Urinary Polyamines as Prostate Cancer Detection Biomarkers
20180172695 ยท 2018-06-21
Inventors
Cpc classification
C07D333/22
CHEMISTRY; METALLURGY
G01N33/52
PHYSICS
International classification
Abstract
The present disclosure relates to urinary polyamines useful as prostate cancer biomarkers. In particular, the present disclosure provides a novel, highly-sensitive and specific, method for detecting and quantifying urinary polyamines using lanthanide complexes or citrate capped gold nanoparticles.
Claims
1. A compound of formula (1): ##STR00003## wherein, Ln is a lanthanide metal; and each M is independently selected from the group consisting of Na, Li, and K; or two M taken together represent Mg or Ca.
2. The compound of claim 1, wherein the lanthanide is europium.
3. The compound of claim 1, wherein M is Li.
4. A method of detecting one or more urinary polyamines, comprising the steps of: a. providing a urine sample; b. contacting the urine sample with a compound of claim 1 thereby forming a test sample; and c. detecting the presence of the one or more urinary polyamines in the test sample.
5. The method of claim 4, wherein the urine sample is obtained from a human.
6. The method of claim 5, wherein the concentration of the one or more urinary polyamines is used to determine whether the human suffers from prostate cancer.
7. A method of detecting one or more urinary polyamines, comprising the steps of: a. providing a urine sample; b. contacting the urine sample with a nanoparticle comprising a gold nanoparticle and at least two ligands comprising citrate and single stranded DNA, wherein the molar ratio of single stranded DNA to gold nanoparticle is about 4:1 to about 3:1, thereby forming a test sample; c. detecting the presence of the one or more urinary polyamines in the test sample.
8. The method of claim 7, wherein the molar ratio of the single stranded DNA to the gold nanoparticle is between about 3.2:1 to about 3.0:1.
9. The method of claim 8, wherein average diameter of the nanoparticle is about 1 nm to about 100 nm.
10. The method of claim 8, wherein the average diameter of the nanoparticle is about 2 nm to about 10 nm.
11. The method of claim 8, wherein the single stranded DNA has between about 5 and about 50 nucleotides.
12. The method of claim 8, wherein the urine sample has been subjected to a purification step prior to the step of contacting the urine sample with a nanoparticle to remove protein or salts.
13. The method of claim 8, wherein the pH of the test sample in the step of detecting the presence of the one or more urinary polyamines is between about to 2 to about 8.
14. The method of claim 8, wherein the step of detecting the presence of the one or more urinary polyamines further comprises determining the concentration of the one or more urinary polyamines.
15. The method of claim 14, wherein the step of determining the concentration comprises visual comparison of the color of the test sample with a reference color chart or a spectroscopic method.
16. The method of claim 8, wherein the urine sample is obtained from a human.
17. The method of claim 8, wherein the concentration of the one or more urinary polyamines is used to determine whether the human suffers from prostate cancer.
18. The method of claim 8, wherein the concentration of the single stranded DNA is about 200 nM to about 300 nM and the concentration of the gold nanoparticle is about 50 nM to about 100 nM in the test sample.
19. The method of claim 8, wherein the concentration of the single stranded DNA is about 240 nM to about 260 nM and the concentration of the gold nanoparticle is about 75 nM to about 87 nM in the test sample.
20. A kit comprising a nanoparticle, wherein the nanoparticle comprises a gold nanoparticle and at least two ligands comprising citrate and single stranded DNA, wherein the molar ratio of single stranded DNA to gold nanoparticle is between is about 4:1 to about 3:1 and instructions for carrying out the method of claim 8.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0040] The above and other objects and features of the present disclosure will become apparent from the following description of the various embodiments described herein, when taken in conjunction with the accompanying drawings, in which:
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
TABLE-US-00001 12mer: CGACAACCACAA; 24mer: CGACAACCACAACACACAATCTGA; 36mer: CGACAACCACAACACACAATCTGACGACAACCACAA)
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
DETAILED DESCRIPTION OF THE INVENTION
[0095] The present disclosure is not to be limited in scope by any of the specific embodiments described herein. The following embodiments are presented for exemplification only.
[0096] Three urinary polyamines (Put, Spd and Spm) were evaluated as biomarkers for PCa detection by comparing the concentrations of each in patients diagnosed with PCa, BPH patients and healthy patients. Through a well validated chromatographic method, urinary Spm had been shown to possess usefulness in differentiating PCa from non-cancerous disease states including BPH, and it could help to act as a secondary screening tool to serum PSA test to address its high false-positive rate when using 4.0 ng/ml as a cut-off point. Two kits were developed afterwards towards this novel biomarker and are described herein.
Part 1: Evaluation of Polyamines' Roles as PCa Biomarker
[0097] Clinical Samples
[0098] Three subsets of patients for the clinical samples collection were assigned as follows: patients diagnosed with PCa, patients diagnosed with BPH, and HC. Written consent was acquired from all of the subjects. Enrolment of patients into the clinical study was reviewed and approved by the Clinical Research Ethical Committee of the Chinese University of Hong Kong, and the study was performed strictly according to the guidelines developed by that committee. Urine samples were obtained at noon time after lunch prior to prostatic biopsy from 165 male patients (age >50) having serum PSA level greater than 4.0 ng/ml between October 2014 and March 2016. These patients' urine samples were accepted only when they didn't have clinically active urinary tract infection which might pose a biasing effect. When patients did not agree to consent for the study, or they clinically showed evidence of other types of cancers, they were excluded from the sampling scheme.
[0099] Amongst these 165 patients, 66 were diagnosed as having PCa and the remaining 99 had no evidence of malignancy (NEM) by using TRUSPB as the reference standard. To further categorize these 99 NEM patients, using the criteria of prostate volume >30 ml as criteria, 88 were found to have BPH while others were considered as HC. All pathological examinations were conducted at Prince of Wales Hospital, The Chinese University of Hong Kong, Hong Kong under the supervision of experienced uro-pathologists.
[0100] Table 1 shows all the clinicopathologic characteristics of samples. All samples were stored at 20C until measurement. All measurements were conducted within three months after collection.
TABLE-US-00002 TABLE 1 Clinicopathologic characteristics of patients. p p p value value value (PCa (PCa (BPH PCa BPH HC vs vs vs Characteristics (n = 66) (n = 88) (n = 11) BPH) HC) HC) Age Mean(SEM) 69.6(0.8) 66.9(0.6) 64.9(1.1) 0.018 0.027 0.245 Median 69 66 65 Range 54-86 51-79 59-74 Preoperative PSA. ng/ml Mean(SEM) 46.39(8.61) 12.39(1.57) 26.54(7.51) <0.0001 0.350 0.007 Median 15.60 8.60 8.50 Range 4.20-299.00 4.40-98.50 4.3-66.00 Gleason score (GS) 5 1 6 26 7 15 8 10 9 12 10 2 Prostate volume (ml) Mean(SEM) 43.81(2.44) 67.28(2.98) 17.46(2.67) <0.0001 <0.0001 <0.0001 Median 40.00 56.50 20.40 Range 16.60-87.80 32.20-162.00 4.60-30.00
[0101] Materials and Chemicals
[0102] Methanol was obtained from TEDIA (HPLC/Spectro grade, 99.9%). Acetonitrile was obtained from ACS (HPLC grade, 99.9%). Water was purified in a MilliQ Direct Water Purification System (Millipore, USA). All standard compounds, including 1,4-Diaminobutane (Put, 99%), spermidine (Spd, 99.0%), spermine (Spm, 99.0%), 1,4-Diamino(butane-d.sub.8) dihydrochloride (98 atom % D), spermidine-(butane-d.sub.8) trihydrochloride (98 atom % D, 95% CP), spermine-(butane-d.sub.8) tetrahydrochloride (97 atom % D, 95% CP) and heptafluorobutyric acid (HFBA, 99.0%) were purchased from Sigma-Aldrich (Hong Kong China) and used without further purification. Strong Anion Exchange solid phase extraction (SPE) cartridges were obtained from Phenomenex (Strata, 100 mg/3 mL, USA). Centrifugation was performed using a Refrigerated centrifuge obtained from Eppendorf (5417R, Hong Kong, China).
[0103] Determination of Creatinine
[0104] The creatinine concentration inside urine samples were determined by LabAssay Creatinine assay (Wako, Japan). Briefly, urine samples and standards were thawed, deproteinized and centrifuged. The supernatant was separated and reacted with picric acid in alkaline solution to produce tangerine condensate through Jaffe reaction as reported in Bonsnes R W Taussky H H. On the colorimetric determination of creatinine by the Jaff reaction. J Biol Chem. 1945; 158(3):581-9. Quantitation of total creatinine inside samples was made by measurement of absorbance by a Clariostar Monochromator Microplate Reader (BMG Labtech, Hong Kong). Concentrated urine samples which exceeded the calibration points were diluted with water with appropriate dilution factor before sample preparation. Each sample was determined at least twice with Relative standard deviation (RSD) less than 15%.
