Methods and compositions for plant pest control
10000767 ยท 2018-06-19
Assignee
Inventors
- Michael J. Crawford (St. Louis, MO, US)
- Xiangqian Li (Chesterfield, MO, US)
- Mahak Kapoor (Creve Coeur, MO, US)
- Deryck Jeremy Williams (University City, MO)
Cpc classification
C12N15/8206
CHEMISTRY; METALLURGY
C12N15/8218
CHEMISTRY; METALLURGY
A01N65/00
HUMAN NECESSITIES
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
International classification
C12N15/82
CHEMISTRY; METALLURGY
A01N65/00
HUMAN NECESSITIES
Abstract
Provided are methods and compositions to improve fungal disease resistance in various crop plants. Also provided are combinations of compositions and methods to improve fungal disease resistance in various crop plants.
Claims
1. A method for producing a soybean plant exhibiting an improvement in Soy Cyst Nematode (SCN) resistance, the method comprising topically applying to a plant surface a composition that comprises: (a) at least four polynucleotides that comprise: (i) a polynucleotide of 25 to 150 nucleotides in length that comprises a segment of 25 contiguous nucleotides that are identical or complementary to SEQ ID NO: 126; (ii) a polynucleotide of 25 to 150 nucleotides in length that comprises a segment of 25 contiguous nucleotides that are identical or complementary to SEQ ID NO: 127; (iii) a polynucleotide of 25 to 150 nucleotides in length that comprises a segment of 25 contiguous nucleotides that are identical or complementary to SEQ ID NO: 128; and (iv) a polynucleotide of 25 to 150 nucleotides in length that comprises a segment of 25 contiguous nucleotides that are identical or complementary to SEQ ID NO: 129, wherein said polynucleotides are polynucleotide is not operably linked to a promoter or a viral vector and wherein said polynucleotides are not integrated into the plant chromosome; and (b) a transfer agent; and thereby producing a soybean plant that exhibits an improvement in SCN resistance resulting from suppression of a BAX inhibitor 1 (BI-1) gene.
2. The method of claim 1, wherein said polynucleotides comprise sense ssDNA, sense ssRNA, dsRNA, dsDNA, a double stranded DNA/RNA hybrid, anti-sense ssDNA, or anti-sense ssRNA.
3. The method of claim 1, wherein said composition further comprises a non-polynucleotide herbicidal molecule, a polynucleotide herbicidal molecule, a polynucleotide that suppresses an herbicide target gene, an insecticide, a fungicide, a nematocide, or a combination thereof.
4. The method of claim 1, wherein said composition further comprises a non-polynucleotide herbicidal molecule and said plant is resistant to said non-polynucleotide herbicidal molecule.
5. The method of claim 1, wherein said transfer agent comprises an organosilicone preparation.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
DETAILED DESCRIPTION
I. Definitions
(3) The following definitions and methods are provided to better define the present embodiments and to guide those of ordinary skill in the art in the practice of the present embodiments. Unless otherwise noted, terms are to be understood according to conventional usage by those of ordinary skill in the relevant art.
(4) Where a term is provided in the singular, the inventors also contemplate aspects described by the plural of that term.
(5) As used herein, the terms DNA, DNA molecule, and DNA polynucleotide molecule refer to a single-stranded DNA or double-stranded DNA molecule of genomic or synthetic origin, such as, a polymer of deoxyribonucleotide bases or a DNA polynucleotide molecule.
(6) As used herein, the terms DNA sequence, DNA nucleotide sequence, and DNA polynucleotide sequence refer to the nucleotide sequence of a DNA molecule.
(7) As used herein, the term gene refers to any portion of a nucleic acid that provides for expression of a transcript or encodes a transcript. A gene thus includes, but is not limited to, a promoter region, 5 untranslated regions, transcript encoding regions that can include intronic regions, and 3 untranslated regions.
(8) As used herein, the terms RNA, RNA molecule, and RNA polynucleotide molecule refer to a single-stranded RNA or double-stranded RNA molecule of genomic or synthetic origin, such as, a polymer of ribonucleotide bases that comprise single or double stranded regions.
(9) Unless otherwise stated, nucleotide sequences in the text of this specification are given, when read from left to right, in the 5 to 3 direction. The nomenclature used herein is that required by Title 37 of the United States Code of Federal Regulations 1.822 and set forth in the tables in WIPO Standard ST.25 (1998), Appendix 2, Tables 1 and 3.
(10) As used herein, a plant surface refers to any exterior portion of a plant. Plant surfaces thus include, but are not limited to, the surfaces of flowers, stems, tubers, fruit, anthers, pollen, leaves, roots, or seeds. A plant surface can be on a portion of a plant that is attached to other portions of a plant or on a portion of a plant that is detached from the plant.
(11) As used herein, the phrase polynucleotide is not operably linked to a promoter refers to a polynucleotide that is not covalently linked to a polynucleotide promoter sequence that is specifically recognized by either a DNA dependent RNA polymerase II protein or by a viral RNA dependent RNA polymerase in such a manner that the polynucleotide will be transcribed by the DNA dependent RNA polymerase II protein or viral RNA dependent RNA polymerase. A polynucleotide that is not operably linked to a promoter can be transcribed by a plant RNA dependent RNA polymerase.
(12) As used herein, SEQ ID NO:, though displayed in the Sequence Listing in the form of ssDNA or ssRNA, encompass dsDNA equivalents, dsRNA equivalents, ssRNA as shown or equivalents, ssRNA complements, ssDNA as shown or equivalents, and ssDNA complements.
(13) As used herein, a first nucleic-acid sequence is operably connected or linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably linked to an RNA and/or protein-coding sequence if the promoter provides for transcription or expression of the RNA or coding sequence. Generally, operably linked DNA sequences are contiguous and, where necessary to join two protein-coding regions, are in the same reading frame.
(14) As used herein, the phrase organosilicone preparation refers to a liquid comprising one or more organosilicone compounds, wherein the liquid or components contained therein, when combined with a polynucleotide in a composition that is topically applied to a target plant surface, enable the polynucleotide to enter a plant cell. Examples of organosilicone preparations include, but are not limited to, preparations marketed under the trade names Silwet or BREAK-THRU and preparations provided in Table 1. In certain embodiments, an organosilicone preparation can enable a polynucleotide to enter a plant cell in a manner permitting a polynucleotide suppression of target gene expression in the plant cell.
(15) As used herein, the phrase provides for an improvement in fungal disease resistance refers to any measurable increase in a plants resistance to fungal damage. In certain embodiments, an improvement in fungal disease resistance in a plant or plant part can be determined in a comparison to a control plant or plant part that has not been treated with a composition comprising a polynucleotide and a transfer agent. When used in this context, a control plant is a plant that has not undergone treatment with polynucleotide and a transfer agent. Such control plants would include, but are not limited to, untreated plants or mock treated plants.
(16) As used herein, the phrase provides for a reduction, when used in the context of a transcript or a protein in a plant or plant part, refers to any measurable decrease in the level of transcript or protein in a plant or plant part. In certain embodiments, a reduction of the level of a transcript in a plant or plant part can be determined in a comparison to a control plant or plant part that has not been treated with a composition comprising a polynucleotide and a transfer agent. When used in this context, a control plant or plant part is a plant or plant part that has not undergone treatment with polynucleotide and a transfer agent. Such control plants or plant parts would include, but are not limited to, untreated or mock treated plants and plant parts.
(17) As used herein, the phrase wherein said plant does not comprise a transgene refers to a plant that lacks either a DNA molecule comprising a promoter that is operably linked to a polynucleotide or a recombinant viral vector.
(18) As used herein, the phrase suppressing expression or suppression, when used in the context of a gene, refers any measurable decrease in the amount and/or activity of a product encoded by the gene. Thus, expression of a gene can be suppressed when there is a reduction in levels of a transcript from the gene, a reduction in levels of a protein encoded by the gene, a reduction in the activity of the transcript from the gene, a reduction in the activity of a protein encoded by the gene, any one of the preceding conditions, or any combination of the preceding conditions. In this context, the activity of a transcript includes, but is not limited to, its ability to be translated into a protein and/or to exert any RNA-mediated biologic or biochemical effect. In this context, the activity of a protein includes, but is not limited to, its ability to exert any protein-mediated biologic or biochemical effect. In certain embodiments, a suppression of gene expression in a plant or plant part can be determined in a comparison of gene product levels or activities in a treated plant to a control plant or plant part that has not been treated with a composition comprising a polynucleotide and a transfer agent. When used in this context, a control plant or plant part is a plant or plant part that has not undergone treatment with polynucleotide and a transfer agent. Such control plants or plant parts would include, but are not limited to, untreated or mock treated plants and plant parts.
(19) As used herein, the term transcript corresponds to any RNA that is produced from a gene by the process of transcription. A transcript of a gene can thus comprise a primary transcription product which can contain introns or can comprise a mature RNA that lacks introns.
(20) As used herein, the term liquid refers to both homogeneous mixtures such as solutions and non-homogeneous mixtures such as suspensions, colloids, micelles, and emulsions.
II. Overview
(21) The hypersensitive reaction (HR) in plants is a form of programmed cell death involved in many developmental processes and stress responses including disease resistance to pathogens.
(22) The protein BAX inhibitor 1 (BI-1), localized at the endoplasmic reticulum and the nuclear envelope in both plants and animals, is a negative regulator of programmed cell death. The silencing of BAX inhibitor 1 increases the resistance of barley to powdery mildew infection.
(23) Provided herein are certain methods and polynucleotide compositions that can be applied to living plant cells/tissues to suppress expression of target genes and that provide improved fungal disease resistance to a crop plant. Also provided herein are plants and plant parts exhibiting fungal disease resistance as well as processed products of such plants or plant parts. The compositions may be topically applied to the surface of a plant, such as to the surface of a leaf, and include a transfer agent. Aspects of the method can be applied to various crops, for example, including but not limited to: i) row crop plants including, but are not limited to, corn, barley, sorghum, soybean, cotton, canola, sugar beet, alfalfa, sugarcane, rice, and wheat; ii) vegetable plants including, but not limited to, tomato, potato, sweet pepper, hot pepper, melon, watermelon, cucumber, eggplant, cauliflower, broccoli, lettuce, spinach, onion, peas, carrots, sweet corn, Chinese cabbage, leek, fennel, pumpkin, squash or gourd, radish, Brussels sprouts, tomatillo, garden beans, dry beans, or okra; iii) culinary plants including, but not limited to, basil, parsley, coffee, or tea; iv) fruit plants including but not limited to apple, pear, cherry, peach, plum, apricot, banana, plantain, table grape, wine grape, citrus, avocado, mango, or berry; v) a tree grown for ornamental or commercial use, including, but not limited to, a fruit or nut tree; or, vi) an ornamental plant (e. g., an ornamental flowering plant or shrub or turf grass). The methods and compositions provided herein can also be applied to plants produced by a cutting, cloning, or grafting process (i. e., a plant not grown from a seed) that include fruit trees and plants. Fruit trees produced by such processes include, but are not limited to, citrus and apple trees. Plants produced by such processes include, but are not limited to, avocados, tomatoes, eggplant, cucumber, melons, watermelons, and grapes as well as various ornamental plants.
