IMMORTALISED CHICKEN EMBRYO FIBROBLASTS

Abstract

The present invention relates to immortalised chicken embryo fibroblasts, to cell cultures comprising such immortalised cells, to vaccines comprising such cells, to methods for the propagation of avian viruses on such cells, and to methods for the preparation of such cells and such vaccines.

Claims

1-16. (canceled)

17. A stably transfected immortalized chicken embryo fibroblast (CEF), wherein said immortalized CEF (i) expresses an SV40 T antigen, (ii) expresses a chicken telomerase (cTERT) under the control of a heterologous promoter, and (iii) does not comprise an exogenous retroviral Long Terminal Repeat (LTR) DNA.

18. A cell culture comprising the immortalized CEF of claim 17.

19. The cell culture of claim 18, which is infected with an avian virus or avian viral vector.

20. The cell culture of claim 19, wherein the avian virus or avian viral vector is selected from the group consisting of Marek's Disease virus (MDV), the MDV-related Herpes virus of turkey (HVT), Newcastle Disease virus (NDV), Infectious Bronchitis virus (IBV), Infectious Bursal Disease virus (IBDV), Egg Drop Syndrome virus (EDSV), Turkey Rhinotracheitis virus (TRT), Reovirus (RV) and a HVT vector; wherein said HVT vector comprises an IBDV VP2-gene, an IBV-spike protein gene, an avian influenza HA gene, an ILT gD/gI protein gene, or an NDV F-gene.

21. A method of preparing the immortalized CEF of claim 17, comprising the steps of: a) obtaining primary CEF cells; b) transfecting said primary CEFs with: i) a first DNA molecule free of LTR sequences, comprising transposon inverted repeats and further comprising a gene encoding the SV40 T antigen under the control of a suitable promoter; ii) a second DNA molecule free of LTR sequences, comprising transposon inverted repeats and further comprising a gene encoding chicken telomerase (cTERT) under the control of a suitable promoter; and iii) a third DNA molecule comprising a gene encoding transposase under the control of a suitable promoter; and c) selecting CEF cells that have been cultured for at least 45 cell cycles.

22. A method of preparing the immortalized CEF of claim 17, comprising the steps of: a) obtaining primary CEF cells; b) transfecting said primary CEF cells with a single DNA molecule free of LTR sequences, comprising (i) transposon inverted repeats and a gene encoding the SV40 T antigen under the control of a suitable promoter, (ii) a gene encoding chicken telomerase under the control of a suitable promoter, and (iii) a gene encoding transposase under the control of a suitable promoter; and c) selecting CEF cells that have been cultured for at least 45 cell cycles.

23. A method of preparing the immortalized CEF of claim 17, comprising the steps of: a) obtaining primary CEF cells; b) transfecting said primary CEF cells with (i) a first DNA molecule free of LTR sequences, comprising transposon inverted repeats, a gene encoding the SV40 T antigen under the control of a suitable promoter, and a gene encoding chicken telomerase under the control of a suitable promoter, and (ii) a second DNA molecule comprising a gene encoding transposase under the control of a suitable promoter; and c) selecting CEF cells that have been cultured for at least 45 cell cycles.

24. The method of claim 21, wherein said CEF cells have been cultured for at least 100 cell cycles.

25. The method of claim 22, wherein said CEF cells have been cultured for at least 100 cell cycles.

26. The method of claim 23, wherein said CEF cells have been cultured for at least 100 cell cycles.

27. A method for replicating an avian virus or avian viral vector, wherein said method comprises the steps of: a) culturing the immortalized CEF of claim 17; b) contacting the immortalized CEF with the avian virus or avian viral vector; c) allowing the avian virus or avian viral vector to replicate; and d) isolating a progeny virus or vector from said immortalized CEF.