[0105] Standard Preparation for Determination of Polyamines
[0106] Stock solutions (5000 g/ml) of each polyamine (Put, Spm, Spd) were prepared in water separately. The three stock solutions were mixed and diluted to give an intermediate standard (50 g/ml), which was then used to prepare a series of working standards with polyamine concentrations of 10, 25, 50, 100, 250, 500, 1000 ng/ml in water. For internal standards, the stock solutions (5000 g/ml) of each polyamine (Put-d.sub.8, Spm-d.sub.8, Spd-d.sub.8) were prepared in water individually. The three stock solution were mixed and diluted to give an internal standard (IS) working solution (1 g/ml) in water.
[0107] Sample/Standard Pretreatment for Determination of Polyamines
[0108] The sample preparation procedures followed the method developed by Hkkinen et al. Analysis of free, mono-and diacetylated polyamines from human urine by LC-MS/MS. J Chromatogr B Analyt Technol Biomed Life Sci. 2013; 941:81-9 with little modifications. Firstly, urine samples/standards were thawed naturally and centrifuged for 5 minutes at 13000 rpm and room temperature. 120 L of urine sample/standard supernatant and 60 L of IS working solution were mixed with 420 L of water. 550 L of this well-mixed solution was passed through the SPE cartridges, which had been conditioned and equilibrated with 1 mL of methanol and water respectively. 450 L of water was passed through the cartridge afterwards to elute out all polyamines. 400 L of these SPE treated samples were then mixed with 100 L of 10% HFBA, and the final mixture was ready for instrumental analysis. Concentrated urine samples which exceeded the calibration points were diluted with water with appropriate dilution factors before sample preparation.
[0109] Quality Control Samples for Determination of Polyamines
[0110] For each batch of sample analysis, three Quality control (QC) working solutions were analyzed to verify the accuracy of calibration curves and ensure comparability among batches. The solutions were prepared using analyzed control urine samples from our research group. The polyamines concentrations of controls' urine samples were determined and then mixed equally to give a pooled urine sample. Afterwards, three QC working solutions with different polyamine concentration range (low, medium and high) were prepared by mixing this pooled urine sample with standard solutions. For low polyamine concentration QC working solution, the SPE-treated pooled urine sample was mixed with SPE-treated 10 ng/ml standard in the 1:7 ratio. For medium polyamine concentration QC working solution, the SPE-treated pooled urine samples were mixed with SPE-treated 100 ng/ml standard in the 1:1 ratio. For high polyamine concentration QC working solution, the SPE-treated pooled urine sample was mixed with SPE-treated 1000 ng/ml standard in the 1:1 ratio.
[0111] Stability Studies
[0112] For stability study, Hkkinen et al. had previously demonstrated that both the standard mixtures and QC samples were stable after storing at six hours at room temperature (short-term stability), after storage at 20C and 80C respectively for two months (long-term stability) and after going three cycles of freezing and thawing before sample preparation (freeze thaw stability). For further verification, the content of polyamines and creatinine inside both standards and selected urine samples was analyzed. It was found that, upon five cycles of freeze and thaw, all the contents were still stable in six months' time when storing at 20C. For the SPE-treated samples, it was stable for at least two days when storing at 4 C. and up to a year when storing at 20 C.
[0113] Instrumentation and Statistical Analysis
[0114] The quantitation of polyamines was performed by Ultra-high Performance Liquid Chromatography coupled with a triple quadrupole mass spectrometer (UPLC-MS/MS). LC separation was done by an Agilent 1290 Infinity Quaternary LC System while mass analyzing was done by an Agilent 6460 Triple Quadrupole mass spectrometer equipped with an Agilent Jet Stream technology electrospray ionization source. The column used was an Agilent EclipsePlus C18 RRHD (2.150 mm, 1.8 m) protected with an Agilent SB-C18 guard column (2.15 mm, 1.8 m).
[0115] The LC elution profiles were optimized as follows: Eluent A was water with 0.1% HFBA while eluent B was acetonitrile with 0.1% HFBA. Eluent A was decreased from 95% to 60%/o in 10 minutes. The gradient was then decreased from 60% to 10% of eluent A in 1 minute. Afterwards the gradient was held constant for 5 minutes. The gradient was then increased from 10% to 95% in 1 minute, followed by being held constant for 8 minutes. (Total run-time=25 minutes).
[0116] Autosampler and column temperature were set as 4 C. and 35C respectively. Injection was achieved by 5-second needle wash in Flush Port mode for 3 times with eluent B. In each time 10 L was injected.
[0117] For the source parameter, drying gas (nitrogen) temperature was set as 300C with 5 l/min flow rate. Nebulizer pressure was 45 psi Sheath gas temperature was set as 250C with 11 l/min flow rate. Capillary voltage was set as 3500V. For mass detection, scheduled multiple reaction monitoring (MRM) was performed. The information of MRM transitions can be found in Table 2.
TABLE-US-00003 TABLE 2 MRM transitions, dwell time, fragmentor, collision energy and cell accelerator voltage for Put, Spm, Spd and their corresponding internal standards Cell Accel- Pre- Dwell Frag- Collision erator cusor Daughter time mentor energy Voltage ion ion (ms) (V) (V) (V) Putrescine 89 72* 100 70 6 3 Putrescine-d.sub.8 97 80* 100 70 6 3 Spermidine 146 112 100 90 10 3 146 72* 100 90 15 3 Spermidine-d.sub.8 154 120 100 90 10 3 154 80* 100 90 15 3 Spermine 203 129 100 90 10 3 203 112* 100 90 15 3 Spermine-d.sub.8 211 137 100 90 10 3 211 120* 100 90 15 3 *Denoted the quantifier transitions
[0118] The result was calculated using Agilent MassHunter Workstation software. Calibration curves were fitted linearly without any weighing. The correlation coefficients should not be smaller than 0.995. Acceptance values for each calibration points and quality control working solutions were 30% to ensure accuracy. For precision verification, after every 10-sample injection each time, a 250 ng/ml standard was injected and checked if it can be reproduced (15%).
[0119] For statistical analysis, the receiver operating characteristics (ROC) curve and the area under curve (AUC) were obtained by using GraphPad Prism 6 (GraphPad Software, San Diego, Calif., USA). A p value smaller than 0.05 (two-tailed) was considered as statistically significant during comparison based on Student's t-test.
