TEMPLATE DIRECTED SPLIT AND MIX SYNTHESIS OF SMALL MOLECULE LIBRARIES

20180163199 ยท 2018-06-14

    Inventors

    Cpc classification

    International classification

    Abstract

    The invention combines the advantages of split and mix synthesis with the advantages of template directed synthesis. The method comprises the steps of: a) adding a linker molecule L to one or more reaction wells; b) adding a molecule fragment to each of said reaction wells; c) adding an oligonucleotide identifier to each of said reaction wells; d) subjecting said wells to conditions sufficient to allow said molecule fragments and said oligonucleotide identifiers to become attached to said linker molecule, or conditions sufficient for said molecule fragments to bind to other molecule fragments and sufficient for said oligonucleotide identifiers to bind to other oligonucleotide identifiers; e) combining the contents of said one or more reaction wells; and f) contacting the resulting bifunctional molecule(s) of step e) with one or more (oligonucleotide) templates each capable of hybridizing to at least one of the oligonucleotide identifiers added step c).

    Claims

    1. A method for synthesizing an encoded molecule comprising the steps of: a) Adding a linker molecule L to one or more reaction wells; b) Adding a molecule fragment to each of said reaction wells; c) Adding an oligonucleotide identifier to each of said reaction wells; d) Subjecting said wells to: conditions sufficient to allow said molecule fragments and said oligonucleotide identifiers to become attached to said linker molecule, or conditions sufficient for said molecule fragments to bind to other molecule fragments and sufficient for said oligonucleotide identifiers to bind to other oligonucleotide identifiers; e) Combining the contents of said one or more reaction wells; wherein at least one reactive group of the linker molecule L reacts with a reactive group in the molecule fragment, or with a reactive group in the oligonucleotide; wherein at least one reactive group of the molecule fragments reacts with a reactive group in the linker molecule L, or with a reactive group in another molecule fragment, wherein at least one reactive group of the oligonucleotide identifiers reacts with a reactive group in the linker L, or with a reactive group in another oligonucleotide identifier; and wherein the oligonucleotide identifier added to each well in step c) identifies the molecule fragment added to the same well in step b).

    Description

    FIGURE LEGENDS

    [0301] FIG. 1. Reactions in stage 1 of the method in the invention

    [0302] Schematic representation of an example of the synthesis steps of stage 1. Two rounds of split and mix synthesis are shown leading to the generation of bi-functional carrier molecules each carrying a different di-peptide and a unique 24-mer oligonucleotide that encodes the di-peptide. Each round of synthesis adds an amino acid and an identifier oligonucleotide. (m) represents the number of different molecule fragments in each of the two different repertoires employed. (m) can have a different values for different repertoires.

    [0303] The split and mix synthesis shown in the example includes the following steps:

    Add linker molecule to wells 1-m
    Add amino acids R.sub.1(1-m) to wells 1-m, and react with linker.
    Add oligonucleotides O.sub.1(1-m) to wells 1-m, and react with the linker.
    Mix content of wells 1-m and split into 1-m wells on a new plate.
    Add amino acids R.sub.2(1-m) to wells 1-m and react with reactive group of R.sub.1(1-m)
    Add oligonucleotides O.sub.2(1-m) to wells and react with O.sub.1(1-m).
    Mix content of wells 1-m

    [0304] FIG. 2. Reactions in stage 2 of the method in the invention

    [0305] Example of the synthesis steps of stage 2. In the illustrated example the bi-functional carrier molecules generated in the example in FIG. 1 are combined by a template directed method. Tetra-peptide bi-functional carrier molecules with 48-mer identifier oligonucleotides are therefore generated in the example. (m) represents the number of different molecule fragments in each of the four different repertoires, i.e., in the example m=1000 for all four repertoires. (M) represents the total number of (encoded) molecules generated. Here, M=(1000).sup.4=10.sup.12.

    [0306] The synthesis in the example comprise the following steps:

    Add bi-functional carrier molecule from stage 1
    Add DNA templates that bind the carriers through their complementary oligo's
    Acyl transfer reaction where the amino group of di-peptide in one carrier attacks the peptidyl ester of the di-peptide in the other carrier
    The synthesis is complete

    [0307] FIG. 3. Types of molecule fragment transfer from one carrier to another:

    [0308] Direct transfer reaction: The reaction between reactive groups leads directly to the transfer of a molecule fragment. The mechanism is shown schematically (generic) as well as for a specific case (example). Other types of reactions allowing direct transfer are shown in FIG. 6.

    [0309] Indirect transfer reaction. Reaction between reactive groups leads to the formation of a linkage between the two reactive groups. Thereafter a molecule fragment is cleaved off from one carrier, mediating its transfer to another carrier. Clv indicates a cleavable moiety, i.e. a part of the linker that is cleavable, for example by acid, base, electromagnetic radiation, light, heat, or by specific reagents or catalysts.

    [0310] Long horizontal line symbolises a template. Short horizontal line symbolises oligonucleotide identifier.

    [0311] FIG. 4. Alternative methods for the reactions in stage 2

    [0312] Examples of alternative methods for carrying out the reactions of stage 2 are shown. A number of templates (long horizontal line) is mixed with sets of carriers (short horizontal line). In the examples, two sets of carriers are employed. The first example is identical to the example shown in FIG. 2, except that in this example the two carriers are ligated together before reaction of the reactive groups of the two carriers. The next two examples show variations of the template directed reactions illustrated in the first example. In Example 2, the identifiers of the two carriers are ligated together prior to reaction of the reactive groups of X and Y, and the duplex structure denatured, to generate single-stranded complementary template. The single-stranded structure improves the likelihood of X and Y reacting. The reaction efficiency of the reactive groups of X and Y may be increased by including complementary sequences next to X and Y. This will lead to stable duplex formation proximal to X and Y, positioning X and Y in close proximity, and thereby increasing the reaction efficiency. In Example 3, one of the carriers is ligated to the template through its oligonucleotide identifier moiety. The ligation of carrier to template may be stimulated by including a hair-pin structure in the template, as shown in the figure, and then ligating together the template and carrier by use of for example a ligase or chemical ligation. Example 4 shows a template-free method of carrying out the reactions in stage 2. The carriers of the example are double-stranded, allowing for efficient ligation of their overhangs. Ligation of the carriers lead to the formation of a complementary template. Before reaction of X with Y, the duplex structure is denatured, allowing a more efficient reaction of X and Y. As in example 3, the efficiency of reaction may be increased by including complementary sequences proximal to X and Y, respectively.

    [0313] The library of encoded molecules that results from each of the examples can be of the same kind; however, the examples describe different set-ups that may allow different chemical reactions to be performed. In a preferred embodiment, the template of the bifunctional molecules are turned into double-stranded DNA before selection or screening is performed, in order to eliminate potential interaction from the single-stranded regions. Thus, in examples 2 and 4, it may be advantageous to add a terminal oligonucleotide that anneals to the DNA template that carries the encoded molecule; by extension, e.g. by a polymerase such as Sequenase, a double-stranded DNA will be generated, carrying the encoded molecule at one end.

    [0314] The lower strand of the duplexes symbolises the template (long horizontal line); short horizontal lines symbolise oligonucleotide identifiers; after ligating the oligonucleotide identifiers together, a complementary template is formed, symbolised by a long horizontal line. X and Y are molecule fragments, each containing at least one reactive group.

    [0315] FIG. 5. Template generation:

    [0316] An example of a DNA library generation process for the synthesis of a library of 10.sup.12 DNA templates. Four sets of 1000 DNA oligos are mixed individually with their complementary sequences, to form for example 12 nt duplex DNA, with an overhang of one nucleotide at both ends. In the example each oligo carries a region complementary to an identifier sequence (a codon sequence). In addition, the oligos of the two distal sets of oligos contain constant regions. These constant regions may be used at a later stage for PCR-amplification, sequencing or polymerase extension. This is followed by a ligation step in which the overhangs mediate the ligation of the 4000 duplex DNA complexes, to form 10.sup.12 (=1000.sup.4) different duplex DNA complexes. Ligation may be by a ligase or by chemical ligation. Optionally, the templates may be amplified by e.g. PCR using primers that anneal to the constant regions at the ends of the template, or by any other molecular biological technique that allows amplification. Finally, one of the strands is isolated in order to be used in a templating process (stage 2 templated synthesis). The isolation of single stranded templates can be done in a number of ways, including asymmetric PCR on the ligated product (which leads to excess of one of the strands), or by including a biotinylated PCR-primer that anneals to one end of the template and thus leads to incorporation of biotin into one of the strands of the duplex; by immobilisation of the biotin on streptavidin-coated solid support, and denaturation of the duplex template, one may recover the non-biotinylated strand from the supernatant, or the biotinylated strand immobilised on solid support.

    [0317] In the example, the configuration of each of the 10.sup.12 single-stranded templates thus is as follows: Constant sequence-codon1-codon2-codon3-codon4-Constant sequence. Each of the codon positions contain one specific of the 1000 possible sequences, i.e., each template carries its specific combination of a codon1-, codon2-, codon3-, and codon4 sequence.

    [0318] Templates may also be generated by stage 1 split and mix synthesis, in which optionally the reaction of molecule fragments with the carrier is excluded. To generate a DNA template library as the one described in this example, 4 sets of 1000 different duplex DNA molecules must be ligated, employing 1000 wells in each of four rounds of split and mix synthesis. This will generate the same DNA template library of 10.sup.12 molecules as described above.

    [0319] FIG. 6. Direct transfer: Reactive groups and bonds formed upon reaction:

    [0320] A number of reactions are shown that mediate the direct transfer of molecule fragments from one carrier to another. In the left part of the figure the two carriers (the donor- and the acceptor carrier) are shown. The oligonucleotide identifiers of the carriers are indicated by a short horizontal line. The templates to which the carriers bind are indicated by long horizontal lines. The carriers carry molecule fragments containing reactive groups that upon reaction lead to the transfer of a molecule fragment from one carrier onto the other. The reactions that allow direct transfer include acylation (formation of amide, pyrazolone, isoxalone, pyrimidine, coumarine, quinolon, phtalhydrazide, diketopiperazine, hydantoin, benzodiazepinone, etc), alkylation (including reductive amination not shown in figure), vinylation, disulfide formation, addition to carbon-hetero multiple bonds, such as Wittig/Wittig-Horner-Emmon (formation of substituted alkenes), transition metal catalysed reactions such as arylation (formation of biaryl, vinylarene), alkylation, nucleophilic substitution using activation of nucleophiles, such as condensations, and cycloadditions. All of these reactions may be used for indirect transfer as well. The reactions may also be used during stage 1 synthesis. FIG. 6 is adapted from (Pedersen et al. (2002) WO 02/103008 A2, Templated molecules and methods for using such molecules)..

    [0321] FIG. 7. Indirect transfer: Reactive groups and bonds formed upon linking reaction:

    [0322] Indirect transfer involves first the coupling reaction between the reactive groups of carrier molecules, followed by a cleavage that releases one molecule fragment from its carrier molecule. This figure shows examples of reactive groups that may for example be used in the coupling reaction. The coupling reaction may be nucleophilic substitution, aromatic nucleophilic substitution, transition metal catalysed reactions, addition to carbon-carbon multiple bonds, cycloaddition to multiple bonds, and addition to carbon-hetero multiple bonds. In FIG. 8 a number of example cleavable linkers that may be combined with these coupling reactions in order to obtain efficient indirect transfer are shown. The reactions may also be used during stage 1 split and mix synthesis. FIG. 7 is adapted from (Pedersen et al. (2002) WO 02/103008 A2, Templated molecules and methods for using such molecules)..

    [0323] FIG. 8. Cleavable linkers and protection groups, cleaving agents and cleavage products: Cleavable linkers and protection groups that may be used to release molecule fragments in an indirect transfer reaction, or can be used as protecting groups, are shown. The cleavable linkers may be combined with reactive groups from FIG. 7, in order to indirectly transfer molecule fragments from one carrier to another. Linkers may be cleaved by acid, base, electromagnetic radiation, light, heat, by specific reagents or catalysts such as LiOH, PdCl.sub.2, TCEP, NaIO.sub.4, etc. FIG. 8 is adapted from (Pedersen et al. (2002) WO 02/103008 A2, Templated molecules and methods for using such molecules)..

    [0324] FIG. 9. A typical affinity selection process:

    [0325] An example affinity selection process is shown. First a DNA template library is generated, for example as described in FIG. 5. Then, stage 2 templated synthesis is performed using the carriers generated in stage 1 (not shown), which generates a library of bi-functional molecules. The target may be biotinylated, allowing its immobilisation on magnetic beads coated with streptavidin. The beads are immobilised on a magnet and washed. The bound ligands are then eluted, and the DNA of the eluted bi-functional molecules are amplified, for example by PCR, where after this amplified DNA can be used in yet another round of bi-functional molecule library synthesis, or may be sequenced in order to identify the ligand structures that bound to the target.

    [0326] FIG. 10. Molecular biological techniques applicable to bi-functional molecules:

    [0327] A number of molecular biological techniques are listed that allow small molecule engineering, analogous to protein engineering through modification of the DNA encoding the protein. Using bi-functional molecules, one may here modify the encoded small molecule through modifications of the DNA encoding the small molecule. Shuffling of the DNA templates (and hence, the small molecules), can be done efficiently by e.g. restriction endonuclease cleavage of the DNA template in the spacer that separates the codons. Other techniques such as DNA arrays of bi-functional molecules are also suggested. FIG. 10 is modified from (Pedersen et al. (2002) WO 02/103008 A2, Templated molecules and methods for using such molecules)..

    [0328] FIG. 11. Polyvalent display and other approaches to the identification of molecules with weak binding characteristics.

    [0329] Polyvalent display by rolling circle amplification of templates before templated reaction. DNA template molecules are circularised by ligation of the ends. Specific primers are annealed and extended by rolling circle amplification resulting in templates having multiple copies of the specific binding sites for carrier molecules. The multiple copy templates are thereafter used for templated synthesis with carrier molecules resulting in polyvalent display of encoded molecules.

    [0330] Stage 1 Synthesis of Divalent Bi-Functional Carrier Molecules.

    [0331] Split and mix synthesis is carried out as in the example describing stage 1 synthesis, but the linker molecule (L) employed in the first step of the synthesis has, in this example, two reactive ends to which molecule fragments (R.sub.1-n) can be coupled. This results in the generation of divalent bi-functional carrier molecules having two encoded molecules attached to a linker that is attached to a single oligonucleotide identifier (O.sub.1-n).

    [0332] Stage 2 Templated Synthesis Employing Divalent Bi-Functional Carrier Molecules (Generated in Example B Above).

    [0333] The divalent carrier molecules from example B can be used for templated synthesis employing the method described for stage 2 of the present invention. As a result a library of divalent encoded molecules are generated. Each molecule consists of two encoded molecules (R.sub.1-n) attached to a linker that is attached to one oligonucleotide identifier (O.sub.1-n).

    [0334] Template Assisted Binding to Target DNA Molecule.

    [0335] For screening of a library of encoded molecules for binding to target DNA sequences, hybridisation of complementary DNA sequences (C and C) on the bi-functional molecule and the target DNA, can increase the overall affinity and help in the identification of molecules in the library with low affinity for the target DNA.

    [0336] Use of Known Ligand for Assisted Target Binding.

    [0337] A library of encoded divalent bi-functional molecules, each containing a known ligand (L) and an encoded molecular entity, (R), is used for screening for molecules with two binding sites, of which one of these is specific for the known ligand. Binding of the known ligand to its site on the target molecule (T), assists the binding of the encoded molecular entity to the other binding site.

    [0338] Use of Known Ligand for Assisted Target BindingHybridisation of Known Ligand to Template.

    [0339] This example uses the same principle as illustrated above in FIG. 11F, but in this example the known ligand is hybridised to the bi-functional molecule through hybridisation of complementary DNA sequences (C and C) carried by the known ligand and the template DNA. Hybridisation of the known ligand to the template DNA of the bi-functional molecule creates functionally divalent molecules that can be used for screening for target with two binding sites, of which one is specific for the known ligand.

    [0340] Use of Known Ligand for Assisted Target BindingBinding to the Same Site.

    [0341] As in the example illustrated in FIG. 11E, but in this example the known ligand (L) and the molecular entity (R) bind to the same site of the target molecule.

    [0342] Use of Complementary DNA Attached to the Target Molecule to Assist Binding.

    [0343] A DNA sequence, C, which is attached to the target molecule, is complementary to a DNA sequence, C, on the template DNA. Hybridisation of the complementary DNA sequences assists binding of the encoded molecules to the target (T).

    [0344] FIG. 12. Example set-ups allowing improved ligation of identifiers.

    [0345] During the stage 1 synthesis, the identifiers are ligated together. In order to make this an efficient reaction, the identifiers can be double-stranded DNA with overhangs that are complementary, and therefore bring the reactive groups of the identifiers into close proximity. Alternatively, the identifiers are single-stranded and a complementary oligonucleotide, or some other kind of molecule that binds to the identifiers and brings the reactive groups into proximity, is added in order to increase the efficiency of the chemical or enzymatic ligation.

    Ligation assisted by sticky ends of the DNA
    Ligation assisted by complementary oligonucleotide
    Ligation assisted by complementary oligonucleotide attached to solid support
    Ligation assisted by annealing to self-complementary sequence
    Ligation assisted by DNA binding molecule

    [0346] FIG. 13. Example molecule fragments and the encoded molecules resulting from stage 1 and stage 2 synthesis.

