Methods for Enhancing Antigen-Specific Immune Responses
20180169221 ยท 2018-06-21
Inventors
Cpc classification
A61K39/4611
HUMAN NECESSITIES
A61K39/39
HUMAN NECESSITIES
A61K47/643
HUMAN NECESSITIES
A61K47/646
HUMAN NECESSITIES
A61K9/0019
HUMAN NECESSITIES
C07K2319/40
CHEMISTRY; METALLURGY
A61K2239/59
HUMAN NECESSITIES
A61K2239/38
HUMAN NECESSITIES
A61K2039/545
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
International classification
A61K39/39
HUMAN NECESSITIES
A61K39/00
HUMAN NECESSITIES
Abstract
Described herein are methods comprising administering to a mammalian subject an effective amount of an annexin chimeric fusion protein, wherein the annexin chimeric fusion protein comprises at least one immunogenic antigen, thereby enhancing the antigen specific immune response relative to administration of the immunogenic antige alone. Methods and kits for treating or preventing recurrence of hyper proliferating diseases, e.g., cancer, are described. A method may comprise priming a mammal by administering to the mammal an effective amount of a chemotherapeutic agent and boosting the mammal by administering to the mammal an effective amount of an annexin chimeric fusion.
Claims
1. A method of inducing or enhancing an antigen-specific immune response in a mammal, comprising administering to the mammal an effective amount of an annexin chimeric fusion protein, wherein the annexin chimeric fusion protein comprises at least one immunogenic antigen, thereby enhancing the antigen specific immune response relative to administration of the immogenic antigen alone.
2. The method of claim 1, wherein the annexin is Annexin V (annV).
3-4. (canceled)
5. The method of claim 1, wherein the antigen is selected from the group consisting of ovalbumin (OVA), HPV16 E6, HPV16 E7, modified colon carcinoma antigen AH5, and influenza antigen M1.
6. The method of claim 2, wherein the annV chimeric fusion protein comprises a furin cleavage site.
7. (canceled)
8. The method of claim 1, wherein the annV chimeric fusion protein is administered intravenously via injection.
9-12. (canceled)
13. The method of claim 1, wherein the mammal is a human, wherein said human is afflicted with cancer.
14. (canceled)
15. A method of inducing or enhancing an antigen-specific immune response in a mammal, comprising the steps of: (a) priming the mammal by administering to the mammal an effective amount of a chemotherapeutic agent; and (b) boosting the mammal by administering to the mammal an effective amount of an annexin chimeric fusion protein, thereby inducing or enhancing the antigen-specific immune response.
16. The method of claim 15, wherein the annexin is Annexin V (annV).
17-18. (canceled)
19. The method of claim 15, wherein the antigen is selected from the group consisting of ovalbumin (OVA), HPV16 E6, HPV16 E7, modified colon carcinoma antigen AH5, and influenza antigen M1.
20. The method of claim 16, wherein the annV chimeric fusion protein comprises a furin cleavage site.
21. (canceled)
22. The method of claim 20, wherein the annV chimeric fusion protein is administered intravenously via injection.
23. (canceled)
24. The method of claim 15, wherein the chemotherapeutic agent is administered intraperitoneally.
25. (canceled)
26. The method of claim 15, wherein the chemotherapeutic agent is cisplatin.
27. (canceled)
28. The method of claim 15, wherein the mammal is a human, wherein said human is afflicted with cancer.
29-33. (canceled)
34. The method of claim 15, wherein the antigen-specific immune response is greater in magnitude than an antigen-specific immune response induced by administration of the annexin chimeric fusion protein alone or chemotherapeutic agent alone.
35. (canceled)
36. A method for treating or preventing advanced stage cancer in a mammal comprising (a) priming the mammal by administering to the mammal an effective amount of a chemotherapeutic agent; and (b) boosting the mammal by administering to the mammal an effective amount of an annexin chimeric fusion protein, thereby inducing or enhancing the antigen-specific immune response.
37. The method of claim 36, wherein the advanced stage cancer is selected from the group consisting of melanoma, thymoma, colon carcinoma, pancreatic carcinoma, and ovarian carcinoma.
38. The method of claim 36, wherein the annexin is Annexin V (annV).
39. The method of claim 36, wherein the antigen is selected from the group consisting of ovalbumin (OVA), HPV16 E6, HPV16 E7, modified colon carcinoma antigen AH5, and influenza antigen M1.
40. The method of claim 36, wherein the chemotherapeutic agent is cisplatin.
41. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
DETAILED DESCRIPTION
[0060] The inventors of the present invention have determined that papillomavirus pseudovirions represents a novel approach for the delivery of naked DNA vaccines to improve transfection efficiency without safety concerns associated with live viral vectors. Accordingly, the present invention is drawn to methods for enhancing an antigen-specific immune response in a mammal using recombinant papillomavirus pseudovirions comprising an antigen.
Partial List of Abbreviations
[0061] ANOVA, analysis of variance; APC, antigen presenting cell; CRT, calreticulin; CTL, cytotoxic T lymphocyte; DC, dendritic cell; E6, HPV oncoprotein E6; E7, HPV oncoprotein E7; ELISA, enzyme-linked immunosorbent assay; HPV, human papillomavirus; IFN ?, interferon-?; i.m., intramuscular(ly); i.t., intratumoral(ly); i.v., intravenous(ly); luc, luciferase; mAB, monoclonal antibody; MOI, multiplicity of infection; OVA, ovalbumin; p-, plasmid-; PBS, phosphate-buffered saline; PCR, polymerase chain reaction; SD, standard deviation; TAA, tumor-associate antigen; WT, wild-type.
Annexins
[0062] Annexins represent a highly conserved family of proteins that selectively bind to negatively charged, phosphatidylserine containing phospholipid membranes in the presence of calcium ions (Ca.sup.+2). The sequences of genes encoding annexins are well known (e.g., Funakoshi et al., Biochemistry 26:8087-8092 (1987). Annexin proteins include proteins of the annexin family, such as Annexin II (lipocortin 2, calpactin 1, protein I, p36, chromobindin 8), Annexin III (lipocortin 3, PAP-III), Annexin IV (lipocortin 4, endonexin I, protein II, chromobindin 4), Annexin V (annV) (Lipocortin 5, Endonexin 2, VAC-alpha, Anchorin CII, PAP-I), Annexin VI (Lipocortin 6, Protein III, Chromobindin 20, p68, p70), Annexin VII (Synexin), Annexin VIII (VAC-beta), Annexin XI (CAP-50), and Annexin XIII (ISA). (Benz and A. Hofmann, Biol. Chem. 378:177-183 (1997).)
[0063] Annexins are highly abundant and influence various intra- and extra-cellular functions, including membrane trafficking, lymphocyte migration, cell motility, calcium flux, and signal transduction (Gerke, V. et al., Annexins: From Structure to Function, Physiol. Rev., April 2002. vol. 82, pages 331-371). Dying cells undergoing apoptosis expose these negatively charged lipids on the outer leaflet of the plasma membrane. Therefore, annexins selectively bind to apoptotic cells. (Ernst J D, et al. Preparation and characterization of an endogenously fluorescent annexin for detection of apoptotic cells. Analytical biochemistry. 1998;260:18-23). This diagnostic application of annexins was first demonstrated using fluorescently labeled annexin A5 (V) (Vermes et al. A novel assay for apoptosis. Flow cytometric detection of phosphatidylserine expression on early apoptotic cells using fluorescein labeled Annexin V. (1995) J. Immunol. Meth. 184:39-51). The inventors of the present invention have determined that annexins, such as annV, can be used to generate various recombinant proteins which can target an immunogenic CTL epitope to tumor loci.
[0064] Accordingly, the methods of the present invention use chimeric proteins containing annV, which binds selectively to apoptotic cells. By fusing the annV to an immunogenic peptide and in combination with conventional chemotherapy, annV can target molecules to tumor loci for cancer therapy following chemotherapy and/or radiation therapy. Immunogenic peptides, include but are not limited to, CTL epitopes or peptides, HPV-16 E7 tumor antigen, HPV-16 E6 tumor antigen, a modified colon carcinoma tumor antigen AH5, ovalubumin (OVA), and influenza antigen M1. Other exemplary antigens are further set forth below. In some embodiments, annV can be conjugated to OVA peptide with or without a furin cleavage site.
[0065] Production of the recombinant chimeric protein encoding annexin V and a immunogenic peptide into a suitable vector and expressing the corresponding conformational coding sequences for these proteins in a eukaryotic cell transformed by the vector according to well known methods in the art (especially as those taught in the Examples and references cited therein). The gene(s) is preferably expressed in a bacterial cell system. In other emboidment, eukaryotic expression systems can be used, such as human cells. However, insect and yeast-cell based expression systems are also suitable. Other mammalian cells similarly transfected using appropriate mammalian expression vectors can also be used to produce assembled annV chimeric fusion proteins. Suitable vectors for cloning of expression of the recited DNA sequences are well known in the art and commercially available. Further, suitable regulatory sequences for achieving cloning and expression, e.g., promoters, polyadenylation sequences, enhancers and selectable markers are also well known. The selection of appropriate sequences for obtaining recoverable protein yields is routine to one skilled in the art.
Nucleic Acid (e.g., DNA) Vaccines
[0066] Vaccines that may be administered to a mammal include any vaccine, e.g., a nucleic acid vaccine (e.g., a DNA vaccine). In an embodiment of the invention, a nucleic acid vaccine will encode an antigen, e.g., an antigen against which an immune response is desired. Other nucleic acids that may be used are those that increase or enhance an immune reaction, but which do not encode an antigen against which an immune reaction is desired. These vaccines are further described below.
[0067] Exemplary antigens include proteins or fragments thereof from a pathogenic organism, e.g., a bacterium or virus or other microorganism, as well as proteins or fragments thereof from a cell, e.g., a cancer cell. In one embodiment, the antigen is from a virus, such as class human papillomavirus (HPV), e.g., E7 or E6. These proteins are also oncogenic proteins, which are important in the induction and maintenance of cellular transformation and co-expressed in most HPV-containing cervical cancers and their precursor lesions. Therefore, cancer vaccines that target E7 or E6 can be used to control of HPV-associated neoplasms (Wu, T-C, Curr Opin Immunol. 6:746-54, 1994).
[0068] However, as noted, the present invention is not limited to the exemplified antigen(s). Rather, one of skill in the art will appreciate that the same results are expected for any antigen (and epitopes thereof) for which a T cell-mediated response is desired. The response so generated will be effective in providing protective or therapeutic immunity, or both, directed to an organism or disease in which the epitope or antigenic determinant is involvedfor example as a cell surface antigen of a pathogenic cell or an envelope or other antigen of a pathogenic virus, or a bacterial antigen, or an antigen expressed as or as part of a pathogenic molecule.
[0069] Exemplary antigens and their sequences are set forth below.
E7 Protein from HPV-16
[0070] The E7 nucleic acid sequence (SEQ ID NO:1) and amino acid sequence (SEQ ID NO:2) from HPV-16 are shown herein (see GenBank Accession No. NC_001526). The single letter code, the wild type E7 amino acid sequence (SEQ ID NO:2) is shown herein.
[0071] In another embodiment (See GenBank Accession No. AF125673, nucleotides 562-858 and the E7 amino acid sequence), the C-terminal four amino acids QDKL (and their codons) above are replaced with the three amino acids QKP (and the codons cag aaa cca), yielding a protein of 98 residues.
[0072] When an oncoprotein or an epitope thereof is the immunizing moiety, it is preferable to reduce the tumorigenic risk of the vaccine itself. Because of the potential oncogenicity of the HPV E7 protein, the E7 protein may be used in a detoxified form.
[0073] To reduce oncogenic potential of E7 in a construct of the present invention, one or more of the following positions of E7 is mutated:
TABLE-US-00001 nt Position Amino acid Original Mutant Preferred codon (in SEQ ID (in SEQ ID residue residue mutation NO: 1) NO: 2) Cys Gly (or Ala) TGT.fwdarw.GGT 70 24 Glu Gly (or Ala) GAG.fwdarw.GGG 77 26 (or GCG) Cys Gly (or Ala) TGC.fwdarw.GGC 271 91
[0074] In one embodiment, the E7 (detox) mutant sequence has the following two mutations:
a TGT.fwdarw.GGT mutation resulting in a Cys.fwdarw.Gly substitution at position 24 of SEQ ID NO: 9 and GAG.fwdarw.GGG mutation resulting in a Glu.fwdarw.Gly substitution at position 26 of the wild type E7. This mutated amino acid sequence is shown herein as SEQ ID NO:3.
[0075] These substitutions completely eliminate the capacity of the E7 to bind to Rb, and thereby nullify its transforming activity. Any nucleotide sequence that encodes the above E7 or E7(detox) polypeptide, or an antigenic fragment or epitope thereof, can be used in the present compositions and methods, including the E7 and E7(detox) sequences which are shown herein.
E6 Protein from HPV-16
[0076] The wild type E6 nucleotide (SEQ ID NO:4) and amino acid sequences (SEQ ID NO:5) are shown herein (see GenBank accession Nos. K02718 and NC_001526). This polypeptide has 158 amino acids and is shown herein in single letter code as SEQ ID NO:5.
[0077] E6 proteins from cervical cancer-associated HPV types such as HPV-16 induce proteolysis of the p53 tumor suppressor protein through interaction with E6-AP. Human mammary epithelial cells (MECs) immortalized by E6 display low levels of p53. HPV-16 E6, as well as other cancer-related papillomavirus E6 proteins, also binds the cellular protein E6BP (ERC-55). As with E7, described below a non-oncogenic mutated form of E6 may be used, referred to as E6(detox). Several different E6 mutations and publications describing them are discussed below.
[0078] The amino acid residues to be mutated are underscored in the E6 amino acid sequence provided herein. Some studies of E6 mutants are based upon a shorter E6 protein of 151 nucleic acids, wherein the N-terminal residue was considered to be the Met at position 8 in the wild type E6. That shorter version of E6 is shown herein as SEQ ID NO:6.
[0079] To reduce oncogenic potential of E6 in a construct, one or more of the following positions of E6 is mutated:
TABLE-US-00002 aa position aa position Original Mutant in SEQ ID in SEQ ID residue residue NO: 5 NO: 6 Cys Gly (or Ala) 70 63 Cys Gly (or Ala) 113 106 Ile Thr 135 128
[0080] Nguyen et al., J Virol. 6:13039-48, 2002, described a mutant of HPV-16 E6 deficient in binding ?-helix partners which displays reduced oncogenic potential in vivo. This mutant, which includes a replacement of Ile with Thr as position 128 (of SEQ ID NO:
[0081] 6), may be used in accordance with the present invention to make an E6 DNA vaccine that has a lower risk of being oncogenic. This E6(I.sup.128T) mutant is defective in its ability to bind at least a subset of ?-helix partners, including E6AP, the ubiquitin ligase that mediates E6-dependent degradation of the p53 protein.
[0082] Cassetti M C et al., Vaccine 22:520-52, 2004, examined the effects of mutations four or five amino acid positions in E6 and E7 to inactivate their oncogenic potential. The following mutations were examined: E6-C.sup.63G and E6 C.sup.106G (positions based on the wild type E6); E7-C.sup.24G, E7-E.sup.26G, and E7 C.sup.91G (positions based on the wild type E7). Venezuelan equine encephalitis virus replicon particle (VRP) vaccines encoding mutant or wild type E6 and E7 proteins elicited comparable CTL responses and generated comparable antitumor responses in several HPV16 E6(+)E7(+) tumor challenge models: protection from either C3 or TC-1 tumor challenge was observed in 100% of vaccinated mice. Eradication of C3 tumors was observed in approximately 90% of the mice. The predicted inactivation of E6 and E7 oncogenic potential was confirmed by demonstrating normal levels of both p53 and Rb proteins in human mammary epithelial cells infected with VRPs expressing mutant E6 and E7 genes.
[0083] The HPV16 E6 protein contains two zinc fingers important for structure and function; one cysteine (C) amino acid position in each pair of CXXC (where X is any amino acid) zinc finger motifs may be mutated at E6 positions 63 and 106 (based on the wild type E6). Mutants are created, for example, using the Quick Change Site-Directed Mutagenesis Kit (Stratagene, La Jolla, Calif.). HPV16 E6 containing a single point mutation in the codon for Cys.sup.106 in the wild type E6 (=Cys 113 in the wild type E6). Cys.sup.106 neither binds nor facilitates degradation of p53 and is incapable of immortalizing human mammary epithelial cells (MEC), a phenotype dependent upon p53 degradation. A single amino acid substitution at position Cys.sup.63 of the wild type E6 (=Cys.sup.70 in the wild type E6) destroys several HPV16 E6 functions: p53 degradation, E6TP-1 degradation, activation of telomerase, and, consequently, immortalization of primary epithelial cells.
[0084] Any nucleotide sequence that encodes these E6 polypeptides, one of the mutants thereof, or an antigenic fragment or epitope thereof, can be used in the present invention. Other mutations can be tested and used in accordance with the methods described herein including those described in Cassetti et al., supra. These mutations can be produced from any appropriate starting sequences by mutation of the coding DNA.
[0085] The present invention also includes the use of a tandem E6-E7 vaccine, using one or more of the mutations described herein to render the oncoproteins inactive with respect to their oncogenic potential in vivo. VRP vaccines (described in Cassetti et al., supra) comprised fused E6 and E7 genes in one open reading frame which were mutated at four or five amino acid positions. Thus, the present constructs may include one or more epitopes of E6 and E7, which may be arranged in their native order or shuffled in any way that permits the expressed protein to bear the E6 and E7 antigenic epitopes in an immunogenic form. DNA encoding amino acid spacers between E6 and E7 or between individual epitopes of these proteins may be introduced into the vector, provided again, that the spacers permit the expression or presentation of the epitopes in an immunogenic manner after they have been expressed by transduced host cells.
Influenza Hemagglutinin (HA)
[0086] A nucleic acid sequence encoding HA is shown herein as SEQ ID NO: 7. The amino acid sequence of HA is shown herein as SEQ ID NO: 8, with the immunodominant epitope underscored.
Ovalbumin (OVA)
[0087] An amino acid sequence encoding a representative OVA is shown herein as SEQ ID NO:9.
Other Exemplary Antigens
[0088] Exemplary antigens are epitopes of pathogenic microorganisms against which the host is defended by effector T cells responses, including CTL and delayed type hypersensitivity. These typically include viruses, intracellular parasites such as malaria, and bacteria that grow intracellularly such as Mycobacterium and Listeria species. Thus, the types of antigens included in the vaccine compositions used in the present invention may be any of those associated with such pathogens as well as tumor-specific antigens. It is noteworthy that some viral antigens are also tumor antigens in the case where the virus is a causative factor in the tumor.
[0089] In fact, the two most common cancers worldwide, hepatoma and cervical cancer, are associated with viral infection. Hepatitis B virus (HBV) (Beasley, R. P. et al., Lancet 2:1129-1133 (1981) has been implicated as etiologic agent of hepatomas. About 80-90% of cervical cancers express the E6 and E7 antigens (discussed above and exemplified herein) from one of four high risk human papillomavirus types: HPV-16, HPV-18, HPV-31 and HPV-45 (Gissmann, L. et al., Ciba Found Symp. 120:190-207, 1986; Beaudenon, S., et al. Nature 321:246-9, 1986, incorporated by reference herein). The HPV E6 and E7 antigens are the most promising targets for virus associated cancers in immunocompetent individuals because of their ubiquitous expression in cervical cancer. In addition to their importance as targets for therapeutic cancer vaccines, virus-associated tumor antigens are also ideal candidates for prophylactic vaccines. Indeed, introduction of prophylactic HBV vaccines in Asia have decreased the incidence of hepatoma (Chang, M H et al. New Engl. J. Med. 336, 1855-1859 (1997), representing a great impact on cancer prevention.
[0090] Among the most important viruses in chronic human viral infections are HPV, HBV, hepatitis C Virus (HCV), retroviruses such as human immunodeficiency virus (HIV-1 and HIV-2), herpes viruses such as Epstein Barr Virus (EBV), cytomegalovirus (CMV),
[0091] HSV-1 and HSV-2, and influenza virus. Useful antigens include HBV surface antigen or HBV core antigen; ppUL83 or pp89 of CMV; antigens of gp120, gp41 or p24 proteins of HIV-1; ICP27, gD2, gB of HSV; or influenza hemagglutinin or nucleoprotein (Anthony, L S et al., Vaccine 1999; 17:373-83). Other antigens associated with pathogens that can be utilized as described herein are antigens of various parasites, including malaria, e.g., malaria peptide based on repeats of NANP.
[0092] In certain embodiments, the invention includes methods using foreign antigens in which individuals may have existing T cell immunity (such as influenza, tetanus toxin, herpes etc). In other embodiments, the skilled artisan would readily be able to determine whether a subject has existing T cell immunity to a specific antigen according to well known methods available in the art and use a foreign antigen to which the subject does not already have an existing T cell immunity. In alternative embodiments, the antigen is from a pathogen that is a bacterium, such as Bordetella pertussis; Ehrlichia chaffeensis; Staphylococcus aureus; Toxoplasma gondii; Legionella pneumophila; Brucella suis; Salmonella enterica; Mycobacterium avium; Mycobacterium tuberculosis; Listeria monocytogenes; Chlamydia trachomatis; Chlamydia pneumoniae; Rickettsia rickettsii; or, a fungus, such as, e.g., Paracoccidioides brasiliensis; or other pathogen, e.g., Plasmodium falciparum.
[0093] As used herein, the term cancer includes, but is not limited to, solid tumors and blood borne tumors. The term cancer includes diseases of the skin, tissues, organs, bone, cartilage, blood and vessels. A term used to describe cancer that is far along in its growth, also referred to as late stage cancer or advanced stage cancer, is cancer that is metastatic, e.g., cancer that has spread from its primary origin to another part of the body. In certain embodiments, advanced stage cancer includes stages 3 and 4 cancers. Cancers are ranked into stages depending on the extent of their growth and spread through the body; stages correspond with severity. Determining the stage of a given cancer helps doctors to make treatment recommendations, to form a likely outcome scenario for what will happen to the patient (prognosis), and to communicate effectively with other doctors.