[0120] Results
[0121] Urinary Polyamines Content
[0122] Put, Spd, Spm and their corresponding deuterated internal standards were successfully separated and quantified from all samples by UPLC-MS/MS. (
TABLE-US-00004 TABLE 3 Summary of creatinine results from all patients p p p value value value Healthy (PCa (PCa (BPH PCa BPH control vs vs vs (n = 66) (n = 88) (n = 11) BPH) HF) HF) Creatinine (ppm) Mean 828.30 970.40 1143 0.173 0.151 0.427 (SEM) (76.82) (69.06) (269.40) Median 671.31 751.80 951.98 Range 119.57- 171.43- 174.16- 3102.61 3025.24 3183.77
[0123] Table 4 and
TABLE-US-00005 TABLE 4 Column statistics of normalized polyamine contents in different subsets. SEM represents the standard error of the mean. p p p value value value (PCa vs (PCa vs (BPH vs PCa BPH HC BPH) HC) HC) Normalized Put Mean (SEM) 1.63(0.61) 1.21(0.16) 0.65(0.14) 0.459 0.522 0.212 Median 0.87 0.92 0.39 Range 0.13-40.64 0.18-12.04 0.17-1.59 25% Percentile 0.45 0.41 0.37 75% Percentile 1.24 1.38 0.93 Normalized Spd Mean (SEM) 0.52(0.05) 0.94(0.24) 2.71(2.17) 0.147 0.014 0.081 Median 0.39 0.52 0.54 Range 0.08-2.09 0.18-21.42 0.21-24.40 25% Percentile 0.25 0.36 0.33 75% Percentile 0.65 0.89 0.71 Normalized Spm Mean (SEM) 1.47(0.22) 5.87(0.71) 5.43(1.17) <0.0001 <0.0001 0.833 Median 0.86 3.25 6.37 Range 0.05-9.57 0.47-31.78 0.63-11.36 25% Percentile 0.48 1.72 1.30 75% Percentile 1.82 7.65 9.18
[0124] The black bar in
[0125] Among the three polyamines monitored, normalized Spm showed a significant decrease in PCa patients compared to non-cancerous cases including BPH patients and HC in terms of statistical means (Unpaired student's t-test). In detail, the mean value was 1.47 in PCa vs 5.87 in BPH vs 5.43 in HC. p values were <0.0001 in t-test, which means significant differences at the pre-set criteria of p<0.05. For normalized Put and Spd, no obvious enhancement or suppression could be observed by looking at their distributions or comparing their mean values by t-test. (Put: 1.63 in PCa vs 1.21 in BPH vs 0.65 in HC; Spd: 0.52 in PCa vs 0.94 in BPH vs 2.71 in HC)
[0126] Receiver Operating Characteristics Analysis
[0127]
TABLE-US-00006 TABLE 5 Sensitivity and Specificity for normalized Spm at different threshold values Sensitivity Specificity Threshold (%) 95% CI (%) 95% CI <0.0800 1.515 0.03835% to 8.155% 100. 96.34% to 100.0% <0.1150 3.03 0.3691% to 10.52% 100 96.34% to 100.0% <0.1350 4.545 0.9474% to 12.71% 100 96.34% to 100.0% <0.1800 6.061 1.676% to 14.80% 100 96.34% to 100.0% <0.2400 7.576 2.506% to 16.80% 100 96.34% to 100.0% <0.2900 9.091 3.410% to 18.74% 100 96.34% to 100.0% <0.3150 10.61 4.372% to 20.64% 100 96.34% to 100.0% <0.3250 12.12 5.381% to 22.49% 100 96.34% to 100.0% <0.3350 13.64 6.430% to 24.31% 100 96.34% to 100.0% <0.3550 15.15 7.512% to 26.10% 100 96.34% to 100.0% <0.3750 16.67 8.625% to 27.87% 100 96.34% to 100.0% <0.4000 18.18 9.763% to 29.61% 100 96.34% to 100.0% <0.4300 19.7 10.93% to 31.32% 100 96.34% to 100.0% <0.4450 22.73 13.31% to 34.70% 100 96.34% to 100.0% <0.4600 24.24 14.54% to 36.36% 100 96.34% to 100.0% <0.4800 24.24 14.54% to 36.36% 98.99 94.50% to 99.97% <0.5000 27.27 17.03% to 39.64% 98.99 94.50% to 99.97% <0.5200 28.79 18.30% to 41.25% 98.99 94.50% to 99.97% <0.5350 30.3 19.59% to 42.85% 98.99 94.50% to 99.97% <0.5500 31.82 20.89% to 44.44% 98.99 94.50% to 99.97% <0.5700 33.33 22.20% to 46.01% 98.99 94.50% to 99.97% <0.6050 34.85 23.53% to 47.58% 97.98 92.89% to 99.75% <0.6350 34.85 23.53% to 47.58% 95.96 89.98% to 98.89% <0.6600 36.36 24.87% to 49.13% 94.95 88.61% to 98.34% <0.6850 39.39 27.58% to 52.19% 93.94 87.27% to 97.74% <0.6950 40.91 28.95% to 53.71% 93.94 87.27% to 97.74% <0.7200 42.42 30.34% to 55.21% 93.94 87.27% to 97.74% <0.7650 42.42 30.34% to 55.21% 92.93 85.97% to 97.11% <0.7950 45.45 33.14% to 58.19% 92.93 85.97% to 97.11% <0.8200 46.97 34.56% to 59.66% 92.93 85.97% to 97.11% <0.8450 46.97 34.56% to 59.66% 91.92 84.70% to 96.45% <0.8550 48.48 35.99% to 61.12% 90.91 83.44% to 95.76% <0.8650 51.52 38.88% to 64.01% 89.9 82.21% to 95.05% <0.8800 53.03 40.34% to 65,44% 88.89 80.99% to 94.32% <0.9100 54.55 41.81% to 66.86% 88.89 80.99% to 94.32% <0.9400 56.06 43.30% to 68.26% 88.89 80.99% to 94.32% <0.9650 57.58 44.79% to 69.66% 88.89 80.99% to 94.32% <0.9850 57.58 44.79% to 69.66% 87.88 79.78% to 93.58% <1.035 60.61 47.81% to 72.42% 86.87 78.59% to 92.82% <1.110 62.12 49.34% to 73.78% 86.87 78.59% to 92.82% <1.145 62.12 49.34% to 73.78% 85.86 77.41% to 92.05% <1.175 63.64 50.87% to 75.13% 85.86 77.41% to 92.05% <1.205 63.64 50.87% to 75.13% 84.85 76.24% to 91.26% <1.225 63.64 50.87% to 75.13% 82.83 73.94% to 89.67% <1.250 65.15 52.42% to 76.47% 82.83 73.94% to 89.67% <1.280 65.15 52.42% to 76.47% 81.82 72.80% to 88.85% <1.305 65.15 52.42% to 76.47% 80.81 71.66% to 88.03% <1.320 66.67 53.99% to 77.80% 80.81 71.66% to 88.03% <1.335 68.18 55.56% to 79.11% 80.81 71.66% to 88.03% <1.365 69.7 57.15% to 80.41% 80.81 71.66% to 88.03% <1.425 71.21 58.75% to 81.70% 79.8 70.54% to 87.20% <1.480 71.21 58.75% to 81.70% 78.79 69.42% to 86.36% <1.520 71.21 58.75% to 81.70% 77.78 68.31% to 85.52% <1.560 71.21 58.75% to 81.70% 76.77 67.21% to 84.67% <1.585 72.73 60.36% to 82.97% 76.77 67.21% to 84.67% <1.620 72.73 60.36% to 82.97% 75.76 66.11% to 83.81% <1.655 74.24 61.99% to 84.22% 75.76 66.11% to 83.81% <1.705 74.24 61.99% to 84.22% 73.74 63.93% to 82.07% <1.830 75.76 63.64% to 85.46% 73.74 63.93% to 82.07% <1.940 75.76 63.64% to 85.46% 71.72 61.78% to 80.31% <1.990 75.76 63.64% to 85.46% 70.71 60.71% to 79.43% <2.045 77.27 65.30% to 86.69% 70.71 60.71% to 79.43% <2.105 80.3 68.68% to 89.07% 70.71 60.71% to 79.43% <2.175 80.3 68.68% to 89.07% 69.7 59.64% to 78.53% <2.235 80.3 68.68% to 89.07% 68.69 58.59% to 77.64% <2.255 80.3 68.68% to 89.07% 67.68 57.53% to 76.73% <2.270 81.82 70.39% to 90.24% 67.68 57.53% to 76.73% <2.325 84.85 73.90% to 92.49% 67.68 57.53% to 76.73% <2.390 84.85 73.90% to 92.49% 66.67 56.48% to 75.82% <2.415 84.85 73.90% to 92.49% 65.66 55.44% to 74.91% <2.435 84.85 73.90% to 92.49% 64.65 54.40% to 73.99% <2.455 84.85 73.90% to 92.49% 63.64 53.36% to 73.07% <2.465 84.85 73.90% to 92.49% 62.63 52.33% to 72.15% <2.485 84.85 73.90% to 92.49% 61.62 51.30% to 71.22% <2.510 84.85 73.90% to 92.49% 60.61 50.28% to 70.28% <2.585 86.36 75.69% to 93.57% 60.61 50.28% to 70.28% <2.665 86.36 75.69% to 93.57% 59.6 49.26% to 69.34% <2.715 87.88 77.51% to 94.62% 59.6 49.26% to 69.34% <2.770 89.39 79.36% to 95.63% 59.6 49.26% to 69.34% <2.800 89.39 79.36% to 95.63% 58.59 48.24% to 68.40% <2.820 89.39 79.36% to 95.63% 57.58 47.23% to 67.45% <2.845 89.39 79.36% to 95.63% 56.57 46.23% to 66.50% <2.895 89.39 79.36% to 95.63% 55.56 45.22% to 65.55% <2.935 89.39 79.36% to 95,63% 54.55 44.22% to 64.59% <2.965 89.39 79.36% to 95.63% 53.54 43.23% to 63.62% <3.110 90.91 81,26% to 96.59% 53.54 43.23% to 63.62% <3.235 90.91 81.26% to 96.59% 52.53 42.24% to 62.66% <3.245 90.91 81.26% to 96.59% 51.52 41.25% to 61.68% <3.380 92.42 83.20% to 97.49% 50.51 40.27% to 60.71% <3.555 92.42 83.20% to 97.49% 49.49 39.29% to 59.73% <3.625 92.42 83.20% to 97.49% 48.48 38.32% to 58.75% <3.760 93.94 85.20% to 98.32% 48.48 38.32% to 58.75% <3.920 93.94 85.20% to 98.32% 47.47 37.34% to 57.76% <4.055 93.94 85.20% to 98.32% 46.46 36.38% to 56.77% <4.170 93.94 85.20% to 98.32% 45.45 35.41% to 55.78% <4.205 93.94 85.20% to 98.32% 44.44 34.45% to 54.78% <4.235 93.94 85.20% to 98.32% 43.43 33.50% to 53.77% <4.290 93.94 85.20% to 98.32% 42.42 32.55% to 52.77% <4.430 93.94 85.20% to 98.32% 41.41 31.60% to 51.76% <4.560 93.94 85.20% to 98.32% 40.4 30.66% to 50.74% <4.595 93.94 85.20% to 98.32% 39.39 