(24) Without being bound by theory, the compositions and methods of the present embodiments are believed to operate through one or more of the several natural cellular pathways involved in RNA-mediated gene suppression as generally described in Brodersen and Voinnet (2006), Trends Genetics, 22:268-280; Tomari and Zamore (2005) Genes & Dev., 19:517-529; Vaucheret (2006) Genes Dev., 20:759-771; Meins et al. (2005) Annu. Rev. Cell Dev. Biol., 21:297-318; and Jones-Rhoades et al. (2006) Annu. Rev. Plant Biol., 57:19-53. RNA-mediated gene suppression generally involves a double-stranded RNA (dsRNA) intermediate that is formed intra-molecularly within a single RNA molecule or inter-molecularly between two RNA molecules. This longer dsRNA intermediate is processed by a ribonuclease of the RNAase III family (Dicer or Dicer-like ribonuclease) to one or more shorter double-stranded RNAs, one strand of which is incorporated into the RNA-induced silencing complex (RISC). For example, the siRNA pathway involves the cleavage of a longer double-stranded RNA intermediate to small interfering RNAs (siRNAs). The size of siRNAs is believed to range from about 19 to about 25 base pairs, but the most common classes of siRNAs in plants include those containing 21 to 24 base pairs (See, Hamilton et al. (2002) EMBO J., 21:4671-4679).
(25) Polynucleotides
(26) As used herein, polynucleotide refers to a DNA or RNA molecule containing multiple nucleotides and generally refers both to oligonucleotides (a polynucleotide molecule of 18-25 nucleotides in length) and longer polynucleotides of 26 or more nucleotides. Embodiments include compositions including oligonucleotides having a length of 18-25 nucleotides (18-mers, 19-mers, 20-mers, 21-mers, 22-mers, 23-mers, 24-mers, or 25-mers), or medium-length polynucleotides having a length of 26 or more nucleotides (polynucleotides of 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 100, about 110, about 120, about 130, about 140, about 150, about 160, about 170, about 180, about 190, about 200, about 210, about 220, about 230, about 240, about 250, about 260, about 270, about 280, about 290, or about 300 nucleotides), or long polynucleotides having a length greater than about 300 nucleotides (e. g., polynucleotides of between about 300 to about 400 nucleotides, between about 400 to about 500 nucleotides, between about 500 to about 600 nucleotides, between about 600 to about 700 nucleotides, between about 700 to about 800 nucleotides, between about 800 to about 900 nucleotides, between about 900 to about 1000 nucleotides, between about 300 to about 500 nucleotides, between about 300 to about 600 nucleotides, between about 300 to about 700 nucleotides, between about 300 to about 800 nucleotides, between about 300 to about 900 nucleotides, or about 1000 nucleotides in length, or even greater than about 1000 nucleotides in length, for example up to the entire length of a target gene including coding or non-coding or both coding and non-coding portions of the target gene). Where a polynucleotide is double-stranded, its length can be similarly described in terms of base pairs.
(27) Polynucleotide compositions used in the various embodiments include compositions including oligonucleotides, polynucleotides, or a mixture of both, including: RNA or DNA or RNA/DNA hybrids or chemically modified oligonucleotides or polynucleotides or a mixture thereof. In certain embodiments, the polynucleotide may be a combination of ribonucleotides and deoxyribonucleotides, for example, synthetic polynucleotides consisting mainly of ribonucleotides but with one or more terminal deoxyribonucleotides or synthetic polynucleotides consisting mainly of deoxyribonucleotides but with one or more terminal dideoxyribonucleotides. In certain embodiments, the polynucleotide includes non-canonical nucleotides such as inosine, thiouridine, or pseudouridine. In certain embodiments, the polynucleotide includes chemically modified nucleotides. Examples of chemically modified oligonucleotides or polynucleotides are well known in the art; see, for example, U.S. Patent Publication 2011/0171287, U.S. Patent Publication 2011/0171176, U.S. Patent Publication 2011/0152353, U.S. Patent Publication 2011/0152346, and U.S. Patent Publication 2011/0160082, which are herein incorporated by reference. Illustrative examples include, but are not limited to, the naturally occurring phosphodiester backbone of an oligonucleotide or polynucleotide which can be partially or completely modified with phosphorothioate, phosphorodithioate, or methylphosphonate internucleotide linkage modifications, modified nucleoside bases or modified sugars can be used in oligonucleotide or polynucleotide synthesis, and oligonucleotides or polynucleotides can be labeled with a fluorescent moiety (e. g., fluorescein or rhodamine) or other label (e. g., biotin).
(28) Polynucleotides can be single- or double-stranded RNA, single- or double-stranded DNA, double-stranded DNA/RNA hybrids, and modified analogues thereof. In certain embodiments, the polynucleotides that provide single-stranded RNA in the plant cell may be: (a) a single-stranded RNA molecule (ssRNA), (b) a single-stranded RNA molecule that self-hybridizes to form a double-stranded RNA molecule, (c) a double-stranded RNA molecule (dsRNA), (d) a single-stranded DNA molecule (ssDNA), (e) a single-stranded DNA molecule that self-hybridizes to form a double-stranded DNA molecule, (f) a single-stranded DNA molecule including a modified Pol III gene that is transcribed to an RNA molecule, (g) a double-stranded DNA molecule (dsDNA), (h) a double-stranded DNA molecule including a modified Pol III gene that is transcribed to an RNA molecule, and (i) a double-stranded, hybridized RNA/DNA molecule, or combinations thereof. In certain embodiments, these polynucleotides can comprise both ribonucleic acid residues and deoxyribonucleic acid residues. In certain embodiments, these polynucleotides include chemically modified nucleotides or non-canonical nucleotides. In certain embodiments of the methods, the polynucleotides include double-stranded DNA formed by intramolecular hybridization, double-stranded DNA formed by intermolecular hybridization, double-stranded RNA formed by intramolecular hybridization, or double-stranded RNA formed by intermolecular hybridization. In certain embodiments where the polynucleotide is a dsRNA, the anti-sense strand will comprise at least 18 nucleotides that are essentially complementary to the target gene. In certain embodiments the polynucleotides include single-stranded DNA or single-stranded RNA that self-hybridizes to form a hairpin structure having an at least partially double-stranded structure including at least one segment that will hybridize to RNA transcribed from the gene targeted for suppression. Not intending to be bound by any mechanism, it is believed that such polynucleotides are or will produce single-stranded RNA with at least one segment that will hybridize to RNA transcribed from the gene targeted for suppression. In certain embodiments, the polynucleotides can be operably linked to a promotergenerally a promoter functional in a plant, for example, a pol II promoter, a pol III promoter, a pol IV promoter, or a pol V promoter.
(29) The polynucleotide molecules of the present embodiments are designed to modulate expression by inducing regulation or suppression of an endogenous gene in a plant and are designed to have a nucleotide sequence essentially identical or essentially complementary to the nucleotide sequence of an endogenous gene of a plant or to the sequence of RNA transcribed from an endogenous gene of a plant, which can be coding sequence or non-coding sequence. These effective polynucleotide molecules that modulate expression are referred to herein as a trigger, or triggers. By essentially identical or essentially complementary it is meant that the trigger polynucleotides (or at least one strand of a double-stranded polynucleotide) have sufficient identity or complementarity to the endogenous gene or to the RNA transcribed from the endogenous gene (e.g. the transcript) to suppress expression of the endogenous gene (e.g. to effect a reduction in levels or activity of the gene transcript and/or encoded protein). Polynucleotides of the methods and compositions provided herein need not have 100 percent identity to a complementarity to the endogenous gene or to the RNA transcribed from the endogenous gene (i.e. the transcript) to suppress expression of the endogenous gene (i.e. to effect a reduction in levels or activity of the gene transcript or encoded protein). Thus, in certain embodiments, the polynucleotide or a portion thereof is designed to be essentially identical to, or essentially complementary to, a sequence of at least 18 or 19 contiguous nucleotides in either the target gene or messenger RNA transcribed from the target gene (e.g. the transcript). In certain embodiments, an essentially identical polynucleotide has 100 percent sequence identity or at least about 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent sequence identity when compared to the sequence of 18 or more contiguous nucleotides in either the endogenous target gene or to an RNA transcribed from the target gene (e.g. the transcript). In certain embodiments, an essentially complementary polynucleotide has 100 percent sequence complementarity or at least about 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent sequence complementarity when compared to the sequence of 18 or more contiguous nucleotides in either the target gene or RNA transcribed from the target gene.
(30) In certain embodiments, polynucleotides used in the methods and compositions provided herein can be essentially identical or essentially complementary to any of: i) conserved regions of BAX inhibitor 1 (BI-1) genes of both monocot and dicot plants; ii) conserved regions of BAX inhibitor 1 (BI-1) genes of monocot plants; or iii) conserved regions of BAX inhibitor 1 (BI-1) genes of dicot plants. Such polynucleotides that are essentially identical or essentially complementary to such conserved regions can be used to improve fungal disease resistance by suppressing expression of BAX inhibitor 1 (BI-1) genes in any of: i) both dicot and monocot plants, including, but not limited to, corn, barley, wheat, sorghum, rice, cucumber, pea, Medicago sp., soybean, pepper, tomato, and grape; ii) monocot plants, including, but not limited to, corn, barley, wheat, sorghum, switchgrass, and rice, and; or iii) dicot plants, including, but not limited to, cucumber, pea, Medicago sp., soybean, pepper, tomato, and grape. Conserved regions of dicot and monocot plant BAX inhibitor 1 (BI-1) genes of SEQ ID NO: 2, 4, 6, 7, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, and 32 can be targeted by essentially identical or essentially complementary polynucleotides.
(31) Polynucleotides containing mismatches to the target gene or transcript can thus be used in certain embodiments of the compositions and methods provided herein. In certain embodiments, a polynucleotide can comprise at least 19 contiguous nucleotides that are essentially identical or essentially complementary to said gene or said transcript or comprises at least 19 contiguous nucleotides that are essentially identical or essentially complementary to the target gene or target gene transcript. In certain embodiments, a polynucleotide of 19 continuous nucleotides that is essentially identical or essentially complementary to the endogenous target gene or to an RNA transcribed from the target gene (e.g. the transcript) can have 1 or 2 mismatches to the target gene or transcript. In certain embodiments, a polynucleotide of 20 or more nucleotides that contains a contiguous 19 nucleotide span of identity or complementarity to the endogenous target gene or to an RNA transcribed from the target gene can have 1 or 2 mismatches to the target gene or transcript. In certain embodiments, a polynucleotide of 21 continuous nucleotides that is essentially identical or essentially complementary to the endogenous target gene or to an RNA transcribed from the target gene (e.g. the transcript) can have 1, 2, or 3 mismatches to the target gene or transcript. In certain embodiments, a polynucleotide of 22 or more nucleotides that contains a contiguous 21 nucleotide span of identity or complementarity to the endogenous target gene or to an RNA transcribed from the target gene can have 1, 2, or 3 mismatches to the target gene or transcript. In designing polynucleotides with mismatches to an endogenous target gene or to an RNA transcribed from the target gene, mismatches of certain types and at certain positions that are more likely to be tolerated can be used. In certain embodiments, mismatches formed between adenine and cytosine or guanosine and uracil residues are used as described by Du et al. Nucleic Acids Research, 2005, Vol. 33, No. 5 1671-1677. In certain embodiments, mismatches in 19 base pair overlap regions can be at the low tolerance positions 5, 7, 8 or 11 (from the 5 end of a 19 nucleotide target) with well tolerated nucleotide mismatch residues, at medium tolerance positions 3, 4, and 12-17, and/or at the high tolerance nucleotide positions at either end of the region of complementarity (i.e. positions 1, 2, 18, and 19) as described by Du et al. Nucleic Acids Research, 2005, Vol. 33, No. 5 1671-1677. It is further anticipated that tolerated mismatches can be empirically determined in assays where the polynucleotide is applied to the plants via the methods provided herein and the treated plants assayed for suppression of BAX inhibitor 1 (BI-1) expression or appearance of fungal disease resistance.