[0094] There are multiple staging scales in use. One of the most common ranks cancers into five progressively more severe stages: 0, I, II, III, and IV. Stage 0 cancer is cancer that is just beginning, involving just a few cells. Stages I, II, III, and IV represent progressively more advanced cancers, characterized by larger tumor sizes, more tumors, the aggressiveness with which the cancer grows and spreads, and the extent to which the cancer has spread to infect adjacent tissues and body organs.
[0095] Another popular staging system is known as the TNM system, a three dimensional rating of cancer extensiveness. Using the TNM system, doctors rate the cancers they find on each of three scales, where T stands for tumor size, N stands for lymph node involvement, and M stands for metastasis (the degree to which cancer has spread beyond its original locations). Larger scores on each of the three scales indicate more advanced cancer. For example, a large tumor that has not spread to other body parts might be rated T3, N0, M0, while a smaller but more aggressive cancer might be rated T2, N2, M1 suggesting a medium sized tumor that has spread to local lymph nodes and has just gotten started in a new organ location.
[0096] Cancers that may be treated by the methods of the present invention include, but are not limited to, cancer cells from the bladder, blood, bone, bone marrow, brain, breast, colon, esophagus, gastrointestine, gum, head, kidney, liver, lung, nasopharynx, neck, ovary, prostate, skin, stomach, testis, tongue, or uterus. In addition, the cancer may specifically be of the following histological type, though it is not limited to these: neoplasm, malignant; carcinoma; carcinoma, undifferentiated; giant and spindle cell carcinoma; small cell carcinoma; papillary carcinoma; squamous cell carcinoma; lymphoepithelial carcinoma; basal cell carcinoma; pilomatrix carcinoma; transitional cell carcinoma; papillary transitional cell carcinoma; adenocarcinoma; gastrinoma, malignant; cholangiocarcinoma; hepatocellular carcinoma; combined hepatocellular carcinoma and cholangiocarcinoma; trabecular adenocarcinoma; adenoid cystic carcinoma; adenocarcinoma in adenomatous polyp; adenocarcinoma, familial polyposis coli; solid carcinoma; carcinoid tumor, malignant; branchiolo-alveolar adenocarcinoma; papillary adenocarcinoma; chromophobe carcinoma; acidophil carcinoma; oxyphilic adenocarcinoma; basophil carcinoma; clear cell adenocarcinoma; granular cell carcinoma; follicular adenocarcinoma; papillary and follicular adenocarcinoma; nonencapsulating sclerosing carcinoma; adrenal cortical carcinoma; endometroid carcinoma; skin appendage carcinoma; apocrine adenocarcinoma; sebaceous adenocarcinoma; ceruminous adenocarcinoma; mucoepidermoid carcinoma; cystadenocarcinoma; papillary cystadenocarcinoma; papillary serous cystadenocarcinoma; mucinous cystadenocarcinoma; mucinous adenocarcinoma; signet ring cell carcinoma; infiltrating duct carcinoma; medullary carcinoma; lobular carcinoma; inflammatory carcinoma; paget's disease, mammary; acinar cell carcinoma; adenosquamous carcinoma; adenocarcinoma w/squamous metaplasia; thymoma, malignant; ovarian stromal tumor, malignant; thecoma, malignant; granulosa cell tumor, malignant; and roblastoma, malignant; sertoli cell carcinoma; leydig cell tumor, malignant; lipid cell tumor, malignant; paraganglioma, malignant; extra-mammary paraganglioma, malignant; pheochromocytoma; glomangiosarcoma; malignant melanoma; amelanotic melanoma; superficial spreading melanoma; malig melanoma in giant pigmented nevus; epithelioid cell melanoma; blue nevus, malignant; sarcoma; fibrosarcoma; fibrous histiocytoma, malignant; myxosarcoma; liposarcoma; leiomyosarcoma; rhabdomyosarcoma; embryonal rhabdomyosarcoma; alveolar rhabdomyosarcoma; stromal sarcoma; mixed tumor, malignant; mullerian mixed tumor; nephroblastoma; hepatoblastoma; carcinosarcoma; mesenchymoma, malignant; brenner tumor, malignant; phyllodes tumor, malignant; synovial sarcoma; mesothelioma, malignant; dysgerminoma; embryonal carcinoma; teratoma, malignant; struma ovarii, malignant; choriocarcinoma; mesonephroma, malignant; hemangiosarcoma; hemangioendothelioma, malignant; kaposi's sarcoma; hemangiopericytoma, malignant; lymphangiosarcoma; osteosarcoma; juxtacortical osteosarcoma; chondrosarcoma; chondroblastoma, malignant; mesenchymal chondrosarcoma; giant cell tumor of bone; ewing's sarcoma; odontogenic tumor, malignant; ameloblastic odontosarcoma; ameloblastoma, malignant; ameloblastic fibrosarcoma; pinealoma, malignant; chordoma; glioma, malignant; ependymoma; astrocytoma; protoplasmic astrocytoma; fibrillary astrocytoma; astroblastoma; glioblastoma; oligodendroglioma; oligodendroblastoma; primitive neuroectodermal; cerebellar sarcoma; ganglioneuroblastoma; neuroblastoma; retinoblastoma; olfactory neurogenic tumor; meningioma, malignant; neurofibrosarcoma; neurilemmoma, malignant; granular cell tumor, malignant; malignant lymphoma; Hodgkin's disease; Hodgkin's lymphoma; paragranuloma; malignant lymphoma, small lymphocytic; malignant lymphoma, large cell, diffuse; malignant lymphoma, follicular; mycosis fungoides; other specified non-Hodgkin's lymphomas; malignant histiocytosis; multiple myeloma; mast cell sarcoma; immunoproliferative small intestinal disease; leukemia; lymphoid leukemia; plasma cell leukemia; erythroleukemia; lymphosarcoma cell leukemia; myeloid leukemia; basophilic leukemia; eosinophilic leukemia; monocytic leukemia; mast cell leukemia; megakaryoblastic leukemia; myeloid sarcoma; and hairy cell leukemia.
[0097] In addition to its applicability to human cancer and infectious diseases, the present invention is also intended for use in treating animal diseases in the veterinary medicine context. Thus, the approaches described herein may be readily applied by one skilled in the art for treatment of veterinary herpes virus infections including equine herpes viruses, bovine viruses such as bovine viral diarrhea virus (for example, the E2 antigen), bovine herpes viruses, Marek's disease virus in chickens and other fowl; animal retroviral and lentiviral diseases (e.g., feline leukemia, feline immunodeficiency, simian immunodeficiency viruses, etc.); pseudorabies and rabies; and the like.
[0098] As for tumor antigens, any tumor-associated or tumor-specific antigen (or tumor cell derived epitope) (collectively, TAA) that can be recognized by T cells, including CTL, can be used. These include, without limitation, mutant p53, HER2/neu or a peptide thereof, or any of a number of melanoma-associated antigens such as MAGE-1, MAGE-3, MART-1/Melan-A, tyrosinase, gp75, gp100, BAGE, GAGE-1, GAGE-2, GnT-V, and p15 (see, for example, U.S. Pat. No. 6,187,306, incorporated herein by reference).
[0099] In one embodiment, it is not necessary to include a full length antigen in a nucleic acid vaccine; it suffices to include a fragment that will be presented by MHC class I and/or II. A nucleic acid may include 1, 2, 3, 4, 5 or more antigens, which may be the same or different ones.
Approaches for Mutagenesis of E6, E7, and Other Antigens
[0100] Mutants of the antigens described here may be created, for example, using the Quick Change Site-Directed Mutagenesis Kit (Stratagene, La Jolla, Calif.). Generally, antigens that may be used herein may be proteins or peptides that differ from the naturally-occurring proteins or peptides but yet retain the necessary epitopes for functional activity. In certain embodiments, an antigen may comprise, consist essentially of, or consist of an amino acid sequence that is at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to that of the naturally-occurring antigen or a fragment thereof. In certain embodiments, an antigen may also comprise, consist essentially of, or consist of an amino acid sequence that is encoded by a nucleotide sequence that is at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to a nucleotide sequence encoding the naturally-occurring antigen or a fragment thereof. In certain embodiments, an antigen may also comprise, consist essentially of, or consist of an amino acid sequence that is encoded by a nucleic acid that hybridizes under high stringency conditions to a nucleic acid encoding the naturally-occurring antigen or a fragment thereof. Hybridization conditions are further described herein.
[0101] In one embodiment, an exemplary protein may comprise, consist essentially of, or consist of, an amino acid sequence that is at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to that of a viral protein, including for example E6 or E7, such as an E6 or E7 sequence provided herein. Where the E6 or E7 protein is a detox E6 or E7 protein, the amino acid sequence of the protein may comprise, consist essentially of, or consist of an amino acid sequence that is at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to that of an E6 or E7 protein, wherein the amino acids that render the protein a detox protein are present.
Exemplary Nucleic Acid (e.g., DNA) Vaccines Encoding an Immunogenicity-Potentiating Polypeptide (IPP) and an Antigen
[0102] In one embodiment, a nucleic acid vaccine encodes a fusion protein comprising an antigen and a second protein, e.g., an IPP. An IPP may act in potentiating an immune response by promoting: processing of the linked antigenic polypeptide via the MHC class I pathway or targeting of a cellular compartment that increases the processing. This basic strategy may be combined with an additional strategy pioneered by the present inventors and colleagues, that involve linking DNA encoding another protein, generically termed a targeting polypeptide, to the antigen-encoding DNA. Again, for the sake of simplicity, the DNA encoding such a targeting polypeptide will be referred to herein as a targeting DNA. That strategy has been shown to be effective in enhancing the potency of the vectors carrying only antigen-encoding DNA. See for example, the following PCT publications by Wu et al: WO 01/29233; WO 02/009645; WO 02/061113; WO 02/074920; and WO 02/12281, all of which are incorporated by reference in their entirety. The other strategies include the use of DNA encoding polypeptides that promote or enhance: [0103] (a) development, accumulation or activity of antigen presenting cells or targeting of antigen to compartments of the antigen presenting cells leading to enhanced antigen presentation; [0104] (b) intercellular transport and spreading of the antigen; [0105] (c) sorting of the lysosome-associated membrane protein type 1 (Sig/LAMP-1); or [0106] (d) any combination of (a)-(c).
[0107] The strategy includes use of: [0108] (a) a viral intercellular spreading protein selected from the group of herpes simplex virus-1 VP22 protein, Marek's disease virus UL49 (see WO 02/09645 and U.S. Pat. No. 7,318,928), protein or a functional homologue or derivative thereof; [0109] (b) calreticulin (CRT) and other endoplasmic reticulum chaperone polypeptides selected from the group of CRT-like molecules ER60, GRP94, gp96, or a functional homologue or derivative thereof (see WO 02/12281 and U.S. Pat. No. 7,3442,002); [0110] (c) a cytoplasmic translocation polypeptide domains of a pathogen toxin selected from the group of domain II of Pseudomonas exotoxin ETA or a functional homologue or derivative thereof (see published US application 20040086845); [0111] (d) a polypeptide that targets the centrosome compartment of a cell selected from y-tubulin or a functional homologue or derivative thereof; [0112] (e) a polypeptide that stimulates dendritic cell precursors or activates dendritic cell activity selected from the group of GM-CSF, Flt3-ligand extracellular domain, or a functional homologue or derivative thereof; [0113] (f) a costimulatory signal, such as a B7 family protein, including B7-DC (see U.S. Ser. No. 09/794,210), B7.1, B7.2, soluble CD40, etc.); or [0114] (g) an anti-apoptotic polypeptide selected from the group consisting of (1) BCL-xL, (2) BCL2, (3) XIAP, (4) FLICEc-s, (5) dominant-negative caspase-8, (6) dominant negative caspase-9, (7) SPI-6, and (8) a functional homologue or derivative of any of (1)-(7). (See WO 2005/047501).
[0115] The following publications, all of which are incorporated by reference in their entirety, describe IPPs: Kim T W et al., J Clin Invest 112: 109-117, 2003; Cheng W F et al., J Clin Invest 108: 669-678, 2001; Hung C F et al., Cancer Res 61:3698-3703, 2001; Chen C H et al., 2000, supra; U.S. Pat. No. 6,734,173; published patent applications WO05/081716, WO05/047501, WO03/085085, WO02/12281, WO02/074920, WO02/061113, WO02/09645, and WO01/29233. Comparative studies of these IPPs using HPV E6 as the antigen are described in Peng, S. et al., J Biomed Sci. 12:689-700 2005.
[0116] An antigen may be linked N-terminally or C-terminally to an IPP. Exemplary IPPs and fusion constructs encoding such are described below.
Lysosomal Associated Membrane Protein 1 (LAMP-1)
[0117] The DNA sequence encoding the E7 protein fused to the translocation signal sequence and LAMP-1 domain (Sig-E7-LAMP-1) is shown herein as SEQ ID NO:10. The amino acid sequence of Sig-E7-LAMP-1 is shown herein as SEQ ID NO:11.
[0118] The nucleotide sequence of the immunogenic vector pcDNA3-Sig/E7/LAMP-1 is shown herein as SEQ ID NO:13, with the SigE7-LAMP-1 coding sequence in lower case and underscored.
HSP70 from M. tuberculosis
[0119] The nucleotide sequence encoding HSP70 is shown herein as SEQ ID NO:13) (i.e., nucleotides 10633-12510 of the M. tuberculosis genome in GenBank NC_000962). The amino acid sequence of HSP70 is shown herein as SEQ ID NO:14.
[0120] The nucleic acid sequences encoding the E7-Hsp70 chimera/fusion polypeptides are shown herein as SEQ ID NO:15 and the corresponding amino acid sequence is shown herein as SEQ ID NO:16. The E7 coding sequence is shown in upper case and underscored.
ETA(dII) from Pseudomonas aeruginosa
[0121] The complete coding sequence for Pseudomonas aeruginosa exotoxin type A (ETA) is shown herein as SEQ ID NO:17 (GenBank Accession No. K01397). The amino acid sequence of ETA is shown herein as SEQ ID NO:18 (GenBank Accession No. K01397).
[0122] Residues 1-25 (italicized) represent the signal peptide. The first residue of the mature polypeptide, Ala, is bolded/underscored. The mature polypeptide is residues 26-638 of SEQ ID NO:18.
[0123] Domain II (ETA(II)), translocation domain (underscored above) spans residues 247-417 of the mature polypeptide (corresponding to residues 272-442 of SEQ ID NO:18) and is presented below separately herein as SEQ ID NO:19.
[0124] The nucleotide construct in which ETA(dII) is fused to HPV-16 E7 is shown herein as SEQ ID NO:20. The corresponding amino acid sequence is shown herein as SEQ ID NO:21. The ETA(dII) sequence appears in plain font, extra codons from plasmid pcDNA3 are italicized. Nucleotides between ETA(dII) and E7 are also bolded (and result in the interposition of two amino acids between ETA(dII) and E7). The E7 amino acid sequence is underscored (ends with Gln at position 269).
Pro Leu Ile Ser Leu Asp Cys Ala Phe AMB
[0125] The nucleotide sequence of the pcDNA3 vector encoding E7 and HSP70 (pcDNA3-E7-Hsp70 is shown herein as SEQ ID NO:22.
Calreticulin (CRT)
[0126] Calreticulin (CRT), a well-characterized ?46 kDa protein was described briefly above, as were a number of its biological and biochemical activities. As used herein, calreticulin or CRT refers to polypeptides and nucleic acids molecules having substantial identity to the exemplary human CRT sequences as described herein or homologues thereof, such as rabbit and rat CRTwell-known in the art. A CRT polypeptide is a polypeptide comprising a sequence identical to or substantially identical to the amino acid sequence of CRT. An exemplary nucleotide and amino acid sequence for a CRT used in the present compositions and methods are presented below. The terms calreticulin or CRT encompass native proteins as well as recombinantly produced modified proteins that, when fused with an antigen (at the DNA or protein level) promote the induction of immune responses and promote angiogenesis, including a CTL response. Thus, the terms calreticulin or CRT encompass homologues and allelic variants of human CRT, including variants of native proteins constructed by in vitro techniques, and proteins isolated from natural sources. The CRT polypeptides used in the present invention, and sequences encoding them, also include fusion proteins comprising non-CRT sequences, particularly MEW class I-binding peptides; and also further comprising other domains, e.g., epitope tags, enzyme cleavage recognition sequences, signal sequences, secretion signals and the like.
[0127] A human CRT coding sequence is shown herein as SEQ ID NO: 23. The amino acid sequence of the human CRT protein encoded by SEQ ID NO:23 is set forth herein as SEQ ID NO:24. This amino acid sequence is highly homologous to GenBank Accession No. NM 004343.
[0128] The amino acid sequence of the rabbit and rat CRT proteins are set forth in GenBank Accession Nos. P1553 and NM 022399, respectively. An alignment of human, rabbit and rat CRT shows that these proteins are highly conserved, and most of the amino acid differences between species are conservative in nature. Most of the variation is found in the alignment of the approximately 36 C-terminal residues. Thus, for the present invention, human CRT may be used as well as, DNA encoding any homologue of CRT from any species that has the requisite biological activity (as an IPP) or any active domain or fragment thereof, may be used in place of human CRT or a domain thereof.
[0129] Cheng et al., supra, incorporated by reference in its entirety, previously determined that nucleic acid (e.g., DNA) vaccines encoding each of the N, P, and C domains of CRT chimerically linked to HPV-16 E7 elicited potent antigen-specific CD8+ T cell responses and antitumor immunity in mice vaccinated i.d., by gene gun administration. N-CRT/E7, P-CRT/E7 or C-CRT/E7 DNA each exhibited significantly increased numbers of E7-specific CD8.sup.+ T cell precursors and impressive antitumor effects against E7-expressing tumors when compared with mice vaccinated with E7 DNA (antigen only). N-CRT DNA administration also resulted in anti-angiogenic antitumor effects. Thus, cancer therapy using DNA encoding N-CRT linked to a tumor antigen may be used for treating tumors through a combination of antigen-specific immunotherapy and inhibition of angiogenesis.
[0130] The constructs comprising CRT or one of its domains linked to E7 is illustrated schematically below.
[0131] The amino acid sequences of the 3 human CRT domains are shown herein as annotations of the full length protein, SEQ ID NO:24. The N domain comprises residues 1-170 (normal text); the P domain comprises residues 171-269 (underscored); and the C domain comprises residues 270-417 (bold/italic).
[0132] The sequences of the three domains are further shown as separate polypeptides herein as human N-CRT (SEQ ID NO:25), as human P-CRT (SEQ ID NO:26), and as human C-CRT (SEQ ID NO:27).
[0133] The present vectors may comprises DNA encoding one or more of these domain sequences, which are shown by annotation of SEQ ID NO:28 herein, wherein the N-domain sequence is upper case, the P-domain sequence is lower case/italic/underscored, and the C domain sequence is lower case. The stop codon is also shown but not counted.
[0134] The coding sequence for each separate domain is provided herein as human N-CRT DNA (SEQ ID NO:29), as human P-CRT DNA (SEQ ID NO:30), and as human C-CRT DNA (SEQ ID NO:31). Alternatively, any nucleotide sequences that encodes these domains may be used in the present constructs. Thus, for use in humans, the sequences may be further codon-optimized.
[0135] Constructs used in the present invention may employ combinations of one or more CRT domains, in any of a number of orientations. Using the designations N.sup.CRT, P.sup.CRT and C.sup.CRT to designate the domains, the following are but a few examples of the combinations that may be used in the nucleic acid (e.g., DNA) vaccine vectors used in the present invention (where it is understood that Ag can be any antigen, including E7(detox) or E6 (detox).
[0136] N.sup.CRT-P.sup.CRT-Ag; N.sup.CRT-P.sup.CRT-Ag; N.sup.CRT-C.sup.CRT-Ag; N.sup.CRT-N.sup.CRT-Ag; N.sup.CRT-N.sup.CRT-N.sup.CRT-Ag; P.sup.CRT-P.sup.CRT-Ag; P.sup.CRT-C.sup.CRT-Ag; P.sup.CRT-N.sup.CRT-Ag; C.sup.CRT-P.sup.CRT-Ag; N.sup.CRT-P.sup.CRT-Ag; etc.
[0137] The present invention may employ shorter polypeptide fragments of CRT or CRT domains provided such fragments can enhance the immune response to an antigen with which they are paired. Shorter peptides from the CRT or domain sequences shown above that have the ability to promote protein processing via the MHC-1 class I pathway are also included, and may be defined by routine experimentation.
[0138] The present invention may also employ shorter nucleic acid fragments that encode CRT or CRT domains provided such fragments are functional, e.g., encode polypeptides that can enhance the immune response to an antigen with which they are paired (e.g., linked). Nucleic acids that encode shorter peptides from the CRT or domain sequences shown above and are functional, e.g., have the ability to promote protein processing via the MHC-1 class I pathway, are also included, and may be defined by routine experimentation.
[0139] A polypeptide fragment of CRT may include at least or about 50, 100, 200, 300, or 400 amino acids. A polypeptide fragment of CRT may also include at least or about 25, 50, 75, 100, 25-50, 50-100, or 75-125 amino acids from a CRT domain selected from the group N-CRT, P-CRT, and C-CRT. A polypeptide fragment of CRT may include residues 1-50, 50-75, 75-100, 100-125, 125-150, 150-170 of the N-domain (e.g., of SEQ ID NO:25). A polypeptide fragment of CRT may include residues 1-50, 50-75, 75-100, 100-109 of the P-domain (e.g., of SEQ ID NO:26). A polypeptide fragment of CRT may include residues 1-50, 50-75, 75-100, 100-125, 125-138 of the C-domain (e.g., of SEQ ID NO:27).
[0140] A nucleic acid fragment of CRT may encode at least or about 50, 100, 200, 300, or 400 amino acids. A nucleic acid fragment of CRT may also encode at least or about 25, 50, 75, 100, 25-50, 50-100, or 75-125 amino acids from a CRT domain selected from the group N-CRT, P-CRT, and C-CRT. A nucleic acid fragment of CRT may encode residues 1-50, 50-75, 75-100, 100-125, 125-150, 150-170 of the N-domain (e.g., of SEQ ID NO:25). A nucleic acid fragment of CRT may encode residues 1-50, 50-75, 75-100, 100-109 of the P-domain (e.g., of SEQ ID NO:26). A nucleic acid fragment of CRT may encode residues 1-50, 50-75, 75-100, 100-125, 125-138 of the C-domain (e.g., of SEQ ID NO:27).