    [0347] A1-A4 show generic structures of molecule fragments, carrying at least 1 reactive group (A1), two reactive groups (A2), three reactive groups (A3), and four reactive groups (A4).

    [0348] R can be any molecular entity, and can be cyclic or non-cyclic, aliphatic or aromatic. X, Y and A are reactive groups. Molecule fragments can carry multiple reactive groups of the same kind (e.g., three X reactive groups), or can carry multiple reactive groups of different kinds (e.g., X, Y and A).

    [0349] B1-B4 show specific examples of molecule fragments. B1 structures carry at least one reactive group (here: carboxylic acid or amine). B2 structures carry at least two reactive groups (hydroxyl, amine, thiol). B3 structures carry at least three reactive groups (amine, disulfide, carboxylic acid). B4 carry at least four reactive groups (hydroxyl, amine, thiol, carboxylic acid).

    [0350] C, D, E, and F show examples of molecules generated by stage 1 and/or stage 2 synthesis, i.e., by covalently coupling molecule fragments through their reactive groups. The stipled circles indicate molecule fragments that have been linked together during the stage 1 and/or stage 2 synthesis.

    [0351] During stage 1 synthesis the molecule fragments become attached to the linker molecule L via reaction of a reactive group of the molecule fragment with a reactive group of the linker. In this example, the hydroxyl of the encoded molecule of (F) could have been attached to a carboxylic acid-modified oligonucleotide, thus linking the encoded molecule to the linker.

    [0352] FIG. 14. Dynamic combinatorial library of dimers or trimers of encoded molecules.

    [0353] A library, A, of encoded bi-functional molecules carries, in addition to its oligonucleotide identifier, O, an oligonucleotide sequence, C, that is complementary to a corresponding oligonucleotide sequence carried by another library, B, of encoded bi-functional molecules. The two libraries are hybridised, thus creating functionally divalent bi-functional molecules that can be used in screening for targets with two binding sites. If appropriately designed, trimers may be formed instead of dimers, thus creating a library of functionally trivalent encoded molecules.

    [0354] FIG. 15. Molecule fragments used in example 1.

    [0355] A). Molecule fragments employed in example X1 are shown.

    [0356] B). List of the molecule fragments used at positions 0, 1, 2, and 3 in the library generation process of example XL.

    EXAMPLES

    Example 1

    [0357] Formation of a Library of Bifunctional Molecules and Affinity Selection Against the Protein Target Integrin alphaV/Beta3 Receptor, Employing Subprocesses 3, 5, A and i (First Synthesis-Selection-Amplification Round), and A and i (Second Synthesis-Selection-Round) (See Above), Using Amine Acylations for the Coupling of Molecule Fragments to Generate the Encoded Molecules.

    [0358] The human integrin receptor a.sub.v/(3w is implicated in many biological functions such as inflammatory responses and thrombus formation as well as cellular migration and metastatic dissemination. The natural ligands for alphaV/beta3 integrin receptor contain an RGD tri-peptide consensus motif that interacts with the receptor binding pocket. Consequently, much medical research have focused on the synthesis and identification of small molecule RGD-mimetics with increased affinity for the alphaV/beta3 receptor. One mimetic, Feuston 5 (Feuston et al., J Med Chem. 2002 Dec. 19; 45(26):5640-8.), comprising an arginine bioisostere coupled to a GD dipeptide exhibits a ten-fold increased affinity (K.sub.D=111 nM) compared to the RGD-tripeptide.

    [0359] It would therefore be of interest to synthesize libraries of bifunctional molecules that include the molecule fragments that generate the Feuston 5 ligand. In the following protocols for the generation and screening of such libraries are described. First, the formation and screening of a 625-membered library is described.

    Stage 1 Synthesis: Generation of Two Sets of Carriers, Using Chemical Ligation and Enzymatic Ligation, Respectively, During Stage 1 Synthesis to Generate Carrier Molecules (Subprocesses 3 and 5).

    [0360] FIG. 15 shows the molecule fragments and oligonucleotides employed to generate the library.

    Formation of Carrier Molecules Set I:

    [0361] Five 14 nt oligonucleotides, each containing a 5-terminal amino-group (Glen Research catalog #10-1905-90) linked by a Spacer-PEG18 (Glen Research catalog #10-1918-90) are synthesised by standard phosphoramidite chemistry, to give the following oligonucleotides:

    TABLE-US-00002 O-0.1: 5-NH2-PEG-ATGCTCGAGACGCG-3 O-0.2: 5-NH2-PEG-TAGCTGTAGGCGCG-3 O-0.3: 5-NH2-PEG-AGAGCTCTGACGCG-3 O-0.4: 5-NH2-PEG-CGTCGTCGTACGCG-3 O-0.5: 5-NH2-PEG-ATCGTCGAGACGCG-3

    [0362] The sequences of these oligonucleotides are not crucial, and the sequences can be changed to increase the sequence dissimilarity or decrease the differences in annealing temperature. Each of the O-0.n oligonucleotides (position 0 in the library) are now portioned out into separate wells (i.e., each oligonucleotide is placed in a separate well, here an eppendorf tube), and loaded with a specific molecule fragment, each of which comprises a carboxylic acid and a penteneoyl-protected amine. The five molecule fragments are shown in FIG. 15; one of these molecule fragments is penteneoyl-Asp(OMe)-OH (aspartic acid, where the side chain carboxylic acid has been protected with a methyl ester). The following molecule fragment loading protocol, Protocol A; is used:

    1 nmol amino-modified oligonucleotide is lyophilized and then dissolved in 20 microliter of 100 mM Na-borate buffer, pH 8.0 with 90 mM sulpho-N-Hydroxysuccinimide (sNHS, Merck). The molecule fragments are preactivated by incubation of 15 microliter of 100 mM molecule fragment in DMSO and 15 microliter of 100 mM 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC, Merck) in DMF for 30 min at 30 C. before addition to the oligonucleotide solution. Each of the five molecule fragments are added to a specific oligonucleotide, as described in FIG. 15. Following incubation for 45 min at 30 C., an additional 30 microliter of pre-activated molecule fragment is added and the solution incubated for another 45 min at 30 C. Excess molecule fragment, activation agents, solvents and salt is removed by double gel filtration using Bio-rad microspin columns 6 and eluted in MS-grade H.sub.2O. Loading is optionally verified by Electrospray-MS analysis. Subsequently, the amino-protection group is removed by addition of 0.2 volumes of 25 mM iodine in a mixture of THF/H.sub.2O (1:1) and incubated at 37 C. for 2 h. Excess iodine is quenched by 20 mM 2-mercaptoethanol before gel filtration purification using Bio-rad 6 microspin columns. From MS-analysis the efficiency of loading and deprotection can optionally be estimated. At the end of this first round of synthesis, each of the 5 oligonucleotides should be attached to their specific molecule fragment; the molecule fragment contains a reactive group, the amine, ready for reaction with the next molecule fragment that is added. The contents of the five wells are pooled, and redistributed into five new wells.

    [0363] Next, 1.2 nmoles unit identifier oligonucleotides, corresponding to position 1, are added to each well, according to the scheme of FIG. 15. The five oligonucleotides carry an imidazole-activated 5-phosphate (Visscher, J., Schwarz, A. W. Journal of Molecular Evolution (1988), 28: 3-6; Zhao, Y., Thorson, J. S. Journal of Organic Chemistry (1998), 63:7568-7572) and have the following sequences:

    TABLE-US-00003 O-1.1: 5-ImP-CACAAGTACGAACG-3 O-1.2: 5-ImP-CACATAGTCTCCTC-3 O-1.3: 5-ImP-CACATACATCGTTC-3 O-1.4: 5-ImP-CACATCCAGTGCAA-3 O-1.5: 5-ImP-CACAAGCATCACTA-3

    [0364] 1-2 nmoles of the oligonucleotide 3-GCGCGTGT-5 is added to all wells, and an appropriate buffer of pH 8-10 is added, to a final volume of 20-50 microliter. This oligo is complementary to the ends of oligonucleotides O-0.n and O-1.n, and by hybridization of these complementary sequences the 3-OH group of the oligonucleotides-O-0.n and the Imidazole activated 5-phosphates of the O-1.n oligonucleotides will be juxtaposed. The solution is incubated for 1-5 hrs at 37 C. or 50 C. This results in ligation of the juxtaposed oligonucleotides, by formation of a phosphodiester bond.

    [0365] Optionally, the five solutions containing the ligation products are purified individually using Biorad 6 spin columns according to manufacturer's instructions and lyophilized. Next, a specific molecule fragment is reacted with each of the five solutions of nascent bifunctional molecules, according to the scheme shown in FIG. 18, using loading protocol A described above. Excess free reactant, reagents and buffer is removed by gelfiltration. The eluates are pooled, lyophilized and resuspended in 40 ul of H.sub.2O before addition of 10 ul of 25 mM iodine (in THF/H.sub.2O, ratio 1:1) for deprotection. The reaction is incubated at 37 C. for 2 h. Excess Iodine is quenched by addition of 1 ul of 1 M 2-mercaptoethanol and left at ambient temperature for 5 min before purification of the sample using spin-gelfiltration (Bio-rad 6). The solution now contains 25 carrier molecules, where 25 different carrier identifier oligonucleotides each is attached to a specific one of 25 different dimers of molecule fragments. The carriers contain a free amino group, for reaction in the templated synthesis (see below).

    [0366] Formation of Carrier Molecules, Set II:

    [0367] The five 15 nt oligonucleotides, corresponding to position 2 of the library:

    TABLE-US-00004 O-2.1: 3-SH-GAGCAGGACCACCAG-5P O-2.2: 3-SH-CTCGACCACTACCAG-5P O-2.3: 3-SH-CGTGCTTCCTACCAG-5P O-2.4: 3-SH-CCTGGTGTCGACCAG-5P O-2.5: 3-SH-CTCGACGAGGACCAG-5P
    each carrying a 3-terminal thiol-group, linked to the oligonucleotide through a flexible linker, and a 5-terminal phosphate group, and each portioned out into one of five separate wells, are each linked through a thioester bond to a specific one of the five molecule fragments listed in FIG. 15 by the following Protocol B (Bruick et al., (1996), Current biology 3:49-56):

    [0368] Five N-protected molecule fragments (see FIG. 15) carrying a free carboxylic acid are first converted by standard procedures to the corresponding thioacids. After lyophilization, 1.2 equivalents of Ellmanns Reagent (5,5-dithiobis(2-nitrobenzoic acid)) is incubated with the thioacid at pH 6.5 for 1 h, to produce the corresponding 5-thio-2-nitrobenzoic acid ester. Optionally, the desired compounds are purified and characterized by HPLC and mass spectrometry.

    [0369] 1 nmol of each of the five oligonucleotides O-2.n are now incubated in separate wells with an excess of one of the five 5-thio-2-nitrobenzoic acid esters, according to the scheme of FIG. 15, at 25 C. or 37 C., at pH 8 for 1-5 h. Optionally, 2 mM spermidine may be added to improve the efficiency of the reaction. Optionally, the formation of the correct oligonucleotide-thioester-molecule fragment product can be verified by mass spectrometry.

    [0370] Finally, the five modified oligonucleotides are pooled.

    [0371] Excess molecule fragment, activation agents, solvents and salt is removed by double gel filtration using Bio-rad microspin columns 6 and eluted in MS-grade H.sub.2O. Subsequently, the amino-protection group is removed by addition of 0.2 volumes of 25 mM iodine in a mixture of THF/H.sub.2O (1:1) and incubated at 37 C. for 2 h. Excess iodine is quenched by 20 mM 2-mercaptoethanol before gel filtration purification using Bio-rad 6 microspin columns. Alternatively, the oligonucleotides are precipitated with ethanol to remove the iodine. From MS-analysis the efficiency of loading and deprotection can optionally be estimated. At the end of this first round of synthesis, each of the 5 oligonucleotides should be attached to their specific molecule fragment through a thioester bond; the molecule fragment contains a free amine, ready for reaction with the next molecule fragment that is added. The contents of the five wells are pooled, and redistributed into five new wells.

    [0372] Next, 1.2 nmoles unit identifier oligonucleotides, corresponding to position 3, are added to the wells, according to the scheme of FIG. 15. The five oligonucleotides have the following sequences:

    TABLE-US-00005 O-3.1: 3-CCTTAGTACGAACG-5 O-3.2: 3-CCTTACACGGAAAG-5 O-3.3: 3-CCTTGCTACTAGCT-5 O-3.4: 3-CCTTGGAATTCCGA-5 O-3.5: 3-CCTTGTACCATGGA-5

    [0373] 1-2 nmoles of the oligonucleotide 5-TGGTCGGAA-3, complementary to the ends of oligonucleotides O-2.n and 0-3.n, is added to all wells. Then, the oligos are ligated in a volume of 20 ul using ligation buffer [30 mM Tris-HCI (pH 7.9), 10 mM MgCI.sub.2, 10 mM DTT, 1 mM ATP] and 10 units T4-DNA ligase at ambient temperature for 1 hour. Subsequently, the solutions of ligation products are purified individually using Biorad 6 spin columns, and the oligonucleotides lyophilized.

    [0374] Next, a specific molecule fragment is reacted with the nascent bifunctional molecule according to the scheme shown in FIG. 18 using loading protocol A described above. Excess free molecule fragment, reagents and buffer are then removed by gelfiltration. The eluate is pooled, lyophilized and resuspended in 40 ul H.sub.2O.

    [0375] The BB-F3 molecule fragment does not react efficiently using protocol A, due to poor solubility of BB-F3 in organic solvent. Consequently, BB-F3 is reacted using Protocol C instead: The ligated and lyophilized sample is dissolved in 35 microliter 100 mM Na-borate buffer (pH 8.0) before addition of 10 microliter 100 mM BB-F3 in water and 5 microliter of 500 mM 4-(4,6-dimethoxy-1,3,5-triazin-2-yl)-4 methylmorpholinium chloride (DMT-MM, carboxylic acid activator) and incubated at 25 C. for 2 h. Following the coupling reaction, excess molecule fragment, reagent and salt is removed by gelfiltration as described in protocol A.

    [0376] The two solutions are pooled, and the resulting solution now contains 25 carrier molecules, all of which contain a thioester bond linking the molecule fragments to the carrier identifiers.

    [0377] Stage 2 synthesis: Generation of bifunctional molecules by DNA-templated synthesis as described by (Bruick et al., (1996), Current biology 3:49-56) (subprocess A, see above). Single-stranded DNA template library generation. First, four sets of duplex DNAs with overhangs are produced, by standard oligonucleotide synthesis followed by hybridization of appropriate oligonucleotide pairs, corresponding to the four encoded positions in the library. Each set of duplex DNA in this library contains five different dsDNAs, corresponding to the 5 different identifier sequences at each position, encoding 5 different molecule fragments at each positions. All dsDNA 0.n carry a biotin as indicated below for the dsDNA 0.1. When employing more molecule fragments, the number of dsDNAs in each set must be increased accordingly. An example of dsDNAs is shown below for the O-0.1, O-1.1, O-2.1, and O-3.1 identifiers:

    TABLE-US-00006 dsDNA0.1: 5-ATGCTCGAGACGCG-3 3-GTACGAGCTCT-5 dsDNA1.1: 5-CACAAGTACGAACGTATGCGTTGGCCAAACACTG-3 3-GCGCGTGTTCATGCTTGCATACGCAACCGGXTTGTGAC-5 dsDNA2.1: 5-GACCACCAGGACGAGC-3 3-AAGGCTGGTGGTCCTGCTC-5 dsDNA3.1: 5-TTGGTTGACTAGAGACGAGCGCAAGCATGATTCC-3 3-AACCAACTGATCTCTGCTCGCGTTCGTACT-5

    [0378] Underlined sequences are priming sites for PCR amplification. All 5-ends are phophorylated (contain phosphates). Overhang sequences can be extended in order to allow more efficient ligation in the preparation of the templates described below. The X in dsDNA 1.1 denotes a T that carries a biotin group.

    [0379] The four sets of dsDNAs are incubated, to allow for hybridization between overhang, and ligated as a mixture using ligation buffer [30 mM Tris-HCI (pH 7.9), 10 mM MgCI.sub.2, 10 mM DTT, 1 mM ATP] and T4-DNA ligase at ambient temperature for 1 hour. Thus, a total of 5555=625 templates are generated. As an example, we have aligned the four dsDNAs corresponding to the O-0.1, O-1.1, O-2.1, and O-3.1 identifiers immediately below; open spaces highlight the complementary overhangs that hybridize during the ligation reaction:

    TABLE-US-00007 dsDNA3.1 -TTGGTTGACTAGAGACGAGCGCAAGCATGATTCC -AACCAACTGATCTCTGCTCGCGTTCGTACTAAGG dsDNA2.1dsDNA0.1 GACCACCAGGACGAGCATGCTCGAGACGCGCACAAGTACG CTGGTGGTCCTGCTCGTACGAGCTCTGCGCGTGTTCATGC dsDNA1.1 AACGTATGCGTTGGCCAAACACTG-3 TTGCATACGCAACCGGTTTGTGAC-5 Theligationproduct(thetemplate)thatresults fromtheligationoftheabovesequencesis indicatedimmediatelybelow: dsDNA3.1dsDNA2.1 5-TTGGTTGACTAGAGACGAGCGCAAGCATGATTCCGACCACCAGGA 3-AACCAACTGATCTCTGCTCGCGTTCGTACTAAGGCTGGTGGTCCT dsDNA0.1dsDNA1.1 CGAGCATGCTCGAGACGCGCACAAGTACGAACGTATGCGTTGGCCAAA GCTCGTACGAGCTCTGCGCGTGTTCATGCTTGCATACGCAACCGGXTT CACTG-3 GTGAC-5

    [0380] Thus, the sequence of identifier sequences in the 625 templates is: (primer annealing site)-O-3-O-2-O-0-O-1-(primer annealing site). Optionally, more copies of the templates can be produced by PCR amplification using primers that anneal to underlined sequences. One of the primers should carry a T with biotin, as indicated. Thus, the ligation product and the PCR product contains a biotinylated lower strand.