(32) In certain embodiments, polynucleotide molecules are designed to have 100 percent sequence identity with or complementarity to one allele or one family member of a given target gene coding or non-coding sequence of a BI-1 target gene. In other embodiments, the polynucleotide molecules are designed to have 100 percent sequence identity with or complementarity to multiple alleles or family members of a given BAX inhibitor 1 (BI-1) target gene. In certain embodiments, the polynucleotide can thus comprise at least 18 contiguous nucleotides that are identical or complementary to SEQ ID NO: 33-106, 108-140, or 142-146. In certain embodiments, the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, or 32.
(33) In certain embodiments, polynucleotide compositions and methods provided herein typically effect regulation or modulation (e. g., suppression) of gene expression during a period during the life of the treated plant of at least 1 week or longer and typically in systemic fashion. For instance, within days of treating a plant leaf with a polynucleotide composition as described herein, primary and transitive siRNAs can be detected in other leaves lateral to and above the treated leaf and in apical tissue. In certain embodiments, methods of systemically suppressing expression of a gene in a plant, the methods comprising treating said plant with a composition comprising at least one polynucleotide and a transfer agent, wherein said polynucleotide comprises at least 18 or at least 19 contiguous nucleotides that are essentially identical or essentially complementary to a gene or a transcript encoding a BAX inhibitor 1 (BI-1) gene of the plant are provided, whereby expression of the gene in said plant or progeny thereof is systemically suppressed in comparison to a control plant that has not been treated with the composition.
(34) Compositions used to suppress a target gene can comprise one or more polynucleotides that are essentially identical or essentially complementary to multiple genes, or to multiple segments of one or more genes. In certain embodiments, compositions used to suppress a target gene can comprise one or more polynucleotides that are essentially identical or essentially complementary to multiple consecutive segments of a target gene, multiple non-consecutive segments of a target gene, multiple alleles of a target gene, or multiple target genes from one or more species.
(35) In certain embodiments, the polynucleotide includes two or more copies of a nucleotide sequence (of 18 or more nucleotides) where the copies are arranged in tandem fashion. In another embodiment, the polynucleotide includes two or more copies of a nucleotide sequence (of 18 or more nucleotides) where the copies are arranged in inverted repeat fashion (forming an at least partially self-complementary strand). The polynucleotide can include both tandem and inverted-repeat copies. Whether arranged in tandem or inverted repeat fashion, each copy can be directly contiguous to the next, or pairs of copies can be separated by an optional spacer of one or more nucleotides. The optional spacer can be unrelated sequence (i. e., not essentially identical to or essentially complementary to the copies, nor essentially identical to, or essentially complementary to, a sequence of 18 or more contiguous nucleotides of the endogenous target gene or RNA transcribed from the endogenous target gene). Alternatively the optional spacer can include sequence that is complementary to a segment of the endogenous target gene adjacent to the segment that is targeted by the copies. In certain embodiments, the polynucleotide includes two copies of a nucleotide sequence of between about 20 to about 30 nucleotides, where the two copies are separated by a spacer no longer than the length of the nucleotide sequence.
(36) Tiling
(37) Polynucleotide trigger molecules can be identified by tiling gene targets in random length fragments, e.g. 200-300 polynucleotides in length, with partially overlapping regions, e.g. 25 or so nucleotide overlapping regions along the length of the target gene. Multiple gene target sequences can be aligned and polynucleotide sequence regions with homology in common are identified as potential trigger molecules for multiple targets. Multiple target sequences can be aligned and sequence regions with poor homology are identified as potential trigger molecules for selectively distinguishing targets. To selectively suppress a single gene, trigger sequences may be chosen from regions that are unique to the target gene either from the transcribed region or the non-coding regions, e.g., promoter regions, 3 untranslated regions, introns and the like.
(38) Polynucleotides fragments are designed along the length of the full length coding and untranslated regions of a BI-1 gene or family member as contiguous overlapping fragments of 200-300 polynucleotides in length or fragment lengths representing a percentage of the target gene. These fragments are applied topically (as sense or anti-sense ssDNA or ssRNA, dsRNA, or dsDNA) to determine the relative effectiveness in providing the fungal disease resistance phenotype. Fragments providing the desired activity may be further subdivided into 50-60 polynucleotide fragments which are evaluated for providing the fungal disease resistance phenotype. The 50-60 base fragments with the desired activity may then be further subdivided into 19-30 base fragments which are evaluated for providing the fungal disease resistance phenotype. Once relative effectiveness is determined, the fragments are utilized singly, or in combination in one or more pools to determine effective trigger composition or mixture of trigger polynucleotides for providing the fungal disease resistance phenotype.
(39) Coding and/or non-coding sequences of gene families in the crop of interest are aligned and 200-300 polynucleotide fragments from the least homologous regions amongst the aligned sequences are evaluated using topically applied polynucleotides (as sense or anti-sense ssDNA or ssRNA, dsRNA, or dsDNA) to determine their relative effectiveness in providing the fungal disease resistance phenotype. The effective segments are further subdivided into 50-60 polynucleotide fragments, prioritized by least homology, and reevaluated using topically applied polynucleotides. The effective 50-60 polynucleotide fragments are subdivided into 19-30 polynucleotide fragments, prioritized by least homology, and again evaluated for induction of the fungal disease resistance phenotype. Once relative effectiveness is determined, the fragments are utilized singly, or again evaluated in combination with one or more other fragments to determine the trigger composition or mixture of trigger polynucleotides for providing the fungal disease resistance phenotype.
(40) Coding and/or non-coding sequences of gene families in the crop of interest are aligned and 200-300 polynucleotide fragments from the most homologous regions amongst the aligned sequences are evaluated using topically applied polynucleotides (as sense or anti-sense ssDNA or ssRNA, dsRNA, or dsDNA) to determine their relative effectiveness in inducing the fungal disease resistance phenotype. The effective segments are subdivided into 50-60 polynucleotide fragments, prioritized by most homology, and reevaluated using topically applied polynucleotides. The effective 50-60 polynucleotide fragments are subdivided into 19-30 polynucleotide fragments, prioritized by most homology, and again evaluated for induction of the yield/quality phenotype. Once relative effectiveness is determined, the fragments may be utilized singly, or in combination with one or more other fragments to determine the trigger composition or mixture of trigger polynucleotides for providing the fungal disease resistance phenotype.
(41) Also, provided herein are methods for identifying a preferred polynucleotide for improving fungal disease in a plant. Populations of candidate polynucleotides that are essentially identical or essentially complementary to a BI-1 gene or transcript of the gene can be generated by a variety of approaches, including but not limited to, any of the tiling, least homology, or most homology approaches provided herein. Such populations of polynucleotides can also be generated or obtained from any of the polynucleotides or genes provided herewith in SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 33-106, 108-140, or 142-146. Such populations of polynucleotides can also be generated or obtained from any genes that are orthologous to the genes or proteins provided herewith as SEQ ID NO: 1-32. Such polynucleotides can be topically applied to a surface of plants in a composition comprising at least one polynucleotide from said population and a transfer agent to obtain treated plants. Treated plants that exhibit suppression of the BI-1 gene and/or exhibit an improvement in fungal disease resistance are identified, thus identifying a preferred polynucleotide that improves fungal disease in a plant. Suppression of the gene can be determined by any assay for the levels and/or activity of a gene product (i.e. transcript or protein). Suitable assays for transcripts include, but are not limited to, semi-quantitative or quantitative reverse transcriptase PCR (qRT-PCR) assays. Suitable assays for proteins include, but are not limited to, semi-quantitative or quantitative immunoassays, biochemical activity assays, or biological activity assays. In certain embodiments, the polynucleotides can be applied alone. In other embodiments, the polynucleotides can be applied in pools of multiple polynucleotides. When a pool of polynucleotides provides for suppression of the BI-1 gene and/or an improvement in fungal disease resistance are identified, the pool can be de-replicated and retested as necessary or desired to identify one or more preferred polynucleotide(s) that improves fungal disease resistance in a plant.
(42) Methods of making polynucleotides are well known in the art. Such methods of making polynucleotides can include in vivo biosynthesis, in vitro enzymatic synthesis, or chemical synthesis. In certain embodiments, RNA molecules can be made by either in vivo or in vitro synthesis from DNA templates where a suitable promoter is operably linked to the polynucleotide and a suitable DNA-dependent RNA polymerase is provided. DNA-dependent RNA polymerases include, but are not limited to, E. coli or other bacterial RNA polymerases as well as the bacteriophage RNA polymerases such as the T7, T3, and SP6 RNA polymerases. Commercial preparation of oligonucleotides often provides two deoxyribonucleotides on the 3 end of the sense strand. Long polynucleotide molecules can be synthesized from commercially available kits, for example, kits from Applied Biosystems/Ambion (Austin, Tex.) have DNA ligated on the 5 end that encodes a bacteriophage T7 polymerase promoter that makes RNA strands that can be assembled into a dsRNA. Alternatively, dsRNA molecules can be produced from expression cassettes in bacterial cells that have regulated or deficient RNase III enzyme activity. Long polynucleotide molecules can also be assembled from multiple RNA or DNA fragments. In some embodiments design parameters such as Reynolds score (Reynolds et al. Nature Biotechnology 22, 326-330 (2004) and Tuschl rules (Pei and Tuschl, Nature Methods 3(9): 670-676, 2006) are known in the art and are used in selecting polynucleotide sequences effective in gene silencing. In some embodiments random design or empirical selection of polynucleotide sequences is used in selecting polynucleotide sequences effective in gene silencing. In some embodiments the sequence of a polynucleotide is screened against the genomic DNA of the intended plant to minimize unintentional silencing of other genes.
(43) While there is no upper limit on the concentrations and dosages of polynucleotide molecules that can be useful in the methods and compositions provided herein, lower effective concentrations and dosages will generally be sought for efficiency. The concentrations can be adjusted in consideration of the volume of spray or treatment applied to plant leaves or other plant part surfaces, such as flower petals, stems, tubers, fruit, anthers, pollen, leaves, roots, or seeds. In one embodiment, a useful treatment for herbaceous plants using 25-mer polynucleotide molecules is about 1 nanomole (nmol) of polynucleotide molecules per plant, for example, from about 0.05 to 1 nmol polynucleotides per plant. Other embodiments for herbaceous plants include useful ranges of about 0.05 to about 100 nmol, or about 0.1 to about 20 nmol, or about 1 nmol to about 10 nmol of polynucleotides per plant. In certain embodiments, about 40 to about 50 nmol of a ssDNA polynucleotide are applied. In certain embodiments, about 0.5 nmol to about 2 nmol of a dsRNA is applied. In certain embodiments, a composition containing about 0.5 to about 2.0 mg/mL, or about 0.14 mg/mL of dsRNA or ssDNA (21-mer) is applied. In certain embodiments, a composition of about 0.5 to about 1.5 mg/mL of a long dsRNA polynucleotide (i.e. about 50 to about 200 or more nucleotides) is applied. In certain embodiments, about 1 nmol to about 5 nmol of a dsRNA is applied to a plant. In certain embodiments, the polynucleotide composition as topically applied to the plant contains the at least one polynucleotide at a concentration of about 0.01 to about 10 milligrams per milliliter, or about 0.05 to about 2 milligrams per milliliter, or about 0.1 to about 2 milligrams per milliliter. Very large plants, trees, or vines may require correspondingly larger amounts of polynucleotides. When using long dsRNA molecules that can be processed into multiple oligonucleotides, lower concentrations can be used. To illustrate certain embodiments, the factor 1, when applied to oligonucleotide molecules is arbitrarily used to denote a treatment of 0.8 nmol of polynucleotide molecule per plant; 10, 8 nmol of polynucleotide molecule per plant; and 100, 80 nmol of polynucleotide molecule per plant.
