). B, PCR-RFLP qualitative analysis of reversal of G6PD-Mahidol mutation in 293T episome. A 104 bp fragment of G6PD exon 6 was PCR amplified using a mutagenic primer pair. If the template carries the G6PD-Mahidol mutation, the amplicon is cut by subsequent HindIII restriction digestion, showing two bands at 88 bp and 22 bp. If the template is WT (repaired), the amplicon is not cut, and the single 104 bp band remains. All samples run in pairs; uncut on left lane and HindIII digested on right lane. +ve: positive control treated with only the WT repair target plasmid. ?ve: negative control treated with only pVAX1-Mahidol. p: plasmid; db: dumbbell. Appearance of 104 bp bands (arrowed) on cut lanes of Cas9-g4, Cas9-g16, Cas9-g17 and Cas9n-g16+g17 pair plasmid and dumbbell treated samples indicate successful repair of the G6PD-Mahidol point mutation on the episomal targethowever only qualitatively. (3% agarose, EtBr stained).

TABLE-US-00001 TABLE 1 Calculation of costs, excluding those for column purification, for the production of 1 ?g dumbbell DNA based on local prices in Singapore converted into USD. ELAN Nicking enzyme AP1-hp AP1-hp (exo-) AP3-hp AP1-loop db Db Db db db db Oligodeoxyribonucleotides FwP: 330 1st round PCR 5P-FwP: 65 5P-FwP: 65 5P-FwP: 94 5P-FwP: 94 (pmol) RvP: 110 FwP: 5.6 5P-RvP: 22 5P-RvP: 22 5P-RvP: 31 5P-RvP: 31 Loop1: 70 RvP: 5.6 Loop2: 70 2nd round PCR FwP: 70 RvP: 70 DNA polymerase Pfu: 11 1st round PCR Pfu: 2.2 Pfu: 2.2 Pfu: 3.1 Pfu: 3.1 (units) Taq: 22 Taq: 0.7 Taq: 4.4 Taq: 4.4 Taq: 6.3 Taq: 6.3 2nd round PCR Taq: 8.8 Restriction endonuclease XhoI: 9.7 NB. Bpu 10I: 8.8 (units) EcoRI: 9.7 SalI: 4.2 MfeI: 4.2 DNA ligase T4 DNA ligase: T4 DNA ligase: T4 DNA ligase: T4 DNA ligase: T4 DNA ligase: CircLigase: (units) 28 17.5 10.9 10.9 31.3 555 T7 DNA polymerase 28 17.5 10.9 15.6 13.3 (units) Total expenses.sup.[a] 72.5 21.1 13.2 7.0 23.8 211.1 (USD)

SEQUENCE LISTING

[0165]

TABLE-US-00002 SEQIDNO1: 5-AGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTG CATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGT AAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTC TTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATG CTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTG GAAAGGACGAAACACC-3 SEQIDNO2: 5-AATTCGAACGCTGACGTCATCAACCCGCTCCAAGGAATCGCGGGCCC AGTGTCACTAGGCGGGAACACCCAGCGCGCGTGCGCCCTGGCAGGAAGAT GGCTGTGAGGGACAGGGGAGTGGCGCCCTGCAATATTTGCATGTCGCTAT GTGTTCTGGGAAATCACCATAAACGTGAAATGTCTTTGGATTTGGGAATC TTATAAGTTCTGTATGAGACCACAGATCTAA-3 SEQIDNO3: 5-ATATTTGCATGTCGCTATGTGTTCTGGGAAATCACCATAAACGTGAA ATGTCTTTGGATTTGGGAATCTTATAAGTTCTGTATGAGACCACAGATCT AA-3 SEQIDNO4: 5-ATATTTGCATGTCGCTATGTGTTCTGGGAAATCACCATAAACGTGAA ATGTCTTTGGATTTGGGAATCTTATAAGTTCTGTATGAGACGGATCTAAA AA-3 SEQIDNO5: 5-GAATTCAAGGTACCAGATCTTAGTTATTAATAGTAATCAATTACGGG GTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGG TAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCA ATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACG TCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAG TGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGG CCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTG GCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTT GGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCA AGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCA ACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGG GCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTGGTTTAGTG AACCGTG-3 SEQIDNO6: 5-TGGTTGCTGACTAATTGAGATGCATGCTTTGCATACTT-3 SEQIDNO7: 5-AGCCTGGGGACTTTCCACACC-3 SEQIDNO8: 5-TGGTTGCTGACTAATTGAGATGCATGCTTTGCATACTTCTGCCTGCT GGGGAGCCTGGGGACTTTCCACACC-3 SEQIDNO9: 5-CGATGGAGCGGAGAATGGGCGGAACTGGGCGGAGTTAGGGGCGGGAT GGGCGGAGTTAGGGGCGGGACTATGGTTGCTGACTAATTGAGATGCATGC TTTGCATACTTCTGCCTGCTGGGGAGCCTGGGGACTTTCCACACCTGGTT GCTGACTAATTGAGATGCATGCTTTGCATACTTCTGCCTGCTGGGGAGCC TGGGGACTTTCCACACCCTAACTGACACACATTCCACAGC-3 SEQIDNO10: 5-CAGGTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAA ACTGGGCTTGTCGAGACAGAGACGACTCTTGCGTTTCTGATAGGCACCTA TTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAGG-3 SEQIDNO11 ATAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTT AACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTT GTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATA AATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAA CGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGG CATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCC CTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACA GGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAATC ATCGTCCTTTCCTTGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCG GGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCT TCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCG CCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCATC

[0166] Primers and enzymes

[0167] Primers for cloning of plasmids. Oligodeoxyribonucleotides shR-luc-plus 5-GATCCGAGCTGTTTCTGAGGAGCCTTCAAGAGAGGCTCCTCAGAAACAGCTCTTTT TC-3, shR-luc-minus 5-TCGAGAAAAAGAGCTGTTTCTGAGGAGCCTCTCTTGAAGGCTCCTCAGAAACAGCT, shR-gfp-plus 5-GATCCGCTGACCCTGAAGTTCATCTTCAAGAGAGATGAACTTCAGGGTCAGCTTTT TC-3, shR-gfp-minus 5-TCGAGAAAAAGCTGACCCTGAAGTTCATCTCTCTTGAAGATGAACTTCAGGGTCAGCG-3, Fw-SV40 5-ATGCGAGCTCCGATGGAGCGGAGAATGG-3, Rv-SV40 5-ATGCGAATTCGCTGTGGAATGTGTGTCAGTTAGG-3, Fw-pre-miR-125b 5-ATCGTCAGATCTTGCGCTCCTCTCAGTCCC-3, Rv-pre-miR-125b 5-ATCGATAAGCTTTAAAAAAGCACGACTCGCAGCTCC-3, BD-miR-125b-plus 5-pTCACAAGTTAGGGTCTCAGGGAATCACAAGTTAGGGTCTCAGGGAATCACAAGTTAGG GTCTCAGGGA-3, BD-miR-125b-minus 5-pAGCTTCCCTGAGACCCTAACTTGTGATTCCCTGAGACCCTAACTTGTGATTCCCTGAG ACCCTAACTTGTGAAGCT-3, BD-miR-21-plus 5-pTCAACATCAGTCTGATAAGCTAATCAACATCAGTCTGATAAGCTAATCAACATCAGTCT GATAAGCTA-3, and BD-miR-21-minus 5-pAGCTTAGCTTATCAGACTGATGTTGATTAGCTTATCAGACTGATGTTGATTAGCTTATC AGACTGATGTTGAAGCT-3 were synthesized by AITbiotech (Singapore).

[0168] Primers for db Production.

[0169] gpPCR method. Unmodified oligodeoxyribonucleotides Fw-luc 5-TAGAATTCATATTTGCATGTCGCTATGT-3, and Rv-luc 5-AACTCGAGAAAAAGAGCTGTTTCTGAG-3 were synthesized by AITbiotech (Singapore). dSpacer1 (AP1) oligodeoxyribonucleotides Fw-AP1-sh 5-pATCCAGTTTTCTGGA-AP1-TAGAATTCATATTTGCATGTCGCTATGT-3, Rv-AP1-sh 5-pAAGGTCTTTTGACCT-AP1-AACTCGAGAAAAAGAGCTGTTTCTGAG-3, Fw-AP 1-loop 5-pATCCAGTTTTCAGCA-AP 1-TAGAATTCATATTTGCATGTCGCTATGT-3, Rv-AP 1-loop 5-pAAGGTCTTTTCAGCA-AP 1-AACTCGAGAAAAAGAGCTGTTTCTGAG-3 and dSpacer3 (AP3) oligodeoxyribonucleotides Fw-AP3-sh 5-pATCTCCAGTTTTCTGGA-AP3-TAGAATTCATATTTGCATGTCGCTATGT-3, Rv-AP3-sh 5-pATCAGGTCTTTTGACCT-AP3-AACTCGAGAAAAAGAGCTGTTTCTGAG-3, Fw-AP3-loop 5-pATCTCCAGTTTTCAGCA-AP3-TAGAATTCATATTTGCATGTCGCTATGT-3, Rv-AP3-loop 5-pATCTCCAGTTTTCAGCA-AP3-AACTCGAGAAAAAGAGCTGTTTCTGAG-3 and PEG-150 (S9) oligodeoxyribonucleotides Fw-S9-sh 5-pATCGTCCAGTTTTCTGGA-S9-TAGAATTCATATTTGCATGTCGCTATGT-3, Rv-S9-sh 5-pATCGAGGTCTTTTGACCT-S9-AACTCGAGAAAAAGAGCTGTTTCTGAG-3, Fw-59-loop 5-pATCGTCCAGTTTTCAGCA-S9-TAGAATTCATATTTGCATGTCGCTATGT-3, Rv-59-loop 5-pATCGAGGTCTTTTCAGCA-S9-AACTCGAGAAAAAGAGCTGTTTCTGAG-3 oligodeoxyribonucleotides were synthesized by Integrated DNA Technologies (Coralville, USA).

[0170] Generation of hairpin template-transcribing dumbbells. Fw-Bpu-mH1 5-pTTAGGAGTTTTCTCCTAAGCATATTTGCATGTCGCTATGTGTTCTG-3, Rv-BamHI-mH1-pA 5-TGCAGGATCCCTTTTTTCTCATACAGAACTTATAAGATTCCC-3, neutralizing oligonucleotide 5-TTAGGAGTTTTCTCCTAA-3, hp-s/as, 5-pGATCTAAAAAGAGCTGTTTCTGAGGAGCCTCTCTTGAAGGCTCCTCAGAAACAGCTCTTTTTA-3, hp-miR-s/as, 5-pGATCCAAAAATCTTCTCAGTAGGCAAAGAGCTGTTTCTGAGGAGCCTCTCTTGAAGGCTCCTCA GAAACAGCTCCGCGCTCACTGAGAAGATTTTTG-3, hp-iPT-s/as, 5-pGATCTGAGCTGTTTCTGAGGAGCCTCTCTTGAAGGCTCCTCAGAAACAGCTCA-3, hp-iPT-as/s, 5-pTCGACAGG CTCCTCAGAAACAG CTCTCTCTTGAAGAG CTGTTTCTGAGGAG CCTG-3, hp-125b 5-pGATCTAAAAAAGCACGACTCGCAGCTCCCAAGAGCCTAACCCGTGGATTTAAACGGTA AACATCACAAGTTAGGGTCTCAGGGACTGAGAGGAGCGCATTTTTA-3 were synthesized by AITbiotech (Singapore).

[0171] nicking enzyme and ELAN method. Fw-shGFP 5-TTAGGAGTTTTCTCCTAAGCGAATTCATATTTGCATGTCGCTATGT-3, Rv-shGFP 5-TTAGGTCTTTTGACCTAAGCCTCGAGAAAAAGCTGACCCTGAA-3, Fw-linear 5-TTAGGAGTTTTCTCCTAAGCCTAGAACTAGTGGATCCCCGGG-3, Rv-linear 5-TTAGGTCTTTTGACCTAAGCCTCGAGGTCGACGGTATCGA-3, Fw-2.sup.nd 5-pTTAGGAGTTTTCTCCTAAGC-3 and Rv-2.sup.nd 5-pTTAGGTCTTTTGACCTAAGC-3, Rv-21-A1 5-pTTAGGTCTTTTGACCTAAGCAAAAAAGACTGATGTTGACTGTTGAATCTCATGGCAGG GAAAGAGTGGTCTCATACAGAACT-3, Rv-21-A2 5-pTTAGGTCTTTTGACCTAAGCAAAAAGATGTTGACTGTTGAATCTCATGGCAACACCGG GAAAGAGTGGTCTCATACAGAACT-3 Rv-21-A3 5-pTTAGGTCTTTTGACCTAAGCAAAAACGGGTAGCTTATCAGACTGATGTTGACTGTTGAA TGGGAA-3, Rv-21-A4 5-pTTAGGTCTTTTGACCTAAGCAAAAACTGATGTTGACTGTTGAATCTCATGGCAACACCA GGGGAAAGAGTGGTCTCATACAGAACT-3 and loop-primers for the ELAN method L1 5-AATTGTCCAGTTTTCTGGAC-3 and L2 5-TCGACAGGTCTTTTGACCTG-3 were synthesized by AITbiotech.