    [0381] The biotinylated double stranded product is now incubated with streptavidin-coated beads, and the upper strand removed by alkaline denaturation of the strands, and the pH is neutralized with an appropriate buffer to produce immobilized, single stranded template.

    [0382] Hybridisation of Carriers and Template, and Templated Reaction Between Reactive Groups (Bruick et al., (1996), Current Biology 3:49-56):

    [0383] 1-100 pmol immobilized templates are mixed with an excess of Set I and Set II carriers obtained above, in an appropriate buffer at pH 8. Optionally, the temperature is kept at 50 C. for 2 min., then lowered to 37 C. The temperature is now kept at 37 C. for 24 h. The carrier molecules anneal to the template under these conditions; the close proximity of the amino group of carriers of Set I, and the thioester of carriers of Set II, leads to amide formation, in effect transferring the molecule fragment of the thioester carrier onto the amine carrier. At this point, 625 different bifunctional molecules have been generated.

    [0384] Optionally, a DNA loop that can be ligated to the carrier molecule with the 0.n and 1.n identifiers (to the right in the figure above) and to the template, and thus covalently attaches the carrier molecule to the template, can be added. Thus, optionally, to the bifunctional molecule that results from the templated synthesis immediately above, add an oligonucleotide with the sequence 5-TATGCGTTGGCCAAACACTGGCAGATA-GAGGTCTGC-3, where the stem sequences are underlined, and where the 5-terminus is phosphorylated (carries a phosphate). Add ligation buffer [30 mM Tris-HCI (pH 7.9), 10 mM MgCI.sub.2, 10 mM DTT, 1 mM ATP] and T4-DNA ligase at ambient temperature for 1 hour, to covalently attach the right-ward carrier molecule (carrying the encoded molecule that results from the templated synthesis) to the template.

    [0385] Optional amine and carboxylic acid deprotection. Optionally, to the solution of the previous step is now added 0.2 volumes of 25 mM iodine (in THF/H.sub.2O, ratio 1:1) for deprotection of the penteneoyl-protected amines. Excess Iodine is quenched by addition of 1 ul of 1 M 2-mercaptoethanol and left at ambient temperature for 5 min before optional purification of the sample using spin-gelfiltration (Bio-rad 6). Then, optionally, NaOH is added to 25 mM, at 80 C. for 5 minutes, to deprotect methylester-protected carboxylic acids. Then increase pH to 12.5 for one min Optionally, the sample is purified using spin-gelfiltration (Bio-rad 6).

    Selection on Immobilised Target (Subprocess i).

    [0386] Immobilisation and selection: Maxisorp ELISA wells (NUNC A/S, Denmark) is coated with each 100 microliter 2 ug/mL integrin alphaV/beta3 (Bachem) in PBS buffer [2.8 mM NaH.sub.2PO.sub.4, 7.2 mM Na.sub.2HPO.sub.4, 0.15 M NaCl, pH 7.2] overnight at 4 C. Then the integrin solution is substituted for 200 microliter blocking buffer [TBS, 0.05% Tween 20 (Sigma P-9416), 1% bovine serum albumin (Sigma A-7030), 1 mM MnCI.sub.2] and incubated for 1 hour at room temperature. Then the wells are washed 2 times with 250 microliter blocking buffer, and 200 microliter blocking buffer, containing the library of bifunctional molecules generated above, is added to the wells. Following 2 hours incubation at room temperature the wells are washed with 20250 microliter blocking buffer. After the final wash the wells are cleared with washing buffer and the bound bifunctional molecules eluted with MeOH, glycine pH 5, or an appropriate buffer of pH 11-13. The pH is adjusted to 7. The eluted fraction contains potential integrin alphaV/beta3 receptor ligands.

    [0387] PCR amplification of the DNA templates of the isolated bifunctional molecules, and cloning and characterization: The templates of the eluted fraction is now amplified by PCR, and then either cloned and sequenced for characterization, or is taken through one more round of single-stranded template preparation, and stage 2 synthesis. For characterization, 5 ul eluted bifunctional molecules are used for PCR in a 25 ul reaction using 10 ul Eppendorf hotmastermix 2.5 and 10 pmol each of forward and backwards primers that anneal to the underlined sequences depicted above. The PCR product is then ligated into suitable plasmid and transformed into e.g. E. coli, whereafter individual clones are sequenced by standard means (see for example below). From the DNA sequences the identity of the recovered encoded molecules can be deduced.

    [0388] Template amplification, single-stranded template preparation, stage 2 synthesis (e.g. subprocess 5) and selection (e.g. subprocess i). Instead of amplifying the recovered identifiers from the selection step above, and cloning and sequencing, the bifunctional molecules can be amplified and taken through one more round of selection. To this end, amplify the recovered identifiers with forwards and backwards primers, where the backwards primer carries a biotin (as indicated above). Isolate single-stranded DNA-template, add carriers generated above, and perform stage 2 synthesis as indicated above. Finally, the selection is performed, as indicated above, or by any other means that lead to identification of integrin alphaV/beta3 ligands. Finally, the identifiers recovered are PCR amplified, cloned, and sequenced (see for example below), to reveal the identity of the encoded molecules responsible for binding to the integrin receptor.

    Identification and Characterisation.

    [0389] To obtain the sequences of the DNA templates, and thereby deduce the chemical structure of the encoded molecules, the double stranded PCR-product is cloned into e.g. an E. coli vector, propagated in E. coli, and individual clones sequenced. Each of the clones represent an identifier sequence of a bifunctional molecule in the pool isolated by the selections; from the sequence of the DNA the corresponding encoded molecule (that was attached to the identifier of the same bifunctional molecule) can be deduced. The TOPO-TA (Invitrogen Cat#K4575-310) ligation is reacted with 4 ul PCR product, 1 ul salt solution, 1 ul vector. The reaction is incubated at RT for 30 min. Heat-shock competent TOP10 E. coli cells are thawed and put on ice. 5 ul ligation reaction is added. Following 30 min on ice, the cells are heat-shocked at 42 C. water for 30 sec, then put on ice. 250 ul SOC is added and the cells incubated 1 h at 37 C., before spreading on LB-ampicillin plates followed by incubation ON at 37 C. Individual E. coli clones are picked and transferred to PCR wells containing 50 ul water. Colonies are incubated at 94 C. for 5 minutes and 20 ul is used in a 25 ul PCR reaction with 5 pmol of each TOPO primer M13 forward & M13 reverse and Ready-To-Go PCR beads (Amersham) using the following PCR program: 94 C. 2 min, then 30 (94 C. 4 sec, 50 C. 30 sec, 72 C. 1 min) then 72 C. 10 min. Primers and free nucleotides are degraded by adding 1 ul EXO/SAP mixture 1:1 to 2 ul PCR product. Incubation is at 37 C. for 15 min and then 80 C. for 15 min. 5 pmol T7 primer is added and water to 12 ul. Subsequently, 8 ul DYE-namic ET cycle sequencing Terminator Mix is added followed by PCR-cycling using 30 rounds of (95 C. 20 sec, 50 C. 15 sec, 60 C. 1 min). Purification is done using seq96 spinplates (Amersham), followed by analysis on a MegaBace sequenzer.

    [0390] To verify that the isolated encoded molecules indeed represent ligands to the target protein (integrin alphaV/beta3), individual bifunctional molecules may be prepared, by preparation of single stranded DNA of that bifunctional molecule, and performing the templated synthesis, to generate multiple copies of that specific bifunctional molecule. The ability of the bifunctional molecule (and, expectably, the ability of the encoded molecule) to bind the protein target (integrin alphaV/beta3) is then tested by e.g. immobilising the protein target in the well of a microtiter plate, adding the bifunctional molecule, washing off unbound bifunctional molecule, and then determine the amount of bound bifunctional molecule.

    [0391] Alternatively, the identified encoded molecule may be synthesized in its free form, by standard chemical synthesis protocols, and then examined in e.g. competition binding experiments.

    [0392] The directionality of the oligonucleotides used in the example may be changed, so as for example to include a thiol at the 5-end rather than the 3-end, or the sequences of the oligonucleotides may be changed in order to obtain highest possible mismatch (sequence difference) among the different unit identifiers and carrier identifiers, while keeping the annealing temperatures relatively similar. This will increase the fidelity of the hybridization of carriers to the template during stage 2 synthesis, and will also increase the fidelity of the deconvolution step, since sequencing errors will be less of a problem if the identifiers have fewer identical nucleotide positions.

    [0393] In the example a thioester was employed as the reactive group of Set II carriers. The activated ester can be any other type of activated ester (e.g., N-hydroxide succinimide ester, nitrophenyl-ester, nitrobenzyl-ester), or the ester may be a regular carboxyester. These activated esters are prepared by standard organic synthesis methods.

    [0394] In the example, only the Set I carriers contain a long, flexible PEG linker. It may be advantageous that both carrier sets contain a PEG linker, to obtain high flexibility of the molecule fragments that must react.

    [0395] In the example, the order of reactions between molecule fragments, and ligation of identifiers during stage 1 synthesis, is reaction-ligation-reaction. This order can be changed, to be reaction-reaction-ligation, if desired.

    [0396] The constant regions of the unit identifier oligonucleotides are 4 or 5 nt in the example. The constant regions are complementary to the third oligonucleotide added; the third oligonucleotide brings the two unit identifiers into close proximity, and thus mediates the ligation of the unit identifiers. The overlap region between the identifier and the third oligonucleotide can be extended (to allow for a more efficient ligation during stage 1 synthesis), or shortened (to allow for more specific annealing of the carrier molecule during the stage 2 synthesis that follows; annealing is more specific because the sequence similarity with other carriers employed during the stage 2 templated synthesis will be smaller when the constant regions are shorter.

    [0397] The recovered sequences from the selection experiment of example X1 will contain an abundance of the identifier sequences encoding the molecule fragments BB98, BB99, and BB-F3, as these are the molecule fragments that generate the known integrin alphaV/beta3 receptor ligand, Feuston 5.

    [0398] The stage 1 synthesis protocol, stage 2 synthesis protocol, screening protocol, and characterization protocol, can be employed as modular units, as long as each of the four protocols are finalized by a purification to remove salts, reagents, unreacted molecule fragments, and the like. Often, an appropriate purification is spin-gelfiltration (Bio-rad 6); in order to obtain very efficient purification, two spin-gelfiltrations may be performed. The following examples describe protocols for individual stage 1 synthesis, stage 2 synthesis, screening/selection, and characterization. As mentioned, these may be combined in any desired way, as long as each of the protocols are finalized with an appropriate purification step. Obviously, the length and composition of the identifiers must be designed so as to mediate specific and efficient annealing of the carriers to the template during templated synthesis.

    Example 2

    [0399] Formation of Five Different Libraries of Bifunctional Molecules, i.e., Libraries Containing 16, 1.610.sup.5, 6.2510.sup.6, 10.sup.8, or 10.sup.12 Bi-Functional Molecules and Affinity Selection Against the Protein Target Integrin alphaV/Beta3 Receptor, Employing Subprocesses 3), 5), A) and i), Using Amine Acylations for the Coupling of Molecule Fragments to Generate the Encoded Molecules.

    [0400] This example describes the generation of libraries of five different libraries, i.e, libraries of 16, 1.610.sup.5, 6.2510.sup.5, 10.sup.8, or 10.sup.12 bi-functional molecules, and the use of these libraries for selection against the integrin alphaV/beta3 receptor.

    [0401] The protocol described in example X1 is followed, except that the sets of molecule fragments are now changed so as to include 2, 20, 50, 100, or 1000 molecule fragments at each of the four positions, leading to the formation of libraries of 2222=16, 20202020=1.610.sup.5, 50505050=6.2510.sup.6, 100100100100=10.sup.8, or 1000100010001000=10.sup.12 bifunctional molecules. The molecule fragments carry the same N-protecting group (N-penteneoyl) and a free carboxylic acid, wherefore the protocol described in example X1 can be used, except that an appropriate number of wells are used, corresponding to the number of molecule fragments. A number of unit identifier oligonucleotides are used that correspond to the number of molecule fragments.

    [0402] Because of the size of these libraries, novel ligands not strongly related to the Feuston 5 ligand, will be identified from the bigger libraries. This is particularly true for the libraries of 10.sup.8 or 10.sup.12 bifunctional molecules. For library sizes larger than 10.sup.8 encoded molecules, ligands will be identified that do not contain all three molecule fragments BB98, BB99, and BBF3, yet have dissociation constants lower than 100 micromolar.

    Example 3

    Covalent Attachment of a Carrier to the Template Employed in the Stage 2 Synthesis.

    [0403] The structure of the identifier template of the bifunctional molecule generated by stage 2 synthesis, and employed in the selections, can be varied. For example, before, during or after the templated reaction, one of the carriers may be ligated to the template by a DNA ligase, if the template for example loops back on itself, as described in FIG. 4, example 3. Optionally, an extension reaction involving a primer that anneals to the other end of the template may be performed, in order to generate a duplex DNA where the encoded molecule is displayed at the end of the dsDNA. This may be done by annealing 1 nmol of a primer that is complementary to the end of the template that is not looping back on itself, and adding sequenase buffer containing 200 micromolar deoxy-ribonucleotides (dNTP) in a total volume of 100 microliter before addition of 20 units of sequenase and incubation at 30 C. for 1 h. Following extension the reaction mixture is used in the selection step without further purification.

    Example 4

    Disulfide Formation During Stage 1 Synthesis, Employed to Attach a Scaffold Molecule Fragment Comprising Three Reactive Groups.

    [0404] This is an example of a reaction that attaches a molecule fragment to another molecule fragment, or to the linker molecule L, through formation of a disulfide bond (Freskgrd et al., WO 2004/039825 A2, example 1, p. 106-108). The protocol may be used in stage 1 synthesis. Similar reaction conditions can be employed in a stage 2 synthesis.

    [0405] An amino-modifier C6 5-labeled oligo (5-X-CGTAACGACTGAATGACGT-3), wherein X may be obtained from Glen research, cat. #10-1039-90) was loaded with a peptide (Cys-Phe-Phe-Lys-Lys-Lys, CFFKKK) using SPDP activation (see below). The SPDP-activation of amino-oligo was performed using 160 uL of 10 nmol oligo in 100 mM Hepes-KOH, pH=7.5, and 40 uL 20 mM SPDP and incubation for 2 h at 30 C. The activated amino-oligo was extracted 3 times with 500 uL EtOAc, dried for 10 min in a speedvac and purified using micro bio-spin column equilibrated with 100 mM Hepes-KOH. The loading of peptide was then performed by adding 10 uL of 100 mM attachment entity and incubating overnight at 30 C. The loaded identifier oligo was precipitated with 2 M NH.sub.4OAc and 2 volume 96% ethanol for 15 min at 80 C. and then centrifuged for 15 min at 4 C. and 15.000 g. The pellet was re-suspended in water and the precipitation was repeated. Wash of the oligo-pellet was done by adding 100 uL of 70% ethanol and then briefly centrifuged. The oligo was re-dissolved in 50 uL H.sub.2O and analysed by MS. After incubation the resin was removed by centrifugation and 15 uL of the supernatant was mixed with 7 uL of water, 2 uL of piperidine and imidazole (each 625 mM) and 24 uL acetonitrile. The sample was analysed using a mass spectroscopy instrument (Bruker Daltonics, Esquire 3000plus). The observed mass was 7244.93 Da, which correspond well with the calculated mass, 7244.00 Da. This experimental data exemplify the possibility to load a molecule fragment onto oligonucleotides through the formation of a disulfide bond. This particular molecule fragment (peptide) harbours three reactive groups, i.e. the amine groups of the lysine side chains, and therefore represents a scaffold with the ability to be reacted with one, two, or three other molecule fragments that are capable of reacting with the amine groups (e.g. carboxylic acids).

    Example 5

    Stage 1 Acylation Reaction.

    [0406] This is an example of a stage 1 acylation reaction that attaches a molecule fragment to another molecule fragment coupled to an oligonucleotide, or to a reactive group of an oligonucleotide. Similar conditions can be applied for a stage 2 acylation reaction, except that the incoming molecule fragment must be at high concentration, e.g. 10-100 mM. The experiment is described in (Freskgrd et al., WO 2004/039825 A2, p. 129-137).