29.72% to 49.72% <4.625 93.94 85.20% to 98.32% 38.38 28.78% to 48.70% <4.695 93.94 85.20% to 98.32% 37.37 27.85% to 47.67% <4.880 93.94 85.20% to 98.32% 36.36 26.93% to 46.64% <5.180 93.94 85.20% to 98.32% 35.35 26.01% to 45.60% <5.440 95.45 87.29% to 99.05% 35.35 26.01% to 45,60% <5.700 95.45 87.29% to 99.05% 34.34 25.09% to 44.56% <6.055 95.45 87.29% to 99.05% 33.33 24.18% to 43.52% <6.305 95.45 87.29% to 99.05% 32.32 23.27% to 42.47% <6.435 95.45 87.29% to 99.05% 31.31 22.36% to 41.41% <6.555 95.45 87.29% to 99.05% 30.3 21.47% to 40.36% <6.685 96.97 89.48% to 99.63% 30.3 21.47% to 40.36% <7.000 96.97 89.48% to 99.63% 29.29 20.57% to 39.29% <7.270 96.97 89.48% to 99.63% 28.28 19.69% to 38.22% <7.310 96.97 89.48% to 99.63% 27.27 18,80% to 37.15% <7.540 96.97 89.48% to 99.63% 26.26 17.93% to 36.07% <7.885 96.97 89.48% to 99.63% 25.25 17.06% to 34.98% <8.060 96.97 89.48% to 99.63% 24.24 16.19% to 33.89% <8.130 96.97 89.48% to 99.63% 23.23 15.33% to 32.79% <8.245 96.97 89.48% to 99.63% 21.21 13.64% to 30.58% <8.495 96.97 89.48% to 99.63% 20.2 12.80% to 29.46% <8.755 98.48 91.84% to 99.96% 20.2 12.80% to 29.46% <8.880 98.48 91.84% to 99.96% 19.19 11.97% to 28.34% <9.040 98.48 91.84% to 99.96% 18.18 11.15% to 27.20% <9.335 98.48 91.84% to 99.96% 17.17 10.33% to 26.06% <9.520 98.48 91.84% to 99.96% 16.16 9.530% to 24.91% <9.560 98.48 91.84% to 99.96% 15.15 8.736% to 23.76% <9.700 100 94.56% to 100.0% 15.15 8.736% to 23.76% <10.60 100 94.56% to 100.0% 14.14 7.953% to 22.59% <11.85 100 94.56% to 100.0% 13.13 7.181% to 21.41% <12.38 100 94.56% to 100,0% 12.12 6.423% to 20.22% <12.63 100 94.56% to 100.0% 11.11 5.679% to 19.01% <12.93 100 94.56% to 100.0% 10.1 4.951% to 17.79% <13.15 100 94.56% to 100.0% 9.091 4.242% to 16.56% <13.29 100 94.56% to 100.0% 8.081 3.553% to 15.30% <16.50 100 94.56% to 100.0% 7.071 2.890% to 14.03% <19.83 100 94.56% to 100.0% 6.061 2.256% to 12.73% <20.11 100 94.56% to 100.0% 5.051 1.660% to 11.39% <22.08 100 94.56% to 100.0% 4.04 1.112% to 10.02% <25.01 100 94.56% to 100.0% 3.03 0.6293% to 8.601% <28.75 100 94.56% to 100.0% 2.02 0.2456% to 7.108% <31.57 100 94.56% to 100.0% 1.01 0.02557% to 5.500%
[0128] The relationship between polyamines and cancer has long been investigated by scientists. It is generally believed that increase of polyamine levels in blood or urine reflect the enhanced levels of polyamine synthesis in rapid-growing cancer tissues/cells, since they are associated with increased cell proliferation, decreased apoptosis and increased expression of genes affecting tumor invasion and metastasis.
[0129] In Russell D H. Increased polyamine concentrations in the urine of human cancer patients. Nat New Biol. 1971; 233(39):144-5 firstly reported the increase of urinary polyamines levels in various solid tumors, including ovarian teratoma, rectal carcinoma, lymphosarcoma, osteogenic sarcoma and acute myelocytic leukaemia. Kyoko Hiramatsu et al. N.sup.1,N.sup.12-Diacetylspermine as a Sensitive and Specific Novel Marker for Early-and Late-Stage Colorectal and Breast Cancers. Clin Cancer Res. 2005; 11(8):2986-90 reported an increase in N.sup.1, N.sup.12-Diacetylspermine in patients with early and late stage colorectal and breast cancers and established its role to be a novel marker for these cancers. In cases of cervical cancer, Lee et al. Altered urinary profiles of polyamines and endogenous steroids in patients with benign cervical disease and cervical cancer Cancer Lett. 2003; 201(2):121-31 had shown a significant elevation in polyamines level in Put, Spd and Spin. For hepatic cancer, Liu et al. Determination of polyamine metabolome in plasma and urine by ultrahigh performance liquid chromatography-tandem mass spectrometry method: Application to identify potential markers for human hepatic cancer Anal Chim Acta. 2013; 791:36-45 monitored the level differences between polyamines, polyamine precursors and catabolites in both patients' plasma and urines. By analyzing these results carefully, indeed it could be observed that different kinds of polyamines showed different variations depending on the type of cancers. The claim of urinary polyamine levels elevating in cancer cases is not specific enough.
[0130] Nevertheless, very few reports focused on detecting the effects of PCa on urinary polyamines levels, which in turn might provide a potential diagnostic tool for this increasing common cancer. In 1975 Fair et al. Urinary polyamine levels in the diagnosis of carcinoma of the prostate. J Urol. 1975; 114(1):88-92 had reported a significant elevation of urinary Spd content in PCa patients by electrophoresis, but not Put and Spin. Horn et al. Relationship of urinary polyamines to tumor activity and tumor volume in patients. Cancer Res. 1984; 44(10):4675-8 analyzed urinary Spd and Put content from patients with tumors in either breast, stomach, prostate, female genital tract, or metastatic carcinomas of unknown origins by LC with fluorometric detector in 1984 yielding an indeterminant conclusion. With the advance of analytical field, in the current disclosure, the potential abilities of three natural polyamines: Put, Spd and Spm, as urinary biomarkers for screening of PCa were evaluated by UPLC-MS/MS. Through a well validated method using separate deuterated internal standards for correcting matrix effects for each polyamine, it is believed that the analytical performance was much more reliable.
[0131] The observation of a declined level in urinary Spm actually was reasonable from results of previous literatures about PCa studies. Although only a limited number of tissue specimens had been examined, van der Graaf et al. Proton MR spectroscopy of prostatic tissue focused on the detection of spermine, a possible biomarker of malignant behavior in prostate cancer. MAGMA 2000; 10(3):153-9 reported a reduced Spm content in tumor prostatic tissues compared to normal and benign hyperplastic prostatic tissues by high performance liquid chromatography with fluorometric detector. Swanson et al. Proton HR-MAS spectroscopy and quantitative pathologic analysis of MRI/3D-MRSI-targeted postsurgical prostate tissues. Magn Reson Med 2003; 50(5): 944-54 also reported a decreased Spm level in prostate tissue samples by Proton high-resolution magic angle spinning nuclear magnetic resonance spectroscopy and quantitative histopathology. High grade cancer prostate tissue could be distinguished from low grade cancer tissue by decreased concentrations of Spm and citrate, as reported by G F Giskedegrd et al Spermine and citrate as metabolic biomarkers for assessing prostate cancer aggressiveness. PLoS One 2013; 8(4):e62375. Apart from direct monitoring of prostate tissue, Serkova et al. The metabolites citrate, myo-inositol, and spermine are potential age-independent markers of prostate cancer in human expressed prostatic secretions. Prostate. 2008; 68(6), 620-8 reported that in human expressed prostatic secretions, citrate, myo-inositol and Spm are potentially important markers of PCa, and all of them showed a decreased level in PCa patients compared to control samples. With respect to these previous research projects, a decrease in urinary Spm content could be foreseen, because urine represents a fluid closely related to exfoliated cancer cells and secreted prostatic products from the prostate. In essence, urine has the advantages of ready availability and the collection of which is non-invasive. Therefore the discovery of a useful urine PCa biomarker is inspiring to the current medical situation for reducing unnecessary biopsies and arranging patients for appropriate therapies.