(44) The polynucleotide compositions of certain embodiments are useful in compositions, such as liquids that comprise polynucleotide molecules, alone or in combination with other components either in the same liquid or in separately applied liquids that provide a transfer agent. As used herein, a transfer agent is an agent that, when combined with a polynucleotide in a composition that is topically applied to a target plant surface, enables the polynucleotide to enter a plant cell. In certain embodiments, a transfer agent is an agent that conditions the surface of plant tissue, e. g., seeds, leaves, stems, roots, flowers, or fruits, to permeation by the polynucleotide molecules into plant cells. The transfer of polynucleotides into plant cells can be facilitated by the prior or contemporaneous application of a polynucleotide-transferring agent to the plant tissue. In some embodiments the transferring agent is applied subsequent to the application of the polynucleotide composition. The polynucleotide transfer agent enables a pathway for polynucleotides through cuticle wax barriers, stomata and/or cell wall or membrane barriers into plant cells. Suitable transfer agents to facilitate transfer of the polynucleotide into a plant cell include agents that increase permeability of the exterior of the plant or that increase permeability of plant cells to oligonucleotides or polynucleotides. Such agents to facilitate transfer of the composition into a plant cell include a chemical agent, or a physical agent, or combinations thereof. Chemical agents for conditioning or transfer include (a) surfactants, (b) an organic solvent or an aqueous solution or aqueous mixtures of organic solvents, (c) oxidizing agents, (d) acids, (e) bases, (f) oils, (g) enzymes, or combinations thereof. Embodiments of the method can optionally include an incubation step, a neutralization step (e.g., to neutralize an acid, base, or oxidizing agent, or to inactivate an enzyme), a rinsing step, or combinations thereof. Embodiments of agents or treatments for conditioning of a plant to permeation by polynucleotides include emulsions, reverse emulsions, liposomes, and other micellar-like compositions. Embodiments of agents or treatments for conditioning of a plant to permeation by polynucleotides include counter-ions or other molecules that are known to associate with nucleic acid molecules, e. g., inorganic ammonium ions, alkyl ammonium ions, lithium ions, polyamines such as spermine, spermidine, or putrescine, and other cations. Organic solvents useful in conditioning a plant to permeation by polynucleotides include DMSO, DMF, pyridine, N-pyrrolidine, hexamethylphosphoramide, acetonitrile, dioxane, polypropylene glycol, other solvents miscible with water or that will dissolve phosphonucleotides in non-aqueous systems (such as is used in synthetic reactions). Naturally derived or synthetic oils with or without surfactants or emulsifiers can be used, e. g., plant-sourced oils, crop oils (such as those listed in the 9.sup.th Compendium of Herbicide Adjuvants, publicly available on the worldwide web (internet) at herbicide.adjuvants.com can be used, e. g., paraffinic oils, polyol fatty acid esters, or oils with short-chain molecules modified with amides or polyamines such as polyethyleneimine or N-pyrrolidine. Transfer agents include, but are not limited to, organosilicone preparations.
(45) In certain embodiments, an organosilicone preparation that is commercially available as Silwet L-77 surfactant having CAS Number 27306-78-1 and EPA Number: CAL.REG.NO. 5905-50073-AA, and currently available from Momentive Performance Materials, Albany, N.Y. can be used to prepare a polynucleotide composition. In certain embodiments where a Silwet L-77 organosilicone preparation is used as a pre-spray treatment of plant leaves or other plant surfaces, freshly made concentrations in the range of about 0.015 to about 2 percent by weight (wt percent) (e. g., about 0.01, 0.015, 0.02, 0.025, 0.03, 0.035, 0.04, 0.045, 0.05, 0.055, 0.06, 0.065, 0.07, 0.075, 0.08, 0.085, 0.09, 0.095, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.5 wt percent) are efficacious in preparing a leaf or other plant surface for transfer of polynucleotide molecules into plant cells from a topical application on the surface. In certain embodiments of the methods and compositions provided herein, a composition that comprises a polynucleotide molecule and an organosilicone preparation comprising Silwet L-77 in the range of about 0.015 to about 2 percent by weight (wt percent) (e. g., about 0.01, 0.015, 0.02, 0.025, 0.03, 0.035, 0.04, 0.045, 0.05, 0.055, 0.06, 0.065, 0.07, 0.075, 0.08, 0.085, 0.09, 0.095, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.5 wt percent) is used or provided. In certain embodiments of the methods and compositions provided herein, a composition that comprises a polynucleotide molecule and an organosilicone preparation comprising Silwet L-77 in the range of about 0.3 to about 1 percent by weight (wt percent) or about 0.5 to about 1% by weight (wt percent) is used or provided.
(46) In certain embodiments, any of the commercially available organosilicone preparations provided in the following Table 1 can be used as transfer agents in a polynucleotide composition. In certain embodiments where an organosilicone preparation of Table 1 is used as a pre-spray treatment of plant leaves or other surfaces, freshly made concentrations in the range of about 0.015 to about 2 percent by weight (wt percent) (e. g., about 0.01, 0.015, 0.02, 0.025, 0.03, 0.035, 0.04, 0.045, 0.05, 0.055, 0.06, 0.065, 0.07, 0.075, 0.08, 0.085, 0.09, 0.095, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.5 wt percent) are efficacious in preparing a leaf or other plant surface for transfer of polynucleotide molecules into plant cells from a topical application on the surface. In certain embodiments of the methods and compositions provided herein, a composition that comprises a polynucleotide molecule and an organosilicone preparation of the following Table 1 in the range of about 0.015 to about 2 percent by weight (wt percent) (e. g., about 0.01, 0.015, 0.02, 0.025, 0.03, 0.035, 0.04, 0.045, 0.05, 0.055, 0.06, 0.065, 0.07, 0.075, 0.08, 0.085, 0.09, 0.095, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.5 wt percent) is used or provided.
(47) TABLE-US-00001 TABLE 1 Name CAS number Manufacturer .sup.1, 2 BREAK-THRU S 321 na Evonik Industries AG BREAK-THRU S 200 67674-67-3 Evonik Industries AG BREAK-THRU OE 441 68937-55-3 Evonik Industries AG BREAK-THRU S 278 27306-78-1 Evonik Goldschmidt BREAK-THRU S 243 na Evonik Industries AG Silwet L-77 27306-78-1 Momentive Performance Materials Silwet HS 429 na Momentive Performance Materials Silwet HS 312 na Momentive Performance Materials BREAK-THRU S 233 134180-76-0 Evonik Industries AG Silwet HS 508 Momentive Performance Materials Silwet HS 604 Momentive Performance Materials .sup.1 Evonik Industries AG, Essen, Germany .sup.2 Momentive Performance Materials, Albany, New York
(48) Organosilicone preparations used in the methods and compositions provided herein can comprise one or more effective organosilicone compounds. As used herein, the phrase effective organosilicone compound is used to describe any organosilicone compound that is found in an organosilicone preparation that enables a polynucleotide to enter a plant cell. In certain embodiments, an effective organosilicone compound can enable a polynucleotide to enter a plant cell in a manner permitting a polynucleotide mediated suppression of a target gene expression in the plant cell. In general, effective organosilicone compounds include, but are not limited to, compounds that can comprise: i) a trisiloxane head group that is covalently linked to, ii) an alkyl linker including, but not limited to, an n-propyl linker, that is covalently linked to, iii) a poly glycol chain, that is covalently linked to, iv) a terminal group. Trisiloxane head groups of such effective organosilicone compounds include, but are not limited to, heptamethyltrisiloxane. Alkyl linkers can include, but are not limited to, an n-propyl linker. Poly glycol chains include, but are not limited to, polyethylene glycol or polypropylene glycol. Poly glycol chains can comprise a mixture that provides an average chain length n of about 7.5. In certain embodiments, the average chain length n can vary from about 5 to about 14. Terminal groups can include, but are not limited to, alkyl groups such as a methyl group. Effective organosilicone compounds are believed to include, but are not limited to, trisiloxane ethoxylate surfactants or polyalkylene oxide modified heptamethyl trisiloxane.
(49) ##STR00001##
(50) (Compound I: polyalkyleneoxide heptamethyltrisiloxane, average n=7.5).
(51) One organosilicone compound believed to be ineffective comprises the formula:
(52) ##STR00002##
(53) In certain embodiments, an organosilicone preparation that comprises an organosilicone compound comprising a trisiloxane head group is used in the methods and compositions provided herein. In certain embodiments, an organosilicone preparation that comprises an organosilicone compound comprising a heptamethyltrisiloxane head group is used in the methods and compositions provided herein. In certain embodiments, an organosilicone composition that comprises Compound I is used in the methods and compositions provided herein. In certain embodiments, an organosilicone composition that comprises Compound I is used in the methods and compositions provided herein. In certain embodiments of the methods and compositions provided herein, a composition that comprises a polynucleotide molecule and one or more effective organosilicone compound in the range of about 0.015 to about 2 percent by weight (wt percent) (e. g., about 0.01, 0.015, 0.02, 0.025, 0.03, 0.035, 0.04, 0.045, 0.05, 0.055, 0.06, 0.065, 0.07, 0.075, 0.08, 0.085, 0.09, 0.095, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.5 wt percent) is used or provided.
(54) In certain embodiments, the polynucleotide compositions that comprise an organosilicone preparation can comprise a salt such as ammonium chloride, tetrabutylphosphonium bromide, and/or ammonium sulfate. Ammonium chloride, tetrabutylphosphonium bromide, and/or ammonium sulfate can be provided in the polynucleotide composition at a concentration of about 0.5% to about 5% (w/v). An ammonium chloride, tetrabutylphosphonium bromide, and/or ammonium sulfate concentration of about 1% to about 3%, or about 2% (w/v) can also be used in the polynucleotide compositions that comprise an organosilicone preparation. In certain embodiments, the polynucleotide compositions can comprise an ammonium salt at a concentration greater or equal to 300 millimolar. In certain embodiments, the polynucleotide compositions that comprise an organosilicone preparation can comprise ammonium sulfate at concentrations from about 80 to about 1200 mM or about 150 mM to about 600 mM.
(55) In certain embodiments, the polynucleotide compositions can also comprise a phosphate salt. Phosphate salts used in the compositions include, but are not limited to, calcium, magnesium, potassium, or sodium phosphate salts. In certain embodiments, the polynucleotide compositions can comprise a phosphate salt at a concentration of at least about 5 millimolar, at least about 10 millimolar, or at least about 20 millimolar. In certain embodiments, the polynucleotide compositions will comprise a phosphate salt in a range of about 1 mM to about 25 mM or in a range of about 5 mM to about 25 mM. In certain embodiments, the polynucleotide compositions can comprise sodium phosphate at a concentration of at least about 5 millimolar, at least about 10 millimolar, or at least about 20 millimolar. In certain embodiments, the polynucleotide compositions can comprise sodium phosphate at a concentration of about 5 millimolar, about 10 millimolar, or about 20 millimolar. In certain embodiments, the polynucleotide compositions will comprise a sodium phosphate salt in a range of about 1 mM to about 25 mM or in a range of about 5 mM to about 25 mM. In certain embodiments, the polynucleotide compositions can comprise a sodium phosphate buffer at a pH of about 6.8.