    [0407] EDC-Based Acylation Protocol:

    [0408] 10 uL triethanolamine (TEA) (0.1 M in DMF) was mixed with 10 uL molecule fragment (here called Building Block (BB)). The building blocks that were tested all carry a carboxylic acid and a Pent-4-enal amine protecting group; the concentration of the building block was 0.1 M in DMSO. From this mixture 6.7 uL was taken and mixed with 3.3 uL EDC [1-Ethyl-3-(3-Dimethylaminopropyl) carbodiimide Hydrochloride] (0.1 M in DMF) and incubated 30 minutes at 25 C. 10 uL of the Building block-EDC-TEA mixture was added to 10 uL of an amino modified oligonucleotide (here termed amino oligo) (in 0.1 M HEPES buffer ((4-(2-Hydroxyethyl)-1-piperazineethanesulfonic acid, SIGMA), pH 7.5 and incubated for 30 minutes. During this half hour, another 6.7 uL of BB-TEA mix was mixed with 3.3 uL EDC (0.1M in DMF) and incubated for 30 minutes at 25 C. 10 uL of this second BB-EDC-TEA mixture was then added to the amino oligo mixture together with 10 uL of 0.1 M HEPES buffer to maintain a 1:1 ratio of DMSO/DMF:H.sub.2O. Then the mixture was incubated for 30 minutes. During this half hour, another 6.7 uL of BB-TEA mix was mixed with 3.3 uL EDC (0.1 M in DMF) and incubate for 30 minutes at 25 C. 10 uL of this third BB-EDC-TEA mixture was then added to the amino oligo mixture together with 10 uL of 0.1 M HEPES buffer to maintain a 1:1 ratio of DMSO/DMF:H.sub.2O. Then the mixture was incubated for 30 minutes. The oligonucleotide, linked to the molecule fragment (here termed loaded oligo) was then purified by gel filtration with columns (Biospin P-6, Bio-Rad) equilibrated with water. The pent-4-enal amine protection group was then removed by addition of 0.25 volumes 25 mM 1.sub.2 in 1:1 water: tetrahydrofuran (THF) and incubation at 370 C. for 2 hours. The mixture was then purified by gel filtration with spin columns (Biospin P-6, BioRad) equilibrated with water. Loaded oligos were analyzed by ES-MS. Molecule fragments tested included aliphatic as well as aromatic compounds, and all were attached efficiently through amide bond formation, as evidenced by mass spectrometric data within a few Daltons of the expected mass. See (Freskgrd et al., WO 2004/039825 A2, p. 129-137).

    [0409] DMT-MM-Based Acylation Protocol:

    [0410] 10-15 nmol of carrier oligo 2 was lyophilized and redissolved in 27.5 ul H.sub.2O. To this was added 7.5 ul 1 M HEPES pH 7.5, 10 ul of 2-amino-pent-4-enal protected (allyl-glycine) building block (0.1 M in dimethyl sulfoxide), and 5 ul DMT-MM [4-(4,6-dimethoxy-1,3,5-thiazin-2-yl)-4-methylmorpholinium chloride] (0.5 M in water). The mixture was incubated 4-16 hours at 25-30 C. The oligo was purified by gel filtration (Biospin P-6, BioRad). To convert the methyl ester moiety of the building block to a carboxylic acid, 5 ul 0.4 M NaOH was added and the mixture was incubated 20 min at 80 C. The mixture was then neutralized by adding 10 ul 0.5 M HEPES pH 7.5 and 5 ul 0.4 M HCI. The loaded building block oligo was purified by gel filtration Biospin P-6, BioRad) and analyzed by ES-MS. Aliphatic as well as aromatic building blocks were attached to the amine modified oligonucleotide efficiently, as evidenced by the MS-data which showed good correlation between expected and observed mass. See (Freskgrd et al., WO 2004/039825 A2, p. 129-137).

    Example 6

    Stage 1 Enzymatic Ligation of Oligonucleotides Carrying Molecule Fragments.

    [0411] This is an example of a stage 1 enzymatic ligation that attaches one oligonucleotide, carrying a molecule fragment, to another oligonucleotide through covalent phosphodiester bond formation. The experiment is described in (Freskgrd et al., WO 2004/039825 A2, p. 137-143).

    [0412] 500 pmol loaded carrier oligo (oligonucleotide carrying a molecule fragment), 5-phosphorylated, was mixed with 750 pmol anti-codon oligo (not carrying any molecule fragment) and 750 pmol splint oligo (comprising complementary sequences to both the carrier oligo and the anti-codon oligo). See figure immediately below, showing an example pair of carrier oligo and anti-codon oligo, as well as the splint oligo. Note that the anti-codon oligo comprises Inosines (allowing annealing to several different bases, here C and A. The mixture was lyophilized and redissolved in 15 ul water. Oligos were annealed by heating and slowly cooling to 20 C. 15 ul TaKaRa ligase mixture (Takara Bio Inc) was added and the reaction was incubated at 20 C. for 1 hour. The mixture was purified by gel filtration (Biospin P-6, BioRad) and the efficiency of the ligation was checked by running an aliquot on a Novex TBE-UREA gel (Invitrogen). Both oligonucleotides carrying aliphatic and aromatic compounds were tested; different sequences around the ligation point was examined as well. All oligonucleotides tested were ligated with more than 95% efficiency. See (Freskgrd et al., WO 2004/039825 A2, p. 137-143).

    TABLE-US-00008 LoadedcarrierOligoAnti-codonoligo 3-2GGAGTCGACACATAGCTCGCpCGTCGIIIIIGCAGCCAATAG TCGAGCG--GCAGCCA Splintoligo TCGT-X

    Example X7. Stage 1 Synthesis of a 484-Member Library of Bifunctional Molecules (Subprocess 4), and Selection by Affinity Selection on Immobilized Target (Subprocess i)

    [0413] This is an example of a stage 1 synthesis employing subprocess 4. Three rounds of encoding are employed, involving 4, 11 and 11 molecule fragments, thus generating a total of 484 bifunctional molecules that may be used as carriers in a templated stage 2 synthesis. The three rounds of encoding involve acylation reactions. (Freskgrd et al., WO 2004/039825 A2, p. 143-148).

    First Encoding Round.

    [0414] 2 pmol of loaded identifier oligo 1.1 (i.e, a particular molecule fragment attached to the identifier oligonucleotide) was combined with 200 pmol of each loaded identifier oligo 1.2, 1.3, and 1.4. (602 pmol loaded identifier oligos in total). These were mixed with 0.7 pmol building block oligo 3.1.3. (i.e., a particular molecule fragment attached to an oligonucleotide, capable of hybridizing with the identifier oligonucleotide), and 72.7 pmol each of 10 different other first round building block oligos (eg. 3.1.1 and 3.1.2; 727 pmol loaded building block oligos in total). The oligos were lyophilized and redissolved in 50 ul extension buffer (EX) [20 mM HEPES, 150 mM NaCl, 8 mM MgCI.sub.2]. The mixture was heated to 80 C. and slowly cooled to 20 C. to allow efficient annealing of identifier and building block oligos. 5 ul of 0.5 M DMT-MM in water was added and the mixture was incubated at 37 C. for 4 hours. Extension of the identifier oligo on the building block oligo identifier was performed by adding 3 ul of a 10 mM mixture of each deoxynucleotide triphosphate [dATP, dGTP, dCTP, dTTP] and 3 uL of 13 units/ul Sequenase (Amersham Biosciences). The mixture was subsequently incubated at 30 C. overnight. Then 3 pi of 2M NaOH was added and the mixture was incubated for 80 C. for 10 minutes followed by neutralization by addition of 3 pi 2M HCI. The mixture was then purified by passing through a gel filtration column (Biospin P-6, BioRad). 0.25 volumes of 25 mM 12 in 1:1 THF:water was added, mixed and incubated at 37 C. for 2 hours. 60 ul binding buffer (BF) [100 mM HEPES, 150 mM NaCI] and water ad 300 ul was added. The mixture was added to streptavidin-sepharose beads (Amersham Biosciences) pre-washed 3 times in BF buffer and incubated at room temperature for 10 minutes, followed by incubation on ice for 10 minutes with gentle stirring. The beads were then washed three times with water. Extended identifier oligos were stripped from the building block oligos bound to the streptaviding-sepharose beads by applying 100 ul NH3 1:1 in water and incubating at room temperature for 5 minutes.

    Second Encoding Round.

    [0415] To the eluate was added 0.36 pmol second round loaded building block oligo 3.2.2 and 36.4 pmol each of 10 different other second round building block oligos (eg. 3.2.1 and 3.2.3; 364 pmol loaded second round building block oligos in total) and the mixture was lyophilized and redissolved in 50 ul EX buffer. The encoding was performed essentially as described under above.

    [0416] Final extension. The eluted identifier oligo were lyophilized and dissolved in 50 ul EX buffer.

    [0417] Then 200 pmol primer E38 [5-XTTTTAGATGGCAGAT-3\X=CXS Biotin] was added. Annealing was performed by heating the mixture to 80 C. and slowly cooling to 20 C. Extension of the identifier oligo was performed by adding 3 ul of a 10 mM mixture of each deoxynucleotide triphosphate [dATP, dGTP, dCTP, dTTP] and 3 ul of 13 units/ul Sequenase. The mixture was subsequently incubated at 30 C. for 2 hours. The mixture was then purified by passing through a gel filtration column (Biospin P-6, BioRad). This eluate was used for selection. An aliquot was removed for analysis of the input in the selection procedure.

    General Procedure 5: Affinity Selection on Immobilized Protein Target.

    [0418] Maxisorp ELISA wells (NUNC A/S, Denmark) were coated with each 100 uL 2 ug/mL integrin aVp3 (Bachem) in PBS buffer [2.8 mM NaH.sub.2PO.sub.4, 7.2 mM Na.sub.2HPO.sub.4, 0.15 M NaCl, pH 7.2] overnight at 4 C. Then the integrin solution was substituted for 200 pi blocking buffer [TBS, 0.05% Tween 20 (Sigma P-9416), 1% bovine serum albumin (Sigma A-7030), 1 mM MnCI.sub.2] which was left on for 3 hours at room temperature. Then the wells were washed 10 times with blocking buffer and the encoded library was added to the wells after diluting it 100 times with blocking buffer. Following 2 hours incubation at room temperature the wells were washed times with blocking buffer. After the final wash the wells were cleared of wash buffer and subsequently inverted and exposed to UV light at 300-350 nm for 30 seconds. Then 100 ul blocking buffer without Tween-20 was immediately added to each well, the wells were shaken for 30 seconds, and the solutions containing eluted identifiers were removed for PCR analysis.

    Analysis of Selection Input and Output.

    [0419] PCR was performed on the input and output of the selection, using primers corresponding to the 5 end of the identifier oligos and the E38 primer. PCR was performed using Ready-To-Go (RTG) PCR beads (Amersham Biosciences) and 10 pmol each primer in a reaction volume of 25 ul. The PCR reaction consisted of an initial denaturation step of 94 C. for 2 minutes followed by 30-45 cycles of denaturation at 94 C. for 30 seconds, annealing at 58 C. for 1 minute and extension at 72 C. for 1 minute. A final extension step of 2 minutes at 72 C. was included. The PCR products were resolved by agarose gel electrophoresis and the band corresponding to the expected size was cut from the gel and purified using QIAquick Gel Extraction Kit (QIAGEN). To sequence individual PCR fragments the purified PCR products were cloned into the pCR4-TOPO vector (Invitrogen) according to the manufacturer's instructions. The resulting mixture was used for transformation of TOP10 E. coli cells (Invitrogen) using standard procedures. The cells were plated on growth medium containing 100 ug/ml ampicillin and left at 37 C. for 12-16 hours. Individual E. coli clones were picked and transferred to PCR wells containing 50 ul water. These wells were then boiled for 5 minutes and 20 ul mixture from each well was used in a PCR reaction using RTG PCR beads and 5 pmol each of M13 forward and reverse primers according to the manufacturer's instructions. A sample of each PCR product was then treated with Exonuclease I (USB) and Shrimp Alkaline Phosphatase (USB) to remove degrade single stranded DNA and dNTPs and sequenced using the DYEnamic ET cycle sequencing kit (Amersham Biosciences) according to the manufacturer's instructions and the reactions were analyzed on a MegaBace 4000 capillary sequencer (Amersham Biosciences). Sequence outputs were analyzed with ContigExpress software (Informax Inc.). A overview of molecule fragments used for library generation is shown in (Freskgrd et al., WO 2004/039825 A2, p. 146-147).

    [0420] Theoretically, the integrin aVp3 ligand A (Molecule 7 in Feuston B. P. et al., Journal of Medicinal Chemistry 2002, 45, 5640-5648) is present in 1 out of 310.sup.8 bifunctional molecules in this library. The codon combination compatible with encoding of ligand A was not found in 28 sequences derived from the encoded library before selection (input) in agreement with the expected low abundance of this codon combination (1 in 310.sup.8). A codon combination compatible with encoding of ligand A was found in 5 out of 19 sequences derived from the encoded library after selection in integrin aVB3-coated wells. These numbers thus correspond to an apparent enrichment factor of (310.sup.8/(19/7))=810.sup.7.

    [0421] For more detailed date see (Freskgrd et al., WO 2004/039825 A2, p. 143-148).

    Example 8. Selection of Bifunctional Molecules Using Size-Exclusion Chromatography

    [0422] This is an example of subprocess iii), although a real library of bifunctional molecules are not screened. A protocol for selection employing size-exclusion chromatography is presented. The experiment is taken from (Freskgrd et al., WO 2004/039825 A2, p. 148-150).

    [0423] This example illustrates the possibility to use column separation to perform selection on complexes against various targets. In this example, size-exclusion chromatography (SEC) is used, but other types of chromatography can be used where target-bound complexes are separated from the non-bound complexes. The complex is exemplified in this example by a biotin molecule attached to an oligonucleotide sequence with a predetermined sequence (see below). Thus, the nucleotide sequence of the identifier specifies the identity of the synthetic molecule as biotin. The encoding sequence can have any length and be divided into discrete regions for encoding various building blocks as discussed elsewhere herein. Also, the displayed molecule can have a linear or scaffold structure. Biotin-AATTCCGGAACATACTAGTCAACATGA Biotin is known to bind to streptavidin. The binding of biotin to streptavidin will link the identifier to the target molecule and therefore change the identifiers physical and chemical properties, such as e.g. the apparent molecular weight. This change is possible to detect using e.g. size-exclusion chromatography: 78 pmol of the complex molecule was loaded on a Superdex 200, PC 3.2/30 column (AKTA-FPLC, AmershamPharmaciaBiotech) and analysed in PBS buffer with a flow rate of 0.050 ml/min. As may be seen from the spectrogram, the complex molecules retention-time was approximately 35 minutes. When the target (83 pmol streptavidin) was analysed under identical conditions the retention-time was approximately the same. The low absorption of the target molecules is due to the wavelength (260 nm) used in the measurement. At this wavelength, the extinction coefficient is high. for the nucleotides in the complexes but low for the protein target.

    [0424] However, when the complex molecules was premixed with the target molecules (78 pmol complex and 83 pmol target incubated for about 1 h in PBS buffer) to allow binding and then analysed under identical conditions, the retention-time change significantly (28 minutes). The change is due to the increase in molecular weight (or hydrodynamic volume) due to the binding of the complex to the target. This will allow

    the separation of the target-bound complexes from the non-bound complexes. The fraction that contains the complexes and the target molecules are pooled and amplified using appropriate primers. The amplified identifiers can then be used to decode the structures of the enriched displayed molecules. The strategy of performing column-selection of libraries of bifunctional complexes has two major advantages. First, the enriched (target-bound) complexes are eluted before the non-bound complexes, which will drastically reduce the background from the non-bounded complexes. Secondly, the enrichment on the column will be extensive due to all the separation steps in the pores in the matrix. The separation of the target-bound complexes using this approach will be dependend on the molecular weight of the complexes but predominantly of the molecular weight of the target. The molecular weight of the target can be adjusted by linking the target to a support that increases the apparent molecular weight. The increased molecular weight will enhance the separation by reducing the retention-time on the column. This can be done using for example a fusion protein, antibody, beads, or cross-linking the target in multimeric form. Thus, the target protein can be expressed as a fusion protein or a specific antibody can be use to increase the molecular weight. The target can be immobilized on small beads that permit separation and the target can be cross-linked using standard reagents to form multimers or cross-linked to a carrier molecule, for example another protein. Preferably, the molecular weight is increased so the target molecules elute in the void volume of the column.

    [0425] Examples of other types of column separation that can be used are affinity chromatography, hydrophobic interaction chromatography (HIC), and ion-exchange chromatography. Examples of column media, other than Superdex, that can be used in size-exclusion chromatography are: Sephacryl, Sepharose or Sephadex.

    Example 9

    Encoded Multiple Component Reaction (MCR) During a Stage 1 Synthesis.

    [0426] This is an example of a stage 1 synthesis that involves the reaction of multiple different encoded molecule fragments in the same well; this is an example of an UGI reaction. The experiment is described in (Freskgrd et al., WO 2004/039825 A2, p. 157-162).

    [0427] Preparation of aldehyde-comprising scaffold-oligo, using 4-carboxybenzaldehyde. A solution of 4-carboxybenzaldehyde (scaffold) in DMF (25 uL, 150 mM) was mixed with 25 uL of a 150 mM solution of EDC in DMF. The mixture was left for 30 min at 25 C. 50 uL aminooligo (10 nmol) in 100 mM HEPES buffer pH 7.5 was added and the reaction mixture was left for 20 min at 25 C. Excess scaffold was removed by extraction with EtOAc (500 uL) and remaining EtOAc was removed in vacuo by spinning 10 min in a speedvac. The mixture was then purified by gel filtration with spin columns (Biospin P-6, BioRad) equilibrated with water. The loaded oligo were analyzed by ES-MS.

    [0428] Multi-component reaction. A solution of the Benzaldehyde loaded oligo prepared above (200 pmol) was lyophilized and redissolved in 10 uL H.sub.2O. 2-Methoxy ethylamine in methanol (10 uL, 40 mM), 3-furan-2-yl-acrylic acid in methanol (10 uL, 40 mM), and cyclohexyl isocyanide in methanol (10 uL, 40 mM) was added and incubated overnight at 37 C. The reaction mixture was diluted with 40 uL H.sub.2O and purified by gel filtration with spin columns (Biospin P-6, BioRad) equilibrated with water. MCR-product on oligo was analyzed by ES-MS. The starting benzaldehyde loaded oligo was identified in the MS-spectrum together with the UGI product.