[0141] Polypeptide fragments of CRT, as provided herein, do not include full-length CRT. Likewise, nucleic acid fragments of CRT, as provided herein, do not include a full-length CRT nucleic acid sequence and do not encode a full-length CRT polypeptide.
[0142] In one embodiment, a vector construct of a complete chimeric nucleic acid that can be used in the present invention, is shown herein as SEQ ID NO:32. The sequence is annotated to show plasmid-derived nucleotides (lower case letters), CRT-derived nucleotides (upper case bold letters), and HPV-E7-derived nucleotides (upper case, italicized/underlined letters). Five plasmid nucleotides are found between the CRT and E7 coding sequences and that the stop codon for the E7 sequence is double underscored. This plasmid is also referred to as pNGVL4a-CRT/E7(detox). The Table below describes the structure of the above plasmid.
TABLE-US-00003 Plasmid Position Genetic Construct Source of Construct 5970-0823 E. coli ORI (ColEl) pBR/E. coli -derived 0837-0881 portion of transposase Common plasmid sequence (tpnA) Tn5/Tn903 0882-1332 ?-Lactamase (Amp.sup.R) pBRpUC derived plasmid 1331-2496 AphA (Kan.sup.R) Tn903 2509-2691 P3 Promoter DNA Tn3/pBR322 binding site 2692-2926 pUC backbone Common plasmid sequence pBR322-derived 2931-4009 NF1 binding and HHV-5(HCMV UL-10 lE1 promoter gene) 4010-4014 Poly-cloning site Common plasmid sequence 4015-5265 Calreticulin (CRT) Human Calreticulin 5266-5271 GAATTC plasmid Remain after cloning sequence 5272-5568 dE7 gene (detoxified HPV-16 (E7 gene) incl. partial) stop codon 5569-5580 Poly-cloning site Common plasmid sequence 551-5970 Poly-Adenylation site Mammalian signal, pHCMV-derived
[0143] In some embodiments, an alternative to CRT is another ER chaperone polypeptide exemplified by ER60, GRP94 or gp96, well-characterized ER chaperone polypeptide that representatives of the HSP90 family of stress-induced proteins (see WO 02/012281, incorporated herein by reference). The term endoplasmic reticulum chaperone polypeptide as used herein means any polypeptide having substantially the same ER chaperone function as the exemplary chaperone proteins CRT, tapasin, ER60 or calnexin. Thus, the term includes all functional fragments or variants or mimics thereof. A polypeptide or peptide can be routinely screened for its activity as an ER chaperone using assays known in the art. While the present invention is not limited by any particular mechanism of action, in vivo chaperones promote the correct folding and oligomerization of many glycoproteins in the ER, including the assembly of the MHC class I heterotrimeric molecule (heavy (H) chain, ?2m, and peptide). They also retain incompletely assembled MHC class I heterotrimeric complexes in the ER (Hauri FEBS Lett. 476:32-37, 2000).
Intercellular Spreading Proteins
[0144] The potency of naked nucleic acid (e.g., DNA) vaccines may be enhanced by their ability to amplify and spread in vivo. VP22, a herpes simplex virus type 1 (HSV-1) protein and its homologues in other herpes viruses, such as the avian Marek's Disease Virus (MDV) have the property of intercellular transport that provide an approach for enhancing vaccine potency. The present inventors have previously created novel fusions of VP22 with a model antigen, human papillomavirus type 16 (HPV-16) E7, in a nucleic acid (e.g., DNA) vaccine which generated enhanced spreading and MHC class I presentation of antigen. These properties led to a dramatic increase in the number of E7-specific CD8+ T cell precursors in vaccinated mice (at least 50-fold) and converted a less effective nucleic acid (e.g., DNA) vaccine into one with significant potency against E7-expressing tumors. In comparison, a non-spreading mutant, VP22(1-267), failed to enhance vaccine potency. Results presented in U.S. Patent Application publication No. 20040028693 (U.S. Pat. No. 7,318,928), hereby incorporated by reference in its entirety, show that the potency of DNA vaccines is dramatically improved through enhanced intercellular spreading and MHC class I presentation of the antigen.
[0145] A similar study linking MDV-1 UL49 to E7 also led to a dramatic increase in the number of E7-specific CD8+ T cell precursors and potency response against E7-expressing tumors in vaccinated mice. Mice vaccinated with a MDV-1 UL49 DNA vaccine stimulated E7-specific CD8+ T cell precursor at a level comparable to that induced by HSV-1 VP22/E7. Thus, fusion of MDV-1UL49 DNA to DNA encoding a target antigen gene significantly enhances the DNA vaccine potency.
[0146] In one embodiment, the spreading protein may be a viral spreading protein, including a herpes virus VP22 protein. Exemplified herein are fusion constructs that comprise herpes simplex virus-1 (HSV-1) VP22 (abbreviated HVP22) and its homologue from Marek's disease virus (MDV) termed MDV-VP22 or MVP-22. Also included in the invention are the use of homologues of VP22 from other members of the herpesviridae or polypeptides from nonviral sources that are considered to be homologous and share the functional characteristic of promoting intercellular spreading of a polypeptide or peptide that is fused or chemically conjugated thereto.
[0147] DNA encoding HVP22 has the sequence SEQ ID NO:33 of the longer sequence SEQ ID NO:34 (which is the full length nucleotide sequence of a vector that comprises HVP22). DNA encoding MDV-VP22 is shown herein as SEQ ID NO:35.
[0148] The amino acid sequence of HVP22 polypeptide is SEQ ID NO:36 as amino acid residues 1-301 of SEQ ID NO:37 (i.e., the full length amino acid encoded by the vector).
[0149] The amino acid sequence of the MDV-VP22 is shown herein as SEQ ID NO:38.
[0150] A DNA clone pcDNA3 VP22/E7, that includes the coding sequence for HVP22 and the HPV-16 protein, E7 (plus some additional vector sequence) is SEQ ID NO:34.
[0151] The amino acid sequence of E7 (SEQ ID NO:39) is residues 308-403 of SEQ ID NO:37. This particular clone has only 96 of the 98 residues present in E7. The C-terminal residues of wild-type E7, Lys and Pro, are absent from this construct. This is an example of a deletion variant as the term is described below. Such deletion variants (e.g., terminal truncation of two or a small number of amino acids) of other antigenic polypeptides are examples of the embodiments intended within the scope of the fusion polypeptides that can be used in the present invention.
Homologues of IPPs
[0152] Homologues or variants of IPPs described herein, may also be used, provided that they have the requisite biological activity. These include various substitutions, deletions, or additions of the amino acid or nucleic acid sequences. Due to code degeneracy, for example, there may be considerable variation in nucleotide sequences encoding the same amino acid sequence.
[0153] A functional derivative of an IPP retains measurable IPP-like activity, including that of promoting immunogenicity of one or more antigenic epitopes fused thereto by promoting presentation by class I pathways. Functional derivatives encompass variants and fragments regardless of whether the terms are used in the conjunctive or the alternative herein.
[0154] The term chimeric or fusion polypeptide or protein refers to a composition comprising at least one polypeptide or peptide sequence or domain that is chemically bound in a linear fashion with a second polypeptide or peptide domain. One embodiment of compositions useful for the present invention is an isolated or recombinant nucleic acid molecule encoding a fusion protein comprising at least two domains, wherein the first domain comprises an IPP and the second domain comprises an antigenic epitope, e.g., an MHC class I-binding peptide epitope. The fusion can be an association generated by a peptide bond, a chemical linking, a charge interaction (e.g., electrostatic attractions, such as salt bridges, H-bonding, etc.) or the like. If the polypeptides are recombinant, the fusion protein can be translated from a common mRNA. Alternatively, the compositions of the domains can be linked by any chemical or electrostatic means. The chimeric molecules that can be used in the present invention (e.g., targeting polypeptide fusion proteins) can also include additional sequences, e.g., linkers, epitope tags, enzyme cleavage recognition sequences, signal sequences, secretion signals, and the like. Alternatively, a peptide can be linked to a carrier simply to facilitate manipulation or identification/ location of the peptide.
[0155] Also included is a functional derivative of an IPP, which refers to an amino acid substitution variant, a fragment of the protein. A functional derivative of an IPP retains measurable activity that may be manifested as promoting immunogenicity of one or more antigenic epitopes fused thereto or co-administered therewith. Functional derivatives encompass variants and fragments regardless of whether the terms are used in the conjunctive or the alternative herein.
[0156] A functional homologue must possess the above biochemical and biological activity. In view of this functional characterization, use of homologous proteins including proteins not yet discovered, fall within the scope of the invention if these proteins have sequence similarity and the recited biochemical and biological activity. To determine the percent identity of two amino acid sequences or of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes). In one embodiment, the method of alignment includes alignment of Cys residues.
[0157] In one embodiment, the length of a sequence being compared is at least 30%, at least 40%, at least 50%, at least 60%, and at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% of the length of the reference sequence (e.g., an IPP). The amino acid residues (or nucleotides) at corresponding amino acid (or nucleotide) positions are then compared. When a position in the first sequence is occupied by the same amino acid residue (or nucleotide) as the corresponding position in the second sequence, then the molecules are identical at that position (as used herein amino acid or nucleic acid identity is equivalent to amino acid or nucleic acid homology). The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.
[0158] The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. In one embodiment, the percent identity between two amino acid sequences is determined using the Needleman and Wunsch (J. Mol. Biol. 48:444-453 (1970) algorithm which has been incorporated into the GAP program in the GCG software package (available at http://www.gcg.com), using either a Blossom 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6. In yet another embodiment, the percent identity between two nucleotide sequences is determined using the GAP program in the GCG software package (available at http://www.gcg.com), using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1, 2, 3, 4, 5, or 6. In another embodiment, the percent identity between two amino acid or nucleotide sequences is determined using the algorithm of E. Meyers and W. Miller (CABIOS, 4:11-17 (1989)) which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4.
[0159] The nucleic acid and protein sequences of the present invention can further be used as a query sequence to perform a search against public databases, for example, to identify other family members or related sequences. Such searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul et al. (1990) J. Mol. Biol. 215:403-10. BLAST nucleotide searches can be performed with the NBLAST program, score=100, wordlength=12 to obtain nucleotide sequences homologous to IPP nucleic acid molecules. BLAST protein searches can be performed with the XBLAST program, score=50, wordlength=3 to obtain amino acid sequences homologous to IPP protein molecules. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al. (1997) Nucleic Acids Res. 25:3389-3402. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used. See http://www.ncbi.nlm.nih.gov.
[0160] Thus, a homologue of an IPP or of an IPP domain described above is characterized as having (a) functional activity of native IPP or domain thereof and (b) amino acid sequence similarity to a native IPP protein or domain thereof when determined as above, of at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%.
[0161] It is within the skill in the art to obtain and express such a protein using DNA probes based on the disclosed sequences of an IPP. Then, the fusion protein's biochemical and biological activity can be tested readily using art-recognized methods such as those described herein, for example, a T cell proliferation, cytokine secretion or a cytolytic assay, or an in vivo assay of tumor protection or tumor therapy. A biological assay of the stimulation of antigen-specific T cell reactivity will indicate whether the homologue has the requisite activity to qualify as a functional homologue.
[0162] A variant refers to a molecule substantially identical to either the full protein or to a fragment thereof in which one or more amino acid residues have been replaced (substitution variant) or which has one or several residues deleted (deletion variant) or added (addition variant). A fragment of an IPP refers to any subset of the molecule, that is, a shorter polypeptide of the full-length protein.
[0163] A number of processes can be used to generate fragments, mutants and variants of the isolated DNA sequence. Small subregions or fragments of the nucleic acid encoding the spreading protein, for example 1-30 bases in length, can be prepared by standard, chemical synthesis. Antisense oligonucleotides and primers for use in the generation of larger synthetic fragment.
[0164] A one group of variants are those in which at least one amino acid residue and in certain embodiments only one, has been substituted by different residue. For a detailed description of protein chemistry and structure, see Schulz, G E et al., Principles of Protein Structure, Springer-Verlag, New York, 1978, and Creighton, T. E., Proteins: Structure and Molecular Properties, W.H. Freeman & Co., San Francisco, 1983, which are hereby incorporated by reference. The types of substitutions that may be made in the protein molecule may be based on analysis of the frequencies of amino acid changes between a homologous protein of different species, such as those presented in Table 1-2 of Schulz et al. (supra) and
[0170] The three amino acid residues in parentheses above have special roles in protein architecture. Gly is the only residue lacking a side chain and thus imparts flexibility to the chain. Pro, because of its unusual geometry, tightly constrains the chain. Cys can participate in disulfide bond formation, which is important in protein folding.
[0171] More substantial changes in biochemical, functional (or immunological) properties are made by selecting substitutions that are less conservative, such as between, rather than within, the above five groups. Such changes will differ more significantly in their effect on maintaining (a) the structure of the peptide backbone in the area of the substitution, for example, as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain. Examples of such substitutions are (i) substitution of Gly and/or Pro by another amino acid or deletion or insertion of Gly or Pro; (ii) substitution of a hydrophilic residue, e.g., Ser or Thr, for (or by) a hydrophobic residue, e.g.,, Leu, Ile, Phe, Val or Ala; (iii) substitution of a Cys residue for (or by) any other residue; (iv) substitution of a residue having an electropositive side chain, e.g., Lys, Arg or His, for (or by) a residue having an electronegative charge, e.g., Glu or Asp; or (v) substitution of a residue having a bulky side chain, e.g., Phe, for (or by) a residue not having such a side chain, e.g., Gly.
[0172] Most acceptable deletions, insertions and substitutions according to the present invention are those that do not produce radical changes in the characteristics of the wild-type or native protein in terms of its relevant biological activity, e.g., its ability to stimulate antigen specific T cell reactivity to an antigenic epitope or epitopes that are fused to the protein. However, when it is difficult to predict the exact effect of the substitution, deletion or insertion in advance of doing so, one skilled in the art will appreciate that the effect can be evaluated by routine screening assays such as those described here, without requiring undue experimentation.
[0173] Exemplary fusion proteins provided herein comprise an IPP protein or homolog thereof and an antigen. For example, a fusion protein may comprise, consist essentially of, or consist of an IPP or an IPP fragment, e.g., N-CRT, P-CRT and/or C-CRT, or an amino acid sequence that is at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence of the IPP or IPP fragment, wherein the IPP fragment is functionally active as further described herein, linked to an antigen. A fusion protein may also comprise an IPP or an IPP fragment and at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acids, or about 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 1-50 amino acids, at the N- and/or C-terminus of the IPP fragment. These additional amino acids may have an amino acid sequence that is unrelated to the amino acid sequence at the corresponding position in the IPP protein.
[0174] Homologs of an IPP or an IPP fragments may also comprise, consist essentially of, or consist of an amino acid sequence that differs from that of an IPP or IPP fragment by the addition, deletion, or substitution, e.g., conservative substitution, of at least about 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids, or from about 1-5, 1-10, 1-15 or 1-20 amino acids. Homologs of an IPP or IPP fragments may be encoded by nucleotide sequences that are at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the nucleotide sequence encoding an IPP or IPP fragment, such as those described herein.
[0175] Yet other homologs of an IPP or IPP fragments are encoded by nucleic acids that hybridize under stringent hybridization conditions to a nucleic acid that encodes an IPP or IPP fragment. For example, homologs may be encoded by nucleic acids that hybridize under high stringency conditions of 0.2 to 1?SSC at 65? C. followed by a wash at 0.2?SSC at 65? C. to a nucleic acid consisting of a sequence described herein. Nucleic acids that hybridize under low stringency conditions of 6?SSC at room temperature followed by a wash at 2?SSC at room temperature to nucleic acid consisting of a sequence described herein or a portion thereof can be used. Other hybridization conditions include 3 x SSC at 40 or 50? C., followed by a wash in 1 or 2?SSC at 20, 30, 40, 50, 60, or 65? C.
[0176] Hybridizations can be conducted in the presence of formaldehyde, e.g., 10%, 20%, 30% 40% or 50%, which further increases the stringency of hybridization. Theory and practice of nucleic acid hybridization is described, e.g., in S. Agrawal (ed.) Methods in Molecular Biology, volume 20; and Tijssen (1993) Laboratory Techniques in biochemistry and molecular biology-hybridization with nucleic acid probes, e.g., part I chapter 2 Overview of principles of hybridization and the strategy of nucleic acid probe assays, Elsevier, New York provide a basic guide to nucleic acid hybridization.
[0177] A fragment of a nucleic acid sequence is defined as a nucleotide sequence having fewer nucleotides than the nucleotide sequence encoding the full length CRT polypeptide, antigenic polypeptide, or the fusion thereof. This invention includes the use of such nucleic acid fragments that encode polypeptides which retain the ability of the fusion polypeptide to induce increases in frequency or reactivity of T cells, including CD8+ T cells, that are specific for the antigen part of the fusion polypeptide.
[0178] Nucleic acid sequences that can be used in the present invention may also include linker sequences, natural or modified restriction endonuclease sites and other sequences that are useful for manipulations related to cloning, expression or purification of encoded protein or fragments. For example, a fusion protein may comprise a linker between the antigen and the IPP protein.
[0179] Other nucleic acid vaccines that may be used include single chain trimers (SCT), as further described in the Examples and in references cited therein, all of which are specifically incorporated by reference herein.
Backbone of Nucleic Acid Vaccine
[0180] A nucleic acid, e.g., DNA vaccine may comprise an expression vector or expression cassette, i.e., a nucleotide sequence which is capable of affecting expression of a protein coding sequence in a host compatible with such sequences. Expression cassettes include at least a promoter operably linked with the polypeptide coding sequence; and, optionally, with other sequences, e.g., transcription termination signals. Additional factors necessary or helpful in effecting expression may also be included, e.g., enhancers.
[0181] Operably linked means that the coding sequence is linked to a regulatory sequence in a manner that allows expression of the coding sequence. Known regulatory sequences are selected to direct expression of the desired protein in an appropriate host cell. Accordingly, the term regulatory sequence includes promoters, enhancers and other expression control elements. Such regulatory sequences are described in, for example, Goeddel, Gene Expression Technology. Methods in Enzymology, vol. 185, Academic Press, San Diego, Calif. (1990)).
[0182] A promoter region of a DNA or RNA molecule binds RNA polymerase and promotes the transcription of an operably linked nucleic acid sequence. As used herein, a promoter sequence is the nucleotide sequence of the promoter which is found on that strand of the DNA or RNA which is transcribed by the RNA polymerase. Two sequences of a nucleic acid molecule, such as a promoter and a coding sequence, are operably linked when they are linked to each other in a manner which permits both sequences to be transcribed onto the same RNA transcript or permits an RNA transcript begun in one sequence to be extended into the second sequence. Thus, two sequences, such as a promoter sequence and a coding sequence of DNA or RNA are operably linked if transcription commencing in the promoter sequence will produce an RNA transcript of the operably linked coding sequence. In order to be operably linked it is not necessary that two sequences be immediately adjacent to one another in the linear sequence.
[0183] In one embodiment, certain promoter sequences useful for the present invention must be operable in mammalian cells and may be either eukaryotic or viral promoters.
[0184] Certain promoters are also described in the Examples, and other useful promoters and regulatory elements are discussed below. Suitable promoters may be inducible, repressible or constitutive. A constitutive promoter is one which is active under most conditions encountered in the cell's environmental and throughout development. An inducible promoter is one which is under environmental or developmental regulation. A tissue specific promoter is active in certain tissue types of an organism. An example of a constitutive promoter is the viral promoter MSV-LTR, which is efficient and active in a variety of cell types, and, in contrast to most other promoters, has the same enhancing activity in arrested and growing cells. Other viral promoters include that present in the CMV-LTR (from cytomegalovirus) (Bashart, M. et al., Cell 41:521, 1985) or in the RSV-LTR (from Rous sarcoma virus) (Gorman, C. M., Proc. Natl. Acad. Sci. USA 79:6777, 1982). Also useful are the promoter of the mouse metallothionein I gene (Hamer, D, et al., J. Mol. Appl. Gen. 1:273-88, 1982; the TK promoter of Herpes virus (McKnight, S, Cell 31:355-65, 1982); the SV40 early promoter (Benoist, C., et al., Nature 290:304-10, 1981); and the yeast gal4 gene promoter (Johnston, S A et al., Proc. Natl. Acad. Sci. USA 79:6971-5, 1982); Silver, P A, et al., Proc. Natl. Acad. Sci. (USA) 81:5951-5, 1984)). Other illustrative descriptions of transcriptional factor association with promoter regions and the separate activation and DNA binding of transcription factors include: Keegan et al., Nature 231:699, 1986; Fields et al., Nature 340:245, 1989; Jones, Cell 61:9, 1990; Lewin, Cell 61:1161, 1990; Ptashne et al., Nature 346:329, 1990; Adams et al., Cell 72:306, 1993.
[0185] The promoter region may further include an octamer region which may also function as a tissue specific enhancer, by interacting with certain proteins found in the specific tissue. The enhancer domain of the DNA construct useful for the present invention is one which is specific for the target cells to be transfected, or is highly activated by cellular factors of such target cells. Examples of vectors (plasmid or retrovirus) are disclosed, e.g., in Roy-Burman et al., U.S. Pat. No. 5,112,767, incorporated by reference. For a general discussion of enhancers and their actions in transcription, see, Lewin, B M, Genes IV, Oxford University Press pp. 552-576, 1990 (or later edition). Particularly useful are retroviral enhancers (e.g., viral LTR) that is placed upstream from the promoter with which it interacts to stimulate gene expression. For use with retroviral vectors, the endogenous viral LTR may be rendered enhancer-less and substituted with other desired enhancer sequences which confer tissue specificity or other desirable properties such as transcriptional efficiency.
[0186] Thus, expression cassettes include plasmids, recombinant viruses, any form of a recombinant naked DNA vector, and the like. A vector comprises a nucleic acid which can infect, transfect, transiently or permanently transduce a cell. It will be recognized that a vector can be a naked nucleic acid, or a nucleic acid complexed with protein or lipid. The vector optionally comprises viral or bacterial nucleic acids and/or proteins, and/or membranes (e.g., a cell membrane, a viral lipid envelope, etc.). Vectors include replicons (e.g., RNA replicons), bacteriophages) to which fragments of DNA may be attached and become replicated. Vectors thus include, but are not limited to RNA, autonomous self-replicating circular or linear DNA or RNA, e.g., plasmids, viruses, and the like (U.S. Pat. No. 5,217,879, incorporated by reference), and includes both the expression and nonexpression plasmids. Where a recombinant cell or culture is described as hosting an expression vector this includes both extrachromosomal circular and linear DNA and DNA that has been incorporated into the host chromosome(s). Where a vector is being maintained by a host cell, the vector may either be stably replicated by the cells during mitosis as an autonomous structure, or is incorporated within the host's genome.
