KIT FOR DETECTING FOOT-AND-MOUTH DISEASE VIRUS AND DETECTION METHOD THEREOF
20230102037 · 2023-03-30
Inventors
Cpc classification
C12Q2521/107
CHEMISTRY; METALLURGY
C12Q1/6888
CHEMISTRY; METALLURGY
C12Q2521/107
CHEMISTRY; METALLURGY
C12Q2600/112
CHEMISTRY; METALLURGY
International classification
Abstract
The present disclosure provides a kit for detecting foot-and-mouth disease virus and a detection method thereof, and belongs to the technical field of biological detection. The kit includes crRNA, T7 transcriptase, NTP, a probe, Cas13a, and a nucleic acid amplification reagent; the nucleic acid amplification reagent includes a primer pair; the primer pair is selected from nucleic acid sequences shown in SEQ ID No: 1 and SEQ ID No: 2, and/or those shown in SEQ ID No: 3 and SEQ ID No: 4; and the crRNA is selected from nucleic acid sequences shown in SEQ ID No: 5 and SEQ ID No: 6. The kit can be used for detecting the foot-and-mouth disease virus for non-diagnostic treatment purposes; the method has extremely high specificity and sensitivity, and provides a reference for preparation and production of a detection reagent for major animal diseases based on isothermal amplification.
Claims
1. A kit for detecting foot-and-mouth disease virus, wherein the kit comprises: crRNA, T7 transcriptase, NTP, a probe, Cas13a, and a nucleic acid amplification reagent; the nucleic acid amplification reagent comprises a primer pair, and the primer pair is selected from nucleic acid sequences shown in SEQ ID No: 1 and SEQ ID No: 2, and/or those shown in SEQ ID No: 3 and SEQ ID No: 4; the crRNA is selected from nucleic acid sequences shown in SEQ ID No: 5 and SEQ ID No: 6.
2. The kit according to claim 1, wherein the nucleic acid amplification reagent further comprises an amplification reagent for recombinase polymerase amplification (RPA) or recombinase-aid amplification (RAA).
3. The kit according to claim 1, wherein the crRNA has a concentration of 10 μM, the T7 transcriptase has concentration of 1 mg/mL, the NTP has a concentration of 100 mM, the probe has a concentration of 10 μM , the Cas13a has a concentration of 1 mg/mL.
4. The kit according to claim 1, wherein the kit further comprises: a reaction buffer and water.
5. The kit according to claim 4, wherein the kit comprises: 1 μL of the crRNA, 1.5 μL of the T7 transcriptase, 4 μL of the NTP, 2.5 μL of the probe, 0.5 μL of the Cas13a, 2.5 μL of a nucleic acid amplification product, 2.5 μL of the reaction buffer, and 11 μL of the water; the nucleic acid amplification product is amplified by the nucleic acid amplification reagent.
6. A method of use of the kit according to claim 1, comprising the following steps: step S1, obtaining a nucleic acid amplification product by using the nucleic acid amplification reagent; step S2, mixing the nucleic acid amplification product with the crRNA, the T7 transcriptase, the NTP, the probe and the Cas13a in proportion to obtain a reaction solution; and step S3, reacting the reaction solution and collecting fluorescence.
7. The method of use according to claim 6, wherein the nucleic acid amplification reagent further comprises an amplification reagent for recombinase polymerase amplification (RPA) or recombinase-aid amplification (RAA).
8. The method of use according to claim 6, wherein the crRNA has a concentration of 10 μM, the T7 transcriptase has concentration of 1 mg/mL, the NTP has a concentration of 100 mM, the probe has a concentration of 10 μM, the Cas13a has a concentration of 1 mg/mL.
9. The method of use according to claim 6, wherein the kit further comprises: a reaction buffer and water.
10. The method of use according to claim 9, wherein the kit comprises: 1 μL of the crRNA, 1.5 μL of the T7 transcriptase, 4 μL of the NTP, 2.5 μL of the probe, 0.5 μL of the Cas13a, 2.5 μL of a nucleic acid amplification product, 2.5 μL of the reaction buffer, and 11 μL of the water; the nucleic acid amplification product is amplified by the nucleic acid amplification reagent.