(56) In certain embodiments, other useful transfer agents or adjuvants to transfer agents that can be used in polynucleotide compositions provided herein include surfactants and/or effective molecules contained therein. Surfactants and/or effective molecules contained therein include, but are not limited to, sodium or lithium salts of fatty acids (such as tallow or tallowamines or phospholipids) and organosilicone surfactants. In certain embodiments, the polynucleotide compositions that comprise a transfer agent are formulated with counter-ions or other molecules that are known to associate with nucleic acid molecules. Illustrative examples include, tetraalkyl ammonium ions, trialkyl ammonium ions, sulfonium ions, lithium ions, and polyamines such as spermine, spermidine, or putrescine. In certain embodiments, the polynucleotide compositions are formulated with a non-polynucleotide herbicide. Non-polynucleotide herbicidal molecules include, but are not limited to, glyphosate, auxin-like benzoic acid herbicides including dicamba, chloramben and TBA, glufosinate, auxin-like herbicides including phenoxy carboxylic acid herbicide, pyridine carboxylic acid herbicide, quinoline carboxylic acid herbicide, pyrimidine carboxylic acid herbicide, and benazolin-ethyl herbicide, sulfonylureas, imidazolinones, bromoxynil, delapon, cyclohezanedione, protoporphyrionogen oxidase inhibitors, and 4-hydroxyphenyl-pyruvate-dioxygenase inhibiting herbicides.
(57) In certain embodiments, the polynucleotides used in the compositions that are essentially identical or essentially complementary to the BI-1 target gene or transcript will comprise the predominant nucleic acid in the composition. Thus in certain embodiments, the polynucleotides that are essentially identical or essentially complementary to the target gene or transcript will comprise at least about 50%, 75%, 95%, 98%, or 100% of the nucleic acids provided in the composition by either mass or molar concentration. However, in certain embodiments, the polynucleotides that are essentially identical or essentially complementary to the target gene or transcript can comprise at least about 1% to about 50%, about 10% to about 50%, about 20% to about 50%, or about 30% to about 50% of the nucleic acids provided in the composition by either mass or molar concentration. Also provided are compositions where the polynucleotides that are essentially identical or essentially complementary to the target gene or transcript can comprise at least about 1% to 100%, about 10% to 100%, about 20% to about 100%, about 30% to about 50%, or about 50% to a 100% of the nucleic acids provided in the composition by either mass or molar concentration.
(58) Polynucleotides comprising ssDNA, dsDNA, ssRNA, dsRNA, or RNA/DNA hybrids that are essentially identical or complementary to certain plant target genes or transcripts and that can be used in compositions containing transfer agents that include, but are not limited to, organosilicone preparations, to suppress those target genes when topically applied to plants are disclosed in co-assigned U.S. patent application Ser. No. 13/042,856. Various polynucleotide herbicidal molecules, compositions comprising those polynucleotide herbicidal molecules and transfer agents that include, but are not limited to, organosilicone preparations, and methods whereby herbicidal effects are obtained by the topical application of such compositions to plants are also disclosed in co-assigned U.S. patent application Ser. No. 13/042,856 (U.S. Patent Application Publication No. 20110296556), and those polynucleotide herbicidal molecules, compositions, and methods are incorporated herein by reference in their entireties. Genes encoding proteins that can provide tolerance to an herbicide and/or that are targets of a herbicide are collectively referred to herein as herbicide target genes. Herbicide target genes include, but are not limited to, a 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), a glyphosate oxidoreductase (GOX), a glyphosate decarboxylase, a glyphosate-N-acetyl transferase (GAT), a dicamba monooxygenase, a phosphinothricin acetyltransferase, a 2,2-dichloropropionic acid dehalogenase, an acetohydroxyacid synthase, an acetolactate synthase, a haloarylnitrilase, an acetyl-coenzyme A carboxylase (ACCase), a dihydropteroate synthase, a phytoene desaturase (PDS), a protoporphyrin IX oxygenase (PPO), a hydroxyphenylpyruvate dioxygenase (HPPD), a para-aminobenzoate synthase, a glutamine synthase, a cellulose synthase, a beta tubulin, and a serine hydroxymethyltransferase gene. The effects of applying certain compositions comprising polynucleotides that are essentially identical or complementary to certain herbicide target genes and transfer agents on plants containing the herbicide target genes was shown to be potentiated or enhanced by subsequent application of an herbicide that targets the same gene as the polynucleotide in co-assigned U.S. patent application Ser. No. 13/042,856. For example, compositions comprising polynucleotides targeting the EPSPS herbicide target gene were potentiated by glyphosate in experiments disclosed in co-assigned U.S. patent application Ser. No. 13/042,856.
(59) In certain embodiments of the compositions and methods disclosed herein, the composition comprising a polynucleotide and a transfer agent can thus further comprise a second polynucleotide comprising at least 19 contiguous nucleotides that are essentially identical or essentially complementary to a transcript to a protein that confers resistance to a herbicide. In certain embodiments, the second polynucleotide does not comprise a polynucleotide that is essentially identical or essentially complementary to a transcript encoding a protein of a target plant that confers resistance to said herbicidal molecule. Thus, in a non-limiting embodiment, the second polynucleotide could be essentially identical or essentially complementary to a transcript encoding a protein that confers resistance to a herbicide in a weed (such as an EPSPS encoding transcript) but would not be essentially identical or essentially complementary to a transcript encoding a protein that confers resistance to that same herbicide in a crop plant.
(60) In certain embodiments, the polynucleotide compositions that comprise a transfer agent can comprise glycerin. Glycerin can be provided in the composition at a concentration of about 0.1% to about 1% (w/v or v/v). A glycerin concentration of about 0.4% to about 0.6%, or about 0.5% (w/v or v/v) can also be used in the polynucleotide compositions that comprise a transfer agent.
(61) In certain embodiments, the polynucleotide compositions that comprise a transfer agent can further comprise organic solvents. Such organic solvents include, but are not limited to, DMSO, DMF, pyridine, N-pyrrolidine, hexamethylphosphoramide, acetonitrile, dioxane, polypropylene glycol, other solvents miscible with water or that will dissolve phosphonucleotides in non-aqueous systems (such as is used in synthetic reactions).
(62) In certain embodiments, the polynucleotide compositions that comprise a transfer agent can further comprise naturally derived or synthetic oils with or without surfactants or emulsifiers. Such oils include, but are not limited to, plant-sourced oils, crop oils (such as those listed in the 9th Compendium of Herbicide Adjuvants, publicly available on line at www.herbicide.adjuvants.com), paraffinic oils, polyol fatty acid esters, or oils with short-chain molecules modified with amides or polyamines such as polyethyleneimine or N-pyrrolidine.
(63) In some embodiments, methods include one or more applications of the composition comprising a polynucleotide and a transfer agent or one or more effective components contained therein. In certain embodiments of the methods, one or more applications of a transfer agent or one or more effective components contained therein can precede one or more applications of the composition comprising a polynucleotide and a transfer agent. In embodiments where a transfer agent and/or one or more effective molecules contained therein is used either by itself as a pre-treatment or as part of a composition that includes a polynucleotide, embodiments of the polynucleotide molecules are double-stranded RNA oligonucleotides, single-stranded RNA oligonucleotides, double-stranded RNA polynucleotides, single-stranded RNA polynucleotides, double-stranded DNA oligonucleotides, single-stranded DNA oligonucleotides, double-stranded DNA polynucleotides, single-stranded DNA polynucleotides, chemically modified RNA or DNA oligonucleotides or polynucleotides or mixtures thereof.
(64) Compositions and methods described herein are useful for modulating or suppressing the expression of an endogenous BAX inhibitor 1 (BI-1) target gene or transgenic BAX inhibitor 1 (BI-1) target gene in a plant cell or plant. In certain embodiments of the methods and compositions provided herein, expression of BI-1 target genes can be suppressed completely, partially and/or transiently to result in an improvement in fungal disease resistance. In various embodiments, a BAX inhibitor 1 (BI-1) target gene includes coding (protein-coding or translatable) sequence, non-coding (non-translatable) sequence, or both coding and non-coding sequence. Compositions can include polynucleotides and oligonucleotides designed to target multiple BAX inhibitor 1 (BI-1) genes, or multiple segments of one or more BAX inhibitor 1 (BI-1) genes. The target gene can include multiple consecutive segments of a target BAX inhibitor 1 (BI-1) gene, multiple non-consecutive segments of a BAX inhibitor 1 (BI-1) target gene, multiple alleles of a target gene, or multiple BAX inhibitor 1 (BI-1) target genes from one or more species. BAX inhibitor 1 (BI-1) target genes include, but are not limited to, the endogenous BAX inhibitor 1 (BI-1) plant genes of SEQ ID NO: or. BAX inhibitor 1 (BI-1) target genes include, but are not limited to, BAX inhibitor 1 (BI-1) plant genes that encode proteins that are orthologous to the proteins encoded by SEQ ID NO:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, or 31. BAX inhibitor 1 (BI-1) target genes include, but are not limited to, BAX inhibitor 1 (BI-1) plant genes that encode the proteins of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, or 31.
(65) Target genes and plants containing those target genes can be obtained from: i) row crop plants including, but are not limited to, corn, soybean, cotton, canola, sugar beet, alfalfa, sugarcane, rice, and wheat; ii) vegetable plants including, but not limited to, tomato, potato, sweet pepper, hot pepper, melon, watermelon, cucumber, eggplant, cauliflower, broccoli, lettuce, spinach, onion, peas, carrots, sweet corn, Chinese cabbage, leek, fennel, pumpkin, squash or gourd, radish, Brussels sprouts, tomatillo, garden beans, dry beans, or okra; iii) culinary plants including, but not limited to, basil, parsley, coffee, or tea; iv) fruit plants including but not limited to apple, pear, cherry, peach, plum, apricot, banana, plantain, table grape, wine grape, citrus, avocado, mango, or berry; v) a tree grown for ornamental or commercial use, including, but not limited to, a fruit or nut tree; or, vi) an ornamental plant (e. g., an ornamental flowering plant or shrub or turf grass). The methods and compositions provided herein can also be applied to plants produced by a cutting, cloning, or grafting process (i. e., a plant not grown from a seed) include fruit trees and plants that include, but are not limited to, citrus, apples, avocados, tomatoes, eggplant, cucumber, melons, watermelons, and grapes as well as various ornamental plants. Such row crop, vegetable, culinary, fruit, tree, or ornamental plants improvements in fungal disease resistance that result from suppressing BAX inhibitor 1 (BI-1) gene expression are provided herein. Such row crop, vegetable, culinary, fruit, tree, or ornamental plant parts or processed plant products exhibiting improvements in fungal disease resistance that result from suppressing BAX inhibitor 1 (BI-1) gene expression are also provided herein. Such plant parts can include, but are not limited to, flowers, stems, tubers, fruit, anthers, meristems, ovules, pollen, leaves, or seeds. Such processed plant products obtained from the plant parts can include, but are not limited to, a meal, a pulp, a feed, or a food product.
(66) In some embodiments, a method for modulating or suppressing expression of an BAX inhibitor 1 (BI-1) gene in a plant including (a) conditioning of a plant to permeation by polynucleotides and (b) treatment of the plant with the polynucleotide molecules, wherein the polynucleotide molecules include at least one segment of 18 or more contiguous nucleotides cloned from or otherwise identified from the BAX inhibitor 1 (BI-1) target gene in either anti-sense or sense orientation, whereby the polynucleotide molecules permeate the interior of the plant and induce modulation of the target gene is provided. The conditioning and polynucleotide application can be performed separately or in a single step. When the conditioning and polynucleotide application are performed in separate steps, the conditioning can precede or can follow the polynucleotide application within minutes, hours, or days. In some embodiments more than one conditioning step or more than one polynucleotide molecule application can be performed on the same plant. In embodiments of the method, the segment can be cloned or identified from (a) coding (protein-encoding), (b) non-coding (promoter and other gene related molecules), or (c) both coding and non-coding parts of the BAX inhibitor 1 (BI-1) target gene. Non-coding parts include DNA, such as promoter regions or the RNA transcribed by the DNA that provide RNA regulatory molecules, including but not limited to: introns, 5 or 3 untranslated regions, and microRNAs (miRNA), trans-acting siRNAs, natural anti-sense siRNAs, and other small RNAs with regulatory function or RNAs having structural or enzymatic function including but not limited to: ribozymes, ribosomal RNAs, t-RNAs, aptamers, and riboswitches. In certain embodiments where the polynucleotide used in the composition comprises a promoter sequence essentially identical to, or essentially complementary to at least 18 contiguous nucleotides of the promoter of the endogenous target gene, the promoter sequence of the polynucleotide is not operably linked to another sequence that is transcribed from the promoter sequence.