[0187] Exemplary virus vectors that may be used include recombinant adenoviruses (Horowitz, M S, In: Virology, Fields, B N et al., eds, Raven Press, NY, 1990, p. 1679; Berkner, K L, Biotechniques 6:616-29, 1988; Strauss, S E, In: The Adenoviruses, Ginsberg, HS, ed., Plenum Press, NY, 1984, chapter 11) and herpes simplex virus (HSV). Advantages of adenovirus vectors for human gene delivery include the fact that recombination is rare, no human malignancies are known to be associated with such viruses, the adenovirus genome is double stranded DNA which can be manipulated to accept foreign genes of up to 7.5 kb in size, and live adenovirus is a safe human vaccine organisms. Adeno-associated virus is also useful for human therapy (Samulski, R J et al., EMBO J. 10:3941, 1991) according to the present invention.
[0188] A nucleic acid (e.g., DNA) vaccine may also use a replicon, e.g., an RNA replicon, a self-replicating RNA vector. In one embodiment, a replicon is one based on a Sindbis virus RNA replicon, e.g., SINrep5. The present inventors tested E7 in the context of such a vaccine and showed (see Wu et al, U.S. patent application Ser. No. 10/343,719) that a Sindbis virus RNA vaccine encoding HSV-1 VP22 linked to E7 significantly increased activation of E7-specific CD8 T cells, resulting in potent antitumor immunity against E7-expressing tumors. The Sindbis virus RNA replicon vector used in these studies, SINrep5, has been described (Bredenbeek, P J et al., 1993, J. Virol. 67:6439-6446).
[0189] Generally, RNA replicon vaccines may be derived from alphavirus vectors, such as Sindbis virus (Hariharan, M J et al., 1998. J Virol 72:950-8.), Semliki Forest virus (Berglund, P M et al., 1997. AIDS Res Hum Retroviruses 13:1487-95; Ying, H T et al., 1999. Nat Med 5:823-7) or Venezuelan equine encephalitis virus (Pushko, P M et al., 1997. Virology 239:389-401). These self-replicating and self-limiting vaccines may be administered as either (1) RNA or (2) DNA which is then transcribed into RNA replicons in cells transfected in vitro or in vivo (Berglund, P C et al., 1998. Nat Biotechnol 16:562-5; Leitner, W W et al., 2000. Cancer Res 60:51-5). An exemplary Semliki Forest virus is pSCA1 (DiCiommo, D P et al., J Biol Chem 1998; 273:18060-6).
[0190] The plasmid vector pcDNA3 or a functional homolog thereof (SEQ ID NO:40) may be used in a nucleic acid (e.g., DNA) vaccine. In other embodiments, pNGVL4a (SEQ ID NO:41) can be used.
[0191] pNGVL4a, one plasmid backbone for use in the present invention, was originally derived from the pNGVL3 vector, which has been approved for human vaccine trials. The pNGVL4a vector includes two immunostimulatory sequences (tandem repeats of CpG dinucleotides) in the noncoding region. Whereas any other plasmid DNA that can transform either APCs, including DC's or other cells which, via cross-priming, transfer the antigenic moiety to DCs, is useful in the present invention, pNGFVLA4a may be used because of the fact that it has already been approved for human therapeutic use.
[0192] The following references set forth principles and current information in the field of basic, medical and veterinary virology and are incorporated by reference: Fields Virology, Fields, B N et al., eds., Lippincott Williams & Wilkins, NY, 1996; Principles of Virology: Molecular Biology, Pathogenesis, and Control, Flint, S. J. et al., eds., Amer Soc Microbiol, Washington DC, 1999; Principles and Practice of Clinical Virology, 4th Edition, Zuckerman. A. J. et al., eds, John Wiley & Sons, NY, 1999; The Hepatitis C Viruses, by Hagedorn, C H et al., eds., Springer Verlag, 1999; Hepatitis B Virus: Molecular Mechanisms in Disease and Novel Strategies for Therapy, Koshy, R. et al., eds, World Scientific Pub Co, 1998; Veterinary Virology, Murphy, F. A. et al., eds., Academic Press, NY, 1999; Avian Viruses: Function and Control, Ritchie, B. W., Iowa State University Press, Ames , 2000; Virus Taxonomy: Classification and Nomenclature of Viruses: Seventh Report of the International Committee on Taxonomy of Viruses, by M. H. V. Van Regenmortel, MHV et al., eds., Academic Press; NY, 2000.
[0193] Plasmid DNA used for transfection or microinjection may be prepared using methods well-known in the art, for example using the Qiagen procedure (Qiagen), followed by DNA purification using known methods, such as the methods exemplified herein.
[0194] Such expression vectors may be used to transfect host cells (in vitro, ex vivo or in vivo) for expression of the DNA and production of the encoded proteins which include fusion proteins or peptides. In one embodiment, a nucleic acid (e.g., DNA) vaccine is administered to or contacted with a cell, e.g., a cell obtained from a subject (e.g., an antigen presenting cell), and administered to a subject, wherein the subject is treated before, after or at the same time as the cells are administered to the subject.
[0195] The term isolated as used herein, when referring to a molecule or composition, such as a translocation polypeptide or a nucleic acid coding therefor, means that the molecule or composition is separated from at least one other compound (protein, other nucleic acid, etc.) or from other contaminants with which it is natively associated or becomes associated during processing. An isolated composition can also be substantially pure. An isolated composition can be in a homogeneous state and can be dry or in aqueous solution. Purity and homogeneity can be determined, for example, using analytical chemical techniques such as polyacrylamide gel electrophoresis (PAGE) or high performance liquid chromatography (HPLC). Even where a protein has been isolated so as to appear as a homogenous or dominant band in a gel pattern, there are trace contaminants which co-purify with it.
[0196] Host cells transformed or transfected to express the fusion polypeptide or a homologue or functional derivative thereof are useful for the present invention. For example, the fusion polypeptide may be expressed in yeast, or mammalian cells such as Chinese hamster ovary cells (CHO) or human cells. In one embodiment, cells for expression according to the present invention are APCs or DCs. Other suitable host cells are known to those skilled in the art.
Other Nucleic Acids for Potentiating Immune Responses
[0197] Methods of administrating a chemotherapeutic drug and a vaccine may further comprise administration of one or more other constructs, e.g., to prolong the life of antigen presenting cells. Exemplary constructs are described in the following two sections. Such constructs may be administered simultaneously or at the same time as a nucleic acid (e.g., DNA) vaccine. Alternatively, they may be administered before or after administration of the DNA vaccine or chemotherapeutic drug.
Potentiation of Immune Responses Using Sirna Directed at Apoptotic Pathways
[0198] Administration to a subject of a DNA vaccine and a chemotherapeutic drug may be accompanied by administration of one or more other agents, e.g., constructs. In one embodiment, a method comprises further administering to a subject an siRNA directed at an apoptotic pathway, such as described in WO 2006/073970, which is incorporated herein in its entirety.
[0199] The present inventors have designed siRNA sequences that hybridize to, and block expression of the activation of Bak and Bax proteins that are central players in the apoptosis signaling pathway. Methods of treating tumors or hyperproliferative diseases involving the administration of siRNA molecules (sequences), vectors containing or encoding the siRNA, expression vectors with a promoter operably linked to the siRNA coding sequence that drives transcription of siRNA sequences that are specific for sequences Bak and Bax nucleic acid are also encompassed within the present invention. siRNAs may include single stranded hairpin sequences because of their stability and binding to the target mRNA.
[0200] Since Bak and Bax are involved, among other death proteins, in apoptosis of APCs, particularly DCs, the present siRNA sequences may be used in conjunction with a broad range of DNA vaccine constructs encoding antigens to enhance and promote the immune response induced by such DNA vaccine constructs, particularly CD8+ T cell mediated immune responses typified by CTL activation and action. This is believed to occur as a result of the effect of the siRNA in prolonging the life of antigen-presenting DCs which may otherwise be killed in the course of a developing immune response by the very same CTLs that the DCs are responsible for inducing.
[0201] In addition to Bak and Bax, additional targets for siRNAs designed in an analogous manner include caspase 8, caspase 9 and caspase 3. The present invention includes compositions and methods in which siRNAs targeting any two or more of Bak, Bax, caspase 8, caspase 9 and caspase 3 are used in combination, optionally simultaneously (along with a DNA immunogen that encodes an antigen), to administer to a subject. Such combinations of siRNAs may also be used to transfect DCs (along with antigen loading) to improve the immunogenicity of the DCs as cellular vaccines by rendering them resistant to apoptosis.
[0202] siRNAs suppress gene expression through a highly regulated enzyme-mediated process called RNA interference (RNAi) (Sharp, P. A., Genes Dev. 15:485-90, 2001; Bernstein, E et al., Nature 409:363-66, 2001; Nykanen, A et al., Cell 107:309-21, 2001; Elbashir et al., Genes Dev. 15:188-200, 2001). RNA interference is the sequence-specific degradation of homologues in an mRNA of a targeting sequence in an siNA. As used herein, the term siNA (small, or short, interfering nucleic acid) is meant to be equivalent to other terms used to describe nucleic acid molecules that are capable of mediating sequence specific RNAi (RNA interference), for example short (or small) interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotide, short interfering nucleic acid, short interfering modified oligonucleotide, chemically-modified siRNA, post-transcriptional gene silencing RNA (ptgsRNA), translational silencing, and others. RNAi involves multiple RNA-protein interactions characterized by four major steps: assembly of siRNA with the RNA-induced silencing complex (RISC), activation of the RISC, target recognition and target cleavage. These interactions may bias strand selection during siRNA-RISC assembly and activation, and contribute to the overall efficiency of RNAi (Khvorova, A et al., Cell 115:209-216 (2003); Schwarz, D S et al. 115:199-208 (2003)))
[0203] Considerations to be taken into account when designing an RNAi molecule include, among others, the sequence to be targeted, secondary structure of the RNA target and binding of RNA binding proteins. Methods of optimizing siRNA sequences will be evident to the skilled worker. Typical algorithms and methods are described in Vickers et al. (2003) J Biol Chem 278:7108-7118; Yang et al. (2003) Proc Natl Acad Sci USA 99:9942-9947; Far et al. (2003) Nuc. Acids Res. 31:4417-4424; and Reynolds et al. (2004) Nature Biotechnology 22:326-330, all of which are incorporated by reference in their entirety.
[0204] The methods described in Far et al., supra, and Reynolds et al., supra, may be used by those of ordinary skill in the art to select targeted sequences and design siRNA sequences that are effective at silencing the transcription of the relevant mRNA. Far et al. suggests options for assessing target accessibility for siRNA and supports the design of active siRNA constructs. This approach can be automated, adapted to high throughput and is open to include additional parameters relevant to the biological activity of siRNA. To identify siRNA-specific features likely to contribute to efficient processing at each of the steps of RNAi noted above. Reynolds et al., supra, present a systematic analysis of 180 siRNAs targeting the mRNA of two genes. Eight characteristics associated with siRNA functionality were identified: low G/C content, a bias towards low internal stability at the sense strand 3-terminus, lack of inverted repeats, and sense strand base preferences (positions 3, 10, 13 and 19). Application of an algorithm incorporating all eight criteria significantly improves potent siRNA selection. This highlights the utility of rational design for selecting potent siRNAs that facilitate functional gene knockdown.
[0205] Candidate siRNA sequences against mouse and human Bax and Bak are selected using a process that involves running a BLAST search against the sequence of Bax or Bak (or any other target) and selecting sequences that survive to ensure that these sequences will not be cross matched with any other genes.
[0206] siRNA sequences selected according to such a process and algorithm may be cloned into an expression plasmid and tested for their activity in abrogating Bak/Bax function cells of the appropriate animal species. Those sequences that show RNAi activity may be used by direct administration bound to particles, or recloned into a viral vector such as a replication-defective human adenovirus serotype 5 (Ad5).
[0207] One advantage of this viral vector is the high titer obtainable (in the range of 10.sup.10) and therefore the high multiplicities-of infection that can be attained. For example, infection with 100 infectious units/ cell ensures all cells are infected. Another advantage of this virus is the high susceptibility and infectivity and the host range (with respect to cell types). Even if expression is transient, cells would survive, possibly replicate, and continue to function before Bak/Bax activity would recover and lead to cell death. In one embodiment, constructs include the following:
TABLE-US-00004 ForBak: (SEQIDNO:42) 5P-UGCCUACGAACUCUUCACCdTdT-3 (sense) (SEQIDNO:43) 5P-GGUGAAGAGUUCGUAGGCAdTdT-3 (antisense),
[0208] The nucleotide sequence encoding the Bak protein (including the stop codon) (GenBank accession No. NM 007523 is shown herein as SEQ ID NO:44 with the targeted sequence in upper case, underscored. The targeted sequence of Bak, TGCCTACGAACTCTTCACC is shown herein as SEQ ID NO:45.
TABLE-US-00005 ForBax: (SEQIDNO:46) 5P-UAUGGAGCUGCAGAGGAUGdTdT-3 (sense) (SEQIDNO:47) 5P-CAUCCUCUGCAGCUCCAUAdTdT-3 (antisense)
[0209] The nucleotide sequence encoding Bax (including the stop codon) (GenBank accession No. L22472 is shown below (SEQ ID NO:48) with the targeted sequence shown in upper case and underscored
[0210] The targeted sequence of Bax, TATGGAGCTGCAGAGGATG is shown herein as SEQ ID NO:49.
[0211] In a one embodiment, the inhibitory molecule is a double stranded nucleic acid (i.e., an RNA), used in a method of RNA interference. The following show the paired 19 nucleotide structures of the siRNA sequences shown above, where the symbol :
Other Pro-Apoptotic Proteins to be Targeted
[0212] 1. Caspase 8: The nucleotide sequence of human caspase-8 is shown herein as SEQ ID NO:50 (GenBank Access. # NM_001228). One target sequence for RNAi is underscored. Others may be identified using methods such as those described herein (and in reference cited herein, primarily Far et al., supra and Reynolds et al., supra).
[0213] The sequences of sense and antisense siRNA strands for targeting this sequence including dTdT 3 overhangs, are:
TABLE-US-00006 (SEQIDNO:51) 5-AACCUCGGGGAUACUGUCUGAdTdT-3 (sense) (SEQIDNO:52) 5-UCAGACAGUAUCCCCGAGGUUdTdT-3 (antisense)
[0214] 2. Caspase 9: The nucleotide sequence of human caspase-9 is shown herein as SEQ ID NO:53 (see GenBank Access. # NM_001229). The sequence below is of variant ? which is longer than a second alternatively spliced variant ? which lacks the underscored part of the sequence shown below (and which is anti-apoptotic). Target sequences for RNAi, expected to fall in the underscored segment, are identified using known methods such as those described herein and in Far et al., supra and Reynolds et al., supra) and siNAs, such as siRNAs, are designed accordingly.
[0215] 3. Caspase 3: The nucleotide sequence of human caspase-3 is shown herein as SEQ ID NO: 54 (see GenBank Access. # NM_004346). The sequence below is of variant cc which is the longer of two alternatively spliced variants, all of which encode the full protein. Target sequences for RNAi are identified using known methods such as those described herein and in Far et al., supra and Reynolds et al., supra) and siNAs, such as siRNAs, are designed accordingly.
[0216] Long double stranded interfering RNAs, such a miRNAs, appear to tolerate mismatches more readily than do short double stranded RNAs. In addition, as used herein, the term RNAi is meant to be equivalent to other terms used to describe sequence specific RNA interference, such as post transcriptional gene silencing, or an epigenetic phenomenon. For example, siNA molecules useful for the invention can be used to epigenetically silence genes at both the post-transcriptional level or the pre-transcriptional level. In a non-limiting example, epigenetic regulation of gene expression by siNA molecules useful for the present invention can result from siNA mediated modification of chromatin structure and thereby alter gene expression (see, for example, Allshire Science 297:1818-19, 2002; Volpe et al., Science 297:1833-37 , 2002; Jenuwein, Science 297:2215-18, 2002; and Hall et al., Science 297, 2232-2237, 2002.)
[0217] An siNA can be designed to target any region of the coding or non-coding sequence of an mRNA. An siNA is a double-stranded polynucleotide molecule comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region has a nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. The siNA can be assembled from two separate oligonucleotides, where one strand is the sense strand and the other is the antisense strand, wherein the antisense and sense strands are self-complementary. The siNA can be assembled from a single oligonucleotide, where the self-complementary sense and antisense regions of the siNA are linked by means of a nucleic acid based or non-nucleic acid-based linker(s). The siNA can be a polynucleotide with a hairpin secondary structure, having self-complementary sense and antisense regions. The siNA can be a circular single-stranded polynucleotide having two or more loop structures and a stem comprising self-complementary sense and antisense regions, wherein the circular polynucleotide can be processed either in vivo or in vitro to generate an active siNA molecule capable of mediating RNAi. The siNA can also comprise a single stranded polynucleotide having nucleotide sequence complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof (or can be an siNA molecule that does not require the presence within the siNA molecule of nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof), wherein the single stranded polynucleotide can further comprise a terminal phosphate group, such as a 5-phosphate (see for example Martinez et al. (2002) Cell 110, 563-574 and Schwarz et al. (2002) Molecular Cell 10, 537-568), or 5,3-diphosphate.
[0218] In certain embodiments, the siNA molecule useful for the present invention comprises separate sense and antisense sequences or regions, wherein the sense and antisense regions are covalently linked by nucleotide or non-nucleotide linkers molecules as is known in the art, or are alternately non-covalently linked by ionic interactions, hydrogen bonding, Van der Waal's interactions, hydrophobic interactions, and/or stacking interactions.
[0219] As used herein, siNA molecules need not be limited to those molecules containing only ribonucleotides but may also further encompass deoxyribonucleotides (as in the siRNAs which each include a dTdT dinucleotide) chemically-modified nucleotides, and non-nucleotides. In certain embodiments, the siNA molecules useful for the present invention lack 2-hydroxy (2-OH) containing nucleotides. In certain embodiments, siNAs do not require the presence of nucleotides having a 2-hydroxy group for mediating RNAi and as such, siNAs useful for the present invention optionally do not include any ribonucleotides (e.g., nucleotides having a 2-OH group). Such siNA molecules that do not require the presence of ribonucleotides within the siNA molecule to support RNAi can however have an attached linker or linkers or other attached or associated groups, moieties, or chains containing one or more nucleotides with 2-OH groups. Optionally, siNA molecules can comprise ribonucleotides at about 5, 10, 20, 30, 40, or 50% of the nucleotide positions. If modified, the siNAs useful for the present invention can also be referred to as short interfering modified oligonucleotides or siMON. Other chemical modifications, e.g., as described in Int'l Patent Publications WO 03/070918 and WO 03/074654, both of which are incorporated by reference, can be applied to any siNA sequence useful for the present invention.
[0220] In one embodiment a molecule mediating RNAi has a 2 nucleotide 3 overhang (dTdT in the sequences disclosed herein). If the RNAi molecule is expressed in a cell from a construct, for example from a hairpin molecule or from an inverted repeat of the desired sequence, then the endogenous cellular machinery will create the overhangs.
[0221] Methods of making siRNAs are conventional. In vitro methods include processing the polyribonucleotide sequence in a cell-free system (e.g., digesting long dsRNAs with RNAse III or Dicer), transcribing recombinant double stranded DNA in vitro, and chemical synthesis of nucleotide sequences homologous to Bak or Bax sequences. See, e.g., Tuschl et al., Genes & Dev. 13:3191-3197, 1999. In vivo methods include [0222] (1) transfecting DNA vectors into a cell such that a substrate is converted into siRNA in vivo. See, for example, Kawasaki et al., Nucleic Acids Res 31:700-07, 2003; Miyagishi et al., Nature Biotechnol 20:497-500, 2003; Lee et al., Nature Biotechnol 20:500-05, 2002; Brummelkamp et al., Science 296:550-53, 2002; McManus et al., RNA 8:842-50, 2002; Paddison et al., Genes Dev 16:948-58, 2002; Paddison et al., Proc Natl Acad Sci USA 99:1443-48, 2002; Paul et al., Nature Biotechnol 20:505-08, 2002; Sui et al., Proc Natl Acad Sci USA 99:5515-20, 2002; Yu et al., Proc Natl Acad Sci USA 99:6047-52, 2002) [0223] (2) expressing short hairpin RNAs from plasmid systems using RNA polymerase III (pol III) promoters. See, for example, Kawasaki et al., supra; Miyagishi et al., supra; Lee et al., supra; Brummelkamp et al., supra; McManus et al., supra), Paddison et al., supra (both); Paul et al., supra, Sui et al., supra; and Yu et al., supra; and/or (3) expressing short RNA from tandem promoters. See, for example, Miyagishi et al., supra; Lee et al., supra).
[0224] When synthesized in vitro, a typical micromolar scale RNA synthesis provides about 1 mg of siRNA, which is sufficient for about 1000 transfection experiments using a 24-well tissue culture plate format. In general, to inhibit Bak or Bax expression in cells in culture, one or more siRNAs can be added to cells in culture media, typically at about 1 ng/ml to about 10 ?g siRNA/ml.
[0225] For reviews and more general description of inhibitory RNAs, see Lau et al., Sci Amer August 2003: 34-41; McManus et al., Nature Rev Genetics 3, 737-47, 2002; and Dykxhoorn et al., Nature Rev Mol Cell Bio 4:457-467, 2003. For further guidance regarding methods of designing and preparing siRNAs, testing them for efficacy, and using them in methods of RNA interference (both in vitro and in vivo), see, e.g., Allshire, Science 297:1818-19, 2002; Volpe et al., Science 297:1833-37, 2002; Jenuwein, Science 297:2215-18, 2002; Hall et al., Science 297 2232-37, 2002; Hutvagner et al., Science 297:2056-60, 2002; McManus et al. RNA 8:842-850, 2002; Reinhart et al., Genes Dev. 16:1616-26, 2002; Reinhart et al., Science 297:1831, 2002; Fire et al. (1998) Nature 391:806-11, 2002; Moss, Curr Biol 11:R772-5, 2002:Brummelkamp et al., supra; Bass, Nature 411 428-9, 2001; Elbashir et al., Nature 411:494-8; U.S. Pat. 6,506,559; Published U.S. Pat App. 20030206887; and PCT applications WO99/07409, WO99/32619, WO 00/01846, WO 00/44914, WO00/44895, WO01/29058, WO01/36646, WO01/75164, WO01/92513, WO 01/29058, WO01/89304, WO01/90401, WO02/16620, and WO02/29858, all of which are incorporated by reference.