11. The method of use according to claim 6, wherein, in step S1, the nucleic acid amplification product obtained by the nucleic acid amplification reagent comprises: a nucleic acid amplification product amplified by an RPA or RAA system; and/or a nucleic acid amplification product purified by a phenol-chloroform method.
12. The method of use according to claim 7, wherein, in step S1, the nucleic acid amplification product obtained by the nucleic acid amplification reagent comprises: a nucleic acid amplification product amplified by an RPA or RAA system; and/or a nucleic acid amplification product purified by a phenol-chloroform method.
13. The method of use according to claim 8, wherein, in step S1, the nucleic acid amplification product obtained by the nucleic acid amplification reagent comprises: a nucleic acid amplification product amplified by an RPA or RAA system; and/or a nucleic acid amplification product purified by a phenol-chloroform method.
14. The method of use according to claim 6, wherein the reaction solution in step S2 comprises: 1 μL of the crRNA, 1.5 μL of the T7 transcriptase, 4 μL of the NTP, 2.5 μL of the probe, 0.5 μL of the Cas13a, 2.5 μL of the nucleic acid amplification product, 2.5 μL of a reaction buffer, and 11 μL of water.
15. The method of use according to claim 6, wherein, in step S3, reacting the reaction solution and collecting the fluorescence comprises the following conditions: a temperature at which the reaction is carried out is 39° C.; and/or time for collecting the fluorescence is 30-120 min.
16. Use of the kit according to claim 1 in the detection of foot-and-mouth disease virus for non-diagnostic treatment purposes.
17. The use according to claim 16, wherein the nucleic acid amplification reagent further comprises an amplification reagent for recombinase polymerase amplification (RPA) or recombinase-aid amplification (RAA).
18. The use according to claim 16, wherein the crRNA has a concentration of 10 μM, the T7 transcriptase has concentration of 1 mg/mL, the NTP has a concentration of 100 mM, the probe has a concentration of 10 μM , the Cas13a has a concentration of 1 mg/mL.
19. The use according to claim 16, wherein the kit further comprises: a reaction buffer and water.
20. The use according to claim 19, wherein the kit comprises: 1 μL of the crRNA, 1.5 μL of the T7 transcriptase, 4 μL of the NTP, 2.5 μL of the probe, 0.5 μL of the Cas13a, 2.5 μL of a nucleic acid amplification product, 2.5 μL of the reaction buffer, and 11 μL of the water; the nucleic acid amplification product is amplified by the nucleic acid amplification reagent.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0033] The present disclosure will be further described below with reference to accompanying drawings and examples, herein:
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
DETAILED DESCRIPTION OF THE EMBODIMENTS
[0040] The concept of the present disclosure and the technical effects produced thereby will be described clearly and completely below with reference to the examples, so as to fully understand the purpose, features and effects of the present disclosure. Obviously, the described examples are only a part of, not all of, the examples of the present disclosure. Based on the examples of the present disclosure, all other examples obtained by those skilled in the art without creative efforts shall fall within the protection scope of the present disclosure. All test methods used in the examples are conventional methods, unless otherwise specified; all materials and reagents used are commercially available, unless otherwise specified.
[0041] Sources of reagents and materials: Cas13a enzyme is prepared, expressed and purified according to method in the literature (J. S. Gootenberg et al., Science, Nucleic acid detection with CRISPR-Cas13a/C2c2, 2017); RT-RAA detection kit is purchased from Hangzhou ZC Bio-Sci & Tech Co. Ltd.; RNaseAlert Lab Test Kit V2 is purchased from Invitrogen, and T7 kit is purchased from NEB. Other reagents are analytical reagents made in China.
EXAMPLE
[0042] A kit for detecting FMDV was provided, including: crRNA, T7 transcriptase, NTP, a probe, Cas13a, a nucleic acid amplification reagent, a reaction buffer, and water.