[0172] Primers and probes for qPCR detection were synthesised by AITbiotech. Stem-loop primer for reverse transcription of the luciferase-targeting shRNA was 5-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAGAGC-3, universal Taqman probe was FAM-5-TCGCACTGGATACG-3-MGB, qPCR forward primer for shlucRNA was 5-GAGCTGTTTCTGAGGAGCCTTC-3, qPCR universal reverse primer for shlucRNA was 5-GTGCAGGGTCCGAGGT-3. Taqman probe for mH1 promoter was FAM-5-TCTGGGAAATCACCATAAA-3-BHQ-1, qPCR forward and reverse primers for mH1 promoter were 5-TTCATATTTGCATGTCGCTATGTG-3 and 5-TCCCAAATCCAAAGACATTTCA-3, respectively. qPCR forward and reverse primers for ?-actin were 5-CTGGCACCCAGCACAATG-3 and 5-GCCGATCCACACGGAGTACT-3, respectively. Trans-splicing hybrid RNA was detected by AFP primers 5-AAGGCATCCCTTCCTGTATGC-3, 5-TTGCTGTGTCCCCGTGATC-3 and probe FAM-5-CCTACAATTCTTCTTTGGGCTGCTCGCT-3-BHQ-1 and HSVtk primers 5-CATCTTGCTGCAAAGCTGAAAA-3, 5-TTGCTGTGTCCCCGTGATC-3 and probe FAM-5-CCCCTGCCATCAACACGCGTC-3-BHQ-1.

[0173] Materials & Methods

[0174] Cell Cultivation and Transfection

[0175] Human HEK293T, HepG2, or CL48 cells were cultured in Dulbecco's Modified Eagle's Medium (DMEM) (Invitrogen) supplemented with 10% v/v heat-inactivated Fetal Bovine Serum (Hyclone) and 1% penicillin-streptomycin solution (Invitrogen). Cells were kept in humidified incubator with 5% CO.sub.2, and were passaged at 80-90% confluence. All transfection assays were performed using Lipofectamine 2000 (Invitrogen) following the manufacturer's recommendations.

[0176] Cloning of Plasmids

[0177] The 227 bp human H1 promoter of the pSuper? (Oligoengine) cloning vector was replaced by the 99 bp minimal H1 (mH1) promoter (5). Therefore, both DNA strands resembling the mH1 sequence were chemically synthesized, annealed, purified, and inserted into the pSuper plasmid using EcoRI and BgIII restriction sites to generate plasmid pSuper-mH1. The expression cassette for a firefly luciferase-targeting small hairpin RNA was cloned into the pSuper-mH1 vector. Therefore, oligodeoxyribonucleotides shR-luc-plus and shR-luc-minus were annealed and inserted into pSuper-mH1 using the BgIII and XhoI restriction sites to generate plasmid pSuper-mH1-shR-luc. Similarly, oligodeoxyribonucleotides shR-gfp-plus and shR-gfp-minus were annealed and inserted into pSuper-mH1 using the BgIII and XhoI restriction sites to generate plasmid pSuper-mH1-shR-gfp.

[0178] To generate the hsa-miR-125b expression plasmid pSuper-mH1-miR-125b, the miR-125b precursor gene was PCR amplified from chemically synthesized oligonucleotide template using primers Fw-pre-miR-125b and Rv-pre-miR-125b and inserted into pSuper-mH1 using the BgIII and HindIII sites. The 72 bp minimal SV40 enhancer sequence was synthesized by gene synthesis (GeneArt/Applied Biosystems, Regensburg) and the 237 bp full-length SV40 enhancer was amplified by PCR form plasmid pGL3-Control (Promega, Madison, Wis.) using primers Fw-SV40 and Rv-SV40. Both enhancers were cloned into pSuper-mH1-miR-125b using the SacI and EcoRI sites to generate plasmids pSuper-mH1-miR-125b-mEnh and pSuper-mH1-miR-125b-fEnh. To generate hsa-miR-125b and hsa-miR-21 luciferase reporter sensor plasmids, DNA sequences resembling three tandem repeats of the respective fully complementary miRNA binding sites BD-miR-125b-plus, BD-miR-125b-minus, BD-miR-21-plus and BD-miR-21-minus were chemically synthesized and inserted into pMIR-Report (Promega, Madison, Wis.) using the SacI and HindIII sites.

[0179] Firefly luciferase expression vectors were generated from plasmid pGL3-Control (Promega, Madison, Wis.) which also harbours the full length SV40 enhancer. The 132 bp chimeric human ?-globin mini-intron was synthesized by gene synthesis (GeneArt/Applied Biosystems, Regensburg) and inserted into pGL3-Control using the HindIII and NcoI sites to generate plasmid p-int-luc-enh. SV40 enhancer-negative plasmids p-luc or p-int-luc were generated from plasmids pGL3-Control or p-int-luc-enh by deleting the SV40 enhancer. Therefore these plasmids were cleaved with XbaI and BamHI and the vector backbones were ligated.

[0180] Taq DNA polymerase, pfu DNA polymerase, restriction enzymes, T4 DNA ligase, and T7 DNA polymerase, if not specified otherwise, were purchased from Life technologies (Singapore).

[0181] Dumbbell Vector Generation

[0182] gpPCR method. To generate the template for gap-primer PCR, pSuper-mH1-shR-luc was cleaved with restriction endonucleases KpnI and BamHI. Gap-primer PCR (gpPCR) was performed in a volume of 400 ?l using 400 ng pSuper-mH1-shR-luc/KpnI/BamHI template, 0.2 mM of each dNTP, 0.3 ?M of forward primer, 0.1 ?M reverse primer, and mixture containing 8 U Taq DNA polymerase and 4 U Pfu DNA polymerase. PCR cycling was done as follows: initial denaturing at 95? C. (3 min), then 30 cycles of denaturing at 95? C. (30 s), primer annealing at 53? C. (hp-primers) or 66? C. (loop-primers) (30 s), and extension at 72? C. (30 s), and final extension at 72? C. (5 min). gpPCR products were converted into dumbbells by ligation. All the PCR products were purified by QIAquick PCR Purification Kit (Qiagen). Each 1 ?g of gpPCR product was ligated as follows: AP1-hp products using 10 U T4 DNA ligase (Fermentas), AP3-hp with 20 U T4 DNA ligase, and AP1-loop products with 417 U CircLigase (Epicentre). Ligation with T4 DNA ligase was performed for 15 h at 22? C., ligation with CircLigase for 4 h at 60? C. For exonuclease treatment, 10 U T7 DNA polymerase was added per pg PCR product and the reaction was incubated for 30 min at 37? C.

[0183] Generation of hairpin template-transcribing dumbbells. To produce hairpin template-transcribing db-vectors, the minimal human H1 promoter (mH1) was PCR amplified using pSuper-mH1-shR-luc template, 5-phosphorylated primer Fw-Bpu-mH1 introducing a Nb.Bpu10I site and primer Rv-BamHI-mH1-pA introducing a BamHI site at 5 and 3 end, respectively. The PCR product was then cleaved using Nb.Bpu10I and BamHI and incubated at 37? C. for 4 hrs to release the oligonucleotide resulting from Nb.Bpu10I cleavage in the presence of neutralizing oligonucleotide to avoid reannealing before oligonucleotides were removed using a PCR purification kit (QIAgen). T4 DNA ligase was used to ligate the phosphorylated Nb.Bpu10I 5-overhang to the recessive 3-hydroxyl group to form one loop of the dumbbell and to ligate a 5 phosphorylated DNA hairpin structure comprising a BgIII overhang to the compatible BamHI sticky end to covalently close the dumbbell from the other side. DNA hairpin hp-s/as, hp-miR-s/as, hp-iPT-s/as, hp-iPT-as/s, hp-125b were used to generate db-iPR-hp-s/as, db-iPR-miR-hp-s/as, db-iPTR-hp-s/as, db-iPTR-hp-as/s, and db-hairpin-miR-125b, respectively. Ligation was performed in the presence of BamHI and BgIII to suppress the formation of alternative dumbbells. Resulting dumbbells were subjected to T7 DNA polymerase (Fermentas, Thermo Scientific) treatment to destroy unligated and misligated by-products.

[0184] Nicking enzyme method. For nicking-enzyme-based production we followed the protocol described by Taki et al. performing two rounds of PCR (6,7). Linear shRNA- (egfp- and luciferase-targeting), miRNA-, and miRNA-21 antagonist-expressing dumbbells were produced using this method. To produce the egfp-targeting dumbbell db-Nick, luciferase-targeting shRNA expressing dumbbell db-iPR-linear-s/as, or the miR-125b-1-expressing dumbbell db-linear-miR-125b, double-digested pSuper-mH1-shR-GFP, pSuper-mH1-shR-luc, or pSuper-mH1-miR-125b plasmid was used as the PCR template, respectively, the sequences of forward and reverse primers for the first PCR reaction were Fw-shGFP and Rv-shGFP for db-Nick, Fw-linear and Rv-linear for db-iPR-linear-s/as and db-linear-miR-125b. The sense and antisense primer sequences for the second PCR reaction were Fw-2.sup.nd and Rv-2.sup.nd, respectively.

[0185] To produce the miR-21-targeting miR-21 antagonist-expressing dumbbells db-anti-miR-21-A1/2/3/4, mH1 promoter was amplified using primers Fw-Bpu-mH1 and Rv-21-A1/Rv-21-A2/Rv-21-A3/Rv-21-A4. The miR-21 antagonist sequences were introduced by the reverse primers used. Exonuclease treatment was done as described above.

[0186] ELAN method. For ELAN-based production of dumbbell db-ELAN we followed the protocol by Cost et al. (8). 2000 ng PCR product was digested with each 2 U FD XhoI and FD EcoRI and each 25 pmol of the loop-sequences L1 and L2 were ligated using 10 U of T4 DNA ligase in the presence of 0.5 U of FD XhoI, FD EcoRI, FD SaII, and FD MfeI. Exonuclease treatment was done as described above.

[0187] Knockdown Assay

[0188] To monitor firefly luciferase target gene knockdown, HEK293T cells were co-transfected with luciferase reporter vector pGL3 (Promega) or the respective miRNA-sensor vectors and the respective small RNA expressing dumbbell or plasmid. To investigate gpPCR-generated dumbbells, 90 ng luciferase reporter vector pGL3 (Promega) and either 90 ng dumbbell or plasmid DNA (equimass) or 0.5 pmol of dumbbell or plasmid DNA (equimolar; pVAX1 plasmid was used as top-up DNA for dumbbell transfection) using Lipofectamine 2000 (Life Technologies) and luciferase knockdown was monitored 48 h post transfection. To investigate luciferase-targeting shRNA-expressing dumbbells, miR-125b-1-expressing dumbbells, and miR-21 antagonist-expressing dumbbells, HEK293T or HepG2 cells seeded in 24-wells were co-transfected with 250 ng reporter or sensor plasmid and specified amounts of dumbbell or plasmid.

[0189] RNA Extraction, Reverse Transcription, and qPCR Detection

[0190] To investigate the kinetics of transcription of the luciferase-targeting shRNA, 5?10.sup.5 cells were transfected with 1 pmol of either a db-vector (linear or hairpin designs) or plasmid pSuper-mH1-shR-Luc. 10 min, 1 h, 6 h, and 24 h post transfection total RNA was isolated using Trizol. (Life Technologies) following the manufacturers protocol and shRNA transcripts were quantified using the universal TaqMan-based RT-PCR protocol (4), and the fold change was determined by ??Ct quantification using ?-actin RNA as an internal standard.