28. The method of claim 27, wherein the avian virus or avian viral vector is selected from the group of avian viruses consisting of Marek's Disease virus (MDV), the MDV-related Herpes virus of turkey (HVT), Newcastle Disease virus (NDV), Infectious Bronchitis virus (IBV), Infectious Bursal Disease virus (IBDV), Egg Drop Syndrome virus (EDSV), Turkey Rhinotracheitis virus (TRT), Reovirus (RV), a HVT vector; wherein said HVT vector comprises an IBDV VP2-gene, an IBV-spike protein gene, an avian influenza HA gene, an ILT gD/gI protein gene, or an NDV F-gene.

29. The method of claim 27, wherein the avian virus or avian viral vector is selected from the group of avian viruses consisting of a MDV and a MDV vector virus.

30. A method of preparing a vaccine comprising an avian virus or an avian viral vector, comprising the step of mixing the cell culture of claim 19 with a pharmaceutically acceptable carrier.

31. The method of claim 30, wherein the avian virus or an avian viral vector is an MDV.

32. The method of claim 30, wherein the MDV or MDV viral vector is in a live attenuated form.

33. A vaccine comprising the cell culture of claim 19, and a pharmaceutically acceptable carrier.

34. A method of preparing a vaccine comprising an avian virus or an avian viral vector, wherein the method comprises the steps of: a) infecting the cell culture of claim 18 with an avian virus or an avian viral vector; b) replicating said avian virus or an avian viral vector; c) isolating a progeny avian virus or avian viral vector; and d) mixing the progeny avian virus or avian viral vector with a pharmaceutically acceptable carrier.

Description

LEGEND TO THE FIGURES

[0071] FIG. 1: Vector maps for pPB-CAG-SV40 T Ag (A) and pPB-CAG-cTERT (B).

[0072] FIG. 2: cTERT amino acid sequence. * indicates stop codon.

[0073] FIG. 3: Growth curve of the CEF ST-1 cell line. Cells transfected with pPB-EV (crosses), pPB-SV (diamonds) or pPB-SV and pPB-cTERT (CEF ST-1) (squares) were passaged. Cell numbers were determined at each passage to calculate the population doublings per passage.

[0074] FIG. 4: CEF ST-1 morphology remains constant during passaging. CEF ST-1 cells were photographed at passage 25 (100?)(A) and passage 44 (100?)(B).

[0075] FIG. 5: Growth curve of the CEF ST-2 cell line. Cells transfected with pPB-SV (diamonds) or pPB-SV and pPB-cTERT (CEF ST-2) (squares) were passaged. Cell numbers were determined at each passage to calculate the population doublings per passage.

[0076] FIG. 6: CEF ST-2 morphology remains constant during passaging. CEF ST-2 cells were photographed at passage 19 (100?)(A) and passage 26 (40?)(B).

[0077] FIG. 7: HVT replication in CEF ST-2 cells. CEF ST-2 cells were infected with HVT at T=0 with an MOI of 0.05. Cells were harvested at the indicated time-points and HVT titers were determined by titration.

[0078] FIG. 8: CEF ST-2 cells were infected with HVT at T=0 with an MOI of 0.05. Cells were trypsinized and harvested after 96 hours and reseeded on a fresh CEF ST-2 monolayer. This procedure was repeated 4 times. At each passage, samples were harvested to determine the HVT titer.

[0079] FIG. 9: CEF ST-2 cells were infected with HVT or recombinant HVT viruses at T=0 with an MOI of 0.05. Cells were trypsinized and harvested after 96 hours. HVT titers were determined by titration.

EXAMPLES

Example 1: Immortalization of Chick Embryonic Fibroblasts

Plasmids.

[0080] To construct pPB-CAG-SV40 T Ag, XhoI and BglII sites were added to SV40 T Ag by PCR using primers SV40 Tag 5-BII (5-GGCGAGATCTACCATGGATAAAGTTTTAAACAG-3) and SV40 Tag 3-XI (5-GGCGCTCGAGTTATGTTTCAGGTTCAGGGG-3). Phusion DNA polymerase was used for PCR according to the manufacturer's protocol (New England Biolabs). The fragment was cloned into pCR-Blunt (Life Technologies) and verified by sequencing. Next, SV40 T Ag was excised from pCR-Blunt and cloned into pPB-CAG-EBNXN (Yusa et al., 2009) using the BglII-XhoI sites to create pPB-CAG-SV40 T Ag (FIG. 1A). The final construct was verified by sequencing.