    [0429] Multi-component reaction. A solution of benzaldehyde loaded oligo (320 pmol) was lyophilized and redissolved in 10 UL H.sub.2O. 2-Amino ethanol in methanol (10 uL, 40 mM), 3-Methoxy-propionic acid in methanol (10 uL, 40 mM), and ethyl isocyanoacetate in methanol (10 uL, 40 mM) was added and incubated overnight at 37 C. The reaction mixture was diluted with 40 uL H.sub.2O and purified by gel filtration with spin columns (Biospin P-6, BioRad) equilibrated with water. MCR-product on oligo was analyzed by ES-MS. The starting benzaldehyde loaded oligo was identified in the MS-spectrum together with three products, Diketopiperazine, UGI product and the Amine product.

    [0430] Encoding. Excess reactants, activation agents, solvents and salt was removed by double gel-filtration using Bio-rad microspin columns 6 and eluted in MS-grade H.sub.2O and loading was verified by Electrospray-MS (Bruker Inc) analysis before the displayed molecule attached to the oligonucleotide was encoded. The benzaldehyde loaded oligonucleotide, that has been reacted with the other three components to form the displayed molecule as described above was mixed with the codon oligonucleotides L2, L3 and L4 together with the splint oligonucleotides S1, S2 and 53 (sequences shown below) and ligated using a ligase (T4 DNA ligase). The ligation was performed using the following conditions. The double stranded oligonucleotide was achieved by mixing the encoding strands (L1, L2, L3 and L4) with the splint oligonucleotides (S1, S2 and S3) to form a 7 oligonucleotide hybridisation product (for efficient annealing and ligation). About 50 pmol of each specific oligonucleotide was used and the oligonucleotides was ligated in a volume of 20 uL using ligation buffer [30 mM Tris-HCI (pH 7.9), 10 mM MgCI2, 10 mM DTT, 1 mM ATP] and 10 units T4-DNA ligase at ambient temperature for 1 hour.

    TABLE-US-00009 LI: 5-CGATGGTACGTCCAGGTCGCA-3 SI: 5-ATCGTGCTGCGACCT-3 L2: 5-GCACGATATGTACGATACACTGA-3 S2: 5-GTGCCATTCAGTGT-3 L3: 5-ATGGCACTTAATGGTTGTAATGC-3 S3: 5-TGTATGCGCATTAC-3 L4: 5-GCATACAAATCGATAATGCAC-3

    [0431] The identifier comprising the tags was amplified using a forward (FP) and reverse (RP) primer using the following conditions: 5 uL of the ligated identifier oligonucleotide was used for PCR in a 25 uL reaction using 10 uL Eppendorph hotmastermix 2.5 and 10 pmol each of AH361 & Frw-27. PCR was run: (ENRICH30): 94 C. 2 min, then 30 cycles of [94 C. 30 sec, 58 C. 1 min, 72 C. 1 min], then 72 C. 10 min.

    TABLE-US-00010 FP: 5-CGATGGTACGTCCAGGTCGCA-3 RP: 5-GTGCATTATCGATTTGTATGC-3

    [0432] The amplified identifier oligonucleotide was cloned to verify that the assembled oligonucleotides contained the codon region (CGTCC, GTACG, AATGG and TCGAT). The TOPO-TA (Invitrogen Cat#K4575-J10) ligation was reacted with 4 ul PCR product, 1 ul salt solution, 1 ul vector. The reaction was incubated at RT for 30 min. Heat-shock competent TOP10 E. coli cells was thawed and put on ice. 5 ul ligation reaction was added. Following 30 min on ice, the cells were heat-shocked at 42 C. water for 30 sec, and then put on ice. 250 ul SOC was added and the cells incubated 1 h at 37 C., before spreading on LB-ampicillin plates followed by incubation ON at 37 C. Individual E. coli clones were picked and transferred to PCR wells containing 50 uL water. Colonies were incubated at 94 C. for 5 minutes and 20 uL was used in a 25 uL PCR reaction with 5 pmol of each TOPO primer M13 forward & M13 reverse (AH365/AH366) and Ready-To-Go PCR beads (Amersham) using PCR program: 94 C. 2 min, then 30(94 C. 4 sec, 50 C. 30 sec, 72 C. 1 min) then 72 C. 10 min.

    [0433] Primers and free nucleotides were degraded by adding 1 pi EXO/SAP mixture 1:1 to 2 uL PCR product. Incubation was at 37 C. for 15 min and then 80 C. for 15 min. 5 pmol T7 primer (AH368) was added and water to 12 uL. Subsequently, 8 uL DYE-namic ET cycle sequencing Terminator Mix was added followed by PCR-cycling using 30 rounds of (95 C. 20 sec, 50 C. 15 sec, 60 C. 1 min). Purification was done using seq96 spinplates (Amersham), followed by analysis on a MegaBace sequenizer.

    Example 10

    Stage 1 Click Reaction.

    [0434] This is an example of stage 1 synthesis, using the click reaction. Similar conditions can be applied to stage 2 click reactions. The experiment is described in (U.S. patent application 60/588,672, p. 34-35.)

    [0435] General procedure. An alkyne-containing DNA conjugate is dissolved in pH 8.0 phosphate buffer at a concentration of ca. 1 mM. To this mixture is added 10 equivalents of an organic azide and 5 equivalents each of copper (II) sulfate, ascorbic acid, and the ligand (tris-((I-benzyltriazol-4-yl)methyl)amine) all at room temperature. The reaction is followed by LCMS, and is usually complete after 12 h. The resulting triazole-DNA conjugate can, be isolated by ethanol precipitation.

    [0436] Preparation of Azidoacetyl-Gly-Pro-Phe-Pra-NH.sub.2: Using 0.3 mmol of Rink-amide resin, the indicated sequence was synthesized by automated synthesis with Fmoc-protected amino acids and HATU as activating agent (Pra=C-propargylglycine). Azidoacetic acid was used to cap the tetxapeptide. The peptide was cleaved from the resin with 20% TFA/DCM for 4 h. Purification by RP HPLC afforded product as a white solid (75 mg, 51%). .sup.1H NMR (DMSO-d.sub.6, 400 MHz): 8.4-7.8 (m, 3H), 7.4-7.1 (m, 7H), 4.6-4.4 (m, 1H), 4.4-4.2 (m, 2H), 4.0-3.9 (m, 2H), 3.74 (dd, 1H, 3=6 Hz, 17 Hz), 3.5-3.3 (m, 2H), 3.07 (dt, 1H, 3=5 Hz, 14 Hz), 2.92 (dd, 1H, 3=5 Hz, 16 Hz), 2.86 (t, 1H, J=2 Hz), 2.85-2.75 (m, 1H), 2.6-2.4 (m, 2H), 2.2-1.6 (m, 4H). IR (mull) 2900, 2100, 1450, 1300 cm.sup.1. ESIMS 497.4 ([M+H], 100%), 993.4 ([2M+H], 50%). ESIMS with ion-source fragmentation: 519.3 ([M+Na], 100%), 491.3 (100%), 480.1 ([MNH.sub.2], 90%), 452.2 ([MNH.sub.2CO], 20%), 424.2 (20%), 385.1 ([M-Pra], 50%), 357.1 ([M-Pra-CO], 40%), 238.0 ([M-Pra-Phe], 100%).

    [0437] Cyclization of Azidoacetyl-Gly-Pro-Phe-Pra-NH2: The azidoacetyl peptide (31 mg, 0.62 mmol) was dissolved in MeCN (30 mL). Diisopropylethylamine (DIEA, 1 mL) and Cu(MeCN)JPF.sub.6 (1 mg) were added. After stirring for 1.5 h, the solution was evaporated and the resulting residue was taken up in 20% MeCN/H.sub.2O. After centrifugation to remove insoluble salts, the solution was subjected to preparative reverse phase HPLC. The desired cyclic peptide was isolated as a white solid (10 mg, 32%). .sup.1H NMR (DMSO-d.sub.5, 400 MHz): 8.25 (t, 1H, J=5 Hz), 7.77 (s, 1H), 7.2-6.9 (m, 9H), 4.98 (m, 2H), 4.48 (m, 1H), 4.28 (ra, 1H), 4.1-3.9 (m, 2H), 3.63 (dd, 1H, 3=5 Hz, 16 Hz), 3.33 (m, 2H), 3-0 (m, 3H), 2.48 (dd, 1H, 3=11 Hz, 14 Hz), 1.75 (m, 1H0, 1.55 (m, 1H), 1.32 (m, 1H), 1.05 (m, 1H). IR (mull) 2900, 1475, 1400 cm.sup.1. ESIMS 497.2 ([M+H], 100%), 993.2 ([2M+H], 30%), 1015.2 ([2M+Na], 15%). ESIMS with ion-source fragmentation: 535.2 (70%), 519.3 ([M+Na], 100%), 497.2 ([M+H], 80%), 480.1 ([MNH2], 30%), 452.2 ([MNH.sub.2CO], 40%), 208.1 (60%).

    Example 11

    A Stage 1 Synthesis Involving Aromatic Nucleophilic Substitution.

    [0438] This is an example of an aromatic nucleophilic substitution reaction employed in a stage 1 synthesis. Similar conditions may be used in stage 2 synthesis. The experiments are described in (U.S. patent application 60/588,672, p. 36)

    [0439] General Procedure for Arylation of DNA-linker with Cyanuric Chloride: DNA-Linker is dissolved in pH 9.5 borate buffer at a concentration of 1 mM. The solution is cooled to 4 C. and 20 equivalents of cyanuric chloride is then added as a 500 mM solution in MeCN. After 2h, complete reaction is confirmed by LCMS and the resulting dichlorotriazine-DNA conjugate is isolated by ethanol precipitation.

    [0440] Procedure for Amine Substitution of Dichlorotriazine-DNA: Dichlorotriazine-DNA is dissolved in pH 9.5 borate buffer at a concentration of 1 mM. At room temperature, 40 equivalents of an aliphatic amine is added as a DMF solution. The reaction is followed by LCMS and is usually complete after 2 h. The resulting monochlorotriazine-DNA conjugate is isolated by ethanol precipitation.

    [0441] Procedure for Amine Substitution of Monochlorotriazine-DNA: (Alkylamino)-monochlorotriazine-DNA is dissolved in pH 9.5 borate buffer at a concentration of 1 mM. At 42 C., 40 equivalents of a second aliphatic amine is added as a DMF solution. The reaction is followed by LCMS and is usually complete after 2 h. The resulting diaminotriazine-DNA conjugate is isolated by ethanol precipitation.

    Example 12

    A Stage 1 Synthesis (Subprocess 9) and Characterization of a Library of 10.SUP.5 .Members.

    [0442] This is an example of a stage 1 synthesis, involving five synthesis rounds (here termed cycles), employing acylation reactions for the coupling of molecule fragments (here termed building blocks). Similar conditions can be used in stage 2 synthesis. The experiments are described in (U.S. patent application 60/588,672, p. 26-34).

    [0443] The synthesis of a library comprising on the order of 10.sup.5 distinct members was accomplished using the following reagents:

    [0444] Compound 1: An approximately 19 bp duplex DNA, where the two strands at one end has been covalently linked, and where that end includes a PEG linker and a terminal amino group; and where the 5-end of one strand at the other end carries a 5-phophate.

    [0445] Building block precursors: 12 compounds, each of which contains a Fmoc-protected amino group and a free carboxylic acid. The compounds include aliphatic as well as aromatic compounds and aliphatic cyclic structures.

    [0446] Oligonucleotide tags: A total of 60 duplex DNAs, with 7 central base pairs and 2 nt overhangs at both ends, and 5-phosphates at both ends, are included. The 60 duplex DNAs correspond to 5 cycles where 12 tags are added, one per building block precursor, in each round.

    [0447] IX ligase buffer: 50 mM Tris, pH 7.5; 10 mM dithiothreitol; 10 mM MgCl.sub.2; 2.5 mM ATP; 50 mM NaCl.

    [0448] 10 ligase buffer: 500 mM Tris, pH 7.5; 100 mM dithiothreitol; 100 mM MgCl.sub.2; 25 mM ATP; 500 mM NaCl

    Cycle 1

    [0449] To each of twelve PCR tubes was added 50 uL of a 1 mM solution of Compound 1 in water; 75 uL of a 0.80 mM solution of one of Tags 1.1-1.12; 15 uL 10 ligase buffer and 10 uL deionized water. The tubes were heated to 95 C. for 1 minute and then cooled to 16 C. over 10 minutes. To each tube was added 5,000 units T4 DNA ligase (2.5 uL of a 2,000,000 unit/mL solution (New England Biolabs, Cat. No. M0202)) in 50 ul IX ligase buffer and the resulting solutions were incubated at 16 C. for 16 hours. Following ligation, samples were transferred to 1.5 ml Eppendorf tubes and treated with 20 uL 5 M aqueous NaCl and 500 ul cold (20 C.) ethanol, and held at 20 C. for 1 hour. Following centrifugation, the supernatant was removed and the pellet was washed with 70% aqueous ethanol at 20 C. Each of the pellets was then dissolved in 150 uL of 150 mM sodium borate buffer, pH 9.4.

    [0450] Stock solutions comprising one each of building block precursors BB1 to BB12, N,N-diisopropylethanolamine and 0-(7-azabenzotriazol-l-yl)-l, 1,3,3-tetramethyluronium hexafluorophosphate, each at a concentration of 0.25 M, were prepared in sodium phosphate buffer, pH 8.0, and incubated at room temperature for 20 minutes. Each solution (6 uL) was diluted with 30 uL N.sub.5N,-dimethylformamide and added to the appropriate eppendorf tube. Two additional 6 uL aliquots of building block precursor stock solution were added after 20 minutes and 40 minutes, respectively, for a final ratio of 30:1 building block precursor to tag. The tubes were gently shaken for 2 hours at 4 C. The tags and corresponding building block precursors used in Round 1 are set forth in Table 1, below.

    TABLE-US-00011 TABLE 1 Building Block Precursor Tag BB1 1.11 BB2 1:6 BB3 1.2 BB4 1-8 BB5 1.1 BB6 1.10 BB7 1.12 BB8 1.5 BB9 1.4 BB10 1.3 BB11 1.7 BB12 1.9

    [0451] Following acylation, the 12 reaction mixtures were pooled and the resulting mixture was lyophilized to yield a dry residue, which was dissolved in 1.7 mL water. Two volumes of cold 100% ethanol were added and the mixture was allowed to stand at 20 C. for at least one hour. The mixture was then centrifuged for 15 minutes at 14,000 rpm in a 4 C. microcentrifuge. Following centrifugation, as much supernatant as possible was removed with a 1 mL micropipet; the mixture was then centrifuged again, and the remainder of the supernatant was removed with a 200 jiL pipet. Cold 70% ethanol (200 uL) was then added to the rube, and the mixture was centrifuged for 5 minutes at 4 C.

    [0452] The supernatant was then removed with a 200 uL pipet; and the remaining ethanol was allowed to evaporate at room temperature over 5 to 10 minutes. The remaining pellet was suspended in 2 mL water and purified by HPLC with a 50 mM aqueous triethylammonium acetate mobile phase at pH 7.5. The fractions containing the library were collected, pooled and lyophilized. The resulting residue was redissolved in 2.5 mL aqueous Na.sub.2HPO4 and 100 uL piperidine was added, resulting in the formation of a precipitate. The precipitate was separated from the supernatant by centrifugation and washed with 200 uL water. The wash and the supernatant were combined and used for Cycle 2.

    Cycles 2-5

    [0453] For each of these cycles, the combined solution resulting from the previous cycle was divided into 12 equal aliquots of 50 ul each and placed in PCR tubes. To each tube was added a solution comprising a different tag, and ligation, purification and acylation were performed as described for Cycle 1, except that for Cycles 3-5, the HPLC purification step described for Cycle 1 was omitted. The correspondence between tags and building block precursors for Cycles 2-5 is presented in Table 2.

    [0454] The products of Cycle 5 were ligated with the closing primer shown below, using the method described above for ligation of tags.

    TABLE-US-00012 5-PO.sub.3-GGCACATTGATTTGGGAGTCA GTGTAACTAAACCCTCAGT-PO.sub.3-5

    TABLE-US-00013 TABLE 2 Building Block Precursor Cycle 2 Tag Cycle 3 Tag Cycle 4 Tag Cycle 5 Tag BB1 2.7 3.7 4.7 5.7 BB2 2.8 3.8 4.8 5.8 BB3 2.2 3.2 4.2 5.2 BB4 2.10 3.10 4.10 5.10 BB5 2.1 3.1 4.1 5.1 BB6 2.12 3.12 4.12 5.12 BB7 2.5 3.5 4.5 5.5 BB8 2.6 3.6 4.6 5.6 BB9 2.4 3.4 4.4 5.4 BB10 23 3.3 4.3 5.3 BB11 2.9 3.9 4.9 5.9 BB12 2.11 3.11 4.11 5.11

    Results:

    [0455] The synthetic procedure described above has the capability of producing a library comprising 12.sup.s (about 249,000) different structures. The synthesis of the library was monitored via gel electrophoresis of the product of each cycle. The gel electrophoresis shows that each cycle results in the expected molecular weight increase and that the products of each cycle are substantially homogeneous with regard to molecular weight.

    Example 13

    Direct Transfer Acylation Reaction.