[0132] To explain the declined level of Spm in PCa patients, the exact mechanisms lack clear evidence and are still under research. Schipper et al. Polyamines and prostatic cancer. Biochem Soc Tans. 2003; 31(2):375-80 suggested a possible explanation that changes of cell organization caused by cancer cell proliferation finally result in a decreased luminal volume, which in turn reduces the amount of secreted compounds in prostate tissue, prostatic fluid or even urine. But this could hardly explain why only urinary Spm level declined. Leo et al. Non-destructive quantitation of spermine in human prostate tissue samples using HRMAS 1H NMR spectroscopy at 9.4 T. FEBS Letters. 2001; 494(1-2):112-6 reported that Spm was a proposed endogeneous inhibitor to prostate cancer growth, and a linear correlation was found between Spm content and the volume percentage of normal prostatic epithelial cells as quantified by histopathology. And in recent studies it was suggested that dysregulation of polyamine metabolism, or more specifically polyamine catabolism, may be involved in carcinogenesis. Increases in spermine oxidase (SMO) and spermidine/spermine N.sup.1-acetyltransferase (SSAT) expression were observed in both precursor prostatic inflammatory atrophy lesions and early prostatic intraepithelial neoplastic lesions, which resulted in a depletion of Spm content (
[0133] This hypothesis is also supported by the observation of a significant increase in urinary diacetylspermine content in patients with urogenital malignancies resulted from the enzymatic action of SSAT, as reported by Hiramatsu, et al. Diagnostic and prognostic usefulness of N.sup.1, N.sup.8-diacetylspermidine and N.sup.1, N.sup.12-diacetylspermine in urine as novel markers of malignancy. J Cancer Res Clin Oncol. 1997; 123(10):539-45. Therefore the observation of a decrease in urinary Spm, as described herein, is in line with previous findings and suggested mechanisms. Without being bound by theory, it is hypothesized that the action of SMO and SSAT counteracted each other so no significant changes were found for Spd.
[0134] Nevertheless, unlike what G F Giskedegrd et al. Spermine and citrate as metabolic biomarkers for assessing prostate cancer aggressiveness. PLoS One 2013; 8(4):e62375 reported that prostatic Spm content can act as a biomarker to assess PCa aggressiveness, determinant definitive conclusion on whether urinary Spm shows similar cancer grade-differentiating ability could be established from the data disclosed herein. From the results, a drop in high grade cancer (GS=8-10) was observed comparing with low grade cancer (GS6), albeit not that significant. (1.23 in High grade vs 1.47 in low grade; p=0.611) Instead, it acts like a diagnostic biomarker working in accordance with TRUSPB for PCa diagnosis.
[0135] The PSA test leaves much to be desired as a primary screening test. It has been shown to cause over-diagnosis especially in patients showing values in the grey zone. For example, serum PSA alone demonstrated fair sensitivity and specificity of 65% and 47% respectively. Li et al. Macrophage inhibitory cytokine 1 biomarker serum immunoassay in combination with PSA is a more specific diagnostic tool for detection of prostate cancer. PLoS One. 2015; 10(4):e0122249 reported an even poorer sensitivity and specificity for it in their study (Sensitivity=54.8%, Specificity=57.1%, AUC=0.684). Another large-scale study by Ferro et al. Prostate Health Index (Phi) and Prostate Cancer Antigen 3 (PCA3) significantly improve prostate cancer detection at initial biopsy in a total PSA range of 2-10 ng/ml. PLoS One 2013; 8(7):e67687 showed that total PSA only gave AUC value of 0.520.07. When focusing on patients with PSA>4.0 ng/ml, the PSA test shows the best screening performance (AUC=0.730.04; See
[0136] To conclude on the basis of the first part of the present disclosure, the potential roles of the three main urinary polyamines as PCa biomarkers were evaluated. Among Put, Spd and Spm, Spm demonstrated an outstanding diagnostic performance for PCa, in particular for patients with elevated serum PSA level, upon comparison of their levels in PCa and BPH patients. Its AUC value is 0.830.03. This could help the current medical challenge brought by poor specificity of serum PSA test. And with our developed lanthanide based bioprobes, we can achieve a simple and quick quantification for PCa screening.
[0137] Part 2: Synthesized Lanthanide Complexes for Spm Sensing
[0138] A series of lanthanide compounds (1) was developed that is useful in the colorimetric quantitative and qualitative analysis of urinary polyamines.
##STR00002##
wherein,
Ln is a lanthanide metal; and
each M is independently selected from the group consisting of Na, Li, and K; or two M taken together represent Mg or Ca. In certain embodiments, two M taken together represent Mg, Ca, Sr, or Ba.
[0139] In certain embodiments, Ln is selected from the group consisting of La, Ce, Pr, Nd, Pr, Nd, Pm, Eu, Gd, Th, Dy, Ho, Er, Tm, Yb, and Lu. In certain embodiments, Ln is Eu.sup.3+.
[0140] In certain embodiments, M is Li and Ln is Eu.sup.3+.
[0141] Put and n-butylamine are significantly less effective than Spm and Spd in binding multiple poly(p-phenylene ethnylene (PPE) chains (i.e., the upper portion of the compound of Formula (I)) to form tightly associated aggregates with enhanced inter-chain exciton migration. Therefore, a chemical sensor based on nonspecific electrostatic interactions could still exhibit some selectivity between similar analytes, with high means, it binds better to Spm (+4 charged) and Spd (+3 charged) and worse to putrescine (+2 charged) and n-butylamine (+1 charged) (
[0142] Ligation of the Newly Developed Chromophore to Lanthaside Complexes Reveals Strong Binding and Specific Selectivity for Polyamines Through Linear/Two-Photon Excitation
[0143] Compound 1 was synthesized with the polyamines-specific binding site. (compound 1,
[0144] Titration of Europium Compound (1) with Spm and Sod
[0145] The significant f-f emission enhancement can be visualized under UV-excitation after compound 1 binds with polyamines (
[0146] Selectivity of Europium Compound (1) for Spm and Sod
[0147] The selectivity of the chemosensors for Spm and Spd over other bioactive cations, such as K.sup.+, Na.sup.+, Ca.sup.2+, and other biogenic amines is presented in
[0148] Preliminary Clinical Trial with 10 Prostate Cancer Patients' Urine Samples
[0149] More than 150 urine samples from prostate cancer patients were collected and analyzed for their Spm level by the standard protocol. (Creatinine level done by Jaffe's method and polyamine level checked with LC-MS/MS). The calibration curve of numerous polyamines (
[0150] A series of prostate cancer patient's urine samples were selected for pre-clinical trial. Their polyamine contents were pre-determined by LC and shown in
[0151] Experiment-wise, 2 mL of patient urine samples will be added into 1 mL europium sensor solution (final concentration of the Eu sensor will be 50 M). The samples will be placed in the spectrofluorometer and the responsive emission and emission lifetime signal changes will be monitored. The inventor also will monitor the emission spectra of the proposed complexes with the urine from the healthy volunteers as the control.
[0152] Standard addition method, as shown in
[0153] The mean values obtained by the two approaches were compared by Student's t tests where P<0.05 is considered to be statistically significant. There are not much differences between the readings obtained from luminescent complexes and the HPLCMS/MS (P<0.05) and those readings are varied in a small range (% RSD <10). The inventor can conclude that the inventor's luminescent complexes are sensitive and reliable to detect polyamines in the urine samples. Analysis of the variation of sample frequency with Spm/Spd concentrations will be undertaken using standard statistical packages running in Origin. Equations are used to model a Gaussian distribution.
[0154] Determination of the Binding Affinity and Selectivity of Compound 1 with Spm/Spd in Aqueous Solution
[0155] The developed compound 1 was examined through fluorescence and fluorescence lifetime titrations with various concentrations of the target Spm/Spd in solution and in biological media (simulated level of Spm-1.2 M/Spd-11.9 M in urine/blood). The physiological properties and detection limits of these sensors for Spm/Spd were also determined. Measurements were taken after attaining equilibrium, and the emission of the europium was monitored. Luminescent responses in terms of I.sub.0/(II.sub.0) (where I and I.sub.0 are the measured and blank luminescence intensities, respectively) were plotted as a function of the analyte concentration. For the determination of the binding strengths of the various analyte adducts, a series of analyte solutions at known concentrations were mixed with the Spm/Spd solutions at various concentrations. The binding constant, K.sub.B, was estimated from the ratio between the y-intercept and the slope that is to be obtained from the line of best fit using Benesi-Hildebrand equations. The signal changes of the lanthanide complex after binding with Spm/Spd may be induced by various mechanisms, such as the electron transfer process (Rehm-Weller equation) and redox potentials, and transient absorption with flash photolysis have been applied to understand the mechanism responsible for the change of the signal after the inventor's lanthanide systems tagging Spm/Spd.