[0081] The sequence encoding cTERT followed by a feline herpesvirus polyA signal sequence (CAATAAACATAGCATACGTTATGACATGGTCTACCGCGTCTTATATGGGGACGAC) (Willemse et al., 1995) was generated synthetically, sequenced and cloned into pPB-CAG-EBNXN (Yusa et al., 2009) using the XhoI-ClaI sites to create pPB-CAG-cTERT (FIG. 1B and FIG. 2). Plasmid DNA for transfection into CEFs was isolated using the Qiagen EndoFree plasmid maxi kit (Qiagen).

Isolation and Growth of CEFs.

[0082] Ten SPF eggs were incubated at 37? C. for ten days and used for isolation of primary embryonic fibroblasts. Embryos were harvested from the eggs under sterile conditions. After removal of the head, legs and wings, embryos were washed three times in sterile PBS and dissociated using a trypsin/EDTA solution. After dissociation, fetal calf serum was added to inactivate trypsin. The isolated cells were centrifuged for 15 minutes at 400?g. Pelleted cells were resuspended in DMEM containing 5% fetal calf serum (Moregate), 1% chicken serum (Sigma), 2 mM glutamine, 1 mM sodium pyruvate and antibiotics, stained for viability and counted. 2.10?5 cells/cm2 were plated in culture flasks and incubated at 40? C. and 5% CO.sub.2.

Transfection

[0083] After 3 days in culture, CEFs were harvested and viable cells were counted before transfection. Per transfection, 1.10?6 viable cells were transfected in 100 ?l Primary cell buffer P3+supplement (Lonza Cologne AG) using program CA-137 of the Nucleofector 4D device (Lonza Cologne AG). Cells were transfected with 1,6 ?g pPB-CAG-SV40 T Ag and 0,4 ?g pPB-CMV-hyPBase (Yusa et al., 2011) or, as a control, with 1,6 ?g pPB-CAG-EBNXN and 0,4 ?g pPB-CMV-hyPBase. After administration of the pulse, cells were left at RT for 5 min. Next, 400 ?l RPMI 1640 (37? C.) was slowly added to the cells and cells were incubated at 37? C. for 5 minutes. Then, cells were carefully resuspended, seeded in T25 flasks in growth medium and incubated at 40? C. and 5% CO.sub.2. Transfection of the CEF+pPB-CAG-SV40 T Ag cells with pPB-CAG-cTERT was performed using the same protocol. Here, CEFs stably transfected with pPB-CAG-SV40 T Ag were transfected with 1,6 ?g pPB-CAG-cTERT and 0,4 ?g pPB-CMV-hyPBase (Yusa et al., 2011) or, as a control, either with 1,6 ?g pPB-CAG-EBNXN and 0,4 ?g pPB-CMV-hyPBase or with 2 ?g of a standard GFP expression vector (pmaxGFP, Lonza).

Tissue Culture

[0084] After transfection, cultures were grown in growth medium (DMEM containing 5% fetal calf serum (Moregate), 1% chicken serum (Sigma), 2 mM glutamine, 1 mM sodium pyruvate) and routinely passaged upon 80-90% confluency. After removal of the medium, cells were washed twice with PBS and trypsinized using a trypsin/EDTA solution. Cells were resuspended in growth medium and pelleted. The pelleted cells were resuspended in growth medium and counted using a B?rker-T?rk counting chamber. Cells were plated in fresh medium in Cellbind tissue culture flasks (Corning) and incubated at incubated at 40? C. and 5% CO.sub.2. CEF+pPB-CAG-SV40 cells were frozen for liquid nitrogen storage at different passages in standard medium containing 42.5% FCS and 10% DMSO. CEF+pPB-CAG-SV40 T Ag cells transfected with p-PB-CAG-cTERT or with control plasmids were plated on collagen I-coated surfaces (Biocoat, Corning) in normal growth medium or animal component free medium+1% newborn calf serum (Hyclone, ThermoFisher). The number of population doublings was calculated using the following equation:

