Abstract
The invention relates to a method for detecting the proximity of at least two biomolecules using branched DNA technology. The assay is called branched proximity hybridization assay.
Claims
1. Method for detecting the proximity of at least two target biomolecules comprising: Providing at least two target biomolecules, providing at least two Target Binding Reagents, each binding to at least one of said target biomolecules, wherein at least one designed Oligo Extension, comprising a linker and a complementary sequence to a Z-DNA Probe or a complementary sequence to a Pre-amplifier, is attached to each Target Binding Reagent, binding of at least two Target Binding Reagents with different Oligo Extensions to the at least two target biomolecules and hybridization of two Z-DNA Probes, that are in vicinity, to Pre-amplifiers, or hybridization of the sequence complementary to a Pre-amplifier to Pre-amplifiers, forming a bDNA structure, wherein said bDNA structure comprises Pre-amplifiers and Amplifiers hybridization of Label Probes and detection.
2. Method according to claim 1, wherein the Target Binding Reagent is a biomolecule, preferred selected from the group comprising nucleic acid sequences, aptamers, antibodies, Fab, nanobodies and scFv.
3. Method according to claim 1 or 2, wherein said two Z-DNA Probes bind to the complementary sequences of the Oligo Extensions.
4. Method according to at least one of the preceding claims, wherein the molar ratio between Target Binding Reagent and Oligo Extension is 1:1.
5. Method according to at least one of the preceding claims, wherein the method is a high-throughput method.
6. Method according to at least one of the preceding claims, wherein the detection is a fluorescent or an enzymatic detection.
7. Method according to at least one of the preceding claims, wherein the method is a multiplex assay.
8. Method according to at least one of the preceding claims, wherein the target biomolecules are proteins or nucleic acids.
9. Method according to at least one of the preceding claims, wherein the method is a protein-protein and/or a protein-nucleic acid proximity assay.
10. Method according to at least one of the preceding claims, wherein the Label Probes are fluorescently, biotin- or enzyme-labeled probes.
11. Method according to at least one of the preceding claims, wherein the method is linear over at least two logarithmic scales.
12. Method according to at least one of the preceding claims, wherein the designed Oligo Extension is coupled to a Target Binding Reagent via (i) Chemical crosslinking (ii) Labeling Target Binding Reagent with a designed Oligo Extension using a sortase transpeptidase, (iii) Nucleic acid synthesis.
13. Kit for use in a method according to at least one of the preceding claims, comprising Target Binding Reagents with attached designed Oligo Extensions and Pre-amplifiers, Amplifiers and Label Probes.
14. Kit according to the preceding claim further comprising Z-DNA Probes.
15. Use of a method or a kit according to at least one of the preceding claims in medical diagnostics.
Description
FIGURES
[0070] The invention is further described by the figures. These are not intended to limit the scope of the invention.
[0071] Short description of the figures:
[0072] FIG. 1: Design of a preferred protein-protein proximity assay of the invention.
[0073] FIG. 2: Design of a preferred protein-nucleic acid proximity assay of the invention.
[0074] FIG. 3: Coupling through chemical crosslinking
[0075] FIG. 4: Coupling using sortase transpeptidase
[0076] FIG. 5: Coupling using aptamers
[0077] FIG. 6: Protein-protein proximity: Detection of BCR oligomers (aptamer)
[0078] FIG. 7: Protein-protein proximity: Detection of membrane associated immunoglobulin heavy chain dimers (nanobody)
[0079] FIG. 8: Protein-protein proximity: Detection of cytokine receptor homodimerization on the cell surface (antibody)
[0080] FIG. 9: Results of bPHA experiments
[0081] FIG. 10: Linearity comparison
[0082] FIG. 11: Data collection and speed comparison
[0083] FIG. 12: Design of a preferred protein-protein proximity assay of the invention.