(67) Compositions comprising a polynucleotide and a transfer agent provided herein can be topically applied to a plant or plant part by any convenient method, e.g., spraying or coating with a powder, or with a liquid composition comprising any of an emulsion, suspension, or solution. Such topically applied sprays or coatings can be of either all or of any a portion of the surface of the plant or plant part. Similarly, compositions that comprise a transfer agent or other pre-treatment can in certain embodiments be applied to the plant or plant part by any convenient method, e. g., spraying or wiping a solution, emulsion, or suspension. Compositions comprising a polynucleotide and a transfer agent provided herein can be topically applied to plant parts that include, but are not limited to, flowers, stems, tubers, meristems, ovules, fruit, anthers, pollen, leaves, or seeds.
(68) Application of compositions comprising a polynucleotide and a transfer agent to seeds is specifically provided herein. Seeds can be contacted with such compositions by spraying, misting, immersion, and the like.
(69) In certain embodiments, application of compositions comprising a polynucleotide and a transfer agent to plants, plant parts, or seeds in particular can provide for an improvement in fungal disease resistance in progeny plants, plant parts, or seeds derived from those treated plants, plant parts, or seeds. In certain embodiments, progeny plants, plant parts, or seeds derived from those treated plants, plant parts, or seeds will exhibit an improvement in an improvement in fungal disease resistance that results from suppressing expression of an BI-1 gene. In certain embodiments, the methods and compositions provided herein can provide for an improvement in an improvement in fungal disease resistance in progeny plants or seeds as a result of epigenetically inherited suppression of BI-1 expression. In certain embodiments, such progeny plants exhibit an improvement in an improvement in fungal disease resistance from epigenetically inherited suppression of BI-1 gene expression that is not caused by a transgene where the polynucleotide is operably linked to a promoter, a viral vector, or a copy of the polynucleotide that is integrated into a non-native location in the chromosomal DNA of the plant. Without seeking to be limited by theory, progeny plants or seeds derived from those treated plants, plant parts, or seeds can exhibit an improvement in an improvement in fungal disease resistance through an epigenetic mechanism that provides for propagation of an epigenetic condition where suppression of BI-1 gene expression occurs in the progeny plants, plant parts, or plant seeds. In certain embodiments, progeny plants or seeds exhibiting an improvement in an improvement in fungal disease resistance as a result of epigenetically inherited suppression of BI-1 gene expression can also exhibit increased methylation, and in particular, increased methylation of cytosine residues, in the endogenous BI-1 gene of the plant. Plant parts, including seeds, of the progeny plants that exhibit an improvement in an improvement in fungal disease resistance as a result of epigenetically inherited suppression of BI-1 gene expression, can also in certain embodiments exhibit increased methylation, and in particular, increased methylation of cytosine residues, in the endogenous BI-1 gene. In certain embodiments, DNA methylation levels in DNA encoding the endogenous BI-1 gene can be compared in plants that exhibit the an improvement in fungal disease resistance and control plants that do not exhibit an improvement in fungal disease resistance to correlate the presence of the an improvement in fungal disease resistance to epigenetically inherited suppression of BI-1 gene expression and to identify plants that comprise the epigenetically inherited improvement in fungal disease resistance.
(70) Various methods of spraying compositions on plants or plant parts can be used to topically apply to a plant surface a composition comprising a polynucleotide that comprises a transfer agent. In the field, a composition can be applied with a boom that extends over the crops and delivers the composition to the surface of the plants or with a boomless sprayer that distributes a composition across a wide area. Agricultural sprayers adapted for directional, broadcast, or banded spraying can also be used in certain embodiments. Sprayers adapted for spraying particular parts of plants including, but not limited to, leaves, the undersides of leaves, flowers, stems, male reproductive organs such as tassels, meristems, pollen, ovules, and the like can also be used. Compositions can also be delivered aerially, such as by a crop dusting airplane. In certain embodiments, the spray can be delivered with a pressurized backpack sprayer calibrated to deliver the appropriate rate of the composition. In certain embodiments, such a backpack sprayer is a carbon dioxide pressurized sprayer with a 11015 flat fan or equivalent spray nozzle with a customized single nozzle assembly (to minimize waste) at a spray pressure of about 0.25 MPa and/or any single nozzle sprayer providing an effective spray swath of 60 cm above the canopy of 3 to 12 inch tall growing plants can be used. Plants in a greenhouse or growth chamber can be treated using a track sprayer or laboratory sprayer with a 11001XR or equivalent spray nozzle to deliver the sample solution at a determined rate. In some embodiments, a non-limiting rate is about 140 L/ha at about 0.25 MPa pressure.
(71) In certain embodiments, it is also contemplated that a plant part can be sprayed with the composition comprising a polynucleotide that comprises a transfer agent. Such plant parts can be sprayed either pre- or post-harvest to provide for an improvement in fungal disease resistance in the plant part that results from suppression of BI-1 gene expression. Compositions can be topically applied to plant parts attached to a plant by a spray as previously described. Compositions can be topically applied to plant parts that are detached from a plant by a spray as previously described or by an alternative method. Alternative methods for applying compositions to detached parts include, but are not limited to, passing the plant parts through a spray by a conveyor belt or trough, or immersing the plant parts in the composition.
(72) Compositions comprising polynucleotides and transfer agents can be applied to plants or plant parts at one or more developmental stages as desired and/or as needed. Application of compositions to pre-germination seeds and/or to post-germination seedlings is provided in certain embodiments. Seeds can be treated with polynucleotide compositions provided herein by methods including, but not limited to, spraying, immersion, or any process that provides for coating, imbibition, and/or uptake of the polynucleotide composition by the seed. Seeds can be treated with polynucleotide compositions using seed batch treatment systems or continuous flow treatment systems. Seed coating systems are at least described in U.S. Pat. Nos. 6,582,516, 5,891,246, 4,079,696, and 4,023,525. Seed treatment can also be effected in laboratory or commercial scale treatment equipment such as a tumbler, a mixer, or a pan granulator. A polynucleotide composition used to treat seeds can contain one or more other desirable components including, but not limited to liquid diluents, binders to serve as a matrix for the polynucleotide, fillers for protecting the seeds during stress conditions, and plasticizers to improve flexibility, adhesion and/or spreadability of the coating. In addition, for oily polynucleotide compositions containing little or no filler, drying agents such as calcium carbonate, kaolin or bentonite clay, perlite, diatomaceous earth or any other adsorbent material can be added. Use of such components in seed treatments is described in U.S. Pat. No. 5,876,739. Additional ingredients can be incorporated into the polynucleotide compositions used in seed treatments. Such ingredients include but are not limited to: conventional sticking agents, dispersing agents such as methylcellulose (Methocel A15LV or Methocel A15C, for example, serve as combined dispersant/sticking agents for use in seed treatments), polyvinyl alcohol (e.g., Elvanol 51-05), lecithin (e.g., Yelkinol P), polymeric dispersants (e.g., polyvinylpyrrolidone/vinyl acetate PVPNA S-630), thickeners (e.g., clay thickeners such as Van Gel B to improve viscosity and reduce settling of particle suspensions), emulsion stabilizers, surfactants, antifreeze compounds (e.g., urea), dyes, colorants, and the like that can be combined with compositions comprising a polynucleotide and a transfer agent. Further ingredients used in compositions that can be applied to seeds can be found in McCutcheon's, vol. 1, Emulsifiers and Detergents, MC Publishing Company, Glen Rock, N.J., U.S.A., 1996 and in McCutcheon's, vol. 2, Functional Materials, MC Publishing Company, Glen Rock, N.J., U.S.A., 1996. Methods of applying compositions to seeds and pesticidal compositions that can be used to treat seeds are described in US Patent Application publication 20080092256, which is incorporated herein by reference in its entirety.
(73) Application of the compositions in early, mid-, and late vegetative stages of plant development is provided in certain embodiments. Application of the compositions in early, mid-, and late reproductive stages is also provided in certain embodiments. Application of the compositions to plant parts at different stages of maturation is also provided.
(74) The following examples are included to demonstrate certain embodiments. Those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments that are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.
EXAMPLES
Example 1. BI-1 Target Gene Sequences
(75) Target BI-1 genes at least occur in the genome of plants provided in Table 2. The BI-1 genes and provided in Table 2 or their corresponding transcripts, can be used as targets of polynucleotide compositions comprising a polynucleotide that of at least 18 contiguous nucleotides that are essentially identical or essentially complementary to those genes or transcripts. The genes and proteins provided in Table 2, or sequences contained within those genes provided herewith in Example 5 can also be used to obtain orthologous BI-1 genes from plants not listed in Table 2. Such orthologous genes and their transcripts can then serve as targets of polynucleotides provided herein or as a source of polynucleotides that are specifically designed to target the orthologous genes or transcripts.
(76) TABLE-US-00002 TABLE 2 BAX inhibitor 1 (BI-1) sequences from various plants that are useful targets for topical suppression to control fungal pathogens. SEQ ID NO: 1 Arabidopsis thaliana Arabidopsis BI-1 protein SEQ ID NO: 2 Arabidopsis thaliana Arabidopsis BI-1 gene SEQ ID NO: 3 Lactuca sativa Lettuce BI-1 protein SEQ ID NO: 4 Lactuca sativa Lettuce BI-1 gene SEQ ID NO: 5 Q ID NO: 4; opersicum Tomato BI-1 protein SEQ ID NO: 6 Solanum lycopersicum Tomato BI-1 gene SEQ ID NO: 7 Vitis vinifera Grape BI-1 protein SEQ ID NO: 8 Vitis vinifera Grape BI-1 gene SEQ ID NO: 9 Capsicum annuum Pepper BI-1 protein SEQ ID NO: 10 Capsicum annuum Pepper BI-1 gene SEQ ID NO: 11 Glycine max Soybean BI-1 protein SEQ ID NO: 12 Glycine max Soybean BI-1 gene SEQ ID NO: 13 Sorghum bicolor Sorghum BI-1 protein SEQ ID NO: 14 Sorghum bicolor Sorghum BI-1 gene SEQ ID NO: 15 Zea mays Corn BI-1 protein SEQ ID NO: 16 Zea mays Corn BI-1 gene SEQ ID NO: 17 Triticum aestivum Wheat BI-1 protein SEQ ID NO: 18 Triticum aestivum Wheat BI-1 gene SEQ ID NO: 19 Triticum aestivum Wheat BI-1 protein SEQ ID NO: 20 Triticum aestivum Wheat BI-1 gene SEQ ID NO: 21 Glycine max Soybean BI-2 protein SEQ ID NO: 22 Glycine max Soybean BI-2 gene SEQ ID NO: 23 Hordeum vulgare Barley BI-1 protein SEQ ID NO: 24 Hordeum vulgare Barley BI-1 gene SEQ ID NO: 25 Oryza sativa subsp. Japonica Rice BI-1 protein SEQ ID NO: 26 Oryza sativa subsp. Japonica Rice BI-1 gene SEQ ID NO: 27 Cucumis sativus BI-1 protein SEQ ID NO: 28 Cucumis sativus BI-1 gene SEQ ID NO: 29 Cucumis sativus Cucumber BI-1 protein SEQ ID NO: 30 Cucumis sativus Cucumber BI-1 gene SEQ ID NO: 31 Gossypium hirsutum Cotton BI-1 protein SEQ ID NO: 32 Gossypium hirsutum Cotton BI-1 gene
(77) Table 2 contains the target BI-1 DNA sequences from the indicated plant species. For each gene having a DNA sequence provided in Table 2, polynucleotides such as single stranded or double stranded DNA or RNA fragments in sense and/or antisense orientation will be mixed with an organosilicone preparation. These compositions will be topically applied to plants to effect expression of the target genes in the specified plant to obtain the plants that exhibit disease resistance. In particular, plants that are resistant to powdery mildew, downy mildew, rust and/or other fungal infections will be obtained through the application of such compositions.