[0226] Ribozymes and siNAs can take any of the forms, including modified versions, described for antisense nucleic acid molecules; and they can be introduced into cells as oligonucleotides (single or double stranded), or in the form of an expression vector.
[0227] In one embodiment, an antisense nucleic acid, siNA (e.g., siRNA) or ribozyme comprises a single stranded polynucleotide comprising a sequence that is at least about 90% (e.g., at least about 93%, 95%, 97%, 98% or 99%) identical to a target segment (such as those indicted for Bak and Bax above) or a complement thereof. As used herein, a DNA and an RNA encoded by it are said to contain the same sequence, taking into account that the thymine bases in DNA are replaced by uracil bases in RNA.
[0228] Active variants (e.g., length variants, including fragments; and sequence variants) of the nucleic acid-based inhibitors discussed herein are also within the scope of the present invention. An active variant is one that retains an activity of the inhibitor from which it is derived (i.e., the ability to inhibit expression). It is to test a variant to determine for its activity using conventional procedures.
[0229] As for length variants, an antisense nucleic acid or siRNA may be of any length that is effective for inhibition of a gene of interest. Typically, an antisense nucleic acid is between about 6 and about 50 nucleotides (e.g., at least about 12, 15, 20, 25, 30, 35, 40, 45 or 50 nt), and may be as long as about 100 to about 200 nucleotides or more. Antisense nucleic acids having about the same length as the gene or coding sequence to be inhibited may be used. When referring to length, the terms bases and base pairs (bp) are used interchangeably, and will be understood to correspond to single stranded (ss) and double stranded (ds) nucleic acids. The length of an effective siNA is generally between about 15 bp and about 29 bp in length, between about 19 and about 29 bp (e.g., about 15, 17, 19, 21, 23, 25, 27 or 29 bp), with shorter and longer sequences being acceptable. Generally, siNAs are shorter than about 30 bases to prevent eliciting interferon effects. For example, an active variant of an siRNA having, for one of its strands, the 19 nucleotide sequence of any of SEQ ID NOs:42, 43, 46, and 47 herein can lack base pairs from either, or both, of ends of the dsRNA; or can comprise additional base pairs at either, or both, ends of the ds RNA, provided that the total of length of the siRNA is between about 19 and about 29 bp, inclusive. One embodiment useful for the present invention is an siRNA that consists essentially of sequences represented by SEQ ID NOs:42, 43, 46, and 47 or complements of these sequence. An siRNA useful for the present invention may consist essentially of between about 19 and about 29 bp in length.
[0230] As for sequence variants, in one embodiment, an inhibitory nucleic acid, whether an antisense molecule, a ribozyme (the recognition sequences), or an siNA, comprises a strand that is complementary (100% identical in sequence) to a sequence of a gene that it is designed to inhibit. However, 100% sequence identity is not required to practice the present invention. Thus, the invention has the advantage of being able to tolerate naturally occurring sequence variations, for example, in human c-met, that might be expected due to genetic mutation, polymorphism, or evolutionary divergence. Alternatively, the variant sequences may be artificially generated. Nucleic acid sequences with small insertions, deletions, or single point mutations relative to the target sequence can be effective inhibitors.
[0231] The degree of sequence identity may be optimized by sequence comparison and alignment algorithms well-known in the art (see Gribskov and Devereux, Sequence Analysis Primer, Stockton Press, 1991, and references cited therein) and calculating the percent difference between the nucleotide sequences by, for example, the Smith-Waterman algorithm as implemented in the BESTFIT software program using default parameters (e.g., University of Wisconsin Genetic Computing Group). In one embodiment, at least about 90% sequence identity may be used (e.g., at least about 92%, 95%, 98% or 99%), or even 100% sequence identity, between the inhibitory nucleic acid and the targeted sequence of targeted gene.
[0232] Alternatively, an active variant of an inhibitory nucleic acid useful for the present invention is one that hybridizes to the sequence it is intended to inhibit under conditions of high stringency. For example, the duplex region of an siRNA may be defined functionally as a nucleotide sequence that is capable of hybridizing with a portion of the target gene transcript under high stringency conditions (e.g., 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50? C. or 70? C., hybridization for 12-16 hours), followed generally by washing. DC-1 cells or BM-DCs presenting a given antigen X, when not treated with the siRNAs useful for the present invention, respond to sufficient numbers X-specific CD8+ CTL by apoptotic cell death. In contrast, the same cells transfected with the siRNA or infected with a viral vector encoding the present siRNA sequences survive better despite the delivery of killing signals.
[0233] Delivery and expression of the siRNA compositions useful for the present invention inhibit the death of DCs in vivo in the process of a developing T cell response, and thereby promote and stimulate the generation of an immune response induced by immunization with an antigen-encoding DNA vaccine vector. These capabilities have been exemplified by showing that: [0234] (1) co-administration of DNA vaccines encoding HPV-16 E7 with siRNA targeted to
[0235] Bak and Bax prolongs the lives of antigen-presenting DCs in the draining lymph nodes, thereby enhancing antigen-specific CD8.sup.+ T cell responses, and eliciting potent antitumor effects against an E7-expressing tumor in vaccinated subjects. [0236] (2) DCs transfected with siRNA targeting Bak and Bax resist killing by T cells in vivo. E7-loaded DCs transfected with Bak/Bax siRNA so that Bak and Bax protein expression is downregulated resist apoptotic death induced by T cells in vivo. When administered to subjects, these DCs generate stronger antigen-specific immune responses and manifest therapeutic effects (compared to DCs transfected with control siRNA).
Thus, siRNA constructs are useful as a part of the nucleic acid vaccination and chemotherapy regimen described in this application.
Potentiation of Immune Responses Using Anti-Apoptotic Proteins
[0237] Administration to a subject of a DNA vaccine and a chemotherapeutic drug may also be accompanied by administration of a nucleic acid encoding an anti-apoptotic protein, as described in WO2005/047501 and in U.S. Patent Application Publication No. 20070026076, both of which are incorporated by reference.
[0238] The present inventors have designed and disclosed an immunotherapeutic strategy that combines antigen-encoding DNA vaccine compositions with additional DNA vectors comprising anti-apoptotic genes including bcl-2, bc-1xL, XIAP, dominant negative mutants of caspase-8 and caspase-9, the products of which are known to inhibit apoptosis (Wu, et al. U.S. Patent Application Publication No. 20070026076, incorporated herein by reference). Serine protease inhibitor 6 (SPI-6) which inhibits granzyme B, may also be employed in compositions and methods to delay apoptotic cell death of DCs. The present inventors have shown that the harnessing of an additional biological mechanism, that of inhibiting apoptosis, significantly enhances T cell responses to DNA vaccines comprising antigen-coding sequences, as well as linked sequences encoding such IPPs.
[0239] Intradermal vaccination by gene gun efficiently delivers a DNA vaccine into DCs of the skin, resulting in the activation and priming of antigen-specific T cells in vivo. DCs, however, have a limited life span, hindering their long-term ability to prime antigen-specific T cells. According to the present invention, a strategy that combines combination therapy with methods to prolong the survival of DNA-transduced DCs enhances priming of antigen-specific T cells and thereby, increase DNA vaccine potency. Co-delivery of DNA encoding inhibitors of apoptosis (BCL-xL, BCL-2, XIAP, dominant negative caspase-9, or dominant negative caspase-8) with DNA encoding an antigen (exemplified as HPV-16 E7 protein) prolongs the survival of transduced DCs. More importantly, vaccinated subjects exhibited significant enhancement in antigen-specific CD8+ T cell immune responses, resulting in a potent antitumor effect against antigen-expressing tumors. Among these anti-apoptotic factors, BCL-XL demonstrated the greatest enhancement of both antigen-specific immune responses and antitumor effects. Thus, co-administration of a combination therapy including a DNA vaccine with one or more DNA constructs encoding anti-apoptotic proteins provides a way to enhance DNA vaccine potency.
[0240] Serine protease inhibitor 6 (SPI-6), also called Serpinb9, inhibits granzyme B, and may thereby delay apoptotic cell death in DCs. Intradermal co-administration of DNA encoding SPI-6 with DNA constructs encoding E7 linked to various IPPs significantly increased E7-specific CD8+ T cell and CD4+ Thl cell responses and enhanced anti-tumor effects when compared to vaccination without SPI-6. Thus, in certain embodiments, combined methods are used that enhance MHC class I and II antigen processing with delivery of SPI-6 to potentiate immunity.
[0241] A similar approach employs DNA-based alphaviral RNA replicon vectors, also called suicidal DNA vectors. To enhance the immune response to an antigen, e.g., HPV E7, a DNA-based Semliki Forest virus vector, pSCA1, the antigen DNA is fused with DNA encoding an anti-apoptotic polypeptide such BCL-xL, a member of the BCL-2 family. pSCA1 encoding a fusion protein of an antigen polypeptide and/BCL-xL delays cell death in transfected DCs and generates significantly higher antigen-specific CD8+ T-cell-mediated immunity. The antiapoptotic function of BCL-xL is important for the enhancement of antigen-specific CD8+ T-cell responses. Thus, in one embodiment, delaying cell death induced by an otherwise desirable suicidal DNA vaccine enhances its potency.
[0242] Thus, the present invention is also directed to combination therapies including administering a chemotherapeutic drug with a nucleic acid composition useful as an immunogen, comprising a combination of: (a) first nucleic acid vector comprising a first sequence encoding an antigenic polypeptide or peptide, which first vector optionally comprises a second sequence linked to the first sequence, which second sequence encodes an immunogenicity-potentiating polypeptide (IPP); b) a second nucleic acid vector encoding an anti-apoptotic polypeptide, wherein, when the second vector is administered with the first vector to a subject, a T cell-mediated immune response to the antigenic polypeptide or peptide is induced that is greater in magnitude and/or duration than an immune response induced by administration of the first vector alone. The first vector above may comprise a promoter operatively linked to the first and/or the second sequence.
[0243] In the above compositions the anti-apoptotic polypeptide may be selected from the group consisting of (a) BCL-xL, (b) BCL2, (c) XIAP, (d) FLICEc-s, (e) dominant-negative caspase-8, (f) dominant negative caspase-9, (g) SPI-6, and (h) a functional homologue or a derivative of any of (a)-(g). The anti-apoptotic DNA may be physically linked to the antigen-encoding DNA. Examples of this are provided in U.S. Patent Application publication No. 20070026076, incorporated by reference, primarily in the form of suicidal DNA vaccine vectors. Alternatively, the anti-apoptotic DNA may be administered separately from, but in combination with the antigen-encoding DNA molecule. Even more examples of the co-administration of these two types of vectors are provided in U.S. patent application Ser. No. 10/546,810 (publication number U.S. 2007-0026076).
[0244] Exemplary nucleotide and amino acid sequences of anti-apoptotic and other proteins are provided in the sequence listing. Biologically active homologs of these proteins and constructs may also be used. Biologically active homologs is to be understood as described herein in the context of other proteins, e.g., IPPs.
[0245] The coding sequence for BCL-xL as present in the pcDNA3 vector useful for the present invention is SEQ ID NO:55; the amino acid sequence of BCL-xL is SEQ ID NO:56; the sequence pcDNA3-BCL-xL is SEQ ID NO:57 (the BCL-xL coding sequence corresponds to nucleotides 983 to 1732); a pcDNA3 vector combining E7 and BCL-xL, designated pcDNA3-E7/BCL-xL is SEQ ID NO:58 (the E7 and BCL-xL sequences correspond to nucleotides 960 to 2009); the amino acid sequence of the E7-BCL-xL chimeric or fusion polypeptide is SEQ ID NO:59; a mutant BCL-xL (mtBCL-xL) DNA sequence is SEQ ID NO:60; the amino acid sequence of mtBCL-xL is SEQ ID NO:61; the amino acid sequence of the E7-mtBCL-xL chimeric or fusion polypeptide is SEQ ID NO:62; in the pcDNA-mtBCL-xL [SEQ ID NO:63] vector, this mutant sequence is inserted in the same position that BCL-xL is inserted in SEQ ID NO:57 and in the pcDNA-E7/mtBCL-XL [SEQ ID NO:64], this sequence is inserted in the same position as the BCL-xL sequence is in SEQ ID NO:58; the sequence of the suicidal DNA vector pSCA1-BCL-xL is SEQ ID NO:65 (the BCL-xL sequence corresponds to nucleotides 7483 to 8232); the sequence of the combined vector, pSCA1-E7/BCL-xL is SEQ ID NO:66 (the sequence of E7 and BCL-xL corresponds to nucleotides 7461 to 8510); the sequence of pSCA1-mtBCL-xL [SEQ ID NO:67] is the same as that for the wild type BCL-xL except that the mtBCL-xL sequence is inserted in the same position as the wild type sequence in the pSCA1-mtBCL-xL vector; the sequence pSCA1-E7/mtBCL-xL [SEQ ID NO:68] is the same as that for the wild type pSCA1-E7/BCL-xL above, except that the mtBCL-xL sequence is inserted in the same position as the wild type sequence; the sequence of the vector pSG5-BCL-xL is SEQ ID NO:69 (the BCL-xL coding sequence corresponds to nucleotides 1061 to 1810); the sequenced of the vector pSG5-mtBCL-xL is SEQ ID NO:70 with the mutant BCL-xL sequence has the mtBCL-xL, shown above, inserted in the same location as for the wild type vector immediately above; the nucleotide sequence of the DNA encoding the XIAP anti-apoptotic protein is SEQ ID NO:71; the amino acid of the vector comprising the XIAP anti-apoptotic protein coding sequence is SEQ ID NO:72; the nucleotide sequence of the vector comprising the XIAP anti-apoptotic protein coding sequence, designated PSGS-XIAP is shown in SEQ ID NO:73 (with the XIAP corresponding to nucleotides 1055 to 2553); the sequence of DNA encoding the anti-apoptotic protein FLICEc-s is SEQ ID NO:74; the amino acid sequence of the anti-apoptotic protein FLICEc-s is SEQ ID NO:75; the PSGS vector encoding the anti-apoptotic protein FLICEc-s, designated PSGS-FLICEc-s, has the sequence SEQ ID NO:76 (with the FLICEc-s sequence corresponding to nucleotides 1049 to 2443); the sequence of DNA encoding the anti-apoptotic protein Bc12 is SEQ ID NO:77; the amino acid sequence of Bc12 is SEQ ID NO:78; the PSG5 vector encoding Bc12, designated PSG5-BCL2, has the sequence SEQ ID NO:79 (with the Bc12 sequence corresponding to nucleotides 1061 to 1678); the pSG5-dn-caspase-8 vector is SEQ ID NO:80 (encoding the dominant-negative caspase-8 corresponding to nucleotides 1055 to 2449); the amino acid sequence of dn-caspase-8 is SEQ ID NO:81; the pSG5-dn-caspase-9 vector is SEQ ID NO:82 (encoding the dominant-negative caspase-9 as nucleotides 1055 to 2305); the amino acid sequence of dn-caspase-9 is SEQ ID NO:83; the nucleotide sequence of murine serine protease inhibitor 6 (SPI-6, deposited in GENEBANK as NM 009256) is SEQ ID NO:84; the amino acid sequence of the SPI-6 protein is SEQ ID NO:85; the nucleic acid sequence of the mutant SPI-6 (mtSPI6) is SEQ ID NO:86; the amino acid sequence of the mutant SPI-6 protein (mtSPI-6) is SEQ ID NO:87; the sequence of the pcDNA3-Spi6 vector is SEQ ID NO:88 (the SPI-6 sequence corresponds to nucleotides 960 to 2081); and the sequence of the mutant vector pcDNA3-mtSpi6 vector [SEQ ID NO:89] is the same as that above, except that the mtSPI-6 sequence is inserted in the same location in place of the wild type SPI-6.
[0246] Biologically active homologs of these nucleic acids and proteins may be used. Biologically active homologs are to be understood as described in the context of other proteins, e.g., IPPs, herein. For example, a vector may encode an anti-apoptotic protein that is at least about 90%, 95%, 98% or 99% identical to that of a sequence set forth herein.
MHC Class I/II Activators
[0247] MHC class I/II activators refers to molecules or complexes thereof that increase immune responses by increasing MHC class I or II (I/II) antigen presentation, such as by increasing MHC class I, class II or class I and class II activity or gene expression. In one embodiment, an MHC class I/II activator is a nucleic acid encoding a protein that enhances MHC class I/II antigen presentation. Exemplary MHC class I/II activators include nucleic acids encoding an MHC class II associated invariant chain (Ii), in which the CLIP region is replaced with a T cell epitope, e.g., a promiscuous T cell epitope, such as the Pan HLA-DR reactive epitope (PADRE), or a variant thereof. Other MHC class I/II activators are nucleic acids encoding the MHC class II transactivator CIITA or a variant thereof.
[0248] In one embodiment, an MHC class I/II activator is a nucleic acid, e.g., an isolated nucleic acid, encoding a protein comprising, consisting or consisting essentially of an invariant (Ii) chain, wherein the CLIP region is replaced with a promiscuous CD4+ T cell epitope. A promiscuous CD4+ T cell epitope is used interchangeably with universal CD4+ T cell epitope and refers to peptides that bind to numerous histocompatibility alleles, e.g., human MEW class II molecules. In one embodiment, the promiscuous CD4+ T cell epitope is a Pan HLA-DR reactive epitope (PADRE), thereby forming an Ii-PADRE protein that is encoded by an Ii-PADRE nucleic acid. In one embodiment, a nucleic acid encodes an Ii chain, wherein amino acids 81-102 (KPVSQMRMATPLLMRPM (SEQ ID NO:92) are replaced with the PADRE sequence AKFVAAWTLKAAA (SEQ ID NO:93). An exemplary human Ii-PADRE amino acid sequence is set forth as SEQ ID NO:91, and is encoded by nucleotide sequence SEQ ID NO:90.
[0249] Also provided herein are variants of a protein consisting of SEQ ID NO:91. A protein may comprise, consist essentially of, or consist of an amino acid sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:91. A protein may comprise a PADRE that is identical to the PADRE of SEQ ID NO:91, i.e., consisting of SEQ ID NO:93. A protein may comprise a PADRE sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:93; and/or an Ii sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the Ii sequence of SEQ ID NO:91.
[0250] An amino acid sequence may differ from that of SEQ ID NO:91 or the Ii or PADRE sequences thereof by the addition, deletion or substitution of at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30 or more amino acids. In certain embodiments, a protein lacks one or more, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acids at the C- and/or N-terminus and/or internal relative to that of SEQ ID NO:91 or the Ii or PADRE region thereof. In certain embodiments, an amino acid sequence differs from that of SEQ ID NO:93 or from that of the Ii sequence by the addition, deletion or substitution of at least about 1, 2, 3, 4, or 5 amino acids.
[0251] Variants of SEQ ID NO:91 or the PADRE or Ii regions thereof preferably have a biological activity. Such variants are referred to as functional homologs or functional variants. Functional homologs include variants of SEQ ID NO:91 that increase an immune response, e.g., an antigen specific immune response, in a subject to whom it is administered, or has any of the biological activities set forth in the Examples pertaining to Ii-PADRE. Variants of the PADRE sequence or the Ii sequence may have a biological activity that is associated with that of the wild type PADRE or Ii sequences, respectively. Biological activities can be determined as know in the art or as set forth in the Examples. In addition, comparison (or alignment) of the Ii and PADRE sequences from different species is expected to be helpful in determining which amino acids may be varied and which ones should preferably not be varied.
[0252] Other proteins provided herein comprise a PADRE amino acid sequence that replaces a larger portion of Ii, e.g., wherein Ii is lacking about amino acids 81-103, 81-104, 81-105, 81-106, 81-107, 81-108, 81-109, 81-110 or more; is lacking about amino acids 70-102, 71-102, 72-102, 73-102, 74-102, 75-102, 76-102, 77-102, 78-102, 79-102, 80-102 or more.
[0253] Other promiscuous CD4+ T cell epitopes that may be used instead of PADRE are listed in Table 1.
TABLE-US-00007 TABLE1 ExemplarypromiscuousCD4+ Tcellepitopes PromiscuousCD4+ Tcellepitopes Reference EBV-latentmembraneprotein1(LMP1.sub.159-175) (1) YLQQNWWTLLVDLLWLL MAGE-A6.sub.172-187;IGHVYIFATCLGLSYD (2) MycoplasmapenetransHF-2.sub.219-226;IYIFAACL six-transmembraneepithelialantigenofprostate(STEAP) (3) STEAP.sub.102-116HQQYFYKIPILVINK STEAP.sub.192-206LLNWAYQQVQQNKED Taxol-resistance-associatedgene-3(TRAG3).sub.35-48 (4) EFHACWPAFTVLGE Survivin.sub.10-24WQPFLKDHRISTFKN (5) HPV18-E6.sub.52-60;LFVVYRDSIPHAACH (6) HPV18-E6.sub.97-111;GLYNLLIRCLRCQKP Carcinoembryonicantigen.sub.177-189;LWWVNNQSLPVSP (7) mycobacterialantigenMPB70 (8) MPB70.sub.106-130;FSKLPASTIDELKTNSSLLTSILTY MPB70.sub.166-193;GNADVVCGGVSTANATVYMIDSVLMPPA HER-2.sub.776-788GSPYVSRLLGICL (9) HER-2.sub.833-849KVPIKWMALESILRRRF (10) NY-ESO-1.sub.119-143PGVLLKEFTVSGNILTIRLTAADHR (11) Tetanustoxin.sub.1084-1099VSIDKFRIFCKANPK (12) Tetanustoxin.sub.1174-1189LKFIIKRYTPNNEIDS Tetanustoxin.sub.1064-1079IREDNNITLKLDRCN Tetanustoxin.sub.947-967FNNFTVSFWLRVPKVSASHLE Tetanustoxin.sub.830-843QYIKANSKFIGITE HBVnuclearcapside.sub.50-69PHHTALRQAILCWGELMTLA Influenzahaemagglutinin.sub.307-319PKYVKQNTLKLAT HBVsurfaceantigen.sub.19-33-FFLLTRILTIPQSLD Influenzamatrix.sub.17-31YSGPLKAEIAQRLEDV P.falciparumCSP.sub.380-398EKKIAKMEKASSVFNVVN
[0254] 1. Kobayashi, H., T. Nagato, M. Takahara, K. Sato, S. Kimura, N. Aoki, M. Azumi, M. Tateno, Y. Harabuchi, and E. Celis. 2008. Induction of EBV-latent membrane protein 1-specific MHC class II-restricted T-cell responses against natural killer lymphoma cells. Cancer Res 68:901-908.