[00001]$\mathrm{Population}.Math..Math.\mathrm{doublings}=\frac{\log .Math..Math.\mathrm{Nt}-\mathrm{Log}.Math..Math.N}{\log .Math..Math.2},$

where Nt was the number of viable cells at the end of the growth period and N the number of plated cells (Venkatesan and Price, 1998). Cells were photographed using an Olympus DP21 camera coupled to an Olympus CKX41 microscope.

Infection

[0085] Cells were seeded 24 hours prior to infection at a density of 1.10?5 cells/cm2 in animal component free medium with or without 0.25% newborn calf serum and incubated at 40? C. and 5% CO2. Cells were infected with an MOI of 0.05 plaque forming units (PFU). Viruses used were HVT (FC126), a recombinant HVT expressing both an NDV F and an IBDV VP2 antigen (HVT-NDV-IBDV) and a recombinant HVT expressing an ILT gD/gI antigen (HVT-ILT). After infection, cells were incubated at 38.5? C. and 5% CO.sub.2. Medium was replenished completely after 72 hours in case cells were incubated for more than 72 hours. Depending on the experiment, samples for titration were harvested 72, 96, 120 or 144 hours after infection and frozen for liquid nitrogen storage: After removal of the medium, cells were washed twice with PBS and trypsinized using a trypsin/EDTA solution. Cells were resuspended in growth medium and pelleted. After removal of the supernatant, cells were resuspended in fresh growth medium and counted. Next, 1.10?7/ml cells were frozen in growth medium containing a final concentration of 10% DMSO and 20% fetal calf serum and stored in liquid nitrogen.

Titration

[0086] Ampoules of the frozen HVT-infected cells were thawed and the number of PFU/ml was determined by titrating the HVT-infected cells on CEFs. Plaques were visualized with an immunofluorescence assay using monoclonal antibodies or polyclonal chicken serum recognizing HVT. Goat-anti-chicken Alexa 488 antibodies or goat-anti-mouse Alexa 488 antibodies were used as secondary antibodies, respectively. All titrations were performed in duplo.

Results

Expression of SV40 T Antigen Extends the Lifespan of Primary CEFs.

[0087] Primary CEFs were transfected at passage 1 with pPB-CAG-SV40 T Ag (pPB-SV) and a piggyBac transposase expression vector to obtain genomic integration and stable expression of SV40 T Ag. As a control, CEFs were also transfected with the empty pPB-CAG-EBNXN (pPB-EV) vector. After transfection, cells were routinely passaged at 80-90% confluency and counted to determine the number of viable cells. The number of viable cells at passaging was used to calculate the number of doublings of the population after seeding (population doublings (PDs)). Although SV40 T Ag expressing cells showed an extended lifespan compared to controls (35 population doublings versus 26 population doublings, respectively), all cultures eventually stopped growing around passage 17 (FIG. 3). After passage 17, proliferating cells were still present in the cultures. However, since many cells in the culture died, no increase in total cell numbers was found and eventually all cells died.

[0088] CEF+pPB-SV cells were examined for SV40 T Ag expression at different passages with an immunofluorescence assay using a monoclonal antibody specific for SV40 T Ag. At passage 2, one passage after transfection, a small number of cells was SV40 T Ag positive. Nearly all cells expressed SV40 T Ag after passage 7 (data not shown).

Expression of cTERT in SV40 T Ag-Expressing Cells Induces Immortalization.