[0156] A further embodiment of the present disclosure relates to an improved method for detecting Spm using an aptasensor gold nanoparticles (AuNPs).
[0157] Gold nanoparticles (AuNPs) emerged as a biocompatible nanomaterial and have been widely used in biomedical engineering and bioanalytical applications. For example colorimetric biosensing probes useful for detecting a wide variety of chemical species have been developed based on the red-shifting of their unique surface plasmon resonance band. Response can be viewed directly by naked eye upon any modulations of the aggregation state by the target analyte.
[0158] Disclosed herein is a comprehensive study on this phenomenon in connection with urinary polyamines. Different parameters of the diagnostic probe were evaluated, including the AuNPs size, DNA length, concentration, and pH towards. Based on these experiments, two sensing mechanisms of aptasensor were identified: depending on the amount of DNA being added, it either sensed based on the aggregation of DNA-AuNPS, which results in the red-shift of plasmonic band, or the precipitation of DNA-AuNPS which results in the decline of plasmonic band. The developed aptasensor could intelligently detect Spm via two different sensing mechanisms simply by changing the DNA concentration without complicated procedures. (
[0159] For the purposes of this disclosure, the terms DNA, DNA aptamer, and single stranded DNA are used interchangeably and refer to polynucleotides existing substantially in single strand form (e.g., greater than >60%, 70/%, 80%, 90%, 95%, 98%, 99%, or 99.9% exists in single stranded form) not bound to a complimentary sequence. Examples, of single stranded DNA as disclosed herein include DNA aptamer 12mer: CGACAACCACAA (SEQ ID NO:1); DNA aptamer 24mer: CGACAACCACAACACACAATCTGA (SEQ ID NO:2); and DNA aptamer 36mer: CGACAACCACAACACACAATCTGACGACAACCACAA (SEQ ID NO:3).
[0160] Materials and Instrument
[0161] All chemicals were acquired from Aldrich (Hong Kong, China) and Meryer (Shanghai, China). DNA aptamers (12mer: CGACAACCACAA (SEQ ID NO:1); 24mer: CGACAACCACAACACACAATCTGA (SEQ ID NO:2); 36mer: CGACAACCACAACACACAATCTGACGACAACCACAA (SEQ ID NO:3)) were obtained from Invitrogen (Hong Kong, China). Britton-Robinson (BR) buffer was prepared by mixing equal molar ratio of phosphoric acid, boric acid and acetic acid, and the pH was then tuned using sodium hydroxide solution. Artificial urine was prepared according to a recipe elsewhere. All standard solutions were prepared in Milli-Q water. For urine samples, they were collected from Princes of Wales Hospital, The Chinese University of Hong Kong.
[0162] The transmission electron microscope (TEM) images of as-prepared AuNPs were captured using a JEOL Model JEM-2011 (JEOL, Beijing, China). Dynamic Light Scattering (DLS) and zeta-potential measurements were achieved by a Zetasizer Nano-ZS90 System (Malvern Instruments, Shanghai, China). The UV-Vis absorption spectra were recorded using a Cary 8453 UV-Vis Spectrometer (Agilent, Hong Kong, China). Isothermal Titration Calorimetry study was achieved using MicroCal PEAQ-ITC Automated System (Malvern Instruments, Shanghai, China).
[0163] For urine sample analysis, liquid chromatography separation was done by an Agilent 1290 Infinity Quaternary LC System while mass analysis was done by an Agilent 6460 Triple Quadrupole mass spectrometer equipped with an Agilent Jet Stream technology electrospray ionization source (Agilent, Hong Kong, China). All the incubations were performed on a KS 260 Basic Orbital Shaker (IKA, Hong Kong, China).
[0164] Synthesis of Citrate-AuNPs
[0165] Three different sizes (4 nm, 13 nm, 27 nm) of AuNPs were prepared. For 4 nm citrate-AuNPs, synthesis of colloidal citrate-AuNPs was performed according to a previous published literature Gu, Y. J.; Cheng, J.; Lin, C. C.; Lam, Y. W.; Cheng, S. H.; Wong, W. T. Toxicol. Appl. Pharm. 2009, 237(2), 196. Briefly, chloroauric acid solution was mixed with trisodium citrate solution, then freshly-prepared sodium borohydride solution was added and left for 2 hours. For 13 nm and 27 nm AuNPs, the synthesis was done by the well-known Turkevich method, where trisodium citrate was used as both the reducing agent and capping ligands under refluxing condition. Final size as determined from TEM was 4.090.65 nm, 12.81.3 nm and 27.24.2 nm. (
[0166] In certain embodiments, the size of the AuNP is between about 1 nm to about 100 nm. In certain embodiments, the size of AuNP is between about 1 nm to about 90 nm, about 1 nm to about 80 nm, about 1 nm to about 70 nm, about 1 nm to about 60 nm, about 1 nm to about 50 nm, about 1 nm to about 40 nm, about 1 nm to about 30 nm, about 1 nm to about 20 nm, about 1 nm to about 10 nm, about 2 nm to about 10 nm, or about 2 nm to about 7 nm.
[0167] Quantitative Detection of Spm by AuNPs
[0168] Firstly, 80 nM as-prepared AuNPs was vortex-mixed with 25 nM DNA aptamer inside 4 mM BR buffer (pH-3.29) for selective adsorption to take place. Spm standard/sample solution was then added and incubated for 40 minutes. The mixture was then ready for UV-Vis absorption, DLS and zeta-potential measurements. In complicated matrices like artificial urine and clinical urine, DNA concentration was raised to 100 nM to provide a better protection.
[0169] Optimization of Working Conditions
[0170] Several parameters including AuNPs size (4, 13, 27 nm), DNA aptamer concentration (12.5, 25, 50, 100 & 200 nM), DNA length effect (12mer, 24mer & 36mer), pH (1.81, 3.29, 4.96, 6.99, 8.98 & 11.0) and length of incubation time were optimized based on the sensitivity towards Spm.
[0171] Sample Pretreatment Procedures
[0172] Briefly, a urine sample was thawed naturally and centrifuged for 5 minutes at 13000 rpm and 25C. Then it was passed through strong anion exchange solid phase extraction cartridge (Phenomenex, Strata, 100 mg/3 ml, USA) to retain unwanted organic acids, phenolic compounds and carbohydrates. Afterwards the solution was treated with concentrated perchloric acid for further deproteinization, which was then removed by neutralization using potassium hydroxide solution to form insoluble potassium perchlorate salt. Finally it was centrifuged again to obtain supernatant, filtered with 0.22 M PES filter and further diluted in water.
[0173] Isothermal Titration Calorimetry Study
[0174] For the study of interactions between DNA/citrate AuNPs and Spm, the AuNPs was firstly pre-concentrated using Amicon Ultra-15 30K centrifugal filter (Millipore, Hong Kong, China). Afterwards, 0.5 M AuNPs and different concentration of DNA aptamer (0, 0.5, 1 & 3p M) were firstly mixed and placed into the sample cell. 0.25 mM Spm solution was then gradually added for recording the temperature change per injection (2 L per injection in 150s interval at 25C).
[0175] For the study of selectivity of citrate against polyamines analogs, 1 mM trisodium citrate solution was firstly placed into sample cell, then 0.8 mM of different polyamine analogs solution was injected independently for recording the temperature under the above-mentioned conditions.
[0176] Data was then fitted the binding model of one site of binding and analyzed by the MicroCal PEAQ-ITC Analysis software.
[0177] Quantitative Detection of Spm by UPLC-MS/MS
[0178] The quantitation of Spm was performed by Ultra-high Performance Liquid Chromatography coupled with a triple quadrupole mass spectrometer (UPLC-MS/MS). LC separation was done by an Agilent 1290 Infinity Quaternary LC System while mass analyzing was done by an Agilent 6460 Triple Quadrupole mass spectrometer equipped with an Agilent Jet Stream technology electrospray ionization source. The column used was an Agilent EclipsePlus C18 RRHD (2.150 mm, 1.8 m) protected with an Agilent SB-C18 guard column (2.15 mm, 1.8 m).
[0179] The LC elution profiles were optimized as follows: Eluent A was water with 0.1% HFBA while eluent B was acetonitrile with 0.1% HFBA. Eluent A was decreased from 95% to 60% in 10 minutes. The gradient was then decreased from 60% to 10% of eluent A in 1 minute. Afterwards the gradient was held constant for 5 minutes. The gradient was then increased from 10% to 95% in 1 minute, followed by being held constant for 8 minutes. (Total run-time=25 minutes).