[0191] To compare the efficiency of trans-splicing between plasmid and dumbbell vectors, 2?10.sup.5 HepG2 cells were transfected in equimass and equimolar amounts with the 3ER trans-splicing RNA dumbbell vector overexpressed with AFP mini gene plasmid using Lipofectamine 2000 reagent (Life Technologies). The 3ER trans-splicing RNA plasmid overexpressed with AFP mini gene transfected equimass was used as a comparing control. The total amount of DNA transfected was 1000 ng and empty pVAX1 vector was used to top up to the final concentration (in case of equimolar). RNA was extracted 24 hours post-transfection using RNeasy plus mini kit (Qiagen) following manufacturer's protocol. 500ng of total RNA was converted into cDNA with random primers using SuperScript III Reverse Transcriptase (Life Technologies). For real time RT-PCR, 25 ng of cDNA was amplified using the AFP and HSV-tk primer/probes. The fold change was determined by ??Ct quantification using ?-actin RNA as an internal standard.

[0192] To investigate the transcriptional activity of gpPCR-generated dumbbells, 10.sup.5 HepG2 cells were transfected with 0.25 pmol of dumbbell or plasmid DNA using Lipofectamine 2000. pVAX1 plasmid was used as control as well as a top-up DNA for dumbbell transfection. 24 h post transfection, cells were harvested and total RNA was isolated using Trizol. (Life Technologies) following the manufacturers protocol. Luciferase-targeting shRNA (shluc) was detected using the universal TaqMan-based RT-PCR protocol (4), and the fold change was determined by ??Ct quantification using ?-actin RNA as an internal standard.

[0193] All real-time PCR reactions were performed using 1XTaqMan Universal PCR Master Mix (Applied Biosystems) following the manufacturer's instructions using the 7900HT Fast realtime PCR system (Applied Biosystems).

[0194] Nuclear Import Assay

[0195] To investigate the nuclear import of different vectors, 5?10.sup.5 HepG2 cells were seeded in 6-well plates and transfected with 1 pmol of dumbbell or plasmid DNA using Lipofectamine 2000. pVAX1 plasmid was used as control as well as a top-up DNA for dumbbell transfection. 24 h post transfection, cells were harvested, washed twice with cold PBS, incubated in hypotonic buffer (20 mM Tris-Cl, pH 7.4, 10 mM NaCl, 3 mM MgCl.sub.2) for 15 min on ice, and lysed by 20 times dounce homogenization in hypotonic buffer. After centrifugation at 3,000 rpm for 10 min at 4? C., the supernatant (cytoplasmic fraction) was subsequently removed and the pellet (nuclear fraction) was further lysed by four freeze-thaw cycles using liquid nitrogen and a water bath. Lysed nuclei were centrifuged for 30 min at the maximum speed at 4? C. Total nuclear nucleic acids were extracted from the supernatant using Trizol and the absolute abundance of transfected vector DNA was determined by TaqMan qPCR quantification of the copy number of the minimal H1 promoter sequence using the 7900HT Fast realtime PCR system (Applied Biosystems). For qPCR quantification, respective rtPCR standard curves were used to measure db-AP1-hp, db-ELAN, and the supercoiled plasmid DNA.

[0196] Capillary Gel Electrophoresis

[0197] High-resolution capillary electrophoresis was performed using a QIAxcel? DNA high-resolution gel cartridge (Qiagen) on a QIAxcel system (Qiagen) according to the manufacturer's instructions. QX DNA Size Marker pUC18/HaeIII (Qiagen) was used to determine dumbbell vector size using 5 ng/?l QX Alignment Marker 15 bp/1 kb (Qiagen) as internal standard. The OL800 method was used for analysis.

[0198] Multiple Cloning Site Insertion Into CRISPR Plasmids

[0199] This study used the pX330-U6-Chimeric_BB-CBh-hSpCas9 (pX330; Addgene plasmid #42330) and the pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A) (pX335; Addgene plasmid #42335) plasmids (9) as expression platforms for the type II CRISPR gene editing system. pX330 encodes the type II CRISPR system with wild-type Cas9, while pX335 encodes the type II CRISPR system with the ?HNH Cas9 nickase (Cas9n), which carries the D10A amino acid change.

[0200] To facilitate dumbbell vector construction from pX330 and pX335, suitable restriction sites were required which separate the necessary components, such as the Cas9/Cas9n and sgRNA expression cassettes, from the components which would be excluded from the dumbbell vectors, such as the ampicillin resistance gene and long non-coding regions on the plasmid backbone. Existing restriction sites on pX330 and pX335 were assessed based on restriction enzyme availability, and the compatibility of their sticky ends for dumbbell loop ligation. Due to the absence of suitable restriction sites, a multiple cloning site bearing the XhoI, NheI and HindIII restriction sites was inserted into the existing PscI restriction site on pX330 and pX335. To introduce this multiple cloning site, an equimolar mixture of a pair of single-stranded DNA oligonucleotides (ssODN) (sense: 5-CATGCTCGAGGCTAGCAAGCTT-3; antisense: 5-CATGAAGCTTGCTAGCCTCGAG-3) was annealed by incubation at 95? C. for 5 min, then placed on the bench to cool gradually to room temperature. 5-OH phosphorylation was carried out using T4 Polynucleotide Kinase (PNK) (Thermo Scientific), to give a double-stranded DNA fragment with the respective restriction sites as well as PscI sticky ends. The pX330 and pX335 plasmids were digested with PscI (PciI) (Thermo Scientific), and the fragment ligated with T4 DNA Ligase (Thermo Scientific). The same approach was then used to introduce a second multiple cloning site bearing the BamHI, BsrGI and MluI restriction sites (ssODNs: sense: 5-GGCCACGCGTTGTACAGGATCC-3; antisense: 5-GGCCGGATCCTGTACAACGCGT-3) into the existing NotI restriction site on pX330 and pX335. FIG. 5 shows simplified plasmid maps of pX330 and pX335 with the multiple cloning sites (pX330-MCS and pX335-MCS respectively).

[0201] Ligation products were used to transform chemically competent Escherichia coli strain DH5?. Cryostocks (?80? C.) of E. coli DH5? were thawed on ice, and added to 1.5 mL microcentrifuge tubes containing 10 ?L of ligation product using pre-cooled pipette tips. Tubes were kept on ice for one hour, then subjected to heat shock at 42? C. for 90 seconds, and then immediately returned to ice for five minutes. To each tube, 1 mL of LB broth was added and tubes incubated at 37? C. for one hour with shaking. Bacteria were pelleted at 3,000 rpm and resuspended in 50 ?L of LB broth. Suspensions were plated on LB agar plates with 100 ?g/mL ampicillin and incubated overnight at 37? C. Viable transformants were screened for successful multiple cloning site insertion using colony PCR with recombinant Taq DNA polymerase (Thermo Scientific) and capillary electrophoresis sequencing (AITbiotech).

[0202] Design and Sub-Cloning of Guide Sequences

[0203] Possible gRNA target sites terminate in a protospacer adjacent motif (PAM) sequence. The S. pyogenes-derived CRISPR system used in this study recognizes target sites terminating in 5-NGG-3 PAMs (beginning in 5-CCN-3 for targets on the antisense strand) (9). Four candidate 20-nucleotide genomic target sites terminating in NGG or beginning with CCN were identified in close proximity to (within 50 bases of) the G6PD-Mahidol point mutation on exon 6. A universal negative guide sequence was also designed (adapted from Sigma-Aldrich), which when cloned into the CRISPR expression vectors, would also be transcribed into a sgRNA which folds the appropriate secondary structure and lacks predicted targets in the human genome (based on sequence alignments). This was required as a more suitable negative control as compared to an empty vector, since empty vectors not containing any guide sequence would not be transcribed into appropriately-folded sgRNAs capable of binding the Cas9/Cas9n endonucleases. Empty vectors are therefore unsuitable to control for Cas9/Cas9n activity in the absence of a target-complementary guide sequence.

TABLE-US-00003 TABLE gRNAcandidates,includinguniversalnegative guidesequence.Only20nttarget- complementaryguidesequencesareshown. Guidesequence Target-complementarysequence 4 5-TACCCCCTTGAACCCCTCTT-3 16 5-GATGCGGTTCCAGCTTCTGC-3 17 5-TCCGGGCTCCCAGCAGAAGC-3 20 5-CTCTGCAGGTCCCTCCCGAA-3 Universalnegative 5-CGCTACCAGAGCTAACTCA-3

[0204] Guide sequence and their respective complementary (antisense) ssODNs were designed with 5-CACCGN . . . N-3 and 3-CN . . . NCAAA-5 ends respectively to give rise to 5-CACC and 5-AAAC overhangs to facilitate cloning into the existing BbsI restriction site of pX330 and pX335. Equimolar mixtures of guide and complementary ssODNs were annealed and phosphorylated with T4 PNK (Thermo Scientific). pX330-MCS and pX335-MCS plasmids were digested with FastDigest BbsI (Thermo Scientific), generating compatible overhangs for guide sequence ligation, then dephosphorylated with FastAP (Thermo Scientific). Ligation was carried out at 22? C. for 4 hours in 20 ?L reaction mixtures containing 1 U of T4 DNA Ligase (Thermo Scientific), and the insert and vector at a 5:1 molar ratio.

[0205] 10 ?L of each ligation product was used to transform chemically competent E. coli strain DH5?, plated on LB agar plates with 100 ?g/mL ampicillin and incubated overnight at 37? C., and viable colonies subject to colony PCR screening. Colony PCR was performed with 0.5 ?M of a universal forward primer binding a region on the U6 promoter (5-CGATACAAGGCTGTTAGAGAGATAATGG-3), and 0.5 ?M of the respective guide sequence antisense ssODNs as reverse primers. PCR conditions were as follows: 95? C., 10 min; 27 cycles of 95? C. 30 sec, 54? C. 30 sec, 72? C. 1 min; and final extension at 72? C. for 10 min. Colony PCR products were analyzed on 1% agarose gel stained with ethidium bromide.

[0206] Generation of Donor Template Oligonucleotides

[0207] Two G6PD wild-type donors were generated, one with approximately 50-nucleotide homology arms flanking the site of editing (short donor), and another with approximately 200-nucleotide homology arms (long donor). The donors were generated using high-fidelity PCR amplification from genomic DNA of cells from a healthy individual, using 1 U of Pfu DNA polymerase (Thermo Scientific) and 0.5 ?M of each primer (short donor forward primer: 5-TGCAGCTCTGATCCTCACTCC-3; short donor reverse primer: 5-TGGACAGCCGGTCAGAGC-3; long donor forward primer: 5-AAAAGGACGCGTGCCAGCAATGCCACCC-3; long donor reverse primer: 5-AATATTGGATCCGGCTCCTGAGTACCACC-3) under the following conditions: 95? C., 5 min; 30 cycles of 95? C. 30 sec, 55? C. 30 sec, 72? C. 1 min; and final extension at 72? C. for 7 min. Capillary electrophoresis sequencing (AITbiotech) was used to ensure that the donors carried segments of the wild-type sequence.

[0208] A G6PD-Mahidol donor (mutant donor'), bearing the G6PD-Mahidol point mutation, was generated using primer extension site-directed mutagenesis, using the wild-type short donor as a template and a pair of mutagenic primers bearing the mutation close to their 5 ends (Mutagenesis primer 1: 5-TCCAGCTTCTGCTGGGAGC-3; mutagenesis primer 2: 5-GAAGCTGGAACCGCATCATC-3; mutation site in bold). In the first PCR, mutagenesis primer 1 was paired with the short donor forward primer, and mutagenesis primer 2 with the short donor reverse primer. PCR was performed using 0.5 U of Taq DNA polymerase (Thermo Scientific) and 0.5 ?M of each primer, under the following conditions: 95? C., 5 min; 25 cycles of 95? C. 30 sec, 55? C. 30 sec, 72? C. 45 sec; and final extension at 72? C. for 10 min. The 75 bp bands on 1% agarose gel were excised and extracted using a GeneJET Gel Extraction Kit (Thermo Scientific). Both fragments were added to a single, second PCR mixture containing 1 U Pfu DNA polymerase (Thermo Scientific) and 0.5 ?M each of the short donor primer pair, to generate the mutant donor. The reaction mixture was first incubated on a heat block at 95? C. for 5 min, then placed on the bench to cool to room temperature. Once cooled, the mixture was returned immediately to the heat block at 72? C. and incubated for 1 min, then placed into the thermal cycler configured as such: 30 cycles of 95? C. 30 sec, 55? C. 30 sec, 72? C. 30 sec; and final extension at 72? C. for 7 min. An aliquot of the PCR product was analyzed on 1% agarose gel stained with ethidium bromide. Capillary electrophoresis sequencing (AITbiotech) was used to verify successful site-directed mutagenesis of the donor.