    [0456] This is an example of a stage 2 synthesis direct transfer reaction, involving the reactive group NH2, and an activated ester, N-hydroxysuccinimide ester. Similar reaction conditions can be applied to the stage 1 acylation reaction, except that the concentration of the incoming molecule fragment must be higher (e.g., 100 mM incoming molecule fragment in a stage 1 synthesis). The example is taken from (Freskgrd et al., WO 2004/039825 A2, example 3, p. 111-116.

    [0457] The molecule fragment, in the following called attachment entitiy (AE) is in the following experiments either a scaffold molecule fragment, e.g. the peptide, CFFKKK, attached to an oligonucleotide, in the following called identifier, or a molecule fragment, in the following called recipient reactive group exemplified by an amino modified oligonucleotide. These molecule fragments allow transfer of three or one molecule fragments, respectively.

    [0458] The identifier used in this experiment is an oligonucleotide coupled to the peptide CFFKKK as described in Example 4. The molecule fragment, in the following called functional entity (FE), is in this experiment 4-Pentynoic acid, which is attached to an oligonucleotide. The identifier oligonucleotide, coupled to the CFFKKK scaffold, is annealed to the oligonucleotide carrying the 4-pentynoic acid, thereby bringing the two molecule fragments into close proximity. The annealing is directed by the complementarity of the two oligonucleotides. The annealing was performed using 600 pmol of the 4-pentynoic acid oligonucleotide and 400 pmol identifier oligonucleotide in 0.1 M MES buffer at 25 C. in a shaker for 2 hours. After annealing and subsequent reaction between the two molecule fragments, the sample was purified by micro-spin gel filtration and analyzed by MS. The observed mass was 7323.45 Da, which correspond well with the calculated mass, 7324.00 Da. Thus, the MS shows a mass corresponding to the transfer of the molecule fragment (4-pentenoic acid) onto the amino group of the identifier oligonucleotide through formation of an amide bond. Another example of transfer of a molecule fragment is shown below using the amine-modified oligonucleotide directly as the AE on the identifier molecule. The functional entity on the building block molecule used in this experiment was 4-pentynoic acid.

    [0459] The annealing was performed using 500 pmol of either carrier molecule in 0.1 M MES buffer and incubating the mixture at 25 C. in a shaker for 2 hours. The molecule fragment (4-pentenoic acid) was transferred to the amino group on the identifier molecule during the annealing (see below). After annealing and transfer the sample was purified by micro-spin gel filtration and analyzed by MS. The observed mass was 6398.04 Da, which correspond well with the calculated mass, 6400.00 Da. Thus, the MS spectra of the identifier molecule after transfer of the functional entity show a mass corresponding to the transferred molecule fragment, 4-pentenoic acid, onto the identifier molecule, by formation of an amide bond. Another example of direct transfer of a molecule fragment by acylation uses the amine modified oligo directly as the identifier molecule. The functional entity used in this experiment was Hexynoic acid. The annealing was performed using 500 pmol of either carrier molecule in 0.1 M MES buffer incubated at 25 C. in a shaker for 2 hours. The hexynoic acid molecule fragment was transferred to the amino group on the identifier molecule through formation of an amide bond (see below). After annealing and transfer the sample was purified by micro-spin gel filtration and analyzed by MS. The observed mass was 6411.96 Da, which correspond well with the 15 calculated mass, 6414 Da. Thus, the MS spectra show a mass corresponding to the transfer of hexynoic acid onto the amine of the identifier oligo through amide bond formation.

    Example 14

    [0460] Multi-Step Stage 2 Synthesis Using Different Types of Cleavable Linkers.

    [0461] This is an example of a multistep, stage 2 synthesis involving several carriers hybridizing to different positions of the same template, and the use of three different types of cleavable linkers, employed in indirect transfer reactions. Also described is a templated Wittig reaction, a direct transfer reaction. The description of the experiment is taken from (Liu et al., WO 2004/016767 A2, example 3, p. 112-117). The figures referred to are from the same patent application.

    [0462] Three distinct strategies have been developed to link chemical reagents (reactive units) with their decoding DNA oligonucleotides, and to purify product after any DNA-templated synthetic step.

    [0463] When possible, an ideal reagent-oligonucleotide linker for DNA-templated synthesis positions the oligonucleotide as a leaving group of the reagent. Under this autocleaving linker strategy, the oligonucleotide-reagent bond is cleaved as a natural chemical consequence of the reaction (see WO 2004/016767 A2, FIG. 28A).

    [0464] As the first example of this approach applied to DNA-templated chemistry, a dansylated Wittig phosphorane reagent (WO 2004/016767 A2, compound (1)) was synthesized in which the decoding DNA oligonucleotide was attached to one of the aryl phosphine groups (Hughes (1996) TETRAHEDRON LETT. 37: 7595). DNA-templated Wittig olefination with aldehyde-linked template 2 resulted in the efficient transfer of the fluorescent dansyl group from the reagent to the template to provide olefin 3 (WO 2004/016767 A2, FIG. 28A). As a second example of an autocleaving linker, DNA-linked thioester 4 (WO 2004/016767 A2), when activated with Ag(I) at pH 7.0 (Zhang et al. (1999) J. AM. CHEM. SOC. 121: 3311) acylated amino-terminated template 5 to afford amide product 6 (WO 2004/016767 A2, FIG. 28B).

    [0465] Ribosomal protein biosynthesis uses aminoacylated tRNAs in a similar autocleaving linker format to mediate RNA-templated peptide bond formation. To purify desired products away from unreacted reagents and from cleaved oligonucleotides following DNA-templated reactions using autocleaving linkers, biotinylated reagent oligonucleotides and washing crude reactions with streptavidin-linked magnetic beads (see WO 2004/016767 A2, FIG. 30A) were utilized. Although this approach does not separate reacted templates from unreacted templates, unreacted templates can be removed in subsequent DNA-templated reaction and purification steps.

    [0466] Reagents bearing more than one functional group can be linked to their decoding DNA oligonucleotides through second and third linker strategies. In the scarless linker approach (WO 2004/016767 A2, FIG. 28C), one functional group of the reagent is reserved for DNA-templated bond formation, while the second functional group is used to attach a linker that can be cleaved without introducing additional unwanted chemical functionality. The DNA-templated reaction then is followed by cleavage of the linker attached through the second functional group to afford desired products (WO 2004/016767 A2, FIG. 28C). For example, a series of aminoacylation reagents such as (D)-Phe derivative 7 (WO 2004/016767 A2) were synthesized in which the alpha-amine is connected through a carbamoylethylsulfone linker (Zarling et al (1980) J. IMMUNOLOGY 124: 913) to its decoding DNA oligonucleotide. The product (WO 2004/016767 A2, compound (8)) of DNA-templated amide bond formation using this reagent and an amine-terminated template (WO 2004/016767 A2, (5)) was treated with aqueous base to effect the quantitative elimination and spontaneous decarboxylation of the linker, affording product 9 containing the cleanly transferred amino acid group (WO 2004/016767 A2, FIG. 28C). This sulfone linker is stable in pH 7.5 or lower buffer at 25 C. for more than 24 hours yet undergoes quantitative cleavage when exposed to pH 11.8 buffer for 2 hours at 37 C.

    [0467] In some cases it may be advantageous to introduce one or more new chemical groups as a consequence of linker cleavage. Under a third linker strategy, linker cleavage generates a useful scar that can be functionalized in subsequent steps (WO 2004/016767 A2, FIG. 28C). As an example of this class of linker, amino acid reagents such as the (L)-Phe derivative 10 were generated linked through 1,2-diols (Fruchart et al. (1999) TETRAHEDRON LETT. 40: 6225) to their decoding DNA oligonucleotides. Following DNA-templated amide bond formation with amine terminated template (WO 2004/016767 A2, compound (5)), this linker was quantitatively cleaved by oxidation with 50 mM aqueous sodium periodate (NaI04) at pH 5.0 to afford product 12 containing an aldehyde group appropriate for subsequent functionalization (for example, in a DNA-templated Wittig olefination, reductive amination, or nitrolaldol addition).

    [0468] FIG. 29 of (WO 2004/016767 A2) shows the results of exemplary DNA-templated synthesis experiments using autocleaving linkers, scarless linkers, and useful scar linkers. The depicted reactions were analyzed by denaturing PAGE. Lanes 1-3 were visualized using UV light without DNA staining; lanes 4-10 were visualized by staining with ethidium bromide following by UV-transillumination. Conditions for 1 to 3 were: one equivalent each of reagent and template, 0.1 M TAPS buffer pH 8.5, 1 M NaCl, at 25 C. for 1.5 hours. Conditions for 4 to 6 were: three equivalents of 4.0; |.sup.1 M. MES buffer pH 7.0, 1 M sodium nitrite (NaNO.sub.2) 10 mM silver nitrate (AgNC<3), at 37 C. for 8 hours. Conditions for 8 to 9 were 0.1 M 3-(cyclohexylamino)-l-5-propanesulfonic acid (CAPS) buffer pH 11.8, 60 mM (3-mercaptoethanol (BME), at 37 C. for 2 hours. Finally, conditions for 11 to 12 were: 50 mM aqueous NaI04, at 25 C. for 2 hours. Ri=NH(CH.sub.2).sub.2NH-dansyl; R=biotin.

    [0469] Desired products generated from DNA-templated reactions using the scarless, or useful scar linkers can be readily purified using biotinylated reagent oligonucleotides (WO 2004/016767 A2, FIG. 30B). Reagent oligonucleotides together with desired products are first captured on streptavidin-linked magnetic beads. Any unreacted template bound to reagent by base pairing is removed by washing the beads with buffer containing 4 M guanidinium chloride. Biotinylated molecules remain bound to the streptavidin beads under these conditions. Desired product then is isolated in pure form by eluting the beads with linker cleavage buffer (in the examples above, either pH 11 or sodium periodate (NaI04)-containing buffer), while reacted and unreacted reagents remain bound to the beads.

    [0470] As one example of a specific library generated as described above, three iterated cycles of DNA-templated amide formation, traceless linker cleavage, and purification with streptavidin-linked beads were used to generate a non-natural tripeptide (WO 2004/016767 A2, FIGS. 31A-B). Each 20 amino acid reagent was linked to a unique biotinylated 10-base DNA oligonucleotide through the sulfone linker described above. The 30-base amine-terminated template programmed to direct the tripeptide synthesis contained three consecutive 10-base regions that were complementary to the three reagents, mimicking the strategy that would be used in a multi-step DNA-templated small molecule library synthesis.

    [0471] In the first step, two equivalents of 13 (see WO 2004/016767 A2) were activated by treatment with 20 mM EDC, 15 mM sulfo-NHS, 0.1 M MES buffer pH 5.5, and 1 M NaCl, for 10 minutes at 25 C. The template then was added in 0.1 M MOPS pH 7.5, and 1M NaCl, at 25 C. and was allowed to react for 1 hour. The free amine group in 14 (see WO 2004/016767 AZ) then was elaborated in a second and third round of DNA-templated amide formation and linker cleavage to afford dipeptide and tripeptide 16

    (see WO 2004/016767 A2) using the following conditions: two equivalents of reagent, 50 mM DMT-MM, 0.1 M MOPS buffer pH 7.0, 1 M NaCl, at 25 C. for 6 hours. Desired product after each step was purified by capture on avidin-linked beads and elution with 0.1 M CAPS buffer pH 11.8, 60 mM BME, at 37 C. for 2 hours. The progress of each reaction and purification was followed by denaturing polyacrylamide gel electrophoresis (WO 2004/016767 A2, FIG. 31B, bottom). Lanes 3, 6, and 9 represent control reactions using reagents containing scrambled oligonucleotide sequences.

    [0472] The progress of each reaction, purification, and sulfone linker cleavage step was followed by denaturing polyacrylamide gel electrophoresis. The final tripeptide linked to template 16 (see WO 2004/016767 A2) was digested with the restriction endonuclease EcoBI and the digestion fragment containing the tripeptide was characterized by MALDI mass spectrometry. Beginning with 2 nmol (20 ug) of starting material, sufficient tripeptide product was generated to serve as the template for more than 10.sup.6 in vitro selections and PGR reactions (Kramer et al. (1999) CURRENT PROTOCOLS IN MOL. BIOL. 3: 15.1) (assuming 1/10,000 molecules survive selection). No significant product was generated when the starting material template was capped with acetic anhydride, or when control reagents containing sequence mismatches were used instead of the complementary reagents (WO 2004/016767 A2, FIG. 31B).

    [0473] A non-peptidic multi-step DNA-templated small molecule synthesis that uses all three linker strategies developed above was also performed (WO 2004/016767 A2, FIG. 32A-32B). An amine-terminated 30-base template was subjected to DNA-templated amide bond formation using an aminoacyl donor reagent (WO 2004/016767 A2, compound (17)) containing the diol linker and a biotinylated 10-base oligonucleotide to afford amide 18 (WO 2004/016767 A2) (two equivalents 17 in 20 mM EDC, 15 mM sulfo-NHS, 0.1 M MES buffer pH 5.5, 1 M NaCl, 10 minutes, 25 C., then add to template in 0.1 M MOPS pH 7.5, 1M NaCl at 16 C. for 8 hours). The desired product then was isolated by capturing the crude reaction on streptavidin beads followed by cleaving the linker with NaI04 to generate aldehyde 19 (WO 2004/016767 A2). The DNA-templated Wittig reaction of 19 with the biotinylated autocleaving phosphorane reagent 20 (WO 2004/016767 A2) afforded fumaramide 21 (WO 2004/016767 A2) (three equivalents 20, 0.1 M TAPS pH 9.0, 3 M NaCl at 25 C. for 48 hours). The products from the second DNA-templated reaction were partially purified by washing with streptavidin beads to remove reacted and unreacted reagent. In the third DNA-templated step, fumaramide 21 was subjected to a DNA-templated conjugate addition (Gartner et al. (2001) J. AM. CHEM. SOC. 123: 6961) using thiol reagent 22 (WO 2004/016767 A2) linked through the sulfone linker to a biotinylated oligonucleotide (three equivalents 22, 0.1 M TAPS pH 8.5, 1 M NaCl at 25 C. for 21 hours). The desired conjugate addition product (WO 2004/016767 A2, compound (23)) was purified by immobilization with streptavidin beads. Linker cleavage with pH 11 buffer afforded final product 24 (WO 2004/016767 A2) in 5-10% overall isolated yield for the three bond forming reactions, two linker cleavage steps, and three purifications (WO 2004/016767 A2, FIGS. 32A-32B). The final product was digested with EcoRI and the mass of the small molecule-linked template fragment was confirmed by MALDI mass spectrometry (exact mass: 2568, observed mass: 25665). As in the tripeptide example, each of the three reagents used during this multi-step synthesis, annealed at a unique location on the DNA template, and control reactions with sequence mismatches yielded no product (WO 2004/016767 A2, FIG. 32B, bottom). In FIG. 32B, bottom lanes 3, 6, and 9 represent control reactions. As expected, control reactions in which the Wittig reagent was omitted (step 2) also did not generate product following the third step. Taken together, the DNA-templated syntheses of compounds 16 and 24 (see WO 2004/016767 A2) demonstrate the ability of DNA to direct the sequence-programmed multi-step synthesis of both oligomeric and non-oligomeric small molecules: unrelated in structure to nucleic acids.

    Example 15

    Stage 2 Reactions in Organic Solvents

    [0474] This is an example of a stage 2 synthesis performed in organic solvents. Similar or identical conditions can be applied to stage 1 synthesis, except that the concentrations of molecule fragments must be appropriately high to obtain efficient reaction, e.g. higher concentrations of molecule fragments than 10 mM. The description of the experiment is taken from (Liu et al., WO 2004/016767 A2, example 4, p. 117-118). The figures referred to are from the same patent application.

    [0475] A variety of DNA-templated reactions can occur in aqueous media. It has also been discovered that DNA-templated reactions can occur in organic solvents, thus greatly expanding the scope of DNA-templated synthesis. Specifically, DNA templates and reagents have been complexed with long chain tetraalkylammonium cations (see, Jost et al. (1989) NUCLEIC ACIDS RES. 17:2143; Melnikov et al. (1999) LANGMUIR 15: 1923-1928) to permit quantitative dissolution of reaction components in anhydrous organic solvents including CH2Cl2, CHCI3, DMF and methanol. Surprisingly, it was found that DNA-templated synthesis can indeed occur in anhydrous organic solvents with high sequence selectivity.

    [0476] FIG. 33, WO 2004/016767 A2 shows DNA-templated amide bond formation reactions where the reagents and templates are complexed with dimethyldidodecylammonium cations either in separate vessels or after preannealing in water, lyophilized to dryness, dissolved in CH.sub.2CI.sub.2, and mixed together. Matched, but not mismatched, reactions provided products both when reactants were preannealed in aqueous solution and when they were mixed for the first time in CH.sub.2CI.sub.2 (WO 2004/016767 A2, FIG. 33). DNA-templated amide formation and Pd-mediated Heck coupling in anhydrous DMF also proceeded sequence-specifically.

    [0477] These observations of sequence-specific DNA-templated synthesis in organic solvents imply the presence of at least some secondary structure within tetraalkylammonium-complexed DNA in organic media, and should permit DNA receptors and catalysts to be evolved towards stereoselective binding or catalytic properties in organic solvents. Specifically, DNA-templated reactions that are known to occur in aqueous media, including conjugate additions, cycloadditions, displacement reactions, and Pd-mediated couplings can also be performed in organic solvents.