[0180] Autosampler and column temperature were set as 4 C. and 35 C. respectively. Injection was achieved by 5-second needle wash in Flush Port mode for 3 times with eluent B. In each time 10 L was injected.
[0181] For the source parameter, drying gas (nitrogen) temperature was set as 300C with 5 L/min flow rate. Nebulizer pressure was 45 psi. Sheath gas temperature was set as 250C with 11 L/min flow rate. Capillary voltage was set as 3500V. For mass detection, scheduled multiple reaction monitoring (MRM) was performed.
[0182] Results & Discussion
[0183] Working Principle
[0184] Sensitive and specific sensing towards Spm was achieved by the current developed aptasensor via two stages: The first stage, as being demonstrated in
[0185] To further study the driving force of citrate displacement by DNA, it was well studied before that the presence of salt would screen the charge repulsion between negatively charged AuNPs and DNA. In the inventors' case, the AuNPs are used directly without any clean-up. Therefore a lot of free citrate molecules and side products from sodium borohydride would act as such screening sources for DNA adsorption. A proof-of-concept experiment was performed to remove these free salts by ultrafiltration. It was found that without them, DNA cannot attach and the AuNPs would aggregate immediately upon addition of acidic BR buffer for protonating the citrate groups, even in the presence of DNA. And vice versa, when stock AuNPs solution was used, aggregation did not happen. This confirms the importance of free citrate and other salts for the aptasensor to function properly.
[0186] Optimization of Working Conditions
[0187] Working condition parameters as discussed below were studied and optimized carefully so as to maximize the analytical performance of the aptasensor for SPM sensing in urine. This was achieved by studying the slope of SPM calibration graphs, which reflects the corresponding sensitivity in each case, and the linear working range to fit the urinary content of SPM. The first parameter the inventors studied was the size effect of AuNPs. As being illustrated in
[0188] The second parameter is the DNA concentration. (
TABLE-US-00007 TABLE 6 Summarized results on the linear equation, R.sup.2 and linear range of Spm calibration graphs at different DNA concentration. DNA concentration Linear (nM) Equation R2 range 12.5 y = 0.2305x + 1.0134 0.9975 0-4 uM 25 y = 0.2657x + 0.9893 0.9988 0-6 uM 50 y = 0.2258x + 0.9987 0.9968 0-10 uM 100 y = 0.1972x + 1.0578 0.9959 0-10 uM 200 y = 0.0529x + 0.9981 0.9926 0-16 uM
[0189] The ratio of single stranded DNA to the gold nanoparticle can be selected, based in part on the complexity of the test sample.
[0190] In certain embodiments, for example, when the test sample consists of a complex matrix (e.g., clinical samples, artificial urine, artificial blood, or other samples with high quantities of interfering analytes), the molar ratio of the single stranded DNA to the gold nanoparticle is between about 4:1 to about 3:1 in the test sample. In certain embodiments, the molar ratio the single stranded DNA to the gold nanoparticle is between about 4:1 to about 3:1, about 3.9:1 to about 3:1, about 3.8:1 to about 3:1, about 3.7:1 to about 3:1, about 3.6:1 to about 3:1, about 3.5:1 to about 3:1, about 3.4:1 to about 3:1, about 3.3:1 to about 3:1, about 3.2:1 to about 3:1, or about 3.2:1 to about 3.1:1 in the test sample.
[0191] In other embodiments, for example, when the test sample consists of a simple matrix, the molar ratio of the single stranded DNA to the gold nanoparticle is between about 1:3 to about 1:4 in the test sample. In certain embodiments, the molar ratio of the single stranded DNA to the gold nanoparticle is between about 1:3 to about 1:4, about 1:3 to about 1:3.9, about 1:3 to about 1:3.8, about 1:3 to about 1:3.7, about 1:3 to about 1:3.6, about 1:3 to about 1:3.5, about 1:3 to about 1:3.4, about 1:3.1 to about 1:3.4, or about 1:3.1 to about 1:3.3 in the test sample.
[0192] In certain embodiments, for example, when the test sample consists of a complex matrix (e.g., clinical samples, artificial urine, artificial blood, or other samples with high quantities of interfering analytes), the concentration of the single stranded DNA is about 200 nM to about 300 nM and the concentration of the gold nanoparticle is about 50 nM to about 100 nM in the test sample. In certain embodiments, the concentration of the single stranded DNA is about 220 nM to about 280 nM and the concentration of the gold nanoparticle is about 60 nM to about 100 nM; the concentration of the single stranded DNA is about 240 nM to about 260 nM and the concentration of the gold nanoparticle is about 70 nM to about 100 nM; the concentration of the single stranded DNA is about 245 nM to about 255 nM and the concentration of the gold nanoparticle is about 70 nM to about 90 nM; or the concentration of the single stranded DNA is about 245 nM to about 255 nM and the concentration of the gold nanoparticle is about 75 nM to about 85 nM in the test sample.
[0193] In certain embodiments, the concentration of the single stranded DNA is about 240 nM to about 260 nM and the concentration of the gold nanoparticle is about 75 nM to about 87 nM in the test sample.
[0194] The third parameter was the pH. (
TABLE-US-00008 TABLE 7 Summarized results on the linear equation, R.sup.2 and linear range of Spm calibration graphs at different pH. pH Equation R.sup.2 Linear range 3.29 y = 0.2657x + 0.9893 0.9988 0-6 uM 4.96 y = 0.2510x + 0.9708 0.9944 0-10 uM 6.99 y = 0.2021x + 1.0845 0.9945 0-12 uM 8.98 y = 0.2321x + 1.0862 0.9914 0-8 uM 11.0 y = 0.0822x + 0.8323 0.9996 2-8 uM
[0195] In certain embodiments, the method is conducted at a pH between about 2 to about 8, about 2 to about 7, about 2 to about 6, about 2 to about 5, about 2 to about 4, about 3 to about 4, or about 3 to about 3.5.
[0196] In certain embodiments, the method is conducted at a pH between about 3 to about 8, about 3 to about 7, about 3 to about 6, about 3 to about 5, about 3 to about 4, or about 3 to about 3.5.
[0197] For the effect of DNA length, longer aptamer yields a more stable AuNP complex and protects AuNPs better from aggregation. (
[0198] In certain embodiments, the single stranded DNA has a length of about 5 nucleotides to about 50 nucleotides, about 5 nucleotides to about 45 nucleotides, about 5 nucleotides to about 40 nucleotides, about 5 nucleotides to about 35 nucleotides, about 5 nucleotides to about 30 nucleotides, about 10 nucleotides to about 30 nucleotides, about 15 nucleotides to about 30 nucleotides, or about 20 nucleotides to about 30 nucleotides.
[0199] Under the final optimal conditions, a linear Spm calibration curve from 0-51 M can be fitted by least square linear regression. (
[0200] Mechanistic Study on AuNPs Aggregation
[0201] During the optimization of DNA concentration, it was surprising to observe a drop of sensitivity to Spm when more DNA was added during the assay. This contradicted the accepted theory that Spm-induced aggregation occurred through DNA molecules by the ion-bridging effect. A control experiment in the absence of DNA was performed to gain more information. Surprisingly, the Spm-induced aggregation process could still be detected and exhibited faster initial kinetics rates, as compared with assays conducted in the presence of DNA. (
[0202] To have a deeper insight into the mechanism, the inventors performed several ITC experiments: Same amount of citrate capped AuNPs was firstly mixed with different DNA concentrations (0, 0.5, 1 and 3 M) separately. Spm solution was then added gradually and the temperature change was measured for each injection. The results are shown in
TABLE-US-00009 TABLE 8 Thermodynamic parameters of the binding of Spm to AuNPs at differen tDNA concentration. DNA concentration K.sub.D H G TS (M) (M) (kcal/mol) (kcal/mol) (kcal/mol) 0 8.13E06 67.9 6.95 61.0 0.5 2.03E06 13.4 7.77 5.68 1 3.45E07 8.40 8.82 0.418 3 4.72E07 7.52 8.63 1.12
[0203] When more DNA was added, the enthalpic peak gradually shifted to the right as at higher molar ratios of SPM to AuNP, implying that the AuNPs aggregation could only be initiated at a higher concentration of SPM. This data matched well with the results from UV-Vis absorption measurements which revealed the decline of sensitivity towards SPM at a higher DNA concentration. After analyzing the thermodynamic parameters, it could be concluded that the Spm-induced aggregation mainly happened via an enthalpy-driven electrostatic/hydrogen-bonding interaction with both DNA and citrate as reflected from the comparatively large negative values of AH. The entropy component gradually became more favorable as the DNA concentration increased, but enthalpy remained as the major driving force. Therefore, the drop of AH strength with increasing DNA concentrations implied the weakening of such electrostatic/hydrogen-bonding interactions (Table 9). From these results, it was hypothesized that Spm interacted with AuNPs electrostatically primarily through the surface citrate ligands, but not through DNA aptamers. The role of DNA in the current aptasensor was to displace surficial citrate ligands to provide protection to AuNPs, and concurrently to control the extent of citrate-Spm interaction and thus AuNPs' aggregation rate and therefore the analytical performance of the aptasensor.