[0209] Production of Minimal-Sized CRISPR Dumbbell Vectors by ELAN Loop Ligation

[0210] Dumbbell vectors were generated from the pX330-MCS and pX335-MCS plasmids carrying the guide sequences, using the enzymatic ligation assisted by nucleases (ELAN) method (4,7). The XhoI and MluI sites contained within the introduced multiple cloning sites were chosen to be the termini of the main double-stranded component of the dumbbells. ssODNs were designed with base sequences thermodynamically favouring the formation of hairpin loops. After hairpin formation, the loops would leave SaII (G/TCGAC) and SgsI (AscI) (GG/CGCGCC) 5 overhangs, which were compatible for ligation to the XhoI (C/TCGAG) and MluI (A/CGCGT) overhangs from digestion of the pX330-MCS/pX335-MCS plasmids at their multiple cloning sites. Loop ssODN folding predictions were obtained using mfold (10) (FIG. 7). Each correct ligation would eliminate both restriction sites, while undesired by-products such as loop dimers retaining SaII or SgsI restriction sites, or linearized plasmid dimers retaining XhoI or MluI restriction sites, would be cleaved by the respective restriction enzymes present in the reaction mixture, and therefore be susceptible to exonuclease degradation during post-treatment. A fifth restriction enzyme, EheI, was also included in each reaction mixture to cleave the unneeded plasmid backbone, also rendering it susceptible to exonuclease degradation. At completion of the reaction, desired dumbbells were exonuclease resistant, while all by-products had free DNA ends due to restriction enzyme cleavage. Reaction mixtures were cleaned up using T7 DNA Polymerase (New England Biolabs), which has strong 3.fwdarw.5 exonuclease activity. A graphical summary of the loop ligation method is shown in FIG. 8, while a detailed protocol is described in Table 2.

[0211] Statistical Analysis

[0212] Results were shown as mean ?S.E.M when more than one experiments were performed. Unpaired student t-test was used to determine significance when comparing two groups. For the comparison of more than two groups of data, one-way ANOVA with Newman-Keuls post hoc test was used. Prism 5 Graphpad software was used for the statistical analysis. * represents p value<0.05, ** represents p value<0.01, and *** represents p value<0.001.

EXAMPLE 1

Design, Generation, and Cellular Activity of Hairpin-Template Transcribing Dumbbell Vectors for Small RNA Expression

[0213] We investigated dumbbells as a safe and cheap alternative vector system to trigger transient expression of small non-coding RNAs. To capitalise on the fact that db-vectors know no lower size limit, we sought to minimise dumbbells for small RNA expression as much as possible employing three strategies: Firstly, conventional shRNA- or miRNA-expression cassettes consist of a promoter, a linear RNA-coding sequence, and a transcriptional terminator. Since shRNAs and precursor miRNAs (pre-miRNA) form hairpin structures which harbour a significant degree of self-complementarity, linear expression cassettes contain redundant sequences as the sense and antisense portions forming the stem are included in both strands of the DNA duplex. We eliminated such redundant sequences and in the minimised dumbbells, part of the db-DNA structure resembles the structure of the hairpin RNA, i.e. the duplex of the dumbbell forms the stem of the RNA and one of the terminal db-loops codes for the loop of the RNA hairpin (FIG. 1A). This design implies that RNA transcription goes around the hairpin template including the loop of the db-DNA. This strategy, to which we refer as hairpin template-transcription, shortens the respective vectors by about 30 to 40 base pairs (bp) for shRNA expression or 60 bp or more for miRNA expression depending on the miRNA precursor length. Secondly, we implemented the minimal human H1 (mH1) promoter (5). This 99 bp polymerase III promoter is 128 bp shorter than the full length H1 promoter, was found to be as active or better in terms of miRNA expression compared with the full length H1 or CMV promoter (FIG. 2), and hasn't found applications in dumbbells yet. Thirdly, earlier studies suggested non-essential sequence positions at the 3 end of the H1 promoter directly upstream of the transcriptional start (5). We replaced six of these nucleotides by a restriction site and another five by an inverted polymerase III transcriptional terminator, i.e. an adenosine pentamer (A.sub.5), which terminates hairpin template-transcription in the opposite strand shortening the vectors by another five base pairs (FIGS. 1A,B). Transcription of the integrated promoter/terminator element starts downstream of the inverted termination signal and its sequence is not added to the 5 end of the transcript. Together, the novel features allow reducing the size of shRNA- or miRNA-expressing dumbbells by 171 bp (57%) or 191 bp (56%) enabling the production of small RNA expressing dumbbells as short as 130 bp, the smallest genetic expression vectors reported.

[0214] We developed a novel protocol for the generation of minimised hairpin template-transcribing db-vectors (FIG. 1C). Therefore, the mH1 promoter sequence is being amplified by PCR using primers introducing upstream a Nb.Bpu10I nicking site and downstream a BamHI cleavage site. After Nb.Bpu10I/BamHI cleavage, the upstream loop is generated by intra-molecular ligation of the Nb.Bpu10I 5 overhang. The small RNA coding sequence is concurrently (simultaneously) added by intermolecular ligation of a chemically synthesised oligomeric DNA hairpin structure that provides a BamHI-compatible BgIII 5 overhang and that resembles the template for the transcription of the RNA precursor (FIG. 1B). Upon dumbbell formation neither (none) of the cleavage sites is reconstituted and the presence of BamHI and BgIII in the ligation reaction destroys misligated homo dimers shifting the equilibrium towards the correctly ligated dumbbell. Exonuclease digestion subsequently yields only the correctly ligated dumbbell. This new protocol combines features of two dumbbell production techniques that were reported earlier (6-8). However, due to the hairpin-template technology, alternative hairpin-forming oligodeoxy-ribonucleotides can be ligated to the same db-core structure to generate dumbbells for alternative targets. The conversion yields for the new protocol approximate 90% when the small DNA fragments resulting from endonucleolytic cleavage are functionally neutralised with a complementary sequence and/or removed prior to loop ligation (FIGS. 1C,D).

[0215] To investigate different design features of minimised hairpin-template-transcribing dumbbells, HEK293T or HepG2 cells were co-transfected with the pGL3-Control reporter plasmid and equimolar amounts of different luciferase shRNA-expressing dumbbells, and luciferase gene expression was monitored 24 h post transfection. This comparison indicates that the dumbbell equipped with the integrated promoter/terminator/restriction element (db-iPRT-hp-s/as) triggered as strong or better target gene knockdown compared with a construct harbouring separated promoter and terminator sequences (db-iPR-hp-s/as) (FIGS. 1E,F). We further aimed to improve shRNA processing by implementing the hsa-miR-30 stem (11) as an extension of the shRNA template stem into db-iPR-hp-s/as. To achieve expression of the correct miR-30 precursor structure including the mismatches in the miR-30 stem region, we considered appropriate mismatches in the stem of the DNA hairpin template structure (FIG. 1A). The implementation of mismatches in the dumbbells did not impair the dumbbell production process. Neither miRNA stems nor mismatches or bulges were reported in the context of dumbbell vector design. The miR-30 stem was previously reported to improve shRNA expressing plasmid vectors (11). The resulting dumbbell db-iPR-miR-hp-s/as triggered 15%/1.5-fold (p<0.01) or 14%/1.3-fold (p<0.05) stronger luciferase knockdown in HEK293T or HepG2 cells compared with the parental vector, despite its 17 bp (34 nt or 12.6%) larger vector size (FIGS. 1E,F). All the three discussed vectors harboured a sense-loop-antisense (5 to 3) orientation of the hairpin transcription cassette. Changing the sense-loop-antisense orientation of construct (db-iPTR-hp-s/as) to an antisense-loop-sense orientation significantly improved the silencing activity of the resulting vector db-iPTR-hp-as/s in HepG2 cells by 28% (p<0.01) but not in HEK293T cells (FIGS. 1E,F). These differences are likely due to alternative shRNA processing and/or processing efficiencies.

[0216] Earlier studies reported superior delivery and transcriptional activity triggered by db-vectors compared with plasmid DNA (12,13). First-time we investigated in detail the kinetics of cellular and nuclear db-delivery, transcriptional activity, and target gene knockdown triggered by db-driven shRNA expression in comparison with equivalent plasmid vectors. HepG2 cells were co-transfected using lipofectamine 2000 with the firefly luciferase reporter vector pGL3-Control and equimolar amounts of either a conventional db-vector (db-iPR-linear-s/as) harbouring a linear expression cassette, a minimised hairpin template-transcribing dumbbell (db-iPRT-hp-s/as) or a plasmid (p-iPR-linear-s/as), each expressing a mH1 promoter-driven luciferase targeting shRNA (FIG. 1A). After 10 min, 1 h, 6 h, and 24 h, total episomal DNA, nuclear episomal DNA or total small RNA was isolated and either the mH1 promoter DNA or the shRNA was quantified by rtPCR or rtRT-PCR, respectively. According to the design of our shRNA expression cassettes (5sense/3antisense), the rtRT-PCR was suitable to detect both the shRNA precursor and the processed antisense shRNA guide strand via binding of the reverse transcription hairpin primer to the RNA 3ends. Since db-vectors and plasmids have different PCR amplification efficiencies, we used individual rtPCR standard curves for the absolute quantification of each of the respective vectors. Target gene expression and hence target gene knockdown wasn't detectable 10 min or 1 h post transfection and was instead monitored at 6 h, 12 h, and 24 h.

[0217] At all investigated time points, the kinetics indicate a clear advantage of the dumbbells over the corresponding plasmid in terms of cellular delivery (transfection) and in particular regarding nuclear delivery and shRNA transcription (FIG. 3; FIG. 4). Cellular db-delivery was enhanced up to 5-fold (p<0.050) (FIG. 3A); that is difficult to understand and could be explained by different efficiencies of liposome formation for the different vector molecules. Nuclear db-delivery was enhanced up to 74 or 25-fold (p<0.001) 10 min or 24 h post transfection compared with the plasmid (FIG. 3B), pointing towards an accelerated rate of dumbbell diffusion from the cytoplasm into the nucleus. Accordingly, shRNA transcription increased 12 to (or) 7-fold (p<0.001) (FIG. 3C) 10 min or 24 hours post transfection. Finally, the db-vectors triggered significantly stronger luciferase knock-down compared with the plasmid vector (FIG. 3D). An advantage of the minimised dumbbell as compared with the conventional dumbbell was most evident (3.7-fold enhancement; p<0.001) in terms of the transcriptional activity early (10 min) after transfection and was also indicated by approx. 0% improved knockdown activities. Only in the case of the minimised dumbbell, transcription has to go around the DNA hairpin structure which one would not consider advantageous. Thus, the enhanced transcriptional activity can most likely be assigned to accelerated nuclear diffusion assuming nuclear diffusion of the minimised dumbbell reaches its steady state in less than 10 min and that differences in terms of nuclear delivery between the minimised and the linear dumbbell were not captured anymore by the investigated 10 min time point.

[0218] At 10 min post transfection, cellular delivery levels had reached about 6% (plasmid and linear db) or 3% (minimised db) of the 24 h levels, the transcriptional levels about 5/2/8% (plasmid/linear db/minimised db) (FIGS. 3A,C). Nuclear delivery on the other hand increased by approx. three orders of magnitude from 10 min to 24 h (2.8?10.sup.3/0.8?10.sup.3/1.2?10.sup.3-fold for plasmid/linear-db/minimised-db) (FIG. 3B). Notably, the absolute vector copy numbers detected in the whole cell vs. the nuclear extracts cannot be directly compared since we added feeder cells to isolate the nuclei and copy numbers refer to 10 ng of total RNA. The observation that a 1000-fold increase in nuclear delivery of all vectors from 10 min to 24 h post transfection only triggers an about 10-fold augmentation of the detectable RNA levels during the same period of time could be due to (i) transcriptional inactivation of the vector DNA, (ii) enhanced degradation of the transcribed RNA, (iii) incomplete processing of the shRNA precursors which are expected be detected with lower sensitivity compared with the processed antisense shRNA due to their self-complementarity and formation of stable secondary structures, or (iv) toxicity and cell death in the consequence of an oversaturation of the cellular silencing machinery (14). Pathway oversaturation and shRNA-triggered toxicity would be dose-dependent and expected to be much more pronounced in case of the db-vectors which expressed the shRNA at much higher levels. However, the discrepancy between the kinetics of nuclear delivery and shRNA transcription (abundance) was independent of the vectors and the corresponding expression levels.