    [0478] It is contemplated that reactions in organic solvents may be utilized that are inefficient or impossible to perform in water. For example, while Ru-catalyzed olefin metathesis in water has been reported (Lynn et al. (1998) J. AM. HEM. SOC. 120: 1627-1628; Lynn et al. (2000) J. AM. CHEM. SOC. 122: 6601-6609; Mohr etal. (1996) ORGANOMETALLICS 15: 4317-4325), the aqueous metathesis system is extremely sensitive to the identities of the functional groups. The functional group tolerance of Ru-catalyzed olefin metathesis in organic solvents, however, is significantly more robust. Some exemplary reactions to utilize in organic solvents include, but are not limited to, 1,3-dipolar cycloaddition between nitrones and olefins which can proceed through transition states that are less polar than ground state starting materials.

    Example 16

    Stage 2 Omega Synthesis (Subprocess F), Involving Amine Acylation, Wittig Olefination, 1,3-Dipolar Cycloaddition and Reductive Amination.

    [0479] This is an example of a stage 2 synthesis employing the Omega DNA architecture during the templated synthesis. Also described are the conditions allowing amine acylation, Wittig olefination, 1,3-Dipolar Cycloaddition and Reductive amination reactions to proceed efficiently. The same conditions can be applied during a stage 1 synthesis involving the same reactions, except that the molecule fragments must be added at a higher concentration (e.g. 10-100 mM molecule fragment). The description of the experiments is taken from (Liu et al., WO 2004/016767 A2, example 5, p. 118-126). The figures referred to are from the same patent application.

    [0480] This example discloses two different template architectures that further expand the scope of nucleic acid-templated synthesis. During a nucleic acid-templated chemical reaction a portion of a template anneals to a complementary sequence of an oligonucleotide-linked reagent, holding functional groups on the template and transfer unit in reactive proximity. Template architecture can have a profound effect on the nature of the resulting reaction, raising the possibility of manipulating reaction conditions by rationally designing template-reagent complexes with different secondary structures. It was hypothesized that the distance dependence of certain DNA-templated reactions such as 1,3-dipolar cycloadditions and reductive animation could be overcome by designing a new architecture that permits a reagent to anneal to two distinct and spatially separated regions of the template. In the Omega architecture (see WO 2004/016767 A2, FIG. 7), the template oligonucleotide contains a small number of constant bases at, for example, the reactive 5-end of the template in addition to distal coding regions. The oligonucleotide of the transfer unit for the Omega architecture contains at its reactive 3-end the bases that complement the constant region of the template followed by bases that complement a coding region anywhere on the template. The constant regions were designed to be of insufficient length to anneal in the absence of a complementary coding region. When the coding region of the template and transfer unit are complementary and anneal, the elevated effective molarity of the constant regions induces their annealing. Constant region annealing forms a bulge in the otherwise double-stranded template-reagent complex and places groups at the ends of the template and reagent in reactive proximity. This design permits distance-dependent DNA-templated reactions to be encoded by bases distal from the reactive end of the template.

    [0481] The efficiency of DNA-templated synthesis using the Omega architecture was compared with that of the standard E and H architectures. The Omega architectures studied comprise (i) three to five constant bases at the 5 end of the template followed by (ii) a five- to 17-base loop and (iii) a ten-base coding region. As a basis for comparison, four different classes of DNA-templated reactions were performed that collectively span the range of distance dependence observed to date.

    [0482] Amine acylation reactions are representative of distance independent reactions that proceed efficiently even when considerable distances (e.g., 30 bases) separate the amine and carboxylate groups. As expected, amine acylation (20 mM DMT-MM, pH 7.0, at 30 C. for 12 hours) proceeded efficiently (46-96% yield) in all architectures with both small and large distances between reactive groups on the reagent and template (WO 2004/016767 A2, FIG. 34, lanes 1-5; and FIG. 35A). The Omega architecture mediated efficient amine acylation with three, four, or five constant bases at the reactive ends of the template and reagent and 10 or 20 bases between annealed reactants (n=10 or 20). Importantly, control reactions in which the distal coding region contained three sequence mismatches failed to generate significant product despite the presence of the complementary three- to five-base constant regions at the ends of the template and reagent (see WO 2004/016767 A2, FIG. 34, lane 5 for a representative example). The Omega architecture, therefore, did not impede the efficiency or sequence-specificity of the distance-independent amine acylation reaction.

    [0483] DNA-templated Wittig olefination reactions proceed at a significantly lower rate when the aldehyde and phosphorane are separated by larger numbers of template bases, eventhough product yields typically are excellent after 12 hours or more of reaction regardless of intervening distance. After only 2 hours of reaction (pH 7.5, 30 C.) in the E or H architectures, however, yields of olefin products were three- to six-fold lower when reactants were separated by ten or more bases (n=10 or 20) than when reactants are separated by only one base (n=1) (WO 2004/016767 A2, FIG. 34, lanes 6-7, and FIG. 35B). In contrast, the Omega architecture with four or five constant bases at the reactive end resulted in efficient and sequence-specific Wittig product formation after 2 hours of reaction even when 10 or 20 bases separated the coding region and reactive end of the template (WO 2004/016767 A2, FIG. 34, lanes 8-9, and FIG. 35B). These results suggest that the constant regions at the reactive ends of the template and transfer unit in the Omega architecture permit the aldehyde and phosphorane moieties to react at an effective concentration comparable to that achieved with the E-architecture when n=1 (WO 2004/016767 A2, FIG. 34).

    [0484] Among the many DNA-templated reactions studied to date, the 1,3-dipolar cycloaddition and reductive animation reactions demonstrate the most pronounced distance dependence. Both reactions proceed in low to modest efficiency (7%-44% yield) under standard reaction conditions using the E or H architectures when 10 or 20 bases separate the annealed reactive groups (WO 2004/016767 A2, FIG. 34, lanes 10-11 and 14-15, and FIGS. 35C-35D). This distance dependence limits the positions on a DNA template that can encode these or other similarly distant dependent reactions. In contrast, both 1,3-dipolar cycloaddition and reductive animation proceed efficiently (up to 97% yield) and sequence-specifically when encoded by template bases 15-25 bases away from the functionalized end of the template using the Omega architecture with four or five constant bases (WO 2004/016767 A2, FIG. 34, lanes 12-13 and 16-17, and FIGS. 35C-35D). These results demonstrate that the templates Omega architecture permits distance-dependent reactions to be efficiently directed by DNA bases far from the reactive end of the template. By overcoming the distance dependence of these reactions while preserving the efficiency of distant independent reactions, the Omega architecture may permit virtually any contiguous subset of bases in a single-stranded 30-base template to encode any viable DNA-templated reaction. Interestingly, the Omega templates with only three constant bases at their reactive ends do not consistently improve the efficiency of these reactions compared with the E-architecture (WO 2004/016767 A2, FIGS. 35C-35D), suggesting that four or five constant bases may be required in the Omega architecture to fully realize favorable proximity effects.

    [0485] In order to probe the structural features underlying the observed properties of the Omega architecture, the thermal denaturation of the Omega-5 and E architectures using n=10 and n=20 reagents were characterized. For all template-reagent combinations, only a single cooperative melting transition was observed. Compared to the E architecture reagent lacking the five-base constant region, the Omega-5 reagent increased the hypochromicity upon annealing by 50% but did not significantly affect melting temperature in either phosphate-buffered saline (PBS) or in 50 mM sodium phosphate pH 7.2 with 1 M NaCl (WO 2004/016767 A2, FIG. 36). These results are consistent with a model in which template-reagent annealing in the Omega architecture is dominated by coding region interactions even though the constant region forms secondary structure once the coding region is annealed. The entropic cost of partially ordering the loop between the coding and constant regions may, therefore, be offset by the favorable interactions that arise upon annealing of the constant region.

    [0486] DNA templates of arbitrary length are easy to synthesize and undesired cross-reactivity between reactants in the same solution can be avoided using concentrations that are too low to allow non-complementary reactants to react intermolecularly. These features of DNA-templated synthesis permit more than one DNA-templated reaction to take place on a single template in one solution, saving the effort associated with additional DNA-templated steps and product purifications. Multiple DNA-templated reactions per step can be difficult using the E, H, or Omega architectures, because the reagent oligonucleotide that remains annealed to the template following the first reaction forms a relatively rigid double helix that can prevent a second reagent annealed further away along the template from encountering the reactive end of the template. To overcome this, the reactive group on the template was moved from the end of the oligonucleotide to the middle, attaching the reactive group to the non-Watson-Crick face of a base. This T architecture (see WO 2004/016767 A2, FIG. 7G) was designed to permit two DNA-templated reactions, one with a reagent coupled to the 5 end of the oligonucleotide of a first transfer unit and one with a reagent coupled to the 3-end of the oligonucleotide of a second transfer unit, to take place sequence-specifically in the same solution on a single template.

    [0487] To test the viability of the T-architecture in DNA-templated reactions, the efficiency of the amine acylation, Wittig olefination, 1,3-dipolar cycloaddition, and reductive amination reactions using the T architecture was studied. The T architecture sequence-specifically directed these four reactions with efficiencies comparable to or greater than those of the E or H architectures (WO 2004/016767 A2, FIG. 37, 69-100% yield when n=1).

    [0488] It can thus be concluded that it is possible to perform each of those reactions in an efficient way, providing high yields, at least for one DNA architecture.

    [0489] The observed degree of distance dependence using the T architecture for each of the four reactions was consistent with the above findings (WO 2004/016767 A2, compare FIG. 37 and FIG. 35). Together these results demonstrate that the T architecture can mediate sequence-specific and efficient DNA-templated synthesis.

    [0490] Once the ability of the T architecture to support efficient DNA-templated synthesis was established, the ability of the T architecture to direct two DNA-templated reactions on one template in one solution was studied. Two different two-reaction schemes using the T architecture were performed. In the first scheme, depicted in (WO 2004/016767 A2, FIG. 38A), a benzaldehyde-linked T template (WO 2004/016767 A2, (1)) was combined with a phosphine-linked reagent (WO 2004/016767 A2, (2)) and an alpha-iodoamide-linked reagent (WO 2004/016767 A2, (3)) in a single solution (pH 8.5, 1 M NaCl, at 25 C. for 1 hour). The phosphine-linked oligonucleotide complemented ten bases of the template 5 of the aldehyde (n=4), while the iodide-linked oligonucleotide complemented ten bases 3 of the aldehyde (n=0). DNA-templated SN2 reaction between the phosphine and alpha-iodoamide generated the corresponding phosphorane, which then participated in a DNA-templated Wittig reaction to generate cinnanamide 4 (WO 2004/016767 A2) in 52% overall yield after 1 hour (FIG. 38B, lanes 9-10). Control reactions containing sequence mismatches in either reagent generated no detectable product. The additional control reaction lacking the aldehyde group on the template generated only the SN2 reaction product (FIG. 38B, lanes 3-4) while control reactions lacking either the phosphine group or the alpha-iodoamide group did not generate any detectable products (FIG. 38B, lanes 5-8).

    [0491] In a second two-reaction scheme mediated by the T architecture, depicted in (WO 2004/016767 A2, FIG. 38C), an amine-linked T template (WO 2004/016767 A2, (5)) was combined with a propargylglycine-linked 5.

    [0492] reagent (WO 2004/016767 A2, (6)) at n=1 and a phenyl azide-linked 3 reagent (WO 2004/016767 A2, (7)) at n=1. The addition of 20 mM DMT-MM at pH 7.0 to induce amide formation followed by the addition of 500 uM copper(n) sulfate and sodium ascorbate to induce the recently reported Sharpless-modified Huisgen 1,3-dipolar cycloaddition provided 1,4-disubstituted triazoyl alanine adduct 8 (WO 2004/016767 A2) in 32% overall yield.

    [0493] Taken together, these observations show that the T architecture permits two sequence-specific DNA-templated reactions to take place on one template in one solution. Importantly, the T architecture templates described above were accepted as efficient templates for both a single cycle of primer extension as well as standard PCR amplification using Taq DNA polymerase, consistent with the known tolerance of several DNA polymerases for modifications to the non-Watson-Crick face of DNA templates. In addition to reducing the number of separate DNA-templated steps needed to synthesize a target structure, this architecture may also permit three-component reactions commonly used to build structural complexity in synthetic libraries to be performed in a DNA-templated format.

    [0494] In summary, the Omega and T architectures significantly expand the scope of DNA-templated synthesis. By enabling distance-dependent DNA-templated reactions to be encoded by bases far away from the reactive end of the template, the Omega architecture expands the types of reactions that can be encoded anywhere on a DNA template. The T architecture permits two DNA-templated reactions to take place on a single template in one step.

    Materials and Methods

    [0495] Oligonucleotide Synthesis.

    [0496] Unless otherwise specified, DNA oligonucleotides were synthesized and functionalized as previously described using 2-[2-(4-monomethoxytrityl) aminoethoxy]ethyl-(2-cyanoethyl)-N,N-diisopropyl-phosphoramidite (Glen Research, Sterling, Va., USA) for S-functionalized oligonucleotides, and using (2-dimethoxytrityloxymethyl-6-fluorenylmethoxycarbonylamino-hexane-l-succinoyl)-long chain alkylamino-CPG (Glen Research, Sterling, Va., USA) for 3-functionalized oligonucleotides (Calderone et al. (2002) ANGEW. CHEM. INT. ED. ENGL. 41:4104; (2002) ANGEW. CHEM. 114: 4278). In the case of templates for the T architecture, amine groups were added using 5-dimethoxytrityl-5-[N-(trifluoroacetylaminohexyl)-3-acrylimido]-2-deoxyuridine-3-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphorarnidite (Glen Research, Sterling, Va., USA) and then acylated as reported previously (Calderone et al. (2002) supra).

    Amine Acylation.

    [0497] Amine-labeled and carboxylic acid-labeled DNA were combined in aqueous 100 mM MOPS buffer, 1 M NaCl, pH 7.0 (60 nM in template DNA, 120 nM in reagent DNA) in the presence of 20 mM DMT-MM. Reactions proceeded for 12 hours at 25 C.

    Wittig Olefination.

    [0498] Aldehyde-labeled and phosphorane-labeled DNA were combined in aqueous 100 mM MOPS, 1 M NaCl, pH 7.5 (60 nM in template DNA, 120 nM in reagent DNA). Reactions proceeded for 2 hours at 30 C.

    1,3-Dipolar Cycloaddition.

    [0499] Dialdehyde-labeled DNA was incubated in 260 mM N-methylhydroxylamine hydrochloride for 1 hour at room temperature (Gartner et al. (2002) J. AM. CHEM. SOC. 124: 10304). It was subsequently combined with succinimide-labeled DNA in aqueous 50 mM MOPS, 2.8 M NaCl, pH 7.5. (final concentrations of N-methylhydroxylamine hydrochloride 0.75 mM, 60 nM in template DNA and 9.0 nM in reagent DNA). Reactions proceeded for 12 hours at 37 C.

    Reductive Animation.

    [0500] Amine-labeled and aldehyde-labeled DNA were combined in aqueous 100 mM MES buffer, 1 M NaCl, pH 6.0 (60 nM in template DNA, 120 nM in reagent DNA). Sodium cyanoborohydride was added as a 5 M stock in 1 M NaOH to a final concentration of 38 mM, and reactions proceeded for 2 hours at 25 C. Reactions were quenched by ethanol precipitation in the presence of 15 mM methylamine.

    T Architecture-Mediated Conversion of Compound 1 to 4.

    [0501] The 5-phosphine-linked oligonucleotide (WO 2004/016767 A2, (2)) was generated by coupling N-succinimidyliodoacetate (SIA) to the amine derived from 12-(4-monomethoxytritylamino) dodecyl-(2-cyanoethyl)-(N,N-diisopropyl)-phosphoramidite (Glen Research, Sterling, Va., USA) using the T (n=4) oligonucleotide listed below, followed by treatment with 4-diphenylphosphinobenzoic acid as described previously (Gartner et al. (2002) supra). The 3-omega-iodoamide-linked reagent (WO 2004/016767 A2, (3)) was prepared by reacting the T (n=1) oligonucleotide (see below) with SIA as described previously (Gartner et al. (2001) supra). Aldehyde-labeled template (WO 2004/016767 A2, (1)) was prepared by reacting the T template oligonucleotide (see below) with para-formyl benzoic acid N-hydroxysuccinimidyl ester as described previously (Gartner et al. (2002) ANGEW. CHEM. INT. ED. 41: 1796; (2002) ANGEW. CHEM. 114:1874). Template 1 was combined with reagents 2 and 3 (WO 2004/016767 A2) in aqueous 200 mM N-(2-hydroxyethyl)piperazine-N-(2-ethanesulfonic acid) (HEPES) buffer at pH 8.5 with 1 M NaCl, (63 nM template and 125 nM of each reagent). Reactions proceeded for up to 1 hour at 25 C.

    [0502] The results of denaturing polyacrylamide gel electrophoresis analysis of these reactions is shown in (WO 2004/016767 A2, FIG. 38B). The 30-base T architecture template (WO 2004/016767 A2, (1)) containing an aldehyde group was present in lanes 1-2 and lanes 5-10. A template lacking the aldehyde group but otherwise identical to (1) was present in lanes 3 and 4. DNA-linked phosphine reagent (WO 2004/016767 A2, (2)) was present in lanes 3-6 and lanes 9-10. DNA-linked alpha-iodoamide reagent (WO 2004/016767 A2, (3)) was present in lanes 3-4 and lanes 7-10. Lanes 1, 3, 5, 7 and 9 show reactions after 30 minutes. Lanes 2, 4, 6, 8, and 10 show reactions after 1 hour.