[0043] Herein, the nucleic acid amplification reagent included a primer pair designed based on the FMDV. The sequences of the designed primer pair were: (1) SEQ ID No: 1 and SEQ ID No: 2, and crRNA sequence: SEQ ID No: 5, which were used to detect FMDV serotypes Asian1, SAT1/2/3, and C strains; (2) SEQ ID No: 3 and SEQ ID No: 4, and crRNA sequence: SEQ ID No: 6, which were used to detect FMDV serotypes O and A strains. The nucleic acid amplification reagents used also included other reagents for the RAA system. Due to a large variation of the virus sequence, two sets of primers were used in this example to achieve full coverage of the detection of different subtypes of FMDV strains.
[0044] The specific sequence information is shown in Table 1 below:
TABLE-US-00001 TABLE 1 Primers and crRNA sequences of FMDV Name Sequence (5′-3′) FMDVascF AATTCTAATACGACTCACTATAGGGACTGGGTTTTACAAA CCTGTGATGGCTTCGAAGA (SEQ ID No. 1) FMDVascR CGCAGGTAAAGTGATCTGTAGCTTGGAATCTC (SEQ ID No. 2) FMDVasc- GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACUCCC crRNA ACGGCGUGCAAAGGAGAGGAUAGC (SEQ ID No. 5) FMDVoaF AATTCTAATACGACTCACTATAGGGGACTATGGAACTGGG TTTTACAAACCTGTGATGGC (SEQ ID No. 3) FMDVoaR GGCGTTCACCCAACGCAGGTAAAGTGATCTGTA(SEQ ID No. 4) FMDVoa- GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACUCCC crRNA ACGGCGUGCAAAGGAGAGGAUAGC (SEQ ID No. 6)
[0045] crRNA was synthesized by using crDNA, herein, FMDVasc-crDNA sequence (SEQ ID No: 7) was: AATTCTAATACGACTCACTATAGGGGATTTAGACTACCCCAAAAACGAAGGGGACTAA AACTCCCACGGCGTGCAAAGGAGAGGATAGC; FMDVoa-crDNA sequence was: AATTCTAATACGACTCACTATAGGGGATTTAGACTACCCCAAAAACGAAGGGGACTAA AACTCCCACGGCGTGCAAAGGAGAGGATAGC (SEQ ID No: 8).
[0046] The probe used in this example was FAM-UUUUUUUUUUUUUU-TAMRA (SEQ ID NO: 9), where the FAM and the TAMRA are fluorophores. In other examples, the fluorophore may further be selected from group consisting of TET, HEX, Cy3, Cy5, and ROX. A method of use of a kit for detecting FMDV, namely an FMDV RAA-Cas13a detection method, was provided, including the following steps:
[0047] Step S1. A nucleic acid amplification product was obtained by the nucleic acid amplification reagent, and the system was composed of the designed primer pair and the amplification reagent for RAA, and the FMDV detection sample was used as a template for amplification.
[0048] Step S2. A reaction solution was prepared, and the restricted digestion reaction system (a 25 μL system) after isothermal amplification was constructed as follows: 2.5 μL of 10× reaction buffer, 1 μL of crRNA (10 μM), 1.5 μL of T7 transcriptase (1 mg/mL), 4 μL of NTP (100 mM), 2.5 μL of probe (10 μM), 2.5 μL of RAA product purified by the phenol-chloroform method, 11 μL of water, and 0.5 μL of Cas13a (1 mg/mL). Each of the above concentration was a final concentration of each component in the system. Herein, the reaction buffer contained reagents with the following components at final concentrations: 40 mM Tris-HCl, 60 mM NaCl, and 6 mM MgCl.sub.2, constituting a pH 7.3 buffer system.
[0049] S3. The reaction solution system prepared in step S2 was reacted and fluorescence was collected. The reaction temperature was 39° C., and the fluorescence was collected for 30 min.
[0050] In the present disclosure, the detection method in the example was referred to as “RAA-Cas13a detection” or “RAA-Cas13a method”.