EXAMPLE 2

Design of Hairpin-Template Transcribing Dumbbell Vectors for MicroRNA Expression

[0219] The minimised db-design along with the new protocol for db-generation is applicable for shRNA- and miRNA-expressing dumbbells. We designed a human miR-125b-1 expressing minimised hairpin template-transcribing dumbbell with integrated promoter/restriction/terminator element (db-iPRT-hp-miR) as well as a conventional dumbbell (db-linear-miR) and a plasmid vector (p-linear-miR), the latter each with linear miR-125b-1 expression cassettes (FIG. 5A). miR-125b-1 was reported to function as tumour suppressor miRNA by targeting the oncogenes LIN28B and IL6R (15,16). All three vectors express the miR-125b-1 precursor structure and to achieve that, various mismatches and bugles were implemented into the design of the minimised dumbbell. To efficiently sense miR-125b-1 expression we constructed a miR-125b-1 sensor plasmid by replacing the firefly luciferase 3UTR of plasmid pMIR-Report with a repeat of three miR-125b binding sites (FIG. 6A). The functionality of the sensor plasmid was tested by transfection of HepG2 cells with the sensor plasmid alone and compared with co-transfection of sensor plasmid plus feeder DNA or the miR-125b-1-expressing plasmid. 24 h post transfection luciferase expression was measured and standardised relative to the expression of the sensor-negative reporter vector (FIG. 6B). The sensor vector efficiently detected endogenous miR-125b-1 expression as well as plasmid-triggered miR-125b-1 overexpression. Next we co-transfected HepG2 cells with the sensor plasmid and the different miR-125b-1-expressing vectors. We compared equimass amounts of the miR-125b expressing vectors in this experiment using identical amounts of lipofectamine 2000. Under these experimental conditions, the db-vectors and most pronounced the minimised dumbbell triggered 3.9-fold (p<0.01) stronger target gene knockdown as compared with the plasmid vector (FIG. 5C). No difference in knockdown activity was detected for dumbbells produced with our new protocol or alternatively using the enzymatic ligation assisted by nuclease (ELAN) method (8), indicating both protocols produce functionally equivalent minimised dumbbells (FIG. 5C). The functionality of the minimised miR-125b-1-expressing dumbbell was confirmed in HEK293T and CL48 cells (FIGS. 5D,E).

EXAMPLE 3

[0220] Nuclear DNA Import Sequences Improve Target Gene Knockdown Triggered by Small RNA Expressing Dumbbell Vectors

[0221] Fast passive diffusion from the cytoplasm into the nucleus is regarded to be one of the key features that can be assigned to db-vectors. For larger plasmid DNA it was reported that certain sequences harbouring transcription factor binding sites significantly enhance gene expression. Examples are the SV40 enhancer sequence (17,18), the smooth muscle ?-actin (SMGA) promoter (19,20), and the origin of replication of the Epstein-Barr virus (oriP), the latter of which depends on the expression of the viral nuclear antigen 1 (EBNA1) in order to be functional (21). We investigated whether this strategy is suitable to further improve nuclear import and gene expression of db-vectors. Therefore we implemented either the 237 bp full-length SV40 enhancer (fEnh) or a 72 bp minimal version (mEnh) of it (17) into the minimised miR-125b-1-expressing dumbbell upstream of the mH1 promoter (FIG. 5A) to generate dumbbells db-fEnh-iPT-hp-miR and db-mEnh-iPT-hp-miR. In HepG2 cells co-transfected with the pMIR-125b-1 sensor plasmid and the db-vectors, strongest miR-125b-1-mediated luciferase knockdown (93%; p<0.001) relative to the control was triggered by the dumbbell harbouring the full-length SV40 enhancer, followed by the dumbbell with the minimal SV40 enhancer (87%; p<0.001), and the enhancer-negative parental db-vector (69%; p<0.001) (FIG. 5F). These data demonstrate, SV40 enhancer elements can significantly enhance db-driven miRNA expression, 2.3 (mEnh) or 4.5-fold (fEnh) compared with the enhancer-negative control, though their implementation triggers a relatively stronger increase of vector size in case of the small dumbbells (47 or 156%) compared with a much larger plasmid vector (2.4 or 8%). Though, both transcriptional activation and/or active nuclear DNA import and retention can account for the enhancement of gene expression triggered by these sequence elements, it is unlikely that the SV40 enhancer promotes transcriptional activation of the heterologous mH1 polymerase III promoter in this experimental setting. The postulated mechanism underlying an active nuclear DNA import is that transcription factors harbouring peptide nuclear localisation signals bind to these DNA sequences and co-import the bound DNA piggy-back into the nucleus by means of the protein nuclear import machinery (22).

EXAMPLE 4

[0222] Design of Antisense miRNA-Expressing Dumbbell Vectors

[0223] As miRNAs are important posttranscriptional regulators of metazoan gene expression, both their overexpression and functional inhibition can be of therapeutic value. Most miRNA antagonists are chemically synthesised oligodeoxyribonucleotides with antisense orientation to the miRNA and/or its precursor (23,24). Alternatively, long miRNA targeting antisense RNAs (miRNA sponges) or siRNAs were described as well. Short endogenously expressed miRNA-targeting antisense RNA (asRNA) has not been described yet. We investigated the possibility to use small db-vectors for antisense miRNA expression. As a target we selected hsa-miR-21 which is overexpressed in the context of hepatocellular carcinoma (25) and designed four antisense miRNA (as-miRNA) structures targeting at the same time the mature miR-21 and part of its precursor (pre-miR-21), thus overlapping with one of the dicer cleavage sites. That is, these as-miRNAs would be suitable to target the primary miR-21 transcript, pre-miR-21, and/or mature miR-21 (FIG. 7A). Despite the fact that the available as-miRNA sequence and structure spaces were very limited, we identified two highly structured and two less structured as-miRNA candidates using in silico tools for RNA secondary structure analysis (26,27). In particular free unpaired ends of asRNAs were reported to correlate with efficient target binding and activity. Accordingly, selected highly structured as-miRNAs fold stable hairpin structures avoiding free ends; the less structured antagonists fold less stable secondary structures and harbour free 5 and 3 ends (FIG. 7A). We designed a luciferase reporter-based miR-21 sensor plasmid (p21-Sensor) harbouring a repeat of three miR-21 binding sites in the firefly luciferase 3UTR as well as db-vectors expressing the selected unstructured (A1 and A3) or structured (A2 and A4) as-miRNAs (FIGS. 7B,C). CL48 cells were transfected either with the sensor construct alone or together with the respective as-miR-expressing db-vectors and luciferase activity was monitored 48 h post transfection (FIG. 7D). All four dumbbells/as-miRNAs triggered comparable levels of endogenous hsa-miR-21 inhibition as indicated by an about 3-fold increase (p<0.01) of luciferase expression. AsRNA-mediated inhibition of gene expression is a kinetically controlled process (28), i.e. fast target binding correlates with activity, and longer asRNAs are faster target binders compared with short asRNAs on a statistical basis (29). However, it was also shown that relatively short asRNAs of about 100 nt in length can be very strong inhibitors provided they form flexible RNA secondary structures with long free ends (26,30). Thus it was at first view surprising that as-miRNA structures with closed ends were as potent inhibitors of miR-21 function as structures with free ends. However, it was also reported that unstructured asRNA is much more prone to ribonucleolytic degradation (26,30). For the group of very short as-miRNAs investigated here we hypothesise that (i) the more unstructured RNAs might be faster target binders but less stable whereas (ii) the more structured RNAs might be slower binding though more stable and that (iii) target binding is just balanced against endogenous RNA stability.

[0224] Our analyses indicate an inverse correlation between the sizes of equally featured naked DNA-based vectors and the kinetics of gene expression. The advantage of the dumbbells over the plasmids was found to be highly evident when delivering equimolar amounts of vector DNA and is expected to become even more pronounced when equimass amounts would be applied. Considering limitations associated with some delivery strategies e.g. with regard to maximally deliverable volumes or toxicity triggered by liposomal or other complexing compounds, together with the fact that the total mass of deliverable DNA is limited, it can be regarded as a strong advantage of the db-vector system that equimass amounts correspond to much higher molar amounts as compared with larger minicircles or plasmids.

[0225] In our in vitro system, small dumbbell size is advantageous mainly in terms of improved nuclear delivery and it remains to be tested whether that goes along with a disproportionate higher risk of nuclear vector integration. In vivo, genetic vectors additionally have to manage extracellular transport including extravasation, diffusion through the extracellular matrix network, target cell binding and internalisation. To overcome these physical including membrane barriers, a small vector size can be highly beneficial. Our data demonstrate that dumbbell vectors trigger accelerated, prolonged, transient small RNA expression. Thus, in terms of small RNA delivery, dumbbell vectors may close the existing gap between short-term knockdown effects triggered by siRNAs or miRNA mimics and long-term effects that can be achieved with integrating lentiviral vectors thereby enabling and facilitating therapeutic applications of this vector system.

EXAMPLE 5

[0226] Design of Dumbbell Vectors for Coding RNA ExpressionA Spliceable Intron and/or the SV40 Enhancer Improve Dumbbell-Driven Gene Expression

[0227] Most db-vectors reported in the literature were designed to express functional proteins and, hence, much larger in size compared with the small RNA expressing dumbbells discussed above. We investigated as to whether the full length SV40 enhancer would be suitable to enhance protein expression driven by large db-vectors. As a second molecular feature to enhance protein expression we implemented a spliceable intron. While the implementation of introns into db-vectors was reported earlier (31), SV40 enhancer elements have not been described in dumbbells yet. Using the ELAN method we generated a db-vector containing a SV40 promoter-driven firefly luciferase gene and the SV40 polyadenylation site (db-luc) as well as variations of this parental vector harbouring either the full-length SV40 enhancer (db-luc-enh), the human 6-globin gene chimeric intron (32) (db-int-luc), or both (db-int-luc-enh) (FIG. 8A). As controls we constructed four plasmid vectors having identical expression cassettes and features but which in addition contained the 2855 bp pGL3-Control backbone. HEK293T and HepG2 cells were transfected with equimass amounts of the plasmid and db-vectors and luciferase gene expression was monitored 48 h post transfection. In HEK293T cells, plasmids and dumbbells triggered a comparable level of gene expression; in HepG2 cells db-triggered expression was 3 to 7-fold (p<0.001) stronger (FIGS. 8B,C). While the implementation on an intron enhanced gene expression of all constructs unconditionally and in both cell lines, the SV40 enhancer was active in HepG2 cells but not in HEK293T cells in which the SV40 enhancer slightly impaired gene expression. In HepG2 cells, implementation of the SV40 enhancer triggered a remarkable 16-fold (p=0.005) or 27-fold (p<0.001) enhancement of luciferase expression compared with the respective enhancer-negative dumbbells db-luc or db-int-luc. Highest levels of luciferase expression were triggered by dumbbell db-int-luc in HEK293T cells and by the dumbbell db-int-luc-enh in HepG2 cells. In HepG2, db-int-luc-enh-triggered gene expression was 7-fold higher (p<0.001) than for the equally featured plasmid p-int-luc-enh, x-fold higher (p<0.001) than for the standard dumbbell db-luc, and 160-fold higher (p<0.001) compared with the basic plasmid p-luc. These numbers are still remarkable when considering the about 50% smaller dumbbell size and the approx. twofold higher molar dumbbell amounts tested.

EXAMPLE 6

[0228] Design of Trans-Splicing RNA-Expressing Dumbbells

[0229] We explored the possibility of using db-vectors for delivery of RNA trans-splicing into human tissue culture cells and compared the db-based with the plasmid-based delivery approach. Spliceosome-mediated RNA trans-splicing represents an alternative form of splicing that describes the joining of sequences originating from distinct transcripts (33). RNA trans-splicing is increasingly being explored for diagnostic and therapeutic applications as it can be used for genetic repair and reprogramming as well as for labelling of endogenous transcripts with death signals for suicide gene therapy or with fluorescent proteins for gene expression imaging. Our trans-slicing RNA was composed of a 5-terminal antisense binding domain targeting intron 5 of the alpha-fetoprotein pre-mRNA, a splice acceptor site, and a sequence coding for a fusion protein of the P2A proteolytic cleavage site (34) and the herpes simplex virus thymidine kinase (HSVtk). This trans-splicing RNA was capable of tagging the endogenous AFP or an over-expressed AFP mini-gene with the HSVtk message via trans-splicing-based 3-end labelling. Successful trans-splicing leads to the expression of the HSVtk enzyme which can trigger a cell death signal upon delivery of the drug ganciclovir for suicide gene therapy (35-37). HepG2 cells were transfected with equimolar amounts of the trans-splicing RNA-expressing plasmid or db-vector, and total RNA was isolated 24 h post transfection. The efficiency of trans-splicing was monitored by rtRT-PCR-based detection of the resulting chimeric AFP-HSVtk RNA using each one AFP-specific and one HSVtk-specific TaqMan-probe (FIG. 9A). The db-vector triggered a 3.6-fold stronger (p<0.05 for the AFP-probe) chimeric RNA signal compared with the plasmid expressing the identical trans-splicing RNA molecule (FIG. 9B).