Example 2. Identification of Orthologous BI-1 Genes
(78) The sequences disclosed in SEQ ID NO: 1 through 32, along with the phylogenetic method for functional assignment described above, can be used to efficiently identify and clone BI-1 homologs useful for the control on pathogens causing powdery mildews, downy mildews or rusts, from other plant species not explicitly described here.
Example 3. Polynucleotides that can be Used to Reduce BI-1 Expression in Various Plants
(79) Examples of polynucleotides that can be used to reduce expression of BI-1 genes in various plants is provided herewith as SEQ ID NOS: 33-106, 109-140, and 142-146. Other regions of BI-1 genes can also be targeted to modify expression including the use of antisense DNA oligonucleotides against coding regions and/or targeting promoter regions using sense/antisense dsRNA, sense or antisense ssDNA as well as sense/antisense double stranded DNA. For example, a polynucleotide that comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, or 32 can be used to downregulate expression of those BI-1 genes.
Example 4. Topical Oligonucleotide Application and Powdery Mildew Testing Methods
(80) Barley seeds are planted in 2 inch pots in the greenhouse. Five days later, barley seedlings are sprayed with polynucleotides such as ssDNA and/or dsRNA oligos directed to the promoter and/or targeting the coding region of a target gene of interest. The nucleotide solution applied consists of 6-20 nm of each ssDNA oligonucleotide or 0.5-4 nm dsRNA, 0.1 to 0.3% L77 silwet, 50 mM NaPO.sub.4 in a final volume of 40 microliters of water. Two to 4 days post spraying, seedlings will be infected with dry spores of barley powdery mildew (Blumeria graminis f. sp. hordei) and 7 days post infection, disease development is scored for the percentage of leaf area covered with powdery mildew.
(81) Cucumber seeds are planted in a 3-inch square pot and thinned to one plant per pot after emergence. When the first true leaf is fully expanded and the second leaf is opening, a polynucleotide solution such as ssDNA and/or dsRNA oligos directed to the promoter and/or targeting the coding region of a target gene of interest is applied to the first true leaf or the cotyledons. The nucleotide solution applied consists of 6-20 nm of each ssDNA oligonucleotide or 0.5-4 nm dsRNA, 0.1 to 0.3% L77 Silwet, 50 mM NaPO.sub.4 in a final volume of 40 microliters of water. Two days later the entire cucumber plant is inoculated with a shower of dry spores of cucumber powdery mildew (Sphaerotheca fuliginea) shaken off diseased plants. Disease severity will be evaluated on the treated leaf and succeeding leaves 10 days later and at subsequent intervals.
(82) Tomato seeds are planted in a 3-inch square pot and thinned to one plant per pot after emergence. Two weeks old tomato seedlings are treated with 6-20 nm of each ssDNA oligonucleotide or 0.5-4 nm dsRNA, 0.2-0.5% L77 silwet, 50 mM NaPO.sub.4, 1% ammonium sulfate in a final volume of 30 microliters of water. Two to 4 days post spraying plants are innoculated with dry spores of tomato powdery mildew (Oidium neolycopersici) and 13 days post infection, disease development is scored for the percentage of leaf area covered with powdery mildew.
Example 5. Control of Powdery Mildew with Oligonucleotide Applications
(83) Barley plants were treated with control and oligonucleotide containing solutions essentially as indicated in Example 4. More specifically, Barley seeds (Perry variety) are planted about into soil in 2 inch pots in the growth chamber and grown at 25 C. with a 16 hr light cycle in 50% humidity. Before polynucleotide application the plants are randomized. Application of polynucleotides (either ssDNA oligos and/or dsRNA) is performed by pipet application where 5 L of solution containing nucleotides is applied to both sides of the first leaf. The nucleotide solution applied consists of 3-15 nm of each ssDNA oligonucleotide or 0.5-1 nm dsRNA, 0.1-0.3% Silwet L-77, 5 mM NaPO4, and 1% AMS in Gibco ultra pure water. Two days post treatment seedlings are infected with barley powdery mildew (Blumeria graminis f. sp. hordei). The growth chamber settings for the infection are as follows: 23 C., with a 12 hr light cycle in 70% humidity. At seven days post infection disease severity is scored for the percentage of leaf area covered with powdery mildew.
(84) Data is analyzed using Anova Single Factor Analysis (=0.1). The A LSD is calculated and custom error bars created for the bar graphs. Percent disease reduction is compared to formulation blank and nucleic acid control
(85) Experiments were conducted using pools of polynucleotides from the following Table 3.
(86) TABLE-US-00003 TABLE3 Polynucleotides SEQ Sequence Sequence ID Type name Sequence Length NO: antisenseDNA T5895 TCAGGGCAATGTGTAGGTAAGCACC 25 93 antisenseDNA T5896 AGCATTGTCAGCATCCCGCCGATGT 25 94 antisenseDNA T5897 TTCCAGGAGGGCTGCACCCATCAGC 25 95 antisenseDNA T5898 CAATCAGAGGTCCAACCGAAGCCCC 25 96 antisenseDNA T5899 CTTGGGTCAAAGTCTATGGCAAGCT 25 97 antisenseDNA T5900 TCCGACAAACCCTGTCACGAGGATG 25 98 antisenseDNA T5901 AGAAGCACCCAAAGGCGATGGCGGT 25 99 antisenseDNA T5902 CGCTTGGCGATGATGGCGGCGCCAG 25 100 antisenseDNA T5903 GCCACCGAGGTACAGGTACTCCCTG 25 101 antisenseDNA T5904 GGATCGACAGGCCAGACGAGAGCA 25 102 G antisenseDNA T5905 GACGTGACAAACTGCAGCCAGAGCA 25 103 antisenseDNA T5906 GCTGCCAGAGGAGTGGCCAAAGATG 25 104 antisenseDNA T5907 GGCCAAAGTAAACCTCAAACATGAA 25 105 antisenseDNA T5908 ACCATGTACCCCAGGAAGATCAACA 25 106 antisenseDNA T4211 GGGGTGCTGGAGAGGCCCAGGTGG 24 107 sense T4211_S CCACCTGGGCCTCTCCAGCACCCC 24 108 antisenseDNA T5909 CTCGATGATCTCCTGCGTGTCGTAC 25 109 antisenseDNA T4223A_AS GACCCCCTCTTCCTCTTCTTCTTG 24 110 antisenseDNA T4223B_AS CGTTCTTGAGCATGATGATGAGGA 24 111 antisenseDNA T4223C_AS GCAACAAAGTCGGTGAAGAGG 21 112 antisenseDNA T4223D_AS GTCAGCATCCCGCCGATGTTCAG 23 113 antisenseDNA T4223E_AS CCACGGCAGATGAGGCCAGTGCA 23 114 antisenseDNA T4223F_AS TAAACGAGCTTGAGGTGGGACTG 23 115 antisenseDNA T4223G_AS AACTGCAGCCAGAGCAGGATCG 22 116 antisenseDNA T4223H_AS AGCAGGCCACCGAGGTACAGGT 22 117 antisenseDNA T4223I_AS GGCGGCGCCAGAGAAGCACCC 21 118 dsRNA T5942 ATGGACGCCTTCTACTCGACCTCGTC 150 119 GGCGGCGGCGAGCGGCTGGGGCCA CGACTCCCTCAAGAACTTCCGCCAGA TCTCCCCCGCCGTGCAGTCCCACCTC AAGCTCGTTTACCTGACTCTATGCTTT GCACTGGCCTCATCTGCCGTG dsRNA T5943 AGGGCGCACCATGGCGACATGGACT 150 120 ACATCAAGCACGCCCTCACCCTCTTC ACCGACTTTGTTGCCGTCCTCGTCCG AGTCCTCATCATCATGCTCAAGAACG CAGGCGACAAGTCGGAGGACAAGA AGAAGAGGAAGAGGGGGTCCTGA dsRNA T5944 CGCTTGTGTCGGAACTATCGCCTGGA 150 121 TGTTCTCGGTGCCAGTCTATGAGGAG AGGAAGAGGTTTGGGCTGCTGATGG GTGCAGCCCTCCTGGAAGGGGCTTC GGTTGGACCTCTGATTGAGCTTGCCA TAGACTTTGACCCAAGCATCCT
(87) Table 4 provides a summary of the results obtained.
(88) TABLE-US-00004 TABLE 4 Powdery Mildew control results Anova: Single Factor SUMMARY Average Oligos Percent in Disease Vari- Groups pool Count Sum Area ance Non Treated 10 256 25.6 480.2667 Blank 10 321 32.1 405.2111 MLO_T4211.sup.1 SEQ ID NO: 10 6 0.6 0.266667 107 BI1_T5895-98 SEQ ID NO: 10 14 1.4 1.6 93, 94, 95, 96 BI1_T5899-02 SEQ ID NO: 10 31 3.1 14.98889 97, 98, 99, 100 BI1_T5903-06 SEQ ID NO: 10 42 4.2 56.17778 101, 102, 103, 104 BI1_T5907-09 SEQ ID NO: 10 78 7.8 52.17778 105, 106, 109 .sup.1A positive control oligonucleotide that suppresses the endogenous barley Mildew Resistance Locus O (MLO) gene and provides fungal disease control.
Example 6. Topical Oligonucleotide Application and Nematode Testing Methods
(89) Application of Oligonucleotides to Seeds for Nematode Control
(90) Cucumber seeds are soaked approximately 5-72 hours in nucleotides, either ssDNA and/or dsRNA oligos directed to the promoter and/or the coding region of a target of interest. Optionally, seeds can be soaked in water for a few hours prior to soaking in oligonucleotide solution. Soaking solution consists of 20 nm of each ssDNA nucleotide or 0.03-1 nm dsRNA, 0.1% silwet L77, 50 mM NaPO4 in a final volume 200 uL in water. The radicals of the cucumber seeds emerge within 72 hours, after which the seeds are placed on germination paper until root length is approximately 2 inches. Seedlings are transplanted to sand vials for RKN inoculation 24 hours later. Ten mL dry sand is added to each vial and seedlings are planted by tilting the vial and laying the seedling in the correct orientation so that the cotyledons are just above the sand and then tilting back to cover the radicles with sand. 3.3 ml water is added to each vial and the vials placed in racks under fluorescent light banks. 500 vermiform eggs or 300 J2 RKN are inoculated in each tube in 50 uL of deionized or spring water. Harvest of the cucumber plants is performed 10 to 12 days after inoculation by washing sand off the roots. A root gall rating and visual phytotoxicity rating is assigned using the following scales: Gall rating scale (Gall: % root mass galled): 0=0-5%; 1=6-20%; 2=21-50%; and 3=51-100%. The average of the triplicate gall rating is then calculated: no galls=0.00-0.33; mild galling=0.67-1.33; moderate galling=1.67-2.33; severe galling=2.67-3.00. Visual phytotoxicity scale is also assigned (Vis. tox; visual reduction in root mass compared to the control): rs1=mild stunting; rs2=moderate stunting; rs3=severe stunting.