[0084] FIG. 13: Ramos BCR-specific TD05 aptamer design
DETAILED DESCRIPTION OF THE FIGURES
[0085] FIG. 1: Schematic representation of the design of a preferred protein-protein proximity assay of the invention. The different steps of the method are demonstrated. This figure shows a method using a Z-DNA Probe. The target biomolecules are two different proteins A and B. Two Target Binding Reagents are used, both protein binding reagents. Both Target Binding Reagents have an attached Oligo Extension comprising a sequence complementary to a Z-DNA Probe. bDNA technology is used for the detection. [0086] FIG. 2: Schematic representation of the design of a preferred protein-nucleic acid proximity assay of the invention. The target biomolecules are a protein and a nucleic acid target. Two different Target Binding Reagents are used, one protein binding reagent and one oligonucleotide specific for the nucleic acid target. Both Target Binding Reagents have an attached Oligo Extension comprising a sequence complementary to a Z-DNA Probe. bDNA technology is used for the detection. [0087] FIG. 3: Example of Oligo Extension couplings to Target Binding Reagents via chemical crosslinking. As a Target Binding Reagent an antibody, a Fab fragment, a nanobody, or a scFv can be used. Sulfo-SMCC (sulfosuccinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate) and a thio modified oligonucleotide are used for the crosslinking. [0088] FIG. 4: Example of Oligo Extension couplings to Target Binding Reagents using sortase transpeptidase. This figure shows the specific labeling of a target specific scFv or nanobody with only one oligonucleotide using sortase transpeptidase (1:1 molar ratio). [0089] FIG. 5: Example of Oligo Extension couplings to Target Binding Reagents using aptamers. A 1:1 Oligo Extension/Target Binding Reagent ratio using aptamers is achieved. [0090] FIG. 6: Protein-protein proximity proof of concept: Detection of BCR oligomers on the Ramos cell surface using aptamers as Target Binding Reagents. FIG. 6 a) shows a schematic representation of the detection. FIG. 6 b) shows that the resting state BCR oligomer can be detected by a preferred method of the invention using aptamer as target binding reagents. Control without the Z-DNA Probes produces negative results. [0091] FIG. 7: Protein-protein proximity proof of concept: Detection of the membrane associated immunoglobulin heavy chain dimers on the Ramos cell surface using nanobodies as target binding reagents. FIG. 7 a) shows a schematic representation of the detection. FIG. 7 b) shows that the dimerization of the membrane associated immunoglobulin dimer can be detected by a preferred method of the invention using nanobodies as Target Binding Reagents. Controls missing the Z-DNA Probes or one of the Target Binding Reagents produce negative results. [0092] FIG. 8: Protein-protein proximity proof of concept: Detection of cytokine receptor homodimerization on the cell surface using antibodies as Target Binding Reagents. FIG. 8 a) shows that the homodimerization of TSLPR on the J558L cell surface is only detected in TSLPR expressing cells by a preferred method of the invention. FIG. 8 b) shows that the homodimerization of IL-7Ra on the J558L cell surface is only detected in the II-7Ra expressing cells by a preferred method of the invention. [0093] FIG. 9: Results of bPHA experiments. FIG. 9 a) shows the FACS results for the transduced IgD KO Ramos cells and the gating strategy. The GFP negative cells express only the IgM BCR while the GFP positive population expresses the GFP-m as well. FIG. 9 b) shows the FACS plot for the transduced IgM KO Ramos cells including the gating strategy. The GFP negative cells express only the IgD BCR while the GFP positive population expresses the GFP-m as well. [0094] FIGS. 9 c)-f) show that bPHA Target Binding Reagents are specific. [0095] FIG. 9 c) shows a schematic representation of the surface BCR organization in the transduced (GFP positive) and non-transduced (GFP negative) IgD KO or IgM KO Ramos cells. The GFP negative IgD KO cells express only the IgM-BCR which should form BCR oligomers while the GFP positive population expresses the GFP-m as well that incorporates into the IgM-BCR oligomers. The GFP negative IgM KO cells express only the IgD-BCR which forms BCR oligomers while the GFP positive population would express the GFP-m as well and it could not incorporate into the IgD-BCR oligomers. [0096] FIG. 9 d) shows that the bPHA Target Binding Reagents are specific. GFP-m expression in IgD KO and IgM KO Ramos cells are equal and the expression of GFP-m did not alter the surface expression of both IgM-BCR and IgD-BCR in the IgD KO and IgM KO Ramos cells. Fluorescent labeled TD05 was able to detect similar expression of IgD-BCR and IgM-BCR in both the transduced and non-transduced IgD KO and IgM KO cells suggesting that the expression of GFP-m did not alter the surface expression of both IgM-BCR and IgD-BCR in the IgD KO and IgM KO Ramos cells. Fluorescent labeled Enh (GFP-specific nanobody called enhancer) could detect a similar expression of GFP-m only in the transduced cells. [0097] FIG. 9 e) explains the expected bPHA results using different pairs of the Target Binding Reagents based on the scheme of FIG. 9 c). Basically, the TD05+/TD05 pair allows the detection of Ramos BCR (IgM-BCR in IgD KO and IgD-BCR in IgM KO) oligomerization. Enh+/Enh pair allows the detection of GFP-m surface expression and the proximity of the two arms of the GFP-m. The TD05+/Enh pair allows the detection of the proximity between GFP-m and the BCR. [0098] FIG. 9 f) shows that the bPHA results are as expected. The GFP-m/BCR proximity can be seen in the transduced IgD KO cells. The signal is higher in the IgD KO cells then in the transduced IgM KO cells. [0099] FIG. 10: FIG. 10 shows a comparison of linearity of a preferred method of the invention and a state of the art proximity ligation assay (PLA). FIG. 10 a) shows the linear signal of a bPHA method of the invention whereas FIG. 10 b) shows the non-linear signal of a PLA assay. [0100] FIG. 11: FIG. 11 shows a comparison of data collection and analysis speed of a preferred method of the invention and a state of the art proximity ligation assay (PLA). FIG. 11 a) shows that the bPHA signal is measured for 2500 cells by FACS in only 24 sec. The raw data are exported for fitting and the fitting can be done within seconds. FIG. 11 b) shows that PLA signal is measured by confocal microscopy. The collection of images with 100-200 cells typically amounts to 1-2 hrs. The images are then processed by ImageJ, the PLA signals counted by the Blobfinder software, and the final counts plotted as bar graph, which normally requires 2-3 hours. [0101] FIG. 12: Schematic representation of the design of a preferred protein-protein proximity assay of the invention using aptamers as Target Binding Reagents. Two Target Binding Reagents are used, both aptamers. Both Target Binding Reagents have an attached Oligo Extension comprising a sequence complementary to a Z-DNA Probe. bDNA technology is used for the detection. [0102] FIG. 13: FIG. 13 shows the design of preferred aptamer Target Binding Reagents with attached Oligo Extensions.