EXAMPLE 7

[0230] Gap-Primer PCREfficient Production of Superior Dumbbell-Shaped DNA Minimal Vectors for Small RNA Expression

[0231] To further simplify and cheapen dumbbell production and to increase the yields, we developed a two-step PCR-based method that involves chemically-modified gap-primers (FIG. 10). The new gap-primer-based PCR (gpPCR) method maximally reduces number and amount of enzymes and oligonucleotides needed for the production of dumbbell-shaped DNA vectors. In step 1, the expression cassette of interest (coding or non-coding) is amplified by PCR with a pair of primers containing a 5-phosphate, a central gap, and a 3-terminal target binding site with a 3-hydroxyl group (3-OH). The extension of both newly synthesized strands is terminated upon reaching the gap yielding PCR products with 5-overhangs. In step 2, the phosphorylated 5-overhangs are ligated intramolecularly to the 3-OH groups to form the covalently closed dumbbell structure. The essential idea behind our method is that the abasic gaps cannot function as templates for base-pairing during primer extension forcing the polymerase to halt, thus directly yielding 5-overhangs ready for efficient intramolecular ligation. The chemical nature of the abasic gaps may affect the efficiency of PCR amplification, ligation, or the biological function of the final dumbbell vector, and the length of the gap may impact polymerase halting. To achieve optimal efficiency and efficacy of dumbbell-production, we investigated oligonucleotides harbouring abasic gaps of different chemistry and length (FIG. 11): dSpacer1 (AP1) and dSpacer3 (AP3) are tetrahydrofuran-based mimics of one or three apurinic/apyrimidinic abasic sites; and PEG-150 (TEG) is a triethylene glycol-based spacer with a molecular weight of 150 Da and a length of 1.3 nm which approximately corresponds to four base pairs (38, 39). For each of the three gap variants we investigated two sets of primers: Firstly, self-complementary hairpin (hp) primers causing the 5-overhangs to fold back forming a stem loop structure and positioning the 5-phosphate close to the 3-OH groups (FIG. 11, left panel). To form linear dumbbell vectors, we bridged the AP1 or AP3 gaps in the opposing strand with one or three nucleotides (nt), and the TEG gap with four nt respectively, and ligated the ends using T4 DNA ligase. Secondly, we designed unstructured (loop) primers forming open 5-overhangs which were ligated using the single-strand-specific Circligase (FIG. 11, right panel) (40) Exonuclease resistance represents a characteristic feature of covalently closed dumbbell-shaped DNA (41). Thus, ligation reactions can be treated with T7 DNA polymerase, which exhibits a strong 3 to 5 exonuclease activity, to degrade all educts and by-products yielding purified dumbbell DNA (42).

[0232] We investigated the efficiency of our new method in terms of dumbbell production using first the hp-primers together with T4 DNA Ligase (FIG. 12). Therefore, hp-primer PCR products were treated with exonuclease either before or after ligation and the resulting DNA products were analysed by 10% polyacrylamide gel electrophoresis (PAGE). All hp-primer PCR reactions yielded products of the expected size of 179 to 185 bp (lanes 2, 6, and 10) which were completely degraded during exonuclease treatment (lanes 3, 7, and 11) due to the availability of free 3 ends. Ligase treatment triggered a detectable change in DNA topology reflected by an increase in mobility, which is characteristic for dumbbell DNA under the conditions of this analysis. Such a mobility shift was observed for PCR products generated using the AP1- (lane 4) or with lower yields the AP3-gap-primers (lane 8), but not with the TEG-primers (lane 12). Accordingly, exonuclease treatment left highest dumbbell yields for the AP1-gpPCR (lane 5), followed by the AP3-gpPCR (lane 9); no dumbbell was produced based on TEG-gpPCR (lane 13).

[0233] Our results indicate that among the series of hp-primers, only those harbouring tetrahydrofuran-based gaps are suitable to produce dumbbell vectors, with highest yields obtained for the smallest gap AP1. That is, a single abasic site efficiently pauses the polymerase without providing any evidence that the enzyme may jump over the gap. It is reasonable to assume that the larger AP3 gap halts the polymerase as effectively as the shorter AP1 gap. However, AP1-primer ligation likely is more efficient due to the more precise positioning of the 5-end for ligation with the 3-end. Currently the question cannot be answered as to whether TEG-gaps are either skipped by the polymerase yielding double-stranded DNA ends which would be unsuitable for dumbbell formation, or alternatively trigger the formation of substrates which are difficult to ligate.

[0234] Next, we evaluated the dumbbell conversion yields by determining the ratios of dumbbell vector DNA after ligation and exonuclease treatment divided by the PCR product yields prior to enzymatic treatment. Among the hp-primer series, highest conversion yields were obtained with the AP1-hp-primers (92%), followed by the AP3-hp-primers (64%), and no dumbbell DNA was produced with the TEG-hp-primers (FIG. 13A). Among the loop-primer series, only the AP1-loop-primers triggered dumbbell formation (75%) supporting the hypothesis that larger abasic gaps lead to difficult-to-ligate DNA substrates (FIG. 13B). In comparison with our new method, the conventional dumbbell production techniques exhibited significantly lower conversion yields of 57% (nicking enzyme method) or 18% (ELAN method), both lower than initially reported in the literature based on the same quantification method (FIGS. 13C,D). The yields of converting the expression cassette of interest into covalently closed exonuclease-resistant dumbbells as well as the purity of the obtained dumbbells were found to inversely correlate with the numbers of (i) manufacturing steps, (ii) involved enzymes, and (iii) possible by-products that can be formed. Accordingly, highest yields of purest dumbbells were achieved with the new gpPCR-method, followed by the nicking enzyme method and the ELAN-method. Notably, though the measured yields may vary depending on the used method of quantification or the batch of ligase, they represent a reliable indicator to compare the relative strengths' of the methods.

[0235] Dumbbell purity after exonuclease treatment was investigated using PAGE and high-resolution capillary gel electrophoresis (FIG. 14). Both methods indicate that gap-primer PCR using AP1-hp-primers generates dumbbells with the highest level of purity which was calculated to be 93.5% by the QIAxcel system. AP3-hp gap-primer PCR as well as the ELAN or nicking enzyme methods produced dumbbells with purity levels ranging between 82 to 85%.

[0236] We calculated and compared the overall input and expenses for the production of 1 ?g dumbbell DNA produced either with the conventional methods or our new strategy (Table 1). Among all investigated protocols including the different gpPCR protocols, AP1-hp-primers generated the most active dumbbells at highest yields and lowest costs. In comparison, both the ELAN and the nicking enzyme method require more and higher amounts of primers and enzymes. A major cost factor involved with the conventional methods is the need for restriction endonucleases. Though gpPCR depends on modified primers, AP1-hp-primer PCR is 10 or 5-fold cheaper compared with the ELAN method and 3.1 or 1.6-fold cheaper compared with the nicking enzyme method, depending on whether the final exonuclease treatment is skipped or not.

EXAMPLE 8

[0237] Gap-Primer PCR Generated Dumbbells are Superior Compared With Conventionally Produced Dumbbells

[0238] All dumbbell vectors investigated in this study harbour the expression cassette for a pre-validated firefly luciferase targeting small hairpin RNA (shRNA). We tested the functionality of gpPCR-generated dumbbells, i.e. luciferase knockdown in human tissue culture cells, in comparison with a dumbbell produced using the ELAN method or a pSuper-based plasmid vector, all expressing the same shRNA driven by the minimal H1 promoter (FIG. 15). HEK293T cells were co-transfected with 90 ng of dumbbell or plasmid DNA and 90 ng of the pGL3 luciferase reporter vector and luciferase knock-down was monitored 48 h post transfection (FIG. 15A). Under these conditions, all gpPCR-generated dumbbells and the plasmid vector triggered significantly stronger luciferase knockdown compared with the ELAN-produced dumbbell (db-ELAN; 17% knockdown; p<0.001). Strongest knockdown (90%; p<0.001) was measured for the AP1-hp-primer-produced dumbbell (db-AP1-hp), followed by the AP1-loop-primer-generated (db-AP1-loop) dumbbell (83%; p<0.001), and db-AP3-hp (75%; p<0.001). The non-ligated dumbbell db-AP1-hp-(lig.sup.?) was with 88% knockdown was almost as effective as its ligated counterpart which might pretend that exonuclease resistance is not that relevant under the assay conditions. However, as db-AP1-hp-(lig.sup.?) was not exonuclease treated, it was contaminated by a small quantity the KpnI/BamHI-digested plasmid DNA which served as PCR template for dumbbell production. Hence, the best way to investigate the meaning of exonuclease resistance is to compare db-AP1-hp-(lig.sup.?) with the ligated but not exonuclease treated DNA db-AP1-hp-(exo.sup.?). The latter was observed to trigger a substantial stronger knockdown (97%) highlighting the importance of the ligation step. This assumption is further supported by the observation that single- (61% knockdown) or double-digestion (57% knockdown) of the supercoiled plasmid vector (68% knockdown) increasingly impaired its silencing activity. Nevertheless, it is unlikely that the small amount of undigested PCR template, which is not detectable on the gel, considerably contributes to the profound knockdown effect triggered by db-AP1-hp-(exo.sup.?). Thus, considering the high conversion yields of 92%, the exonuclease step may be skipped for db-AP1-hp production to further simplify the protocol. Considering limitations associated with some delivery strategies such as delivery volumes or toxicity triggered by liposomal compounds, together with the fact that the total mass of DNA that can be delivered can be limited, small db-vectors harbour the advantage that equimass amounts correspond to much higher (here about 17-fold higher) equimolar amounts as compared with larger plasmids. To directly compare the activity of our best dumbbell db-AP1-hp with the corresponding supercoiled plasmid DNA, HEK293T cells were co-transfected with equimolar amounts, i.e. 0.5 pmol, of dumbbell or plasmid and 90 ng of the pGL3 luciferase reporter vector and luciferase knock-down was monitored 48 h post transfection (FIG. 15B). Even under these conditions, db-AP-1-hp triggered significantly (p<0.001) stronger luciferase knockdown (74.7%) compared with the plasmid vector (53.7%) highlighting the advantage of the dumbbell size and/or structure.

[0239] The gpPCR-generated dumbbells triggered significantly (p<0.001) stronger knockdown compared with the ELAN-produced dumbbell, the latter of which was equal in size and uses the same expression cassette to transcribe the same shRNA. Thus, the only difference between gpPCR- and ELAN-produced dumbbells relies in a) abasic sites that trigger the formation of b) internal loops close to the ends of the gpPCR-generated dumbbells. Abasic sites are being cleaved by the apurinic/apyrimidinic enzyme 1 (APE1) in human cells prior to base excision and/or nucleotide incision repair (FIG. 16) (43). Thus, these might not be considered advantageous for a genetic vector though the abasic site mimics used in this study, which are lacking the OH-group at the C-1 position of the 2-deoxyribose, are considerably more stable. The internal loops as well as larger terminal loops, however, trigger increased flexibility of the gpPCR-dumbbell ends (FIG. 17A). While rigid rod-like ELAN-dumbbells might enter the nuclear pore complexes (NPCs) only in nearly perpendicular orientation to the nuclear membrane (FIG. 17B), the more flexible ends of the gpPCR-dumbbells could enable NPC threading even from sub-perpendicular angles, that way accelerating the trajectory through the NPCs (FIG. 17C). A recent study suggested that passive fluxes through NPCs are controlled by channels with three distinct radii of 1.74 nm (78%), 2.63 nm (22%), and 4.32 nm (0.07%) corresponding to diameters of 3.48 nm, 5.26 nm, and 8.64 nm (44). The DNA double-helix effective diameter (d.sub.eff) in solutions containing the physiological salt concentration was calculated to be 5 nm, which is significantly larger than the geometric diameter of 2 nm (45). That implies that base-paired double-helical DNA can freely pass through the medium-sized NPC channels; however, depending on their size, terminal and internal loops would rapidly enlarge d.sub.eff beyond the cut-off value for passage through midsize meshes, thus significantly delaying the nuclear influx. Given a certain minimum size, however, terminal loops are more flexible then internal loops. This model is suitable to explain the reduced activity of dumbbells db-AP3-hp and db-AP3-loop as compared with db-AP1-hp (FIG. 17D).