COMPARATIVE EXAMPLE
[0051] A RAA system kit (purchased from Hangzhou ZC Bio-Sci & Tech Co. Ltd.) was used in this comparative example, and the kit of the comparative example was used to detect FMDV. The specific process was as follows:
[0052] S1. An RAA amplification system was used; according to the 25 μL reaction system, the volume of each reagent component was in accordance with the kit instructions, the template volume was 1 μL, and the reaction conditions were implemented at 37° C. for 30 min.
[0053] Step S2, after RAA, the detection results were analyzed by agarose gel electrophoresis.
[0054] In the present disclosure, the detection method in the comparative example was referred to as “RAA detection” or “RAA method”.
TEST EXAMPLE
[0055] The detection effects of the kits of the example and the comparative example on FMDV was tested in this test example (in the following test, the detection method in the example was referred to as “RAA-Cas13a detection” or “RAA-Cas13a method”, and that in the comparative example was referred to as “RAA detection” or “RAA method”), mainly including their detection sensitivity, specificity and accuracy. The specific experiments were as follows:
1. Sensitivity of RAA-Cas13a Detection
[0056] The detection was conducted according to the detection methods in the example and the comparative example, respectively:
[0057] (1) For different concentrations of plasmids of FMDV serotypes Asian1, SAT1/2/3, and C strains, at this time, the primer pair used was FMDVascF (SEQ ID No: 1) and FMDVascR (SEQ ID No: 2). Gradiently diluted plasmids were used as templates. The plasmid concentrations were 1×10.sup.6 copies/μL, 1×10.sup.5 copies/μL, 1×10.sup.4 copies/μL, 1×10.sup.3 copies/μL, 1×10.sup.2 copies/μL, 1×10.sup.1 copies/μL, 1×10.sup.0 copy/μL, and 0 copies/μL, respectively. Experimental results were obtained:
[0058] Comparative Example: For different concentrations of plasmids of FMDV serotypes Asian1, SAT1/2/3, and C strains, the minimum copy number of positive plasmids detected by ordinary RAA was 10.sup.4 copies/μL, but 10.sup.3 copies/μL plasmids and those and lower this concentration could not be detected. The results are shown in
[0059] Implementaion Example: For different concentrations of plasmids of FMDV serotypes Asian1, SAT1/2/3, and C strains, the kit in the example was used for detection (RAA-Cas13a detection), and a minimum of 10.sup.2 copies/μL positive plasmids could be detected. The results are shown in
[0060] (2) For different concentrations of plasmids of FMDV serotypes O and A strains, at this time, the primer pair used was FMDVoaF (SEQ ID No: 3) and FMDVascR (SEQ ID No: 4). Gradiently diluted plasmids were used as templates. The plasmid concentrations were 1×10.sup.6 copies/μL, 1×10.sup.5 copies/μL, 1×10.sup.4 copies/μL, 1×10.sup.3 copies/μL, 1×10.sup.2 copies/μL, 1×10.sup.1 copies/μL, 1×10.sup.0 copy/μL, and 0 copies/μL, respectively.
[0061] Comparative Example: For different concentrations of plasmids of FMDV serotypes O and A strains, the minimum copy number of positive plasmids detected by ordinary RAA was 10.sup.4 copies/μL, but 10.sup.3 copies/μL plasmids and those and lower this concentration could not be detected. The results are shown in
[0062] Implementaion Example: For different concentrations of plasmids of FMDV serotypes O and A strains, the kit in the example was used for detection (RAA-Cas13a detection system), and a minimum of 10.sup.2 copies/μL positive plasmids could be detected. The results are shown in
2. Specificity of RAA-Cas13a Detection
[0063] In order to test the specificity of this method, positive nucleic acids of FMDV strains and those of other 7 swine disease viruses were detected by the RAA-Cas13a method. Specific steps were as follows:
[0064] (1) A primer pair for serotypes Asian1, SAT1/2/3, and C (the primer pair used is shown in SEQ ID No: 1 and SEQ ID No: 2) was used to detect positive clinical samples. The results are shown in
[0065] (2) A primer pair for serotypes O and A (the primer pair used is shown in SEQ ID No: 3 and SEQ ID No: 4) was used to detect positive clinical samples. The results are shown in
[0066] After positive samples were amplified by RAA, obvious fluorescence signal enhancement of FMDV-positive nucleic acids could be detected by the Cas13a reaction system 10 min after the reaction, and the positive nucleic acids of the remaining 7 swine disease viruses had no fluorescence signal enhancement.