[0255] 2. Vujanovic, L., M. Mandic, W. C. Olson, J. M. Kirkwood, and W. J. Storkus. 2007. A mycoplasma peptide elicits heteroclitic CD4+ T cell responses against tumor antigen MAGE-A6. Clin Cancer Res 13:6796-6806.
[0256] 3. Kobayashi, H., T. Nagato, K. Sato, N. Aoki, S. Kimura, M. Murakami, H. Iizuka, M. Azumi, H. Kakizaki, M. Tateno, and E. Celis. 2007. Recognition of prostate and melanoma tumor cells by six-transmembrane epithelial antigen of prostate-specific helper T lymphocytes in a human leukocyte antigen class II-restricted manner. Cancer Res 67:5498-5504.
[0257] 4. Janjic, B., P. Andrade, X. F. Wang, J. Fourcade, C. Almunia, P. Kudela, A. Brufsky, S. Jacobs, D. Friedland, R. Stoller, D. Gillet, R. B. Herberman, J. M. Kirkwood, B. Maillere, and H. M. Zarour. 2006. Spontaneous CD4+ T cell responses against TRAG-3 in patients with melanoma and breast cancers. J Immunol 177:2717-2727.
[0258] 5. Piesche, M., Y. Hildebrandt, F. Zettl, B. Chapuy, M. Schmitz, G. Wulf, L. Trumper, and R. Schroers. 2007. Identification of a promiscuous HLA DR-restricted T-cell epitope derived from the inhibitor of apoptosis protein survivin. Hum Immunol 68:572-576.
[0259] 6. Facchinetti, V., S. Seresini, R. Longhi, C. Garavaglia, G. Casorati, and M. P. Protti. 2005. CD4+ T cell immunity against the human papillomavirus-18 E6 transforming protein in healthy donors: identification of promiscuous naturally processed epitopes. Eur J Immunol 35:806-815.
[0260] 7. Campi, G., M. Crosti, G. Consogno, V. Facchinetti, B. M. Conti-Fine, R. Longhi, G. Casorati, P. Dellabona, and M. P. Protti. 2003. CD4(+) T cells from healthy subjects and colon cancer patients recognize a carcinoembryonic antigen-specific immunodominant epitope. Cancer Res 63:8481-8486.
[0261] 8. Al-Attiyah, R., F. A. Shaban, H. G. Wiker, F. Oftung, and A. S. Mustafa. 2003. Synthetic peptides identify promiscuous human Th1 cell epitopes of the secreted mycobacterial antigen MPB70. Infect Immun 71:1953-1960.
[0262] 9. Sotiriadou, R., S. A. Perez, A. D. Gritzapis, P. A. Sotiropoulou, H. Echner, S. Heinzel, A. Mamalaki, G. Pawelec, W. Voelter, C. N. Baxevanis, and M. Papamichail. 2001. Peptide HER2(776-788) represents a naturally processed broad MHC class II-restricted T cell epitope. Br J Cancer 85:1527-1534.
[0263] 10. Kobayashi, H., M. Wood, Y. Song, E. Appella, and E. Celis. 2000. Defining promiscuous MHC class II helper T-cell epitopes for the HER2/neu tumor antigen. Cancer Res 60:5228-5236.
[0264] 11. Zarour, H. M., B. Maillere, V. Brusic, K. Coval, E. Williams, S. Pouvelle-Moratille, F. Castelli, S. Land, J. Bennouna, T. Logan, and J. M. Kirkwood. 2002. NY-ESO-1 119-143 is a promiscuous major histocompatibility complex class II T-helper epitope recognized by Thl- and Th2-type tumor-reactive CD4+ T cells. Cancer Res 62:213-218.
[0265] 12. Falugi, F., R. Petracca, M. Mariani, E. Luzzi, S. Mancianti, V. Carinci, M. L. Melli, 0. Finco, A. Wack, A. Di Tommaso, M. T. De Magistris, P. Costantino, G. Del Giudice, S. Abrignani, R. Rappuoli, and G. Grandi. 2001. Rationally designed strings of promiscuous CD4(+) T cell epitopes provide help to Haemophilus influenzae type b oligosaccharide: a model for new conjugate vaccines. Eur Immunol 31:3816-3824.
[0266] The CLIP region in an Ii molecule, e.g., having the amino acid sequence of the Ii portion set forth in SEQ ID NO:91, may be replaced with any of the peptides in Table 2 or other promiscuous epitopes set forth in the references of Table 2, or functional variants thereof. Preferred epitopes include those from tetanus toxin and influenza. Any other promiscuous CD4+ T cell epitopes may be used, e.g., those described in the following references:
[0267] 1. Campi, G., M. Crosti, G. Consogno, V. Facchinetti, B. M. Conti-Fine, R. Longhi, G. Casorati, P. Dellabona, and M. P. Protti. 2003. CD4(+) T cells from healthy subjects and colon cancer patients recognize a carcinoembryonic antigen-specific immunodominant epitope. Cancer Res 63:8481-8486.
[0268] 2. Castelli, F. A., M. Leleu, S. Pouvelle-Moratille, S. Farci, H. M. Zarour, M. Andrieu, C. Auriault, A. Menez, B. Georges, and B. Maillere. 2007. Differential capacity of T cell priming in naive donors of promiscuous CD4+ T cell epitopes of HCV NS3 and Core proteins. Eur J Immunol 37:1513-1523.
[0269] 3. Consogno, G., S. Manici, V. Facchinetti, A. Bachi, J. Hammer, B. M. Conti-Fine, C. Rugarli, C. Traversari, and M. P. Protti. 2003. Identification of immunodominant regions among promiscuous HLA-DR-restricted CD4+ T-cell epitopes on the tumor antigen MAGE-3. Blood 101:1038-1044.
[0270] 4. Depil, S., 0. Morales, F. A. Castelli, N. Delhem, V. Francois, B. Georges, F. Dufosse, F. Morschhauser, J. Hammer, B. Maillere, C. Auriault, and V. Pancre. 2007. Determination of a HLA II promiscuous peptide cocktail as potential vaccine against EBV latency II malignancies. J Immunother (1997) 30:215-226.
[0271] 5. Facchinetti, V., S. Seresini, R. Longhi, C. Garavaglia, G. Casorati, and M. P. Protti. 2005. CD4+ T cell immunity against the human papillomavirus-18 E6 transforming protein in healthy donors: identification of promiscuous naturally processed epitopes. Eur J Immunol 35:806-815.
[0272] 6. Kobayashi, H., T. Nagato, K. Sato, N. Aoki, S. Kimura, M. Murakami, H. Iizuka, M. Azumi, H. Kakizaki, M. Tateno, and E. Celis. 2007. Recognition of prostate and melanoma tumor cells by six-transmembrane epithelial antigen of prostate-specific helper T lymphocytes in a human leukocyte antigen class II-restricted manner. Cancer Res 67:5498-5504.
[0273] 7. Kobayashi, H., M. Wood, Y. Song, E. Appella, and E. Celis. 2000. Defining promiscuous MHC class II helper T-cell epitopes for the HER2/neu tumor antigen. Cancer Res 60:5228-5236.
[0274] 8. Mandic, M., C. Almunia, S. Vicel, D. Gillet, B. Janjic, K. Coval, B. Maillere, J. M. Kirkwood, and H. M. Zarour. 2003. The alternative open reading frame of LAGE-1 gives rise to multiple promiscuous HLA-DR-restricted epitopes recognized by T-helper 1-type tumor-reactive CD4+ T cells. Cancer Res 63:6506-6515.
[0275] 9. Neumann, F., C. Wagner, S. Stevanovic, B. Kubuschok, C. Schormann, A. Mischo, K. Ertan, W. Schmidt, and M. Pfreundschuh. 2004. Identification of an HLA-DR-restricted peptide epitope with a promiscuous binding pattern derived from the cancer testis antigen HOM-MEL-40/S SX2. Int J Cancer 112:661-668.
[0276] 10. Ohkuri, T., M. Sato, H. Abe, K. Tsuji, Y. Yamagishi, H. Ikeda, N. Matsubara, H. Kitamura, and T. Nishimura. 2007. Identification of a novel NY-ESO-1 promiscuous helper epitope presented by multiple MHC class II molecules found frequently in the Japanese population. Cancer Sci 98:1092-1098.
[0277] 11. Piesche, M., Y. Hildebrandt, F. Zettl, B. Chapuy, M. Schmitz, G. Wulf, L. Trumper, and R. Schroers. 2007. Identification of a promiscuous HLA DR-restricted T-cell epitope derived from the inhibitor of apoptosis protein survivin. Hum Immunol 68:572-576.
[0278] 12. Sotiriadou, R., S. A. Perez, A. D. Gritzapis, P. A. Sotiropoulou, H. Echner, S. Heinzel, A. Mamalaki, G. Pawelec, W. Voelter, C. N. Baxevanis, and M. Papamichail. 2001. Peptide HER2(776-788) represents a naturally processed broad MHC class II-restricted T cell epitope. Br J Cancer 85:1527-1534.
[0279] 13. Texier, C., S. Pouvelle-Moratille, C. Buhot, F. A. Castelli, C. Pecquet, A. Menez, F. Leynadier, and B. Maillere. 2002. Emerging principles for the design of promiscuous HLA-DR-restricted peptides: an example from the major bee venom allergen. Eur J Immunol 32:3699-3707.
[0280] 14. Vujanovic, L., M. Mandic, W. C. Olson, J. M. Kirkwood, and W. J. Storkus. 2007. A mycoplasma peptide elicits heteroclitic CD4+ T cell responses against tumor antigen MAGE-A6. Clin Cancer Res 13:6796-6806.
[0281] 15. Zarour, H. M., B. Maillere, V. Brusic, K. Coval, E. Williams, S. Pouvelle-Moratille, F. Castelli, S. Land, J. Bennouna, T. Logan, and J. M. Kirkwood. 2002. NY-ESO-1 119-143 is a promiscuous major histocompatibility complex class II T-helper epitope recognized by Th1- and Th2-type tumor-reactive CD4+ T cells. Cancer Res 62:213-218.
[0282] 16. Gao, M., H. P. Wang, Y. N. Wang, Y. Zhou, and Q. L. Wang. 2006. HCV-NS3 Th1 minigene vaccine based on invariant chain CLIP genetic substitution enhances CD4(+) Th1 cell responses in vivo. Vaccine 24:5491-5497.
[0283] 17. Nagata, T., T. Aoshi, M. Suzuki, M. Uchijima, Y. H. Kim, Z. Yang, and Y. Koide. 2002. Induction of protective immunity to Listeria monocytogenes by immunization with plasmid DNA expressing a helper T-cell epitope that replaces the class II-associated invariant chain peptide of the invariant chain. Infect Immun 70:2676-2680.
[0284] 18. Nagata, T., T. Higashi, T. Aoshi, M. Suzuki, M. Uchijima, and Y. Koide. 2001. Immunization with plasmid DNA encoding MHC class II binding peptide/CLIP-replaced invariant chain (Ii) induces specific helper T cells in vivo: the assessment of Ii p31 and p41 isoforms as vehicles for immunization. Vaccine 20:105-114.
[0285] 19. Toda, M., M. Kasai, H. Hosokawa, N. Nakano, Y. Taniguchi, S. Inouye, S. Kaminogawa, T. Takemori, and M. Sakaguchi. 2002. DNA vaccine using invariant chain gene for delivery of CD4+ T cell epitope peptide derived from Japanese cedar pollen allergen inhibits allergen-specific IgE response. Eur J Immunol 32:1631-1639.
[0286] 20. van Bergen, J., M. Camps, R. Offringa, C. J. Melief, F. Ossendorp, and F. Koning. 2000. Superior tumor protection induced by a cellular vaccine carrying a tumor-specific T helper epitope by genetic exchange of the class II-associated invariant chain peptide. Cancer Res 60:6427-6433.
[0287] 21. van Tienhoven, E. A., C. T. ten Brink, J. van Bergen, F. Koning, W. van Eden, and C. P. Broeren. 2001. Induction of antigen specific CD4+ T cell responses by invariant chain based DNA vaccines. Vaccine 19:1515-1519.
[0288] In certain embodiments, the CLIP region of Ii is replaced with a T cell epitope, e.g,. a CD4+ T cell epitope, such as a promiscuous CD4+ T cell epitope, with the proviso that the resulting construct is not one that has been publicly disclosed previously, e.g., one year prior to the filing of the priority application of the instant application. For example, in certain embodiments, the epitope that replaces the CLIP region is not a promiscuous CD4+ T cell epitope from an HCV antigen, Listeria LLO antigen, ovalbumin antigen, Japanese cedar pollen allergen, MuLV env/gp70-derived helper epitope, and Heat Shock Protein 60 (described in references 16-21 above), or epitopes replacing CLIP regions that are described in publications that are referenced to in the Examples.
[0289] In certain embodiments, a nucleic acid comprises, consists essentially of, or consists of the nucleotide sequence set forth in SEQ ID NO:90, or comprises a nucleotide sequence sequence encoding the PADRE or Ii portion thereof. A nucleic acid may also comprise a nucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:90 and/or to the PADRE and/or to the Ii portion thereof. Nucleic acids may differ by the addition, deletion or substitution of one or more, e.g., 1, 3, 5, 10, 15, 20, 25, 30 or more nucleotides, which may be located at the 5 end, 3 end, and/or internally to the sequence.
[0290] In certain embodiments, a nucleic acid encodes a protein that is a functional homolog of an Ii-PADRE protein, with the proviso that the Ii sequence and/or PADRE sequence is (or are) not the wild-type or a naturally-occurring sequence, e.g., the wild-type or naturally-occurring human sequence.
[0291] In another embodiment, an MHC class I/II activator is a protein that enhances MHC class II expression, e.g., an MHC class II transactivator (CIITA). The nucleotide and amino acid sequences of human CIITA are set forth as GenBank Accession Nos. P33076, NM_000246.3 and NP_000237.2 and set forth as SEQ ID NOs:94 and 95, respectively (GeneID: 4261)).
[0292] Variants of the protein may also be used. Exemplary variants comprise, consist essentially of, or consist of an amino acid sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:95. An amino acid sequence may differ from that of SEQ ID NO:95 by the addition, deletion or substitution of at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30 or more amino acids. In certain embodiments, a protein lacks one or more, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acids at the C- and/or N-terminus and/or internally relative to that of SEQ ID NO:95. The locations at which mino acid changes (i.e., deletions, additions or substitutions) may be made may be determined by comparing, i.e., aligning, the amino acid sequences of CIITA homologues, e.g., those from various animal species.
[0293] Exemplary amino acids that may be changed include S286, S288 and S293. Indeed, as described in Greer et al., mutation of these amino acids results in a stronger transactivation function relative to the wild-type protein. Changes are preferably not made in the guanine-nucleotide binding motifs within residues 420-561, as these appear to be necessary for CIITA activity (see Chin et al. (1997) PNAS 94:2501). Amino acids 59-94 have also been shown to be necessary for CIITA activity, as further described herein. Additional structure/function data are provided, e.g., in Chin et al., supra.
[0294] In certain embodiments, a nucleic acid comprises, consists essentially of, or consists of the nucleotide sequence set forth in SEQ ID NO:94. A nucleic acid may also comprise a nucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:94. Nucleic acids may differ by the addition, deletion or substitution of one or more, e.g., 1, 3, 5, 10, 15, 20, 25, 30 or more nucleotides, which may be located at the 5 end, 3 end, and/or internally to the sequence.
[0295] In certain embodiments, a nucleic acid encodes a protein that is a functional homolog of a CIITA protein, with the proviso that the sequence is not the wild-type or a naturally-occurring sequence, e.g., the wild-type or naturally-occurring human sequence.
[0296] Other nucleic acids encoding MHC class I/II activators that may be used include those that hybridize, e.g., under stringent hybridization conditions to a nucleic acid encoding an MHC class I/II activator described herein, e.g., consisting of SEQ ID NO:90 or 94 or portions thereof. Hybridization conditions are further described herein.
[0297] Nucleic acids encoding an MHC class I/II activator may be included in plasmids or expression vectors, such as those further described herein in the context of DNA vaccines.
[0298] In one embodiment, a nucleic acid encoding an Ii-PADRE protein or functional homolog thereof is administered to a subject who is also receiving a nucleic acid encoding a CIITA protein or functional homolog thereof. The nucleic acids may be administered simultaneously or consecutively. The nucleic acids may also be linked, i.e., forming one nucleic acid molecule. For example, one or more nucleotide sequences encoding an Ii-PADRE protein or a functional variant thereof; one or more nucleotide sequences encoding an antigen or a fusion protein comprising an antigen; one or more nucleotide sequences encoding a CIITA protein of a functional variant thereof may be linked to each other, i.e., present on one nucleic acid molecule.
Chemotherapeutic Drugs/Agents
[0299] Drugs may also further be administered to a mammal in accordance with the methods and compositions taught herein. Generally, any drug that reduces the growth of cells without significantly affecting the immune system may be used, or at least not suppressing the immune system to the extent of eliminating the positive effects of a DNA vaccine that is administered to the subject. In one embodiment, the drugs are chemotherapeutic drugs.
[0300] A wide variety of chemotherapeutic drugs may be used, provided that the drug stimulates the effect of a vaccine, e.g., DNA vaccine. In certain embodiments, a chemotherapeutic drug may be a drug that (a) induces apoptosis of cells, in particular, cancer cells, when contacted therewith; (b) reduces tumor burden; and/or (c) enhances CD8+ T cell-mediated antitumor immunity. In certain embodiments, the drug must also be one that does not inhibit the immune system, or at least not at certain concentrations.
[0301] In one embodiment, the chemotherapeutic drug is epigallocatechin-3-gallate (EGCG) or a chemical derivative or pharmaceutically acceptable salt thereof. Epigallocatechin gallate (EGCG) is the major polyphenol component found in green tea. EGCG has demonstrated antitumor effects in various human and animal models, including cancers of the breast, prostate, stomach, esophagus, colon, pancreas, skin, lung, and other sites. EGCG has been shown to act on different pathways to regulate cancer cell growth, survival, angiogenesis and metastasis. For example, some studies suggest that EGCG protects against cancer by causing cell cycle arrest and inducing apoptosis. It is also reported that telomerase inhibition might be one of the major mechanisms underlying the anticancer effects of EGCG. In comparison with commonly-used antitumor agents, including retinoids and doxorubicin, EGCG has a relatively low toxicity and is convenient to administer due to its oral bioavailability. Thus, EGCG has been used in clinical trials and appears to be a potentially ideal antitumor agent.
[0302] Exemplary analogs or derivatives of EGCG include (?)-EGCG, (+)-EGCG, (?)-EGCG-amide, (?)-GCG, (+)-GCG, (+)-EGCG-amide, (?)-ECG, (?)-CG, genistein, GTP-1, GTP-2, GTP-3, GTP-4, GTP-5, Bn-(+)-epigallocatechin gallate (U.S. 2004/0186167, incorporated by reference), and dideoxy-epigallocatechin gallate (Furuta, et al., Bioorg. Med. Chem. Letters, 2007, 11: 3095-3098), For additional examples, see U.S. 2004/0186167 (incorporated by reference in its entirety); Waleh, et al., Anticancer Res., 2005, 25: 397-402; Wai, et al., Bioorg. Med. Chem., 2004, 12: 5587-5593; Smith, et al.,
[0303] Proteins: Struc. Func. & Bioinform., 2003, 54: 58-70; US 7,109,236 (incorporated by reference in its entirety); Landis-Piwowar, et al., Int. J. Mol. Med., 2005, 15: 735-742; Landis-Piwowar, et al., J. Cell. Phys., 2007, 213: 252-260; Daniel, et al., Int. J. Mol. Med., 2006, 18: 625-632; Tanaka, et al., Ang. Chemie Int., 2007, 46: 5934-5937.
[0304] Another chemotherapeutic drug that may be used is (a) 5,6 di-methylxanthenone-4-acetic acid (DMXAA), or a chemical derivative or analog thereof or a pharmaceutically acceptable salt thereof. Exemplary analogs or derivatives include xanthenone-4-acetic acid, flavone-8-acetic acid, xanthen-9-one-4-acetic acid, methyl (2,2-dimethyl-6-oxo-1,2-dihydro-6H-3,11-dioxacyclopenta[?]anthracen-10-yl)acetate, methyl (2-methyl-6-oxo-1,2-dihydro-6H-3,11-dioxacyclopenta[?]anthracen-10-yl)acetate, methyl (3,3-dimethyl-7-oxo-3H,7H-4,12-dioxabenzo[?]anthracen-10-yl)acetate, methyl-6-alkyloxyxanthen-9-one-4-acetates (Gobbi, et al., 2002, J. Med. Chem., 45: 4931) or a . For additional examples, see WO 2007/023302 A1, WO 2007/023307 A1, U.S. 2006/9505, WO 2004/39363 A1, WO 2003/80044 A1, AU 2003/217035 A1, and AU 2003/282215 A1, each incorporated by reference in their entirety.