CEF ST-1 Cell Line

[0089] To obtain immortalized CEFs we transfected CEF+pPB-SV cells with the pPB-CAG-cTERT (pPB-cTERT) expression vector. CEF+pPB-SV passage 13 ampoules were thawed, cells were taken into culture, passaged and transfected at passage 18 with pPB-cTERT and the transposase expression vector. The total number of CEF+pPB-SV cells at passage 18 was low. Therefore we used the CEF+pPB-SV cells that were transfected with a standard GFP expression vector (EV) to determine transfection efficiency also as empty vector controls during passaging. After transfection, cells were seeded and examined daily for proliferation and outgrowth of colonies. No proliferation was observed in the CEF+pPB-SV+EV cultures and all cells eventually died (data not shown). In the CEF+pPB-SV+pPB-cTERT cultures, however, rapidly proliferating colonies were clearly visible after 10 days. These colonies were trypsinized, cells were counted and seeded in tissue culture flasks. We found that these cells proliferated better in animal component free (ACF) medium than in our standard growth medium (data not shown), therefore we continued to grow these cells in ACF medium. These CEF+pPB-SV+pPB-cTERT cells continued to grow vigorously and were passaged until they had performed over 100 population doublings (PDs) (FIG. 3).

[0090] At this point, cells were still healthy and proliferating vigorously. Therefore, we concluded that we had established an immortalized CEF cell line and named it CEF ST-1 (for CEF+SV40 T Ag+cTERT-nr.1). The cells have a fibroblastic morphology which remains constant during passaging (FIG. 4).

[0091] CEF ST-1 cells of different passages have been frozen down in ampoules for liquid nitrogen storage. These cells can be easily regrown after liquid nitrogen storage.

CEF ST-2 Cell Line

[0092] CEF ST-1 was generated by transfecting passage 18 CEF+pPB-SV cells with the cTERT expression vector. At this point, a limited number of cells was still proliferating and many cells in the culture had already died. Since only a small number of immortalized colonies grew out after cTERT transfection and gave rise to the CEF ST-1 cell line, we conclude that CEF ST-1 is an oligoclonal cell line.

[0093] In order to establish a polyclonal cell line, i.e. a cell line originating from many different immortalized CEF cells, we also transfected early passage CEF+pPB-SV cells with cTERT. CEF+pPB-SV cells that were stored in liquid nitrogen at passage 9 were taken into culture, passaged in ACF medium and transfected at passage 11 cells with pPB-cTERT or pPB-EV in combination with the transposase expression vector. After transfection, cells were seeded and passaged. CEF+pPB-SV+pPB-EV cells stopped proliferating and died after passage 16 (data not shown). Cells transfected both with pPB-SV and pPB-cTERT continued to proliferate vigorously and were passaged until they had performed over 70 PDs (passage 33, FIG. 5).

[0094] At this point, cells were still healthy and proliferating well. Therefore, we concluded that we had established another immortalized CEF cell line. This cell line was named CEF ST-2 (for CEF+SV40 T Ag+cTERT-nr.2). CEF ST-2 cells have a fibroblastic morphology which remains constant during passaging (FIG. 6). CEF ST-2 cells of different passages have been frozen down in ampoules for liquid nitrogen storage. These cells can be easily regrown after liquid nitrogen storage.

Replication of HVT on CEF ST-1 and CEF ST-2.

[0095] We tested both the CEF ST-1 and CEF ST-2 cell line for their ability to support Herpes virus of turkey (HVT) replication. First, using an immunofluorescence assay (IF), we demonstrated that CEF ST-1 can be infected by HVT and supports the replication of HVT. CEF ST-1 cells were infected with HVT and fixed for IF after 72, 96 and 120 hours. HVT-positive foci could be seen in HVT-infected CEF ST-1 cells at all time-points, indicating that CEF ST-1 cells can be infected by HVT and support cell-to-cell spread of HVT (data not shown).

[0096] In a second experiment, we compared the efficiency of HVT infection and cell-to-cell spread between the CEF ST-1 and CEF ST-2 cells. Both CEF ST-1 and CEF ST-2 were infected with HVT and fixed at different time-points to study the kinetics of HVT replication in these cell lines. HVT-positive foci were present in both cell lines after 24, 48 and 72 hours and the number and size of the foci increased in time (data not shown). From these experiments it was clear that a higher number of HVT foci and also larger foci were seen in CEF ST-2 compared to CEF ST-1. We therefore concluded that CEF ST-2 cells are a better substrate for HVT replication than CEF ST-1.