[0240] To prove our hypothesis that gpPCR-dumbbells are more efficiently entering cellular nuclei, HepG2 cells were transfected with equimolar (1 pmol) amounts of db-AP1-hp, db-ELAN, or plasmid DNA and both nuclear vector abundance as well as transcriptional vector activity were monitored 24 h post transfection using qPCR (FIG. 18). Since db-vectors and plasmids have different PCR amplification efficiencies, we used individual rtPCR standard curves for the absolute quantification of each of the respective vectors. For example, a db-AP1-hp standard curve was used to quantify db-AP1-hp and so forth. As shown in FIG. 18A, nuclear delivery of the gpPCR-produced dumbbell was 6.4-fold (p<0.001) or 94.7-fold (p<0.001) enhanced compared with the ELAN-produced dumbbell or the plasmid. The fact that db-AP1-hp entered the nucleus much more efficiently compared with the equally sized db-ELAN indicates that not only the vector size but also the vector structure matters in terms of nuclear delivery. In accordance with the measured nuclear vector abundancies, highest transcriptional activity was detected for db-AP1-hp followed by db-ELAN and the plasmid DNA (FIG. 18B). These findings are consistent with our suggested model that the flexible ends of gpPCR-produced dumbbells might accelerate the trajectory through the nuclear pores. However, one has to keep in mind that the observed nuclear vector abundance is the result of a multi-step process and depends not only on diffusion through the nuclear pores but also on cellular delivery, endosomal escape, cytoplasmic and nuclear DNA stability, and the efficiency of vector DNA isolation from the nuclear compartment. To fully understand the phenomenon of facilitated nuclear targeting by gpPCR-produced dumbbells, more detailed studies of the delivery kinetics will be required.

[0241] In summary, our novel two-step gpPCR method produces higher yields of superior dumbbells at lower costs within a shorter period of time. The protocol is scalable and may facilitate large-scale production of RNA or protein expressing dumbbell vectors for pre-clinical and clinical investigation towards efficient and safe genetic therapy. The current focus and future challenge lies in covalent linkage of RNA, peptide or protein helper functions to the loops of the dumbbells for targeted delivery in vivo.

EXAMPLE 9

[0242] Dumbbell Vectors Trigger Prolonged Expression of Transgenes in Human Primary Cells

[0243] Many promising approaches in molecular medicine depend on efficient delivery of recombinant DNA into primary cells ex vivo or in vivo in order to trigger the expression of non-coding RNAs or proteins and subsequently a therapeutic phenotype. These approaches include the genetic therapy of inherited and acquired genetic diseases, genetic vaccination, stem cell programming, somatic cell reprogramming, immunotherapy, and protein expression.

[0244] All state-of-the-art technologies harbor major disadvantages: the expression of conventional naked DNA-based vectors such as plasmids is silenced in primary cells within 24 hours after delivery and RNA-based vectors achieve only short-term effects due the kinetic instability of RNA in living cells or organisms. Sustained transgene expression was only achieved with integrating viral delivery vectors, such as retroviral, lentiviral, or AAV vectors, which harbor severe safety concerns and risks. The dumbbell vector-based technology of this invention enables researchers and clinicians to achieve sustained transgene expression in primary cells without the need to integrate the foreign DNA into the host cell genome. In our example we designed and generated dumbbell-shaped DNA vectors for the expression of the eGFP reporter gene (FIG. 19). This dumbbell-shaped vector was then delivered via nucleofection into primary human PBMCs and subsequently eGFP expression was monitored using flow cytometry analyses (FIG. 20). Sustained expression triggered by the dumbbell-shaped vector could be monitored up to day 14 post delivery after which the primary cells died due to the tissue cell culture conditions. eGFP expression of a conventional plasmid vector containing the identical eGFP expression cassette plus the bacterial sequence backbone was silenced down to mock levels (cells treated with buffer only) within the first two days as reflected by the mean and median eGFP intensities detected by FACS analyses (FIGS. 20A,B). A fraction of cells expressing very low eGFP levels was still detectable in the plasmid sample until day 8 (FIG. 20C). However, the expression levels of these cells were too low to be reflected in the mean and median of expression levels. The presented dumbbell-DNA vector-based system triggers sustained transgene expression in human primary cells representing a promising tool for genetic therapy of human diseases as well as a safe and cheap alternative to viral gene delivery vectors.

EXAMPLE 10

Dumbbell Vectors for RNA-Guided Genome Editing

[0245] We designed, generated, and tested dumbbell vectors to deliver the CRISPR/Cas9(n)-mediated RNA-guided genome editing system into human cells for reversal of Glucose-6-phosphate dehydrogenase (G6PD) deficiency.

[0246] RNA-guided genome editing is based on RNA-mediated adaptive defense systems evolved from bacteria and archaea (46-49) termed clustered regulatory interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) systems which originally use short RNAs to direct degradation of foreign invading DNA originating from viruses or plasmids. The most popular system is the Streptococcus pyogenes (SP) type II CRISPR system. For editing of genomic DNA in human cells several system adaptations were made: 1. The originally distinct two short RNA molecules, called CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA), necessary to guide the enzyme to the DNA target in order to trigger cleavage were fused to form a single guide RNA (gRNA). The scaffolding tracrRNA domain, hereinafter referred to as Cas-interacting domain, can be fused to any crRNA domain, hereinafter referred to as DNA binding domain (BD) (50). 2. Codon optimization converted the SPCas9 into the hSPCas9 (51). 3. To reduce off-target editing, an aspartate-to-alanin substitution (D10A) was introduced to convert the DNA double-strand break (DSB) triggering hSPCas9 into the DNA nickase hSPCas9n (9). The DNA binding domain (20 to 17 nt in length) of the gRNA can now guide the gRNA-Cas9 complex to complementary/homologous DNA sites termed protospacer, hereinafter referred to as DNA target site, which has to be followed 3 by a second short identifier called PAM (protospacer adjacent motif) which is 5-NGG for the system described here. The BD of the gRNA can overlap with the site to be edited, or should alternatively be in proximity to this site. hSPCas9 complexes will then trigger DSBs, hSPCas9n complexes trigger nicks. Two hSPCas9n complexes with different gRNAs and shifted target sites will be required to trigger a double nick. DSBs including double nicks induced by Cas9 or Cas9n will then activate one of two endogenous repair mechanisms: 1. In the error-prone non-homologous end-joining (NHEJ) pathway, the ends will be processed and rejoined which can result in random insertion/deletion (indel) mutations. 2. Alternatively, a repair template in form of a plasmid, PCR product or single-stranded oligodeoxyribonucleotides (termed oligonucleotides in the following) can be supplied to leverage the homology-directed repair (HDR) pathway triggering high fidelity, precise editing. Single nicks trigger HDR using the intact strand as template. Beauty and simplicity of this technology, as opposed to transcription activator-like effector nucleases (TALENs) or zinc-finger nucleases (ZFNs), are given by the facts that (i) genomic target site selection is determined solely by base-complementarity to the gRNA and the optimized enzyme does not require further reengineering, (ii) higher targeting efficiencies (repair rates in the range of up to several ten %), and (iii) the possibility to perform multiplex genome editing (9, 52).

[0247] Red blood cell disorders also termed erythrocytic abnormalities (EAs) are the most prevalent inherited disorders worldwide. In particular, Southeast (SE) Asia bears a considerable burden of heritable EAs, which in most cases adversely affect normal human development and life span. The only cure has been the transplantation of bone-marrow cells (BMCs) from foreign donors whose success depends on the limited availability of suitable donors. Therapies based on genetic correction of a patient's own BMCs using state-of-the-art viral delivery vectors have shown promise, however its clinical application is limited by the alarming possibility of uncontrolled genomic vector integration. Thus there is a pressing need to develop gene therapies that are both safe and efficient. We developed dumbbell-shaped DNA minimal vectors to deliver the CRISPR/Cas9(n) genome editing technology into human tissue culture cells and cord blood stem cells (HSCs) isolated from patients to cure an important SE Asian EA, the Glucose-6-phosphate dehydrogenase deficiency.

[0248] RNA-guided genome editing requires the CRISPR/Cas9(n) components to be expressed for a sufficient but limited period of time. While plasmid vectors are suitable due to rapid transgene silencing in primary cells, lentiviral vectors irreversibly change the host cell genome offside the intended editing site. Dumbbell vectors trigger prolonged gene expression in primary cells and do not interfere with the target cell genome and, hence, are most suitable to deliver RNA-guided genome editing into primary including human primary cells.

[0249] We demonstrated that distinct molecular features can enhance the expression of coding and non-coding genes from db-vectors. We considered these features to design vectors which show strongest expression of hSPCas9(n). The basic dumbbell is composed of the gRNA and hSPCas9(n) expression cassettes of vectors pX330 and pX335 (9), containing the gRNA under control of the human U6 (hU6) promoter, followed by the CBh promoter, an modified MVM intron 3, the hSPCas9(n) coding sequence flanked by two nuclear localization signals, and the bGHpA (bovine growth hormone) polyadenylation signal (FIG. 21, construct A). We fused the Woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) to the mRNA 3 end for facilitated mRNA processing, enhanced nuclear RNA export, and gene expression (construct A1) (53). Secondly, we included the SV40 enhancer sequence or truncated versions thereof to support promoter function and/or trigger active nuclear import of the db-vectors (construct A2). Finally, we designed a vector harboring both WPRE and SV40 enhancer to achieve maximum synergistic effects on gene expression (construct A3). Applications involving the nickase enzyme require the expression of two different gRNAs which are usually expressed from two distinct vectors. We designed db-vectors harboring expression cassettes for the nickase and two gRNAs (construct B). The DNA repair templates required for homologous recombination are usually co-delivered as separate DNA molecules (ssDNA or dsDNA) together with the Cas9 and gRNA(s). Vectors unifying all three components, the gRNA gene(s), the Cas9 enzyme, and the repair template have not been described yet, presumably because dsDNA templates can be cleaved due to the high degree of homology with the genomic DNA target sequence. Single-stranded DNA repair templates, however, are no substrate of the Cas9 enzymes. Hence the unique structure of the db-vectors will allowed us to implement non-cleavable single-stranded repair templates of about 80 nt or longer in the terminal loop structures of the dumbbells (constructs D1 & D2). For comparison we also designed db-vectors containing dsDNA repair templates of 1 kb in length (constructs C1 & C2). Finally, we designed db-vectors amalgamating computationally designed gRNAs with all molecular features found to support the overall genetic editing efficiency (e.g. construct E). Neither Cas9/CRISPR-based reversal of EAs nor db-vector-based Cas9/CRISPR nor any of the molecular dumbbell features to be investigated in this work have ever been tested before.

[0250] Dumbbell construct A was generated from corresponding plasmid DNA using an optimized ELAN protocol (FIG. 22). Before exonuclease treatment, the ligation products showed a 5.6 kb band corresponding to the desired dumbbells, and bands at 2.8 kb and 180 bp corresponding to the EheI-cleaved plasmid backbone (FIG. 22B). Following exonuclease treatment, the 5.6 kb band remained while the 2.8 kb and 180 bp bands were no longer present (FIG. 22C) as expected. The expected 5.6 kb products corresponded to the exonuclease-resistant dumbbell vectors generated from pX330-MCS and pX335-MCS (FIG. 22C).

[0251] We performed a cutter assay to investigate the target cleavage activities. Therefore, 293T cells were co-transfected with the pVAX plasmid harbouring the G6PD Mahidol mutation as a target site and equimolar amounts of either a dumbbell vector or the corresponding plasmid expressing different guide-RNAs (g4, g16, g17, and g20). Episomal DNA was isolated and target cleavage was quantified using qPCR (FIG. 23A). Compared to the plasmid vectors, dumbbells showed enhanced CRISPR/Cas9-triggered target DNA cleavage.

[0252] Next we measured reversal of the G6PD Mahidol mutation on episomal plasmid target DNA in human tissue culture cells. PCR-RFLP qualitative analysis of episomal DNA extracts revealed successful editing of the G6PD-Mahidol mutation on the pVAX1-Mahidol repair target, to the wild-type sequence in 293T cells after 24 hours (FIG. 23B). Repair was observed in cells treated with the Cas9-g4, Cas9-g16 and Cas9-g17 plasmids and dumbbells. For Cas9-g4 constructs, dumbbell-triggered editing was more efficient than plasid-triggered editing. As expected, no detectable repair was observed with any of the constructs bearing the universal negative guide sequences.