Examples
[0103] The invention is further described by the following examples. These are not intended to limit the scope of the invention. The experimental examples relate to
1. Protein-Protein Proximity Assay Using an Aptamer
[0104] Proof of concept was demonstrated with a detection of BCR oligomers on the Ramos cell surface. Therefore, the target proteins were BCR on the Ramos cell surface. As the Target Binding Reagent a synthesized TD05 aptamer was used. Different Oligo Extensions, each with a complementary region to a Z-DNA Probe, were used in this example.
[0105] FIG. 6 a) shows a schematic representation of this detection. FIG. 6 b) shows that the resting state BCR oligomer can be detected by a preferred method of the invention using aptamer as Target Binding Reagents. Control without the Z-DNA Probes produces negative results. As a Ramos BCR-specific TD05 aptamer the following sequence was used.
TABLE-US-00004 SEQIDNO7: ACCGGGAGGATAGTTCGGTGGCTGTTCAGGGTCTCCTCCCGGTG
[0106] TD05+, TD05 and TD05+ were generated by synthesis. TD05+ alone can detect the BCR expressed on the Ramos cells. + and refer to different Oligo Extensions.
[0107] TD05+ and TD05 pairs are needed to detect the BCR (oligomers).
2. Protein-Protein Proximity Assay Using a Nanobody
[0108] GFP fused to mIgM HC (GFP-m) was used as target biomolecules. The target binding reagent was the enhancer (Enh) GFP-specific nanobody produced in E. coli.
[0109] Enh+, Enh were generated by sortagging. FIG. 7 shows in a) a structure of the hybridized complex. FIG. 7 b) shows the bPHA can be used to detect the proximity of the two arms of the BCR.
3. Protein-Protein Proximity Assay Using an Antibody
[0110] Detection of cytokine receptor homodimerization on the cell surface
[0111] TSLPR or IL-7Ra expressed on the cells surface were used as target proteins. Target Binding Reagents are anti-TSLPR antibody and anti-IL-7Ra antibody (both are commercially available: Anti-TSLPR: R&D, AF546, anti-II7ra(CD127): eBioscience, 14-1271-82). Oligo Extension coupled antibody probes were prepared using sulfo-SMCC and thio modified oligonucleotides.
[0112] FIG. 8 a) shows that the homodimerization of TSLPR on the J558L cell surface is only detected in the TSLPR expressing cells by bPHA. FIG. 8 b) shows that the homodimerization of IL-7Ra on the J558L cell surface is only detected in the IL-7Ra expressing cells by bPHA.
4. Multiplexing
[0113] To confirm the class-specific oligomerization of the BCR, multiplexing bPHA experiments were conducted.
[0114] bPHA experimental systems: [0115] IgD KO Ramos cells and IgM KO Ramos cells [0116] Transduction with GFP-m results in a mixed GFP positive and GFP negative population
[0117] The results of these experiments proof that bPHA Target Binding Reagents are specific. Therefore, bPHA faithfully detects the oligomerization of IgM and IgD and works in mixed cell populations.
[0118] The results are shown in FIG. 9.
5. Linearity
[0119] Linearity comparison of bPHA and the state-of-the-art proximity ligation assay (PLA) were performed.
[0120] The results are shown in FIG. 10.
6. Data Collection and Speed
[0121] Data collection and analysis speed comparison of bPHA and PLA were performed.
[0122] The results are shown in FIG. 11. bPHA of the invention:
[0123] Collection of 2500 cells by FACS: 24 seconds
[0124] Data analysis on laptops: 5 seconds
[0125] PLA (state-of-the-art):
[0126] Collection of 100-200 cells by microscopy: 1 to 2 hours
[0127] Data analysis on desktop computers: 2 to 3 hours