[0097] Next, we examined HVT replication kinetics in the CEF ST-2 line in more detail. CEF ST-2 cells were infected with HVT and samples were taken 72, 96, 120 and 144 hours after infection to determine the number of plaque forming units (PFU) per ml (FIG. 7). These results indicate that HVT replicates on CEF ST-2 cells, and although differences in titer between different times of harvesting are small, virus titers seem to peak around 96 hours after infection (FIG. 7).

HVT can be Passaged on CEF ST-2 Cells.

[0098] After we had established that CEF ST-2 is a substrate for HVT infection and replication, we examined whether HVT-infected CEF ST-2 cells could infect fresh monolayers of CEF ST-2 cells. CEF ST-2 cells were infected with HVT, harvested after 96 hours and seeded onto a monolayer of fresh CEF ST-2 cells. This procedure was repeated 4 times and at each passage cells were fixed for IF staining and samples were taken to determine the number of PFU/ml. The IF staining demonstrated that HVT-positive foci were present after each passage and a large number of clear HVT foci were seen after the fourth passage (data not shown). Titration showed that HVT titers at passage 2 are slightly lower compared to passage 1 titers (FIG. 8). However, subsequent passaging on CEF ST-2 cells resulted in an increase in HVT titers with each passage and at passage 5 HVT titers were 10.sup.5.7 PFU/ml. This clearly shows that the CEF ST-2 cell line is a suitable substrate for HVT replication.

CEF ST-2 is a Substrate for Replication of Recombinant HVT Constructs.

[0099] HVT can also be used as a viral vector for the expression of antigens, e.g. of other avian viruses such as Newcastle Disease Virus (NDV), Infectious Bursal Disease virus (IBDV) or Infectious Laryingotracheitis virus (ILT)(Iqbal, 2012). To test whether CEF ST-2 cells also allow replication of recombinant HVT constructs, CEF ST-2 cells were infected either with wild type HVT, a recombinant HVT expressing both an NDV F and a IBDV VP2 antigen (HVT-NDV-IBDV) or a recombinant HVT expressing an ILT gD/gI antigen (HVT-ILT). Cells were fixed for IF staining or cells were harvested to make samples for titration 96 hours after infection. IF staining clearly showed foci both for wild type HVT and recombinant HVT constructs in CEF ST-2 cells (data not shown). Titration of the samples also demonstrated that CEF ST-2 cells support the replication of HVT recombinants (FIG. 9) although replication of the recombinant HVTs is less efficient than wild type HVT replication in the conditions used.

REFERENCE LIST

[0100] Iqbal, M. (2012). Progress toward the development of polyvalent vaccination strategies against multiple viral infections in chickens using herpesvirus of turkeys as vector. Bioengineered. 3, 222-226. [0101] Venkatesan, R. N. and Price, C. (1998). Telomerase expression in chickens: constitutive activity in somatic tissues and down-regulation in culture. Proc. Natl. Acad. Sci. U. S. A 95, 14763-14768. [0102] Willemse, M. J., Strijdveen, I. G., van Schooneveld, S. H., van den Berg, M. C., and Sondermeijer, P. J. (1995). Transcriptional analysis of the short segment of the feline herpesvirus type 1 genome and insertional mutagenesis of a unique reading frame. Virology 208, 704-711. [0103] Yusa, K., Rad, R., Takeda, J., and Bradley, A. (2009). Generation of transgene-free induced pluripotent mouse stem cells by the piggyBac transposon. Nat. Methods 6, 363-369. [0104] Yusa, K., Zhou, L., Li, M. A., Bradley, A., and Craig, N. L. (2011). A hyperactive piggyBac transposase for mammalian applications. Proc. Natl. Acad. Sci. U. S. A 108, 1531-1536.