[0305] A chemotherapeutic drug may also be cisplatin, or a chemical derivative or analog thereof or a pharmaceutically acceptable salt thereof. Exemplary analogs or derivatives include dichloro[4,4-bis(4,4,4-trifluorobutyl)-2,2-bipyridine]platinum (Kyler et al., Bioorganic & Medicinal Chemistry, 2006, 14: 8692-8700), cis-[Rh2(-O2CCH3)2(CH3CN)6]2+ (Lutterman et al., J. Am. Chem. Soc., 2006, 128: 738 -739), (+)-cis-(1,1-Cyclobutanedicarboxylato)((2R)-2-methyl-1,4-butanediamine-N,N)platinum (O'Brien et al., Cancer Res., 1992, 52: 4130-4134), cis-bisneodecanoato-trans-R,R-1,2-diaminocyclohexane platinum(II) (Lu et al., J. of Clin. Oncol., 2005, 23: 3495-3501), carboplatin (Woloschuk, Drug Intell. Clin. Pharm., 1988, 22: 843-849), sebriplatin (Kanazawa et al., Head & Neck, 2006, 14: 38-43), satraplatin (Amorino et al., Cancer Chemother. and Pharmacol., 2000, 46: 423-426), azane (dichloroplatinum) (CID: 11961987), azanide (CID: 6712951), platinol (CID: 5702198), lopac-P-4394 (CID: 5460033), MOLI001226 (CID: 450696), trichloroplatinum (CID: 420479), platinate(1-), amminetrichloro-, ammonium (CID: 160995), triammineplatinum (CID: 119232), biocisplatinum (CID: 84691), platiblastin (CID: 2767) and pharmaceutically acceptable salts thereof. For additional examples, see U.S. Pat. No. 5,922,689, U.S. Pat. No. 4,996,337, U.S. Pat. No. 4,937,358, U.S. Pat. No. 4,808,730, U.S. Pat. No. 6,130,245, U.S. Pat. No. 7,232,919, and U.S. Pat. No. 7,038,071, each incorporated by reference in their entirety.
[0306] Another chemotherapeutic drug that may be used is apigenin, or a chemical derivative or analog thereof or a pharmaceutically acceptable salt thereof. Exemplary analogs or derivatives include acacetin, chrysin, kampherol, luteolin, myricetin, naringenin, quercetin (Wang et al., Nutrition and Cancer, 2004, 48: 106-114), puerarin (U.S. 2006/0276458, incorporated by reference in its entirety) and pharmaceutically acceptable salts thereof. For additional examples, see U.S. 2006/189680 A1, incorporated by reference in its entirety).
[0307] Another chemotherapeutic drug that may be used is doxorubicin, or a chemical derivative or analog thereof or a pharmaceutically acceptable salt thereof. Exemplary analogs or derivatives include anthracyclines, 3-deamino-3-(3-cyano-4-morpholinyl)doxorubicin, WP744 (Faderl, et al., Cancer Res., 2001, 21: 3777-3784), annamycin (Zou, et al., Cancer Chemother. Pharmacol., 1993, 32:190-196), 5-imino-daunorubicin, 2-pyrrolinodoxorubicin, DA-125 (Lim, et al., Cancer Chemother. Pharmacol., 1997, 40: 23-30), 4-demethoxy-4-O-methyldoxorubicin, PNU 152243 and pharmaceutically acceptable salts thereof (Yuan, et al., Anti-Cancer Drugs, 2004, 15: 641-646). For additional examples, see EP 1242438 B1, U.S. Pat. No. 6,630,579, AU 2001/29066 B2, U.S. Pat. No. 4,826,964, U.S. Pat. No. 4,672,057, U.S. Pat. No. 4,314,054, AU 2002/358298 A1, and U.S. Pat. No. 4,301,277, each incorporated by reference in their entirety);
[0308] Other chemotherapeutic drugs that may be used are anti-death receptor 5 antibodies and binding proteins, and their derivatives, including antibody fragments, single-chain antibodies (scFvs), Avimers, chimeric antibodies, humanized antibodies, human antibodies and peptides binding death receptor 5. For examples, see U.S. 2007/31414 and U.S. 2006/269554, each incorporated by reference in their entirety.
[0309] Another chemotherapeutic drug that may be used is bortezomib, or a chemical derivative or analog thereof or a pharmaceutically acceptable salt thereof. Exemplary analogs or derivatives include MLN-273 and pharmaceutically acceptable salts thereof (Witola, et al., Eukaryotic Cell, 2007, doi:10.1128/EC.00229-07). For additional possibilities, see Groll, et al., Structure, 14:451.
[0310] Another chemotherapeutic drug that may be used is 5-aza-2-deoxycytidine, or a chemical derivative or analog thereof or a pharmaceutically acceptable salt thereof. Exemplary analogs or derivatives include other deoxycytidine derivatives and other nucleotide derivatives, such as deoxyadenine derivatives, deoxyguanine derivatives, deoxythymidine derivatives and pharmaceutically acceptable salts thereof.
[0311] Another chemotherapeutic drug that may be used is genistein, or a chemical derivative or analog thereof or a pharmaceutically acceptable salt thereof. Exemplary analogs or derivatives include 7-0-modified genistein derivatives (Zhang, et al., Chem. & Biodiv., 2007, 4: 248-255), 4,5,7-tri[3-(2-hydroxyethylthio)propoxy]isoflavone, genistein glycosides (Polkowski, Cancer Letters, 2004, 203: 59-69), other genistein derivatives (Li, et al., Chem & Biodiv., 2006, 4: 463-472; Sarkar, et al., Mini. Rev. Med. Chem., 2006, 6: 401-407) or pharmaceutically acceptable salts thereof. For additional examples, see U.S. Pat. No. 6,541,613, U.S. Pat. No. 6,958,156, and WO/2002/081491, each incorporated by reference in their entirety.
[0312] Another chemotherapeutic drug that may be used is celecoxib, or a chemical derivative or analog thereof or a pharmaceutically acceptable salt thereof. Exemplary analogs or derivatives include N-(2-aminoethyl)-4-[5-(4-tolyl)-3-(trifluoromethyl)-1H-pyrazol-1-yl]benzenesulfonamide, 4-[5-(4-aminophenyl)-3-(trifluoromethyl)-1H-pyrazol-1-yl]benzenesulfonamide, OSU03012 (Johnson, et al., Blood, 2005, 105: 2504-2509), OSU03013 (Tong, et. al, Lung Cancer, 2006, 52: 117-124), dimethyl celecoxib (Backhus, et al., J. Thorac. and Cardiovasc. Surg., 2005, 130: 1406-1412), and other derivatives or pharmaceutically acceptable salts thereof (Ding, et al., Int. J. Cancer, 2005, 113: 803-810; Zhu, et al., Cancer Res., 2004, 64: 4309-4318; Song, et al., J. Natl. Cancer Inst., 2002, 94: 585-591). For additional examples, see US 7026346, incorporated by reference in its entirety.
[0313] One of skill in the art will readily recognize that other chemotherapeutics can be used with the methods disclosed in the present invention, including proteasome inhibitors (in addition to bortezomib) and inhibitors of DNA methylation. Other drugs that may be used include Paclitaxel; selenium compounds; SN38, etoposide, 5-Fluorouracil; VP-16, cox-2 inhibitors, Vioxx, cyclooxygenase-2 inhibitors, curcumin, MPC-6827 , tamoxifen or flutamide, etoposide, PG490, 2-methoxyestradiol, AEE-788, aglycon protopanaxadiol, aplidine, ARQ-501, arsenic trioxide, BMS-387032, canertinib dihydrochloride, canfosfamide hydrochloride, combretastatin A-4 prodrug, idronoxil, indisulam, INGN-201, mapatumumab, motexafin gadolinium, oblimersen sodium, OGX-011, patupilone, PXD-101, rubitecan, tipifarnib, trabectedin PXD-101, methotrexate, Zerumbone, camptothecin, MG-98, VX-680, Ceflatonin, Oblimersen sodium, motexafin gadolinium, 1D09C3, PCK-3145, ME-2 and apoptosis-inducing-ligand (TRAIL/Apo-2 ligand). Others are provided in a report entitled competitive outlook on apoptosis in oncology, December 2006, published by Bioseeker, and available, e.g., at http://bizwiz.bioseeker.com/bw/Archives/Files/TOC_BSG0612193.pdf.
[0314] Generally, any drug that affects an apoptosis target may also be used. Apoptosis targets include the tumour-necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL) receptors, the BCL2 family of anti-apoptotic proteins (such as Bcl-2), inhibitor of apoptosis (IAP) proteins, MDM2, p53, TRAIL and caspases. Exemplary targets include B-cell CLL/lymphoma 2, Caspase 3, CD4 molecule, Cytosolic ovarian carcinoma antigen 1, Eukaryotic translation elongation factor 2, Farnesyltransferase, CAAX box, alpha; Fc fragment of IgE; Histone deacetylase 1;Histone deacetylase 2; Interleukin 13 receptor, alpha 1; Phosphodiesterase 2A, cGMP-stimulatedPhosphodiesterase 5A, cGMP-specific; Protein kinase C, beta 1 ;Steroid 5-alpha-reductase, alpha polypeptide 1; 8.1.15 Topoisomerase (DNA) I; Topoisomerase (DNA) II alpha; Tubulin, beta polypeptide; and p53 protein.
[0315] In certain embodiments, the compounds described herein, e.g., EGCG, are naturally-occurring and may, e.g., be isolated from nature. Accordingly, in certain embodiments, a compound is used in an isolated or purified form, i.e., it is not in a form in which it is naturally occurring. For example, an isolated compound may contain less than about 50%, 30%, 10%, 1%, 0.1% or 0.01% of a molecule that is associated with the compound in nature. A purified preparation of a compound may comprise at least about 50%, 70%, 80%, 90%, 95%, 97%, 98% or 99% of the compound, by molecule number or by weight. Compositions may comprise, consist essentially of consist of one or more compounds described herein. Some compounds that are naturally occurring may also be synthesized in a laboratory and may be referred to as synthetic. Yet other compounds described herein are non-naturally occurring.
[0316] In certain embodiments, the chemotherapeutic drug is in a preparation from a natural source, e.g., a preparation from green tea.
[0317] Pharmaceutical compositions comprising 1, 2, 3, 4, 5 or more chemotherapeutic drugs or pharmaceutically acceptable salts thereof are also provided herein. A pharmaceutical composition may comprise a pharmaceutically acceptable carrier. A composition, e.g., a pharmaceutical composition, may also comprise a vaccine, e.g., a DNA vaccine, and optionally 1, 2, 3, 4, 5 or more vectors, e.g., other DNA vaccines or other constructs, e.g., described herein.
[0318] Compounds may be provided with a pharmaceutically acceptable salt. The term pharmaceutically acceptable salts is art-recognized, and includes relatively non-toxic, inorganic and organic acid addition salts of compositions, including without limitation, therapeutic agents, excipients, other materials and the like. Examples of pharmaceutically acceptable salts include those derived from mineral acids, such as hydrochloric acid and sulfuric acid, and those derived from organic acids, such as ethanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, and the like. Examples of suitable inorganic bases for the formation of salts include the hydroxides, carbonates, and bicarbonates of ammonia, sodium, lithium, potassium, calcium, magnesium, aluminum, zinc and the like. Salts may also be formed with suitable organic bases, including those that are non-toxic and strong enough to form such salts. For purposes of illustration, the class of such organic bases may include mono-, di-, and trialkylamines, such as methylamine, dimethylamine, and triethylamine; mono-, di- or trihydroxyalkylamines such as mono-, di-, and triethanolamine; amino acids, such as arginine and lysine; guanidine; N-methylglucosamine; N-methylglucamine; L-glutamine; N-methylpiperazine; morpholine; ethylenediamine; N-benzylphenethylamine; (trihydroxymethyl)aminoethane; and the like. See, for example, J. Pharm. Sci., 66:1-19 (1977).
[0319] Also provided herein are compositions and kits comprising one or more DNA vaccines and one or more chemotherapeutic drugs, and optionally one or more other constructs described herein.
Therapeutic Compositions and Their Administration
[0320] The methods of the present invention can be practiced by administering annexin chimeric fusion proteins described herein alone or in a pharmaceutically acceptable carrier in a biologically-effective and/or a therapeutically-effective amount. The annexin chimeric fusion protein may comprise Annexin V fused to an immunogenic peptide such as ovalbumin (OVA), HPV16 E6, HPV16 E7, modified colon carcinoma antigen AH5, and influenza antigen M1. The annexin chimeric fusion protein may be used in combination with chemotherapy, wherein a chemotherapeutic agent, such as cisplatin, is administered.
[0321] Certain conditions as described herein are disclosed in the Examples. The composition may be given alone or in combination with another protein or peptide such as an immunostimulatory molecule. Treatment may include administration of an adjuvant, used in its broadest sense to include any nonspecific immune stimulating compound such as an interferon. Adjuvants contemplated herein include resorcinols, non-ionic surfactants such as polyoxyethylene oleyl ether and n-hexadecyl polyethylene ether.
[0322] A therapeutically effective amount is a dosage that, when given for an effective period of time, achieves the desired immunological or clinical effect.
[0323] A therapeutically active amount of an annexin chimeric fusion protein may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the fusion protein to elicit a desired response in the individual. Dosage regimes may be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation. A therapeutically effective amount of the protein, in cell associated form may be stated in terms of the protein or cell equivalents.
[0324] Thus an effective amount of an annexin chimeric fusion protein may be between about 1 nanogram and about 1 gram per kilogram of body weight of the recipient, between about 0.1 ?g/kg and about 10mg/kg, between about 1 ?g/kg and about 1 mg/kg. Dosage forms suitable for internal administration may contain (for the latter dose range) from about 0.1 ?g to 100 ?g of active ingredient per unit. The active ingredient may vary from 0.5 to 95% by weight based on the total weight of the composition. Those skilled in the art of immunotherapy will be able to adjust these doses without undue experimentation.
[0325] The annexin chimeric fusion protein may be packaged into retrovirus vectors using packaging cell lines that produce replication-defective retroviruses, as is well-known in the art (e.g., Cone, R. D. et al., Proc Natl Acad Sci USA 81:6349-53, 1984; Mann, R F et al., Cell 33:153-9, 1983; Miller, A D et al., Molec Cell Biol 5:431-7, 1985; Sorge, J, et al., Molec Cell Biol 4:1730-7, 1984; Hock, R A et al., Nature 320:257, 1986; Miller, A D et al., Molec Cell Biol 6:2895-2902 (1986). Newer packaging cell lines which are efficient an safe for gene transfer have also been described (Bank et al., U.S. Pat. No. 5,278,056, incorporated by reference).
[0326] The above approach can be utilized in a site specific manner to deliver the retroviral vector to the tissue or organ of choice. Thus, for example, a catheter delivery system can be used (Nabel, E G et al., Science 244:1342 (1989)). Such methods, using either a retroviral vector or a liposome vector, are particularly useful to deliver the annexin chimeric fusion protein to a blood vessel wall, or into the blood circulation of a tumor.
[0327] Other pharmaceutically acceptable carriers for the annexin chimeric fusion protein according to the present invention are liposomes, pharmaceutical compositions in which the active protein is contained either dispersed or variously present in corpuscles consisting of aqueous concentric layers adherent to lipidic layers. The active protein may be present in the aqueous layer and in the lipidic layer, inside or outside, or, in any event, in the non-homogeneous system generally known as a liposomic suspension. The hydrophobic layer, or lipidic layer, generally, but not exclusively, comprises phospholipids such as lecithin and sphingomyelin, steroids such as cholesterol, more or less ionic surface active substances such as dicetylphosphate, stearylamine or phosphatidic acid, and/or other materials of a hydrophobic nature. Those skilled in the art will appreciate other suitable embodiments of the present liposomal formulations.
[0328] Embodiments disclosed herein also relate to methods of administering an annexin chimeric fusion protein described herein to a subject in order to contact in vivo cells with such compositions. The routes of administration can vary with the location and nature of the cells to be contacted, and include, e.g., intravascular, intradermal, transdermal, parenteral, intravenous, intramuscular, intranasal, subcutaneous, regional, percutaneous, intratracheal, intraperitoneal, intraarterial, intravesical, intratumoral, inhalation, perfusion, lavage, direct injection, and oral administration and formulation. In other embodiments, the routes of administration of the fusion protein may include (a) intratumoral, peritumoral, and/or intradermal delivery, (b) intramuscularly (i.m.) injection using a conventional syringe needle; and (c) use of a needle-free biojector such as the Biojector 2000 (Bioject Inc., Portland, Oreg.) which is an injection device consisting of an injector and a disposable syringe. The orifice size controls the depth of penetration.
[0329] The term systemic administration refers to administration of an annexin chimeric fusion protein or chemotherapeutic agent as described herein, in a manner that results in the introduction of the composition into the subject's circulatory system or otherwise permits its spread throughout the body. Regional administration refers to administration into a specific, and somewhat more limited, anatomical space, such as intraperitoneal, intrathecal, subdural, or to a specific organ. Local administration refers to administration of a composition or drug into a limited, or circumscribed, anatomic space, such as intratumoral injection into a tumor mass, subcutaneous injections, intradermal or intramuscular injections. Those of skill in the art will understand that local administration or regional administration may also result in entry of a composition into the circulatory system i.e., rendering it systemic to one degree or another. For example, the term intravascular is understood to refer to delivery into the vasculature of a patient, meaning into, within, or in a vessel or vessels of the patient, whether for systemic, regional, and/or local administration. In certain embodiments, the administration can be into a vessel considered to be a vein (intravenous), while in others administration can be into a vessel considered to be an artery. Veins include, but are not limited to, the internal jugular vein, a peripheral vein, a coronary vein, a hepatic vein, the portal vein, great saphenous vein, the pulmonary vein, superior vena cava, inferior vena cava, a gastric vein, a splenic vein, inferior mesenteric vein, superior mesenteric vein, cephalic vein, and/or femoral vein. Arteries include, but are not limited to, coronary artery, pulmonary artery, brachial artery, internal carotid artery, aortic arch, femoral artery, peripheral artery, and/or ciliary artery. It is contemplated that delivery may be through or to an arteriole or capillary.
[0330] Injection into the tumor vasculature is specifically contemplated for discrete, solid, accessible tumors. Local, regional or systemic administration also may be appropriate. For tumors of greater than about 4 cm, the volume to be administered can be about 4-10 ml (preferably 10 ml), while for tumors of less than about 4 cm, a volume of about 1-3 ml can be used (preferably 3 ml). Multiple injections delivered as single dose comprise about 0.1 to about 0.5 ml volumes. The annexin chimeric fusion protein may advantageously be contacted by administering multiple injections to the tumor, spaced at approximately 1 cm intervals.
[0331] Continuous administration also may be applied where appropriate. Such continuous administration, such as intravenous injection, may take place for a period of 9 days with periodic injections every 3 days. Generally, the dose of the therapeutic composition via continuous administration will be equivalent to that given by a single or multiple injections, adjusted over a period of time during which the treatment occurs. Other routes of administration include oral, intranasal or rectal or any other route known in the art.
[0332] Depending on the route of administration, the annexin chimeric fusion protein may be coated in a material to protect the compound from the action of enzymes, acids and other natural conditions which may inactivate the compound. Thus it may be necessary to coat the composition with, or co-administer the composition with, a material to prevent its inactivation. For example, an enzyme inhibitors of nucleases or proteases (e.g., pancreatic trypsin inhibitor, diisopropylfluorophosphate and trasylol) or in an appropriate carrier such as liposomes (including water-in-oil-in-water emulsions as well as conventional liposomes (Strejan et al., J. Neuroimmunol 7:27, 1984).
[0333] A chemotherapeutic drug may be administered in doses that are similar to the doses that the chemotherapeutic drug is used to be administered for cancer therapy.
[0334] Alternatively, it may be possible to use lower doses, e.g., doses that are lower by 10%, 30%, 50%, or 2, 5, or 10 fold lower. Generally, the dose of chemotherapeutic agent is a dose that is effective to increase the effectiveness of the annexin chimeric fusion protein, but less than a dose that results in significant immunosuppression or immunosuppression that essentially cancels out the effect of the annexin chimeric fusion protein.
[0335] The route of administration of chemotherapeutic drugs may depend on the drug. For use in the methods described herein, a chemotherapeutic drug may be used as it is commonly used in known methods. Generally, the drugs will be administered orally or they may be injected. The regimen of administration of the drugs may be the same as it is commonly used in known methods. For example, certain drugs are administered one time, other drugs are administered every third day for a set period of time, yet other drugs are administered every other day or every third, fourth, fifth, sixth day or weekly. The Examples provide exemplary regimens for administrating the drugs, as well as an annexin chimeric fusion protein. In certain embodiments, the chemotherapeutic drug/agent is cisplatin. The cisplatin is administered via intraperitoneal injection two times at a three day interval. The intraperitoneal injection of the cisplatin may be spread out over a period of 1 week, 2 weeks, 3 weeks, 4 weeks or longer. Likewise, the cisplatin can be repeated administered over a 1 day, 2 day, 3 day, 4 day, or more intereval.
[0336] The compositions of the present invention, may be administered simultaneously or subsequently. When administered simultaneously, the different components may be administered as one composition. Accordingly, also provided herein are compositions, e.g., pharmaceutical compositions comprising one or more agents.
[0337] In one embodiment, a subject first receives one or more doses of chemotherapeutic drug and then one or more doses of the annexin chimeric fusion protein. One may administer 1, 2, 3, 4, 5 or more doses of chemotherapeutic agent and 1, 2, 3, 4, 5 or more doses of annexin chimeric fusion protein.
[0338] A method may further comprise subjecting a subject to another cancer treatment, e.g., radiotherapy, an anti-angiogenesis agent and/or a hydrogel-based system.
[0339] As used herein pharmaceutically acceptable carrier includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the therapeutic compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions.
[0340] Pharmaceutically acceptable diluents include saline and aqueous buffer solutions. Pharmaceutical compositions suitable for injection include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. Isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, sodium chloride may be included in the pharmaceutical composition. In all cases, the composition should be sterile and should be fluid. It should be stable under the conditions of manufacture and storage and must include preservatives that prevent contamination with microorganisms such as bacteria and fungi. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations may contain a preservative to prevent the growth of microorganisms.
[0341] The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
[0342] Prevention of the action of microorganisms in the pharmaceutical composition can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like.
[0343] Compositions may be formulated in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form refers to physically discrete units suited as unitary dosages for a mammalian subject; each unit contains a predetermined quantity of active material (e.g., annexin chimeric fusion protein) calculated to produce the desired therapeutic effect, in association with the required pharmaceutical carrier. The specification for the dosage unit forms of the invention are dictated by and directly dependent on (a) the unique characteristics of the active material and the particular therapeutic effect to be achieved, and (b) the limitations inherent in the art of compounding such an active compound for the treatment of, and sensitivity of, individual subjects.