TABLE-US-00010 TABLE 9 Thermodynamic parameters of the binding of DNA to different polyamine analogs. H G TS Fitness of (kcal/ (kcal/ (kcal/ Analyte binding model K.sub.D (M) mol) mol) mol) Spermine Good 1.10 10.sup.6 7.83 8.13 0.308 Spermidine Good 1.11 10.sup.6 4.44 8.13 3.69 Histamine Good 1.27 10.sup.5 3.61 6.68 3.07 Putrescine Good 3.97 10.sup.6 7.29 7.37 0.08 Arginine Good 1.42 10.sup.5 4.59 6.61 2.03 Tyramine Good 3.06 10.sup.5 13.6 6.16 7.46 Cadaverine* Good 9.33 10.sup.6 1.06 6.86 7.93 Ornithine Cannot be N/A N/A N/A N/A fitted Control Cannot be N/A N/A N/A N/A (water) fitted *Cadaverine interacted with DNA following an endothermic pathway.
[0204] To further confirm the importance of surface citrate during aggregation, an additional ITC experiment was conducted to study the interactions between pure citrate ligands and other polyamine analogs. (Table 10) Although there are three carboxylate groups in free citrate for interaction, only one remained when being capped onto AuNPs; and the H strength sequence (Spermine>Spermidine>Histamine>Putrescine>Arginine>Tyramine=Cadaverine=Ornithine=Creatinine=Control) was very similar to that of the cross-reactivity sequence (Spermine>Spermidine>Histamine>Putrescine=Arginine=Tyramine=Cadaverine=Omithine=Creatinine=Control) determined from UV-Vis absorption measurements but not to that of the DNA. Table 9 and 10 for the summarized thermodynamics data of free citrate and DNA obtained from ITC. (
TABLE-US-00011 TABLE 10 Thermodynamic parameters of the binding of citrate to different polyamine analogs. H G TS (kcal/ (kcal/ (kcal/ Analytes Binding N (sites) K.sub.D (M) mol) mol) mol) Spermine Binding 1.40E02 1.26E06 36.9 8.05 28.8 Spermidine Binding 3.80E02 2.11E06 18.4 7.74 10.7 Histamine Binding 9.96 6.56E03 15.6 2.98 12.7 Putrescine Binding 4.10E02 1.41E06 14.5 7.98 6.54 Arginine Binding 3.68 3.65E03 6.45 3.33 3.13 (Poor) Tyramine Binding 0.102 3.88E06 0.24 7.38 7.14 (Poor) Cadaverine No N/A N/A N/A N/A N/A binding Ornithine No N/A N/A N/A N/A N/A binding Creatinine No N/A N/A N/A N/A N/A binding Control No N/A N/A N/A N/A N/A (water) binding
[0205] Finally, to study if DNA really took part in the interactions, the selectivity profile of AuNPs against polyamine analogs at different DNA concentrations was monitored. Each of their cross-reactivity was determined by comparing the Abs.sub.610/Abs.sub.512 to that of Spm. Upon modulating the capping ratio by adding more DNA for displacing citrate, a change on the overall selectivity profile of AuNPs was expected. However, after normalization,
[0206] Application of Aptasensor in Real Samples
[0207] To demonstrate that the current developed aptasensor was fitted for its intended purpose for detecting Spm, its applicability was being tested in one of the most Spm-content concerning sample: urine. Artificial urine was prepared to mimic clinical urine during early investigation. Unfortunately, under the described optimal condition, the aptasensor failed to work properly since artificial urine contains a high salt concentration which could effectively screen negative charges for aggregation. AuNPs could not tolerate it even in the absence of Spm. The origin of such an undesired aggregation was a result of insufficient AuNPs protection by the surfactants. Clearly addition of only 25 nM DNA was not enough for working in such complicated matrix and to provide further protection, the working DNA concentration was elevated to 250 nM.
[0208] Spm was spiked into artificial urine and
TABLE-US-00012 TABLE 11 Determination of spiked SPM in artificial urine specimen. (n = 3) Amount spiked Average Relative standard Sample (M) recovery (%) deviation (%) Artificial 2.0 87.90 5.46 urine 4.0 100.61 0.07 6.0 94.76 2.65 8.0 106.70 2.01 Urine 1 3.0 98.80 9.52 Urine 2 3.0 121.98 7.76 Urine 3 3.0 104.09 4.21
[0209] To further demonstrate the applicability of the aptasensor for a fast urinary Spm screening, three clinical urine samples from cancerous patients were selected for further spike analysis. Before that, common urinary components (Urea, uric acid, glutathione, human serum albumin, calcium salt and creatinine) were tested to check if they interfered seriously with Spm sensing. (
TABLE-US-00013 TABLE 12 Determination of spiked SPM in clinical urine specimen. (n = 3) Relative Amount Average standard Clinical spiked recovery deviation sample (M) (%) (%) 1 3.0 98.80 9.52 2 3.0 121.98 7.76 3 3.0 104.09 4.21
[0210] To demonstrate the usefulness of current developed aptasensor, the Spm content of low concentration Spa human urine was evaluated. Four urine samples with insignificant Spm level, as determined by UPLC-MS/MS (<5 ppb), were chosen for studying the matrix effect. Unfortunately, the matrix effect differed from sample to sample, especially in urine sample 3 (green curve in
[0211] The matrix effect of urine with that of blank and artificial urine solution was compared, but no distinct differences were observed. (
TABLE-US-00014 TABLE 13 Spike Analysis in urine specimen (n = 2) Amount spiked Average Relative standard Sample (M) recovery (%) deviation (%) Urine 1 1.0 93.26 6.60 3.0 98.80 9.52 Urine 2 1.0 99.29 4.90 3.0 121.98 7.76 Urine 3 1.0 93.51 2.68 3.0 104.09 4.21
[0212] To further show that the aptasensor was fit for intended purpose of fast urinary Spm screening, the original Spm level present in selected urine samples was determined. Results were compared to that of UPLC-MS/MS which acted as a reference method. (Table 14)
TABLE-US-00015 TABLE 14 Quantitation of Spm in urine specimen by UPLC-MS/MS and current developed method By UPLCMS/MS By developed aptasensor Average Average spermine spermine Average found RSD found RSD recovery (M) (%) (M) (%) (%) Urine 5 29.18 2.51 28.52 5.06 97.75 Urine 6 13.26 0.92 14.33 2.02 108.08 Urine 7 10.75 1.17 12.94 7.61 120.34
[0213] Optical Method for Determination of Urinary Biogenic Amines by Metal-Organic Framework (MOF)
[0214] The rapidly emerging interest in the evaluation of biogenic amines especially Spd and Spm has brought up new demands for efficacious technical methods. These amines are abundantly present in human urinary excretion. For the simultaneous quantification of Spd and Spm in both aqueous and urinary phase, an optical method relying on the efficient application of Metal-Organic Framework (MOF) is currently under development. The sensor is designed in such a way that the framework offers unsaturated metal ions coordination spheres for the penetration and binding of small and cationic species. The complementarity of binding sites that prevailed in biogenic amine and steric requirements of the cation coordination sphere will govern the selectivity for biogenic amine, providing a good specificity towards target amines.
[0215] The method will allow visual naked-eye determination as the color of the aqueous solution of MOF upon the addition of Spd and Spm individually. Further titration experiments of MOF sensor against increasing concentration of Spd and Spm will be performed to examine the linear relation of absorbance for quantitative purpose. Eventually, the real sample application of proposed MOF sensor will be validated using artificial urine and clinical urine samples from prostate cancer patients. Any modulations in chromogenic signals being observed; i.e., change in color of the sensor solution when reacting with urinary biogenic amines, will allow a simple and direct quantitation of these high-interest analyzes for cancer screening.
INDUSTRIAL APPLICATIONS
[0216] The present invention relates to urinary polyamines for prostate cancer biomarkers. In particular, the present invention provides a novel, highly-sensitive and specific, and colour-changing polyamines tracer with the use of lanthanide complexes or citrate-AuNPs with DNA aptamer as prostate cancer diagnostic biomarker for early prostate cancer screening, which has a great potential to be applied in future clinical diagnosis.