3. Consistency Comparison with Detection Results of Fluorescent RT-PCR
[0067] Two sets of primer pairs designed in Example 1 were used for simultaneous detection, and if one set was tested positive, it was determined to be positive for FMDV. In order to evaluate the consistency between the method established in this study and fluorescent RT-PCR, 14 FMDV-positive cDNA samples preserved in this laboratory and other 38 negative pork nucleic acid samples prepared by reverse transcription were tested. All samples were simultaneously tested in accordance with the GB/T 22915-2008 Protocol of Universal Fluorogenic RT-PCR for Foot and Mouth Disease Virus. Among them, 13 samples that were tested positive by the fluorescent RT-PCR method could be detected by RAA-Cas13a, and the κ value was between 0.81 and 1.00 (κ=0.95), indicating that the detection results of the RAA-Cas13a method established in this study were almost identical to the those stipulated by the national standard. The detection results are shown in Table 2 below:
TABLE-US-00002 TABLE 2 Consistency comparison with FMDV detection results of RAA-Cas13a method versus fluorescent RT-PCR Fluorescent RT-PCR Positive Negative Total RAA-Cas13a Positive 13 0 13 Negative 1 29 30 Total 14 29 43
[0068] Compared with the fluorescent RT-PCR method in the standard, the specificity of the RAA-Cas13a method established in this study was: 29/(29+0)=100.00%; the sensitivity was: 13/(13+1)=92.86%; Po=(13+29)/43=97.67%; Pe=14/43×13/43+29/43×30/43=56.90%; κ=(Po−Pe)/(1−Pe)=0.95.
[0069] In summary, the kit of the present disclosure has extremely high specificity and sensitivity for the detection of FMDV. Two sets of primers can be used to detect a total of seven FMDV serotypes, namely, serotypes A, O, C, Asial, and SA1/2/3, and have low demand for the template concentration, while a minimum of 10.sup.2 copies/μL positive plasmids can be detected. Therefore, the kit and the detection method provided by the present disclosure are used for the detection of foot-and-mouth disease virus, enrich clinical detection methods, and provide a reference for the preparation and production of detection reagents for major animal diseases based on isothermal amplification.
[0070] The examples of the present disclosure have been described in detail above with reference to the accompanying drawings, but the present disclosure is not limited thereto. Within the scope of knowledge possessed by those of ordinary skill in the art, various modifications can be made without departing from the purpose of the present disclosure. In addition, in the case of no conflict, the examples of the present disclosure and the features in the examples may be combined with each other.