REFERENCES

[0253] 1. Paul W E (2008). Fundamental Immunology. Philadelphia, Wolters Kluwer/Lippincott Williams & Wilkins. [0254] 2. Murphy K, Travers P, Walport M, Janeway C (2012). Janeway's immunobiology. New York, Garland Science. [0255] 3. Wagner R W, Matteucci M D, Grant D, Huang T, Froehler B C (1996). Potent and selective inhibition of gene expression by an antisense heptanucleotide. Nat Biotechnol 14, 7, 840-4. [0256] 4. Jung U, Jiang X, Kaufmann S H E, Patzel V (2013). A universal stem-loop primer-based TaqMan RT-PCR protocol for cost efficient detection of small non-coding RNA. RNA 19, 1864-73. [0257] 5. Myslinski E, Am? J-C, Krol A, Carbon P (2001). An unusually compact external promoter for RNA polymerase III transcription of the human H1RNA gene. Nucleic Acids Res. 29, 2502-9. [0258] 6. Taki M, Kato Y, Miyagishi M, Takagi Y, Sano M, Taira K (2003). A direct and efficient synthesis method for dumbell-shaped linear DNA using PCR in vitro. Nucleic Acids Res Suppl 3, 191-2. [0259] 7. Taki M, Kato Y, Miyagishi M, Takagi Y, Taira K (2004). Small-interfering-RNA expression in cells based on an efficiently constructed dumbbell-shaped DNA. Angew Chem Int Ed Engl 43, 24, 3160-3. [0260] 8. Cost G J (2007). Enzymatic ligation assisted by nucleases: simultaneous ligation and digestion promote the ordered assembly of DNA. Nat Protoc 2, 9, 2198-202. [0261] 9. Cong L, Ran F A, Cox D, Lin S, Barretto R, Habib N, Hsu P D, Wu X, Jiang W, Marraffini L A, Zhang F (2013). Multiplex genome engineering using CRISPR/Cas systems. Science 339, 6121, 819-23. [0262] 10. Zuker M (2003). Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res 31, 13, 3406-15. [0263] 11. Zeng Y, Wagner E J, Cullen B R (2002). Both natural and designed micro RNAs can inhibit the expression of cognate mRNAs when expressed in human cells. Mol Cell 9, 6, 1327-33. [0264] 12. Schakowski F, Gorschluter M, Junghans C, Schroff M, Buttgereit P, Ziske C, Schottker B, Konig-Merediz S A, Sauerbruch T, Wittig B, Schmidt-Wolf I G (2001). A novel minimal-size vector (MIDGE) improves transgene expression in colon carcinoma cells and avoids transfection of undesired DNA. Mol Ther 3, 5 Pt 1, 793-800. [0265] 13. Schakowski F, Gorschluter M, Buttgereit P, Marten A, Lilienfeld-Toal M V, Junghans C, Schroff M, Konig-Merediz S A, Ziske C, Strehl J, Sauerbruch T, Wittig B, Schmidt-Wolf I G (2007). Minimal size MIDGE vectors improve transgene expression in vivo. In Vivo 21, 1, 17-23. [0266] 14. Grimm D, Streetz K L, Jopling C L, Storm T A, Pandey K, Davis C R, Marion P, Salazar F, Kay M A. (2006). Fatality in mice due to oversaturation of cellular microRNA/short hairpin RNA pathways. Nature 441, 7092, 537-41. [0267] 15. Liang L, Wong C M, Ying Q, Fan D N, Huang S, Ding J, Yao J, Yan M, Li J, Yao M, Ng I O, He X (2010). MicroRNA-125b suppressesed human liver cancer cell proliferation and metastasis by directly targeting oncogene LIN28B2. Hepatology 52, 5, 1731-40. [0268] 16. Jia H Y, Wang Y X, Yan W T, Li H Y, Tian Y Z, Wang S M, Zhao H L (2012). MicroRNA-125b Functions as a Tumor Suppressor in Hepatocellular Carcinoma Cells. Int J Mol Sci 13, 7, 8762-74. [0269] 17. Dean D A (1997). Import of Plasmid DNA into the Nucleus Is Sequence Specific. Experimental Cell Research 230, 293-302. [0270] 18. Dean D, Dean B, Muller S, Smith L (1999). Sequence Requirements for Plasmid Nuclear Import. Experimental Cell Research 253, 713-22. [0271] 19. Vacik J, Dean B S, Zimmer W E, Dean D A (1999). Cell-specific nuclear import of plasmid DNA. Gene Therapy 6, 1006-14. [0272] 20. Miller A M, Dean D A (2008). Cell-specific nuclear import of plasmid DNA in smooth muscle requires tissue-specific transcription factors and DNA sequences. Gene Ther 15, 15, 1107-15 [0273] 21. L?ngle-Rouault F, Patzel V, Benavente A, Taillez M, Silvestre N, Bompard A, Sczakiel G, Jacobs E, Rittner K (1998). Up to 100-Fold Increase of Apparent Gene Expression in the Presence of Epstein-Barr Virus oriP Sequences and EBNA1: Implications of the Nuclear Import of Plasmids. Journal of Virology 72, 6181-5. [0274] 22. Miller A, Dean D (2009). Tissue-specific and transcription factor-mediated nuclear entry of DNA. Advanced Drug Delivery Reviews 61, 603-13. [0275] 23. Kr?tzfeldt J, Rajewsky N, Braich R, Rajeev K G, Tuschl T, Manoharan M, Stoffel M (2005). Silencing of microRNAs in vivo with antagomirs. Nature 438, 7068, 685-9 [0276] 24. Chabot S, Orio J, Castanier R, Bellard E, Nielsen S J, Golzio M, Teissie J (2012). LNA-based oligonucleotide electrotransfer for miRNA inhibition. Mol Ther 20, 8, 1590-8. [0277] 25. Meng F, Henson R, Wehbe-Janek H, Ghoshal K, Jacob S T, Patel T (2007). MicroRNA-21 regulates expression of the PTEN tumor suppressor gene in human hepatocellular cancer. Gastroenterology 133, 647-58. [0278] 26. Patzel V, Sczakiel G (1998). Theoretical design of antisense RNA structures substantially improves annealing kinetics and efficacy in human cells. Nature Biotechnology 16, 1, 64-8. [0279] 27. Patzel V (2004). In silico design of functional RNA molecules. Curr Opin Drug Discov Dev 7, 3, 360-9. [0280] 28. Patzel V, Sczakiel G (2000). In vitro selection supports the view of a kinetic control of antisense RNA-mediated inhibition of gene expression in mammalian cells. Nucleic Acids Res. 28, 13, 2462-6. [0281] 29. Patzel V, Sczakiel G (1999). Length dependence of RNA-RNA annealing. J. Mol. Biol. 294, 1127-34. [0282] 30. Lehmann M J, Patzel V, Sczakiel G (2000). Theoretical design of antisense genes with statistically increased efficacy. Nucleic Acids Res 28, 13, 2597-604. [0283] 31. Schirmbeck R, Konig-Merediz S A, Riedl P, Kwissa M, Sack F, Schroff M, Junghans C, Reimann J, Wittig B (2001). Priming of immune responses to hepatitis B surface antigen with minimal DNA expression constructs modified with a nuclear localization signal peptide. J Mol Med (Berl) 79, 5-6, 343-50. [0284] 32. Brinster R L, Allen J M, Behringer R R, Gelinas R E, Palmiter R D (1988). Introns increase transcriptional efficiency in transgenic mice. Proc Natl Acad Sci USA 85, 3, 836-40. [0285] 33. Mansfield S G, Chao H, Walsh C E (2004). RNA repair using spliceosome-mediated RNA trans-splicing. Trends Mol Med 10, 6, 263-8. [0286] 34. Kim J H, Lee S R, Li L H, Park H J, Park J H, Lee K Y, Kim M K, Shin B A, Choi S Y (2011). High cleavage efficiency of a 2A peptide derived from porcine teschovirus-1 in human cell lines, zebrafish and mice. PLoS One 6, 4, e18556. [0287] 35. Beltinger C, Fulda S, Kammertoens T, Meyer E, Uckert W, Debatin K M (1999). Herpes simplex virus thymidine kinase/ganciclovir-induced apoptosis involves ligand-independent death receptor aggregation and activation of caspases. Proc Natl Acad Sci USA 96, 15, 8699-704. [0288] 36. Jiang Y X, Lu Y, Liu T J, Yang J, Chen Y, Fang Y W (2011). Using HSV-TK/GCV suicide gene therapy to inhibit lens epithelial cell proliferation for treatment of posterior capsular opacification. Mol Vis 17, 291-9. [0289] 37. Hwang H C, Smythe W R, Elshami A A, Kucharczuk J C, Amin K M, Williams J P, Litzky L A, Kaiser L R, Albelda S M (1995). Gene therapy using adenovirus carrying the herpes simplex-thymidine kinase gene to treat in vivo models of human malignant mesothelioma and lung cancer. Am J Respir Cell Mol Biol 13, 1, 7-16. [0290] 38. Rumney S, Kool E T (1995). Structural Optimization of Non-Nucleotide Loop Replacements for Duplex and Triplex DNAs. J. Am. Chem. Soc. 117, 5635-46. [0291] 39. Takeshita M, Chang C N, Johnson F, Will S, Grollman A P (1987). Oligodeoxynucleotides containing synthetic abasic sites. Model substrates for DNA polymerases and apurinic/apyrimidinic endonucleases. J. Biol. Chem. 262, 10171-9. [0292] 40. Lin C, Xie M, Chen J J, Liu Y, Yan H (2006). Rolling-circle amplification of a DNA nanojunction. Angew Chem Int Ed Engl 45, 45, 7537-9. [0293] 41. Chu B C, Orgel L E (1992). The stability of different forms of double-stranded decoy DNA in serum and nuclear extracts. Nucleic Acids Res 20, 21, 5857-8. [0294] 42. Sambrook J, Russell D W (2001). Molecular cloning: a laboratory manual. Cold Spring Harbor, N.Y., Cold Spring Harbor Laboratory Press. [0295] 43. Li M, Wilson D M, 3rd (2014). Human apurinic/apyrimidinic endonuclease 1. Antioxid Redox Signal 20, 4, 678-707. [0296] 44. Mohr D, Frey S, Fischer T, Guttler T, Gorlich D (2009). Characterisation of the passive permeability barrier of nuclear pore complexes. EMBO J 28, 17, 2541-53. [0297] 45. Rybenkov V V, Cozzarelli N R, Vologodskii A V (1993). Probability of DNA knotting and the effective diameter of the DNA double helix. Proc Natl Acad Sci USA 90, 11, 5307-11. [0298] 46. Wiedenheft B, Sternberg S H, Doudna J A (2012). RNA-guided genetic silencing systems in bacteria and archaea. Nature 482, 7385, 331-8. [0299] 47. Horvath P, Barrangou R (2010). CRISPR/Cas, the immune system of bacteria and archaea. Science 327, 5962, 167-70. [0300] 48. Barrangou R, Fremaux C, Deveau H, Richards M, Boyaval P, Moineau S, Romero D A, Horvath P (2007). CRISPR provides acquired resistance against viruses in prokaryotes. Science 315, 5819, 1709-12. [0301] 49. Marraffini L A, Sontheimer E J (2008). CRISPR interference limits horizontal gene transfer in staphylococci by targeting DNA. Science 322, 5909, 1843-5. [0302] 50. Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna J A, Charpentier E (2012). A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 6096, 816-21. [0303] 51. Ran F A, Hsu P D, Wright J, Agarwala V, Scott D A, Zhang F (2013). Genome engineering using the CRISPR-Cas9 system. Nat Protoc 8, 11, 2281-308. [0304] 52. Mali P, Yang L, Esvelt K M, Aach J, Guell M, DiCarlo J E, Norville J E, Church G M (2013). RNA-guided human genome engineering via Cas9. Science 339, 6121, 823-6. [0305] 53. Niang M, Bei A K, Madnani K G, Pelly S, Dankwa S, Kanjee U, Gunalan K, Amaladoss A, Yeo K P, Bob N S, Malleret B, Duraisingh M T, Preiser P R (2014). STEVOR is a Plasmodium falciparum erythrocyte binding protein that mediates merozoite invasion and rosetting. Cell Host Microbe 16, 1, 81-93.