[0344] For lung instillation, aerosolized solutions are used. In a sprayable aerosol preparations, the active protein may be in combination with a solid or liquid inert carrier material. This may also be packaged in a squeeze bottle or in admixture with a pressurized volatile, normally gaseous propellant. The aerosol preparations can contain solvents, buffers, surfactants, and antioxidants in addition to the protein of the invention.
[0345] Diseases that may be treated as described herein include hyper proliferative diseases, e.g., cancer, whether localized or having metastasized. Exemplary cancers include head and neck cancers and cervical cancer. Any cancer can be treated provided that there is a tumor associated antigen that is associated with the particular cancer. Other cancers include skin cancer, lung cancer, colon cancer, kidney cancer, breast cancer, prostate cancer, pancreatic cancer, bone cancer, ovarian cancer, brain cancer, as well as blood cancers, e.g., myeloma, leukemia and lymphoma. Generally, any cell growth can be treated provided that there is an antigen associated with the cell growth, which antigen or homolog thereof can be fused to annexin V.
[0346] Treating a subject includes curing a subject or improving at least one symptom of the disease or preventing or reducing the likelihood of the disease to return. For example, treating a subject having cancer could be reducing the tumor mass of a subject, e.g., by about 10%, 30%, 50%, 75%, 90% or more, eliminating the tumor, preventing or reducing the likelihood of the tumor to return, or partial or complete remission.
[0347] All references cited herein are all incorporated by reference herein, in their entirety, whether specifically incorporated or not. All publications, patents, patent applications, GenBank sequences and ATCC deposits, cited herein are hereby expressly incorporated by reference for all purposes. In particular, all nucleotide sequences, amino acid sequences, nucleic constructs, DNA vaccines, methods of administration, particular orders of administration of DNA vaccines and agents that are described in the patents, patent applications and other publications referred to herein or authored by one or more of the inventors of this application are specifically incorporated by reference herein. In case of conflict, the definitions within the instant application govern.
[0348] Having now fully described this invention, it will be appreciated by those skilled in the art that the same can be performed within a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation.
[0349] The present description is further illustrated by the following examples, which should not be construed as limiting in any way.
EXAMPLES
Example 1
Material and Methods For Examples 2-7
A. Mice
[0350] Six- to eight-week-old female C57BL/6 and BALB/c mice were purchased from the National Cancer Institute (Frederick, Md.). All animal procedures were performed according to approved protocols and in accordance with recommendations for the proper use and care of laboratory animals.
B. Cells
[0351] TC-1 cells, which are an E7-expressing murine tumor model, were obtained by co-transformation of primary C57BL/6 mouse lung epithelial cells with HPV-16 E6 and E7 and an activated ras oncogene as previously described. CT 26 murine colon carcinoma cells, PancO2 murine pancreatic cancer cells and OVCAR3 human ovarian cancer cells were purchased from ATCC. The HLA-A2-restricted influenza M1 peptide-specific CD8+ T cell line was generated using splenocytes from HLA-A2 (AAD) transgenic mice vaccinated with DNA encoding single chain trimer (SCT) encoding HLA-A2 linked to influenza M1 peptide using methods similar to what was described previously (11). E7 (aa49-57)-specific T cell line (12), OVA-specific T cell line (13) have also been previously described. These cell lines were cultured in vitro in PRMI10 (RPMI 1640 supplemented with 10% fetal bovine serum, 50 units/ml of penicillin/streptomycin, 2 mM L-glutamine, 1 mM sodium pyruvate, and 2 mM non-essential amino acids) and grown at 37? C. with 5% CO.sub.2. Luciferase expressing TC-1 and OVCAR3 cells were generated by same methods above described.
C. Plasmid DNA Constructs and Preparation
[0352] pET28 (pET28-annV, annV-E7 and other constructs) plasmids, which were identified by sequencing, were transformed into the Escherichia coli BL21(DE3) strain. The selected colony was cultured in 5 mL Luria-Bertani (LB) liquid medium containing kanamycin (25 ?g/mL) and grown overnight at 37? C. on a shaking incubator, then transferred to 200 mL of fresh medium (with the antibiotic) and incubated for another 2 hours until the optical density of the cultured cells reached around 0.6 (OD 600). Expression of the fusion protein was induced with 1 mM isopropyl-b-D-thiogalactopyranoside (IPTG) at 37? C. for 5 h. The cultured cells were harvested by centrifugation at 6,000 rpm for 10 min at 4? C. The pellet was washed with phosphate buffered saline (PBS) 2 times and then suspended in bacteria lysis buffer (SoluLyse Reagent for Bacteria, Genlantis) containing lysozyme (100 ?g/ml) (Gibco BRL) and deoxynuclease (Dnase) I (100 U/ml) (Invitrogen). The suspension was incubated for 2 hours at room temperature with stirring. The suspension was centrifuged at 12,000 rpm for 15 min. The clear supernatant (soluble fraction) was collected and recombinant protein was purified by Ni.sup.+ affinity chromatography (Ni-NTA agarose, Qiagen) according to the manufacturer's protocol. In briefly, cell supernatant was loaded in 2 ml of Ni.sup.+ affinity chromatography that is equilibrated with washing buffer (50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, and 20 mM imidazole, pH 8.0) and then washed with 20 ml washing buffer. For the elution of binding protein, 10 ml of elution buffer (50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, and 250 mM imidazole, pH 8.0) was used. The eluted protein was collected and analyzed using 10-15% gradient SDS-PAGE and Coomassie brilliant blue staining. The purity of proteins was characterized by limulus amoebocyte lysate (LAL) (Lonza) and Picogreen assays (Invitrogen). The endotoxin level of each protein was less than 25.0 EU/mg, and the bacterial DNA level was 8.6 ng/mg of protein in independent preparations.
D. In Vivo Tumor Treatment Experiments
[0353] For in vivo tumor treatment experiment using only protein, 1?10.sup.5 TC-1 cells were injected subcutaneously into C57BL/6 mice (10 per group). After 3 days, 100 ?g of each protein was injected intravenously three times with 3 day intervals. Mice were monitored for tumor growth by palpation and inspection twice a week. For in vivo combined tumor treatment experiments, 1?10.sup.5 TC-1 cells or 5?10.sup.5 CT 26 cells were subcutaneously injected into C57BL/6 mice (10 per group) or BALB/c mice. After 5 days, cisplatin (5 mg/kg) or saline (control) was intraperitoneally injected two times at a 3 day interval. 6 days after tumor challenge, mice received 100 ?g of protein each, intravenously injected three times with 3 day intervals. Mice were monitored for tumor growth by palpation and inspection twice a week. 5?10.sup.6PancO2 cells were injected into C57BL/6 mice (10 per group) and after 25 days, cisplatin and protein treatment was initiated using the same methods mentioned above.
E. Tetramer Staining, Intracellular Cytokine Staining and Flow Cytometry Analysis
[0354] Each mouse was treated as mentioned above In vivo tumor treatment experiments section. For tetramer staining, peripheral blood mononuclear cells (PBMCs) and tumor tissues were harvested 1 week after the last protein injection. PBMCs were prepared as described previously and tumor tissues were obtained from mice and cut into fragments in PBS, washed twice, and then digested with 500 U/ml of Dispase (Godo Shusei, Co., Ltd. Tokyo) at 37? C. for 20 min. The supernatants of the first digestion were discarded. The remaining fragments were suspended in 5 ml of PBS and then extensively pipetted with a Pasteur pipet to obtain free cell suspensions. The cell suspensions were passed through a stainless wire sieve and washed twice with 20 ml of PBS by centrifugation for 5 min at 150?g. Sedimented cells were resuspended in the PBS and used for staining. Phycoerythrin (PE)-labeled H-2D.sup.b HPV16 E7 (RAHYNIVTF) and H-2K.sup.b OVA (SIINFEKL) tetramer reagents were purchased from Beckman Coulter (Hialeah, FL) and were used for the fluorescence-activated cell sorter analysis of peptide-specific cytotoxic T lymphocyte immunity. Tetramer-positive and CD8.sup.+ cells from the blood and tumor tissues were quantified using flow cytometry (14). For intracellular cytokine staining, splenocytes from each vaccination group were harvested 1 week after the last protein injection. Before intracellular cytokine staining, 5?10.sup.6 pooled splenocytes from each vaccination group were incubated with 1 ?g/ml HPV16 E7 49-57 peptide (RAHYNIVTF), OVA 257-264 peptide (SIINFEKL) or AH1 423-431 peptide (SPSYVYHQF) and 1 ?l/ml GolgiPlug (BD Cytofix/Cytoperm Kit) for 16 hours. Cells were then harvested and stained for CD8 and IFN-? using a previously described standard protocol (15). Samples were analyzed on a FACSCalibur flow cytometer, using CellQuest software (Becton Dickinson, San Jose, Calif.). All of the analyses shown were carried out with gated lymphocyte populations.
F. In Vivo CD8 Antibody Depletion Experiment
[0355] In vivo CD8 antibody depletion was performed as described previously. Briefly, C57BL/6 mice (five per group) were injected with 1?10.sup.5 TC-1 cells and were treated with three-time 100 ?g of annV-E7 protein similar to what has been described previously (16). Depletion was started 1 day before injection of protein. mAb 2.43 was used for CD8 depletion and control IgG was used as control. Depletion was terminated on day 20 after tumor challenge.
F. In Vitro Cytotoxicity Assay
[0356] For in vitro cytotoxicity experiments, 1?10.sup.5 of luciferase-expressing tumor cells (TC-1/luc or OVCAR3/luc) were treated with 5?g/ml each of one of the various proteins on a 24-well plate for 18 hours. 2?10.sup.5 OVA-specific or M1-specific cytotoxic T cells were then added to the wells. The degree of CTL-mediated killing of the tumor cells was measured by the IVIS Spectrum Imaging System Series 2000.
G. Luciferase-Based Bioluminescence Imaging
[0357] Gaussia luciferase (GLuc) (17) and the substrate coelenterazine (Sigma) were used to test for GLuc activity in vivo. For the in vivo luciferase attraction experiment, mice were injected with 1?10.sup.5 TC-1 cells. After 10 days, cisplatin was intraperitoneally injected. 2 days after cisplatin treatment, 200 ?g of Gluc or annV-Gluc protein was injected intravenously and 1 day later, luciferin substrate was injected intraperitoneally. The bioluminescence of the cells was detected via the IVIS Spectrum Imaging System Series 2000. The region of interest from displayed images was designated and quantified as total photon counts using Living Image 2.50 software (Xenogen).
H. Statistical Analysis
[0358] The data presented in this study are from one representative experiment of the two or three experiments performed, and are expressed as means?standard deviation (S.D.). The number of samples in each group for any given experiment was >3. Results for intracellular cytokine staining with flow cytometry analysis and tumor treatment experiments were evaluated by analysis of variance (one-way ANOVA) and the Tukey-Kramer multiple comparison test. Comparisons between individual data points were performed using Student's t-test. The event time distributions for different mice were compared using the Kaplan-Meier method and the log-rank statistic. All p values <0.05 were considered significant.
Example 2
Treatment with Annexin V-HPV16 E7 Fusion Protein Generates Potent Antitumor Responses in Tumor-Bearing Mice.
[0359] To examined whether treatment with a fusion protein consisting of annexin V (annV) and HPV16 E7 antigen (annV-E7) could control E7-expressing TC-1 tumors in mice, C57BL/6 mice were inoculated with TC-1 cells subcutaneously and then three days later, were injected intravenously with either PBS control, annV alone, E7 alone, annV plus E7, or annV-E7 fusion protein for a total of three times as outlined in
Example 3
Treatment with AnnexinV-E7 Fusion Protein and Cisplatin Generates Synergistic Antitumor Effects
[0360] In order to demonstrate that the annV protein selectively accumulates in tumor cells, a fusion protein consisting of annV and gaussia luciferase (GLuc) was employed. C57BL/6 mice were injected with TC-1 cells subcutaneously and then treated with or without cisplatin 10 days later to enhance apoptosis of tumor cells. After an additional 2 days, mice were injected with PBS, annV only, or annV-Gluc proteins intravenously. The following day, bioluminescence imaging demonstrated that mice treated with cisplatin and annV-GLuc had significant accumulation of the annV fusion protein in tumor loci (
Example 4
AnnexinV Fusion to Different Tumor Antigen is Capable of Generating Antitumor Effects.
[0361] To demonstrate that the concept of annV fusion to a tumor antigen to elicit antitumor effects could be applied to a different mouse system and tumor model, BALB/c mice were subcutaneously injected with AH1-expressing CT-26 tumor cells and then treated with or without cisplatin combined with annV, a modified AH1 peptide termed AH5, or annV-AH5 fusion protein as outlined in
Example 4
AnnexinV Fused to OVA Peptide Generates Potent Antitumor Effects Against TC-1 Tumors when Combined with Cisplatin.
[0362] To further test the treatment methodology using a foreign non-tumor-specific antigen against TC-1 tumors, AnnV conjugated with OVA peptide fusion proteins were created with or without a furin cleavage site (annV-O and annV-RO, respectively) and annV expression was confirmed by gel electrophoresis as shown in
Example 5
AnnexinV Fused to OVA Peptide Combined with Cisplatin Generates Potent Antitumor Effects Against PancO2 Tumors.
[0363] The strategy using annV-RO fusion protein plus cisplatin to treat PancO2 tumors was applied. C57BL/6 mice were injected subcutaneously with PancO2 cells and, 25 days later, were treated with cisplatin and either annV-RO or GFP-RO fusion protein as indicated in
Example 6
AnnexinV Fused To Influenza M1 Peptide Combined with Cisplatin Generates Potent Antitumor Effects Against OVCAR3 Tumors.
[0364] To modify the treatment strategy so that it would be applicable to tumor control in humans, annV was conjugated to a foreign non-tumor antigen highly relevant to human immunity, influenza virus M1 peptide, with or without a furin cleavage site (annV-RM1 and annV-M1 respectively) as depicted in
Example 7
Characterization of Tumor Growth in Tumor-Bearing Mice Treated with Different Regimens
Materials and Method
Plasmid DNA Constructs and Preparation
[0365] pFuse-Fc (pFuse-mIgG2a-Fc2) was obtained from Invivogen (San Diego, USA). To generate pFuse-Hannv-Fc, human annexin v was PCR amplified by primers (AAAGAATTCGATGGCACAGGTTCTCAGAGG and TTTAGATCTGTCATCTTCTCCACAGAGCA) with Human annexin v cDNA as the template DNA (Addgene, Cambridge, Mass.), and then cloned into EcoRI and Bgl II sites of pFuse-IgG2a (Invivogen).
Transfection and Protein Purification
[0366] For the production of the recombinant protein pFuse-Hannv-Fc and control proteins IgG2a Fc (hereinafter Con-Fc), 1?10.sup.7 BHK-21 cells were transfected with 50 ?g of each plasmid in T-150 flasks using Lipofectamin 2000 (Invitrogen Corp., Carlsbad, Calif., USA) (PMID 22509395). After 3 days, the cell-cultured media was accumulated, filtered with a 0.22 ?m syringe filter (Millipore, Billerica Mass., USA) and concentrated with Amicon Ultra-15 50kDa cut-off centrifugal filter units (Millipore, Billerica Mass., USA). The concentrated recombinant proteins were loaded onto a HiTrap Protein G HP column (GE Healthcare) and immobilized via Fc-protein G binding. The column was washed with 20 mM sodium phosphate buffer (pH 7.0) and the recombinant protein was eluted using 0.1 M glycine-Cl buffer (pH 2.8). Protein concentrations were determined with the Coomassie Plus protein assay (Pierce, Rockford, USA) and purity was estimated by SDS polyacrylamide gel electrophoresis.
In Vivo Experiment 1?10.sup.5 TC-1 tumor cells were inoculated subcutaneously into C57BL/6. Five days later, tumor-bearing mice were treated with intraperitoneal cisplatin (5 mg/kg body weight) or saline control. Six days later, mice were treated with intraperitoneal AnnexinV-FC or mouse IgG (100 ug/mouse) control. Tumor-bearing mice were treated continually weekly.
Result
[0367] As demonstrated in
REFERENCES
[0368] 1. Sznol M, Holmlund J. Antigen-specific agents in development. Semin Oncol. 1997;24:173-86.
[0369] 2. Kang T H, Ma B, Wang C, Wu T C, Hung C F. Targeted coating with antigenic peptide renders tumor cells susceptible to CD8(+) T cell-mediated killing. Molecular therapy : the journal of the American Society of Gene Therapy. 2013;21:542-53.
[0370] 3. Scholler N, Fu N, Yang Y, Ye Z, Goodman G E, Hellstrom K E, et al. Soluble member(s) of the mesothelin/megakaryocyte potentiating factor family are detectable in sera from patients with ovarian carcinoma. Proceedings of the National Academy of Sciences of the United States of America. 1999;96:11531-6.
[0371] 4. Hassan R, Bera T, Pastan I. Mesothelin: a new target for immunotherapy. Clinical cancer research : an official journal of the American Association for Cancer Research. 2004;10:3937-42.
[0372] 5. D'Amico A V, McKenna W G. Apoptosis and a re-investigation of the biologic basis for cancer therapy. Radiotherapy and oncology : journal of the European Society for Therapeutic Radiology and Oncology. 1994;33:3-10.
[0373] 6. Sen S, D'Incalci M. Apoptosis. Biochemical events and relevance to cancer chemotherapy. FEB S letters. 1992;307:122-7.
[0374] 7. Dive C, Evans C A, Whetton A D. Induction of apoptosisnew targets for cancer chemotherapy. Seminars in cancer biology. 1992;3:417-27.
[0375] 8. Schmitt C A, Lowe S W. Apoptosis and therapy. The Journal of pathology. 1999;187:127-37.
[0376] 9. Dewey W C, Ling C C, Meyn R E. Radiation-induced apoptosis: relevance to radiotherapy. International journal of radiation oncology, biology, physics. 1995;33:781-96.
[0377] 10. Ernst J D, Yang L, Rosales J L, Broaddus V C. Preparation and characterization of an endogenously fluorescent annexin for detection of apoptotic cells. Analytical biochemistry. 1998;260:18-23.
[0378] 11. Hung C F, Calizo R, Tsai Y C, He L, Wu T C. A DNA vaccine encoding a single-chain trimer of HLA-A2 linked to human mesothelin peptide generates anti-tumor effects against human mesothelin-expressing tumors. Vaccine. 2007;25:127-35.
[0379] 12. Wang T L, Ling M, Shih I M, Pham T, Pai S I, Lu Z, et al. Intramuscular administration of E7-transfected dendritic cells generates the most potent E7-specific anti-tumor immunity. Gene therapy. 2000;7:726-33.
[0380] 13. Peng S, Monie A, Kang T H, Hung C F, Roden R, Wu T C. Efficient delivery of DNA vaccines using human papillomavirus pseudovirions. Gene therapy. 2010;17:1453-64.
[0381] 14. Clay T M, Hobeika A C, Mosca P J, Lyerly H K, Morse M A. Assays for monitoring cellular immune responses to active immunotherapy of cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 2001;7:1127-35.
[0382] 15. Cheng W F, Hung C F, Lin K Y, Ling M, Juang J, He L, et al. CD8+ T cells, NK cells and IFN-gamma are important for control of tumor with downregulated MHC class I expression by DNA vaccination. Gene therapy. 2003;10:1311-20.
[0383] 16. Lin K Y, Guarnieri F G, Staveley-O'Carroll K F, Levitsky H I, August J T, Pardoll D M, et al. Treatment of established tumors with a novel vaccine that enhances major histocompatibility class II presentation of tumor antigen. Cancer research. 1996;56:21-6.
[0384] 17. Tannous B A, Kim D E, Fernandez J L, Weissleder R, Breakefield X O. Codon-optimized Gaussia luciferase cDNA for mammalian gene expression in culture and in vivo. Molecular therapy: the journal of the American Society of Gene Therapy. 2005;11:435-43.
[0385] 18. Kersemaekers A M, Fleuren G J, Kenter G G, Van den Broek L J, Uljee S M, Hermans J, et al. Oncogene alterations in carcinomas of the uterine cervix: overexpression of the epidermal growth factor receptor is associated with poor prognosis. Clinical cancer research: an official journal of the American Association for Cancer Research. 1999;5:577-86.
[0386] 19. Maurizi M, Almadori G, Ferrandina G, Distefano M, Romanini M E, Cadoni G, et al. Prognostic significance of epidermal growth factor receptor in laryngeal squamous cell carcinoma. Br J Cancer. 1996;74:1253-7.
[0387] 20. Inada S, Koto T, Futami K, Arima S, Iwashita A. Evaluation of malignancy and the prognosis of esophageal cancer based on an immunohistochemical study (p53, E-cadherin, epidermal growth factor receptor). Surg Today. 1999;29:493-503.
[0388] 21. Fischer-Colbrie J, Witt A, Heinzl H, Speiser P, Czerwenka K, Sevelda P, et al. EGFR and steroid receptors in ovarian carcinoma: comparison with prognostic parameters and outcome of patients. Anticancer Res. 1997;17:613-9.
[0389] 22. Mellon K, Wright C, Kelly P, Home C H, Neal D E. Long-term outcome related to epidermal growth factor receptor status in bladder cancer. J Urol. 1995;153:919-25.
[0390] 23. Normanno N, De Luca A, Bianco C, Strizzi L, Mancino M, Maiello M R, et al. Epidermal growth factor receptor (EGFR) signaling in cancer. Gene. 2006;366:2-16.
[0391] 24. Nicholson R I, Gee J M, Harper M E. EGFR and cancer prognosis. Eur J Cancer. 2001;37 Suppl 4:S9-15.
[0392] 25. Lu J, Higashimoto Y, Appella E, Celis E. Multiepitope Trojan antigen peptide vaccines for the induction of antitumor CTL and Th immune responses. J Immunol. 2004;172:4575-82.
[0393] 26. Currier J R, Kuta E G, Turk E, Earhart L B, Loomis-Price L, Janetzki S, et al. A panel of MHC class I restricted viral peptides for use as a quality control for vaccine trial ELISPOT assays. Journal of immunological methods. 2002;260:157-72.
EQUIVALENTS
[0394] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. While specific embodiments of the subject invention have been discussed, the above specification is illustrative and not restrictive. Many variations of the invention may become apparent to those skilled in the art upon review of this specification. The full scope of the invention should be determined by reference to the claims, along with their full scope of equivalents, and the specification, along with such variations. Such equivalents are intended to be encompassed by the following claims.