(91) Experiments in soybeans using soy cyst nematodes (SCN) are similar to RKN assays except for the following changes. After 5-72 hours of soaking soybean seeds are planted in 100% sand in two inch square plastic pots. Optionally, seeds are soaked in water for a few hours prior to soaking in oligonucleotide solution. Seven days after planting the soybean seed, the nematode soybean cyst nematode (SCN) inoculum (1000 vermiform eggs or 1000 J2s) are applied to the pot. Watering of the test plants is then restricted to only water as needed to prevent wilt for a period of 24 hours. After the 24 hour restricted watering, normal sub-irrigation watering is done for the duration of the test. Twenty eight days after inoculation the test is harvested and cysts counted.
(92) Experiments in corn using lesion nematodes are similar to above except for the following changes. After 5-72 hours of soaking, corn seeds are planted in a sand:Turface mix 2:1 in 4 inch deep pots (Turface MVP, Profile Products, LLC., Buffalo Grove, Ill.). Optionally, seeds are soaked in water for a few hours prior to soaking in oligonucleotide solution. Inoculum of 2 gm of roots P. scribneri infested corn roots are applied to seedings and removed from the pot after 7 days. Watering of the test plants is then restricted to only water as needed to prevent wilt for a period of 24 hours after inoculation. After the 24 hour restricted watering, normal sub-irrigation watering as needed is done for the duration of the test. 12-14 days post inoculation, plants are harvested and nematodes extracted for 6 days from the cut up roots in a mist tent.
(93) RKN and SCN J2s are prepared from hatchbowls using the following solutions: RKN solution: 1 L aerated tap water, 1 ml of 50 mg/ml kanamycin, 0.5 ml of 20 mg/ml imazalil sulfate; SCN solution: 1 L aerated tap water, 1 ml of 50 mg/ml kanamycin, 0.5 ml of 20 mg/ml imazalil sulfate, 1430 mg zinc sulfate.
(94) Hatchbowls are autoclaved 6 oz bowls, lined with screen mesh and paper filter. Approximately 20 ml of appropriate hatch solution is poured into each bowl. Eggs are then place in the bowls and covered with foil. The bowls are then placed in a 25 C. incubator overnight. The next day the hatched J2's are extracted, additional solution added as needed and replaced in the incubator. Each bowl is used for 2 weeks and then disposed.
Example 7. Protection of Soybean from Soy Cyst Nematode (SCN)
(95) Soybean cotyledons of the variety W82 were treated with the treatments indicated in Table 5 by topical application of the oligonucleotide solution in 5 mM NaPO.sub.4, 1% Ammonium Sulfate, and 0.20% Silwet (wt percent). Approximately 50 l of solution containing the ssDNA oligonucleotides of Table 6, in pools of 4 ssDNAs/pool, was applied to each cotyledon of the plants and 4 plants were subjected to each treatment. One day following treatment, the plants were infected with approximately 1000 vermiform eggs of Soy Cyst Nematode applied directly to the pot. Twenty eight days after inoculation the root weights and cyst counts were recorded. ANOVA analysis for cyst count is provided in Table 8 and root weight is in Table 10.
(96) TABLE-US-00005 TABLE 5 Treatments Treatment # Description Oligo Final Conc. 1 Bi1-1 pool 1 AS coding 80 nmol/4 10 L 2 Bi1-1 pool 2 AS coding 80 nmol/4 10 L 3 Bi1-1 pool 3 AS coding 80 nmol/4 10 L 4 Bi 1-2 pool 4 AS coding 80 nmol/4 10 L 5 Bi1-2 pool 5 AS coding 80 nmol/4 10 L 6 GFP AS control 80 nmol/4 10 L 7 Mock treated no Silwet L-77 8 Formulation
(97) TABLE-US-00006 TABLE6 Oligonucleotidesused SEQ ID Pool NO Sequence Mapsto ID 122 TTGAATCGAAGAAGGAATTGAAGGAGTCCAT Soybean 1 Bil-1 SEQID NO12 123 AGGTAAGCCCCAACAGCCGCAGCAACCA Soybean 1 Bil-1 SEQID NO12 124 CTCTTTTCCTCTCTTCAAAAGGAGGTGTC Soybean 1 Bil-1 SEQID NO12 125 TGCACTAAAGATAAGGCTTGGATCGAT Soybean 1 Bil-1 SEQID NO12 126 ATCCAGAAGAAACCAAGCCACCAAGGT Soybean 2 Bil-1 SEQID NO12 127 CCTACAAACACCAAAAGCCCAAAGTAC Soybean 2 Bil-1 SEQID NO12 128 ACTGCAACCAAATCGGTAAACAAGGTCAA Soybean 2 Bil-1 SEQID NO12 129 TCAATCTCTCCTCTTCTTTTTCTTC Soybean 2 Bil-1 SEQID NO12 130 TCAAGGGACCAACGAAGGCTAATTTCG Soybean 3 Bil-1 SEQID NO12 131 GGCTTTGAATTTCAACACCCCTAATT Soybean 3 Bil-1 SEQID NO12 132 GCTTGCAATCGGAGAAACACAAATTT Soybean 3 Bil-1 SEQID NO12 133 ATGGGGACTTGAAGAAAGTGTCCAT Soybean 4 Bil-2 SEQID NO22 134 TAAAATAAACCAGTTTGATGTGATTCTG Soybean 4 Bil-2 SEQID NO22 135 TGCTCCCAATGGAAGCCACCGTGGTGA Soybean 4 Bil-2 SEQID NO22 136 AATCAGAGGTCCAATGGAAGCACCCTGA Soybean 4 Bil-2 SEQID NO22 137 GCCTTGCAACTAAGGCTACTGCAGAAAA Soybean 5 Bil-2 SEQID NO22 138 AGAGCTATAGAGCCCCCAAAGAGAGAGG Soybean 5 Bil-2 SEQID NO22 139 TCCAGGTCACCAAAGTGAGCCCTCTCA Soybean 5 Bil-2 SEQID NO22 140 CTTCTCATTTCTCTTAGATGAATTATT Soybean 5 Bil-2 SEQID NO22 141 GTTGTAGTTGTACTCCATCTTATTG GFP Control
(98) TABLE-US-00007 TABLE 7 Cyst counts trt# rep1 rep2 rep3 rep4 avg 1 143.0 109.0 90.0 111.0 113.3 2 42.0 46.0 44.0 31.0 40.8 3 78.0 197.0 193.0 101.0 142.3 4 138.0 75.0 80.0 51.0 86.0 5 141.0 136.0 92.0 107.0 119.0 6 72.0 67.0 75.0 95.0 77.3 7 83.0 128.0 52.0 103.0 91.5 8 179.0 122.0 165.0 184.0 162.5
(99) TABLE-US-00008 TABLE 8 ANOVA Single Factor analysis of Cyst counts Anova: Single Factor SUMMARY Groups Count Sum Average Variance Row 1 4 453 113.25 482.9167 Row 2 4 163 40.75 44.91667 Row 3 4 569 142.25 3800.917 Row 4 4 344 86 1362 Row 5 4 476 119 548.6667 Row 6 4 309 77.25 150.9167 Row 7 4 366 91.5 1032.333 Row 8 4 650 162.5 793.6667 ANOVA Source of SS df MS F P-value F crit Variation Between 41568.88 7 5938.411 5.782054 0.000521 2.422629 Groups Within 24649 24 1027.042 Groups Total 66217.88 31 std of diff 22.6 df = 1.711 Isd 38.8 Isd 19.4
(100) TABLE-US-00009 TABLE 9 Root Weight trt# rep1 rep2 rep3 rep4 avg 1 16.0 18.4 14.8 18.8 17.0 2 13.5 16.7 18.6 4.0 13.2 3 5.6 15.1 11.7 10.5 10.7 4 14.8 14.1 12.6 12.4 13.5 5 12.9 13.1 14.1 12.4 13.1 6 15.8 17.0 19.8 16.9 17.4 7 15.6 15.1 14.0 11.5 14.1 8 14.2 16.2 17.2 14.8 15.6
(101) TABLE-US-00010 TABLE 10 ANOVA analysis of root weight Anova: Single Factor SUMMARY Treatment Count Sum Average Variance 1 4 68 17 3.68 2 4 52.8 13.2 42.04667 3 4 42.9 10.725 15.46917 4 4 53.9 13.475 1.355833 5 4 52.5 13.125 0.509167 6 4 69.5 17.375 2.909167 7 4 56.2 14.05 3.336667 8 4 62.4 15.6 1.84 ANOVA Source of Variation SS df MS F P-value F crit Between 138.1888 7 19.74125 2.219781 0.068719 2.422629 Treatm. Within Treatment 213.44 24 8.893333 Total 351.6288 31 std of diff 2.1 df = 1.711 Isd 3.6 Isd 1.8
Example 8. Protection of Cucumber from Root Knot Nematode (RKN)
(102) Cucumber seed were soaked for 72 hr in dsRNA polynucleotide solution directed to the coding sequence of soybean Bi-1 gene. Soaking solution consisted of 0.01-1 nm dsRNA, 0.2% Silwet L77, 20 mM NaPO4 in a final volume 200 uL in water as outlined in Table 11. The radicals of the cucumber seeds emerged within 72 hours, after which the seeds were placed on germination paper until root length was approximately 2 inches. Seedlings were transplanted to sand vials for RKN inoculation 24 hours later. Ten mL dry sand was added to each vial and seedlings were planted by tilting the vial and laying the seedling in the correct orientation so that the cotyledons were just above the sand and then tilting back to cover the radicles with sand. 3.3 ml water was added to each vial and the vials placed in racks under fluorescent light banks. 500 vermiform eggs or 300 J2 RKN were inoculated in each tube in 50 uL of deionized or spring water. Harvest of the cucumber plants was performed 10 to 12 days after inoculation by washing sand off the roots.
(103) A root gall rating and visual phytotoxicity rating was assigned using the following scales: Gall rating scale (Gall: % root mass galled): 0=0-5%; 1=6-20%; 2=21-50%; and 3=51-100%. The average of the triplicate gall rating was then calculated: no galls=0.00-0.33; mild galling=0.67-1.33; moderate galling=1.67-2.33; severe galling=2.67-3.00. Table 11 summarizes the treatments performed and Table 12 shows the gall rating results. These results are also graphically displayed in
(104) TABLE-US-00011 TABLE 11 Treatments SEQ Volume Treat- Trigger ID Conc of each ment# type Trigger NOs (nmol/L) dsRNA 1 dsRNA Bi-1 142 0.0172 0.70 0.06 nmol 143 0.022 0.55 (0.012 nmol each) 144 0.0148 0.81 145 0.0195 0.62 146 0.0216 0.56 2 dsRNA Bi-1 142 0.0172 1.74 0.15 nmol 143 0.022 1.36 (0.03 nmol each) 144 0.0148 2.03 145 0.0195 1.54 146 0.0216 1.39 3 dsRNA GFP 147 0.0157 3.82 control 0.06 nmol 4 dsRNA GFP 147 0.0157 9.55 control 0.15 nmol 5 Mock, no Silwet 6 Formulation
(105) TABLE-US-00012 TABLE 12 RKN Assay Results Treat- ment No. Treatment Score % AVG St Dev 1 Bax1 dsRNA 15 25 10 10 15 7.071067812 coding .06 nmol (.012 nmol each) 2 Bax1 dsRNA 10 40 5 20 18.76 15.47847968 coding .15 nmol (0.03 nmol each) 3 GFP dsRNA 15 40 50 20 31.25 16.52 control .06 nmol 4 GFP dsRNA 50 65 57.50 10.61 control .15 nmol 5 Mock no 25 50 40 40 38.75 10.31 silwet 6 Formulation 50 30 70 30 45 19.15