Sequence Listing Information:
[0071] DTD Version: V1_3 [0072] File Name: GWP20220700074-Sequencing Lising.xml [0073] Software Name: WIPO Sequence [0074] Software Version: 2.1.2 [0075] Production Date: 2022-09-02
General Information:
[0076] Current application/Applicant file reference: GWP20220700074 [0077] Earliest priority application/IP Office: CN [0078] Earliest priority application/Application number: 202111128236.X [0079] Earliest priority application/Filing date: 2021-09-26 [0080] Applicant name: AFTC of Shanghai Customs [0081] Applicant name/Language: en [0082] Invention title: KIT FOR DETECTING FOOT-AND-MOUTH DISEASE VIRUS AND DETECTION METHOD THEREOF (en) [0083] Sequence Total Quantity: 9
TABLE-US-00003 Sequences: Sequence Number (ID): 1 Length: 59 Molecule Type: DNA Features Location/Qualifiers: - source, 1 . . . 59 >PCR_primers, fwd_name: FMDVascF, fwd_seq: aattctaatacgactcactatagggactgggttttacaaacctgtgatggcttcgaaga, rev_name: FMDVascR, rev_seq: cgcaggtaaagtgatctgtagcttggaatctc > mol_type, other DNA > note, Primer_FMDVascF > organism, synthetic construct Residues: aattctaata cgactcacta tagggactgg gttttacaaa cctgtgatgg cttcgaaga 59 Sequence Number (ID): 2 Length: 32 Molecule Type: DNA Features Location/Qualifiers: - source, 1 . . . 32 >PCR_primers, fwd_name: FMDVascF, fwd_seq: aattctaatacgactcactatagggactgggttttacaaacctgtgatggcttcgaaga, rev_name: FMDVascR, rev_seq: cgcaggtaaagtgatctgtagcttggaatctc > mol_type, other DNA > note, Primer_FMDVascR > organism, synthetic construct Residues: cgcaggtaaa gtgatctgta gcttggaatc tc 32 Sequence Number (ID): 3 Length: 60 Molecule Type: DNA Features Location/Qualifiers: - source, 1 . . . 60 >PCR_primers, fwd_name: FMDVoaF, fwd_seq: aattctaatacgactcactataggggactatggaactgggttttacaaacctgtgatggc, rev_name: FMDVoaR, rev_seq: ggcgttcacccaacgcaggtaaagtgatctgta > mol_type, other DNA > note, Primer_FMDVoaF > organism, synthetic construct Residues: aattctaata cgactcacta taggggacta tggaactggg ttttacaaac ctgtgatggc 60 Sequence Number (ID): 4 Length: 33 Molecule Type: DNA Features Location/Qualifiers: - source, 1 . . . 33 >PCR_primers, fwd_name: FMDVoaF, fwd_seq: aattctaatacgactcactataggggactatggaactgggttttacaaacctgtgatggc, rev_name: FMDVoaR, rev_seq: ggcgttcacccaacgcaggtaaagtgatctgta > mol_type, other DNA > note, Primer_FMDVoaR > organism, synthetic construct Residues: ggcgttcacc caacgcaggt aaagtgatct gta 33 Sequence Number (ID): 5 Length: 64 Molecule Type: RNA Features Location/Qualifiers: - source, 1 . . . 64 > mol_type, other RNA > note, crRNA sequence: FMDVasc-crRNA > organism, synthetic construct Residues: gatttagact accccaaaaa cgaaggggac taaaactccc acggcgtgca aaggagagga 60 tagc 64 Sequence Number (ID): 6 Length: 64 Molecule Type: RNA Features Location/Qualifiers: - source, 1 . . . 64 > mol_type, other RNA >note, crRNA sequence: FMDVoa-crRNA > organism, synthetic construct Residues: gatttagact accccaaaaa cgaaggggac taaaactccc acggcgtgca aaggagagga 60 tagc 64 Sequence Number (ID): 7 Length: 89 Molecule Type: DNA Features Location/Qualifiers: - source, 1 . . . 89 > mol_type, other DNA > note, FMDVasc-crDNA sequence > organism, synthetic construct Residues: aattctaata cgactcacta taggggattt agactacccc aaaaacgaag gggactaaaa 60 ctcccacggc gtgcaaagga gaggatagc 89 Sequence Number (ID): 8 Length: 89 Molecule Type: DNA Features Location/Qualifiers: - source, 1 . . . 89 > mol_type, other DNA > note, FMDVoa-crDNA sequence > organism, synthetic construct Residues: aattctaata cgactcacta taggggattt agactacccc aaaaacgaag gggactaaaa 60 ctcccacggc gtgcaaagga gaggatagc 89 Sequence Number (ID): 9 Length: 14 Molecule Type: RNA Features Location/Qualifiers: - source, 1 . . . 14 > mol_type, other RNA > note, sequence of probe > organism, synthetic construct Residues: tttttttttt tttt 14 END