    T Architecture-Mediated Conversion of Compound 5 to 8.

    [0503] The 5-propargylglycine linked oligonucleotide (WO 2004/016767 A2, (6)) was generated by combining the corresponding T (n=1) 5-amine-linked reagent oligonucleotide (see below) with 2 mg/mL bis(sulfosuccinimidyl)suberate in 9:1 200 mM spdium phosphate pH 7.2:DMF for 10 minutes at 25 C., followed by treatment with 0.3 vol of 300 mM racemic propargylglycine in 300 mM NaOH for 2 hours at 25 C. The 3-azido linked oligonucleotide (WO 2004/016767 A2, (7)) was generated by combining the T (n=1) amine-linked reagent oligonucleotide (see below) with 2 mg/mL (N-15 hydroxysuccinimidyl)-4-azidobenzoate in 9:1 200 mM sodium phosphate pH 7.2:DMF for, 2 hours at 25 C. Reagents 6 and 7 (WO 2004/016767 A2) were purified by gel filtration and reverse-phase HPLC. Template 5 and reagents 6 and 7 were combined in aqueous 100 mM MOPS pH 7.0 in the presence of 1 M NaCl and 20 mM DMT-MM for 12 hours (60 nM template, 120 nM reagents) at 25 C. Copper (II) sulfate pentahydrate and sodium ascorbate were then added to 500 uM each. After 1 hour at 25 C., reactions were quenched by ethanol precipitation.

    DNA Oligonucleotide Sequences Used.

    [0504] E or Omega template: 5-H.sub.2N-GGT ACGAAT TCG ACT CGG GAA TAC CAC CTT [SEQ ID NO: 58]. H template: 5-H.sub.2N-CGC GAG CGT ACG CTC GCG GGT ACG AAT TCG ACT CGG GAA TAC CAC CTT [SEQ ID NO: 59]. T template: 5-GGT ACG AAT TCG AC(dT-NH.sub.2) CGG GAA TAC CAC CTT [SEQ ID NO: 60]. E or H reagent (n=1): 5-AAT TCG TAC C-NH.sub.2 [SEQ ID NO: 61]. E or H reagent (n=10): 5-TCC CGA GTC G-NH.sub.2 [SEQ ID NO: 62]. E or H reagent (n=20): 5-AAG GTG GTA T-NH.sub.2 [SEQ ID NO: 63]. Mismatched E or H reagent: 5-TCC CTG ATC G-NH.sub.Z[SEQ ID NO: 64]. Omega-3 reagent (ra=10): 5-TCC CGA GTC GAC C-NH.sub.2 [SEQ ID NO: 65]. Omega-4 reagent (ra=10): 5-TCC CGA GTC GTA CC-NH.sub.2 [SEQ ID NO: 66]. Omega-5 reagent (n=10): 5-TCC CGA GTC GGT ACC-NH.sub.2[SEQ ID NO: 67]. Omega-3 reagent (n=20): 5-AAG GTG GTA TAC C-NH.sub.2 [SEQ ID NO: 68]. Omega-4 reagent (n=20): 5-AAG GTG GTA TTA CC-NH.sub.2 [SEQ ID NO: 69]. Omega-5 reagent (n=20): 5-AAG GTG GTA TGT ACC-NH.sub.2 [SEQ ID NO: 70]. Mismatched Omega-3 reagent: 5-TCC CTG ATC GAC C-NH.sub.2 [SEQ ID NO: 71]. Mismatched Omega-4 reagent: 5-TCC CTG ATC GTA CC-NH.sub.2 [SEQ ID NO: 72]. Mismatched Omega-5 reagent: 5-TCC CTG ATC GGT ACC NH.sub.2 [SEQ ID NO: 73]. T reagent (n=I): 5-GGT5 ATT CCC G-NH.sub.2 [SEQ ID NO: 74]. T reagent (n=2): 5-TGG TAT TCC C-NH.sub.2 [SEQ ID NO: 75]. T reagent (n=3): 5-GTG GTATTC C-NH.sub.2 [SEQ ID NO: 76]. T reagent, \n=4): 5-GGT GGT ATT C-NH.sub.2 [SEQ ID NO: 77]. T reagent (n=5): 5-AGG TGG TAT T-NH.sub.2 [SEQ ID NO: 78]. T reagent (n=1): 5-NH.sub.2-GTC GAA TTC G [SEQ ID NO: 79], T reagent (n=4) for 2: 5-[C.sub.12-amine linker]-AAT TCG TAG C [SEQ ID NO: 80]. Reaction yields were quantitated by denaturing polyacrylamide gel electrophoresis followed by ethidium bromide staining, UV visualization, and CCD-based densitometry of product and template starting material bands. Yield calculations assumed that templates and products were denatured and, therefore, stained with comparable intensity per base; for those cases in which products are partially double-stranded during quantitatidn, changes in staining intensity may result in higher apparent yields. Representative reaction products were characterized by MALDI mass spectrometry in addition to denaturing polyacrylamide gel electrophoresis.

    [0505] Melting curves were obtained on a Hewlett-Packard 8453 UV-visible spectrophotometer using a Hewlett-Packard 89090A Peltier thermocontroller. Absorbances of template-reagent pairs (1.5 uM each) at 260 nm were measured every 1 C. from 20 C. to 80 C. holding for 1 minute at each temperature in either phosphate-buffered saline (PBS, 137 mM NaCl, 2.7 mM potassium chloride, 1.4 mM potassium phosphate, 10 mM sodium phosphate, pH 7.4) or in high salt phosphate buffer (HSB, 50 mM sodium phosphate pH 7.2, 1 M NaCl).

    Example 18

    Functionalisation of Oligonucleotides.

    [0506] This is an example of how oligonucleotides may be functionalized for their further manipulation in stage 1 or stage 2 synthesis schemes. It also describes a stage 1 amine acylation reaction. The description of the experiment is taken from (Liu et al., WO 2004/016767 A2, p. 131). The figures referred to are from the same patent application.

    2-Bromopropionamide-NHS Esters.

    [0507] 200 mg JV-hydroxysuccinimide (Pierce, Rockford, Ill., USA) was dissolved in anhydrous CH2CI2 together with 1.1 equivalents of a 2-bromopropionic acid (either racemic, (R)-, or (S)-) and 2 equivalents of I-(3-dimethylaminopropyl)-3-ethylcarbodiimide (EDC) (Aldrich). The 2-bromopropionic acid enantiomers were >95% enantiopure as judged by chiral HPLC (5% isopropanol in hexanes, (R,R) WHELK 01 chiral phase, detection at 220 nm). The reaction was maintained at room temperature and complete after 1.5 hours as judged by TLC (EtOAc). The crude reaction mixture was extracted with 2.5% sodium hydrogen sulfate (NaHSO.sub.4 to remove the excess EDC. The organic phase was washed with brine, dried over magnesium sulfate (MgSO.sub.4, and concentrated in vacuo. The residue was dried and used directly for DNA functionalization.

    5-Functionalization of Oligonucleotides.

    [0508] An NHS ester prepared as described above was dissolved in DMSO. Up to 150 ug of a 5-amino DNA oligonucleotide was combined with 3 mg/mL NHS ester (final reaction=10% DMSO) in 200 mM sodium phosphate (pH=7.2) at room temperature for 2 hours. The functionalized oligonucleotides were purified by gel filtration and reverse-phase HPLC, and were characterized by denaturing PAGE and MALDI-TOF mass spectrometry.

    3-Thiol Modified Oligonucleotides.

    [0509] The 3 thiol group was incorporated by standard automated DNA synthesis using 3-disulfide-linked CPG (Glen Research, Sterling, 20 Virginia, USA). Following oligonucleotide synthesis, the disulfide was cleaved with 50 mM DTT, 1M TAPS (pH=8.0) at room temperature for 1 hour and purified by gel filtration before being used in DNA-templated reactions.

    Example 19

    One-Pot Simultaneous Stage 2 Synthesis Involving Amine Conjugate Addition, Thiol Conjugate Addition, Nitro-Michael Addition, Reductive Amination, Amine Acylation, and Wittig Olefination.

    [0510] This is an example of a number of templated reactions that are executed simultaneously in one solution, giving high yields of all reaction types tested. The same reaction conditions may be applied to stage 1 synthesis, except that the molecule fragments must be added in higher concentrations (preferably 10-100 mM). The description of the experiments is taken from (Liu et al., WO 2004/016767 A2, example 7, p. 137-142). The figures referred to are from the same patent application.

    [0511] This example demonstrates that oligonucleotides can simultaneously direct several different synthetic reaction types within the same solution, even though the reactants involved would be cross-reactive and, therefore, incompatible under traditional synthesis conditions. These findings also demonstrate that it is possible to perform a one-pot diversification of synthetic library precursors Into products using multiple, simultaneous and not necessarily compatible reaction types.

    [0512] The ability of DNA templates to mediate diversification using different reaction types without. spatial separation was initially tested by preparing three oligonucleotide templates of different DNA sequences (Ia-3a)(WO 2004/016767 A2) functionalized at their 5 ends with maleimide groups and three oligonucleotide reagents (4a-6a) (WO 2004/016767 A2) functionalized at their 3 ends with an amine, thiol, or nitroalkane group, respectively (WO 2004/016767 A2, FIG. 46). The DNA sequences of the three reagents each contained a different 10-base annealing region that was complementary to ten bases, near the 5 end of each of the templates. Combining Ia with 4a, 2a with 5a, or 3a with 6a in three. separate vessels at pH 8.0 resulted in the expected DNA-templated amine conjugate addition, thiol conjugate addition, or nitro-Michael addition products 7-9 (WO 2004/016767 A2, FIG. 46, lanes 1-3).

    [0513] To distinguish the nine possible reaction products that could be generated upon combining Ia-6a, the lengths of template oligonucleotides were varied to include 11, 17, or 23 bases and the lengths of reagent oligonucleotides were varied to include 14, 16, or 18 bases. Differences in oligonucleotide length were achieved using extensions distal from the reactive groups that did not significantly affect the efficiency of DNA-templated reactions. This design permitted all nine possible reaction products (linked to 25, 27, 29, 31, 33, 35, 37, 39, or 41 bases of DNA) to be distinguished by denaturing polyacrylamide gel electrophoresis.

    [0514] A solution containing all three templates (Ia-3a) was combined with a solution containing all three reagents (4a-6a) at pH 8.0. The resulting reaction exclusively generated the three desired products 7, 8, and 9 of lengths 25, 33, and 41 bases indicating that only the three reactions corresponding to the complementary template-reagent pairs took place (WO 2004/016767 A2, FIG. 46, lane 4). Formation of the other six possible reaction products was not detected by densitometry (<5% reaction). In contrast, individually reacting templates and reagents containing the same, rather than different, 10-base annealing regions permitted the formation of all possible products (WO 2004/016767 A2, FIG. 46, lane 5). This result demonstrates the ability of DNA-templated synthesis to direct the selective one-pot transformation of a single functional group into three distinct types of products (in this example, maleimide into secondary amine, thioether, or a-branched nitroalkane).

    [0515] To test the ability of this diversification mode to support one-pot reactions requiring non-DNA-linked accessory reagents, an analogous experiment was conducted with two aldehyde-linked reagents either 14 or 16 bases in length (WO 2004/016767 A2, (4b) or (5b), respectively) and a complementary 11-base amine-linked template (WO 2004/016767 A2, (Ib)) or a 17-base phosphorane-linked template (WO 2004/016767 A2, (2b)). Combining Ib and 4b at pH 8.0 in. the presence of 3 mM NaBH.sub.3CN resulted in the DNA-templated reductive animation product 10 (WO 2004/016767 A2), while 2b and 5b under the same conditions generated Wittig olefination product 11 (WO 2004/016767 A2, FIG. 46). Mixing all four reactants together in one pot resulted in an identical product distribution as the combined individual Wittig olefination or reductive animation reactions (WO 2004/016767 A2, FIG. 46). No reaction between amine Ib and aldehyde 5b or between phosphorane 2b and aldehyde 4b was detected (WO 2004/016767 A2, FIG. 46, lane 8 versus lane 9).

    [0516] The generality of this approach was explored by including multiple reaction types that required different accessory reagents. Three amine-linked templates (Ic-3c) (WO 2004/016767 A2) of length 11, 17, or 23 bases were combined with an aldehyde-, carboxylic acid-, or maleimide-linked reagent (4c-6c) (WO 2004/016767 A2) 14, 16, or 18 bases in length, respectively, at pH 8.0 in the presence of 3 mM NaBH.sub.3CN, 10 mM 1-(3-dimethyl-aminopropyl)-3-ethylcarbodiimide (EDC), and 7.5 mM N-hydroxylsulfosuccinimide (sulfo-NHS). The reactions containing all six reactants afforded the same three reductive animation, amine acylation, or conjugate addition products (12-14) (WO 2004/016767 A2) that were generated from the individual reactions containing one template and one reagent and did not produce detectable quantities of the six possible undesired products arising from non-DNA-templated reactions (WO 2004/016767 A2, FIG. 46, lanes 10-14). Collectively, these results indicate that DNA-templated synthesis can direct simultaneous reactions between several mutually cross-reactive groups in a single pot to yield only the sequence-programmed subset of many possible products.

    [0517] The above three examples each diversified a single functional group (maleimide, aldehyde, or amine) into products of different reaction types. A more general format for the one-pot diversification of a DNA-templated synthetic library into products of multiple reaction types would involve the simultaneous reaction of different functional groups linked to both reagents and templates. To examine this possibility, six DNA-linked nucleophile templates (15-20) (WO 2004/016767 A2) and six DNA-linked electrophile reagents (21-25) (WO 2004/016767 A2) collectively encompassing all of the functional groups used in the above three examples (amine, aldehyde, maleimide, carboxylic acid,

    nitroalkane, phosphorane, and thiol) were prepared (WO 2004/016767 A2, FIG. 47). These twelve DNA-linked reactants could, in theory, undergo simultaneous amine conjugate addition, thiol, conjugate addition, nitro-Michael addition, reductive amination, amine acylation, and Wittig olefination in the same pot, although the apparent second order rate constants of these six reactions vary by more than 10-fold.

    [0518] Determining the outcome of combining all twelve reagents and templates in a single pot by using oligonucleotides of varying lengths; is difficult due the large number (at least 28) of possible products that could be generated. Accordingly, the length of the reagents as 15, 20, 25, 30, 35, or 40 bases were varied but the length of the templates was fixed at 11 bases (WO 2004/016767 A2, FIG. 47). Each of the six complementary template-reagent pairs when reacted separately at pH 8.0 in the presence of 3 mM NaBH.sub.3CN; 10 mM EDC, and 7.5 mM sulfo-NHS generated the expected amine conjugate addition, thiol conjugate addition, nitro-Michael addition, reductive amination, amine acylation, or Wittig olefination products (WO 2004/016767 A2, FIG. 47). Reaction efficiencies were greater than 50% relative to the corresponding individual reactions despite having to compromise between differing optimal reaction conditions. Templates 15-20 (WO 2004/016767 A2) were also prepared in a 3-biotinylated form. The biotinylated templates demonstrated reactivities indistinguishable from those of their non-biotinylated counterparts (WO 2004/016767 A2, FIG. 47).

    [0519] Six separate reactions each containing twelve reactants then were performed at pH 8.0 in the presence of 3 mM NaBH.sub.3CN, 10 mM EDC, and 7.5 mM sulfo-NHS (WO 2004/016767 A2, FIG. 48). Each reaction contained a different biotinylated template (15, 16, 17, 18, 19, or 20) together with five non-biotinylated templates (from 15-20) (WO 2004/016767 A2) and six reagents (21-25) (WO 2004/016767 A2). These reactions were initiated by combining a solution containing 15-20 with a solution containing 21-25. The products that arose from each biotinylated template were captured with streptavidin-coated magnetic beads and identified by denaturing gel electrophoresis. Because the six reagents in each reaction contained oligonucleotides of unique lengths, the formation of any reaction products involving the biotinylated templates and any of the reagents could be detected. In all six cases, the biotinylated template formed only the single product programmed by its DNA sequence (WO 2004/016767 A2, FIG. 48) despite the possibility of forming up to five other products in each reaction. Taken together, these findings indicate that reactions of significantly different rates requiring a variety of non-DNA-linked accessory reagents can be directed by DNA-templated synthesis in the same solution, even when both templates and reagents contain several different cross-reactive functional groups. The ability of DNA templates to direct multiple reactions at concentrations that exclude non-templated reactions from proceeding at appreciable rates mimics, in a single solution, a spatially separated set of reactions.

    [0520] Compared to the use of traditional synthetic methods, generating libraries of small molecules by DNA-templated synthesis is limited by several factors including the need to prepare DNA-linked reagents, the restriction of aqueous, DNA-compatible chemistries, and the reliance on characterization methods such as mass spectrometry and electrophoresis that are appropriate for molecular biology-scale (pg to ug) reactions. On the other hand, DNA-templated synthesis (i) allows the direct in vitro selection (as opposed to screening) and amplification of synthetic molecules with desired properties, (ii) permits the preparation of synthetic libraries of unprecedented diversity, and (iii) requires only minute quantities of material for selection and identification of active library members. In addition, this example demonstrates that potentially useful modes of reactivity not possible using current synthetic methods can be achieved in a DNA-templated format. For example, six different types of reactions can be performed simultaneously in one solution, provided that required non-DNA-linked accessory reagents are compatible. This reaction mode permits the diversification of synthetic small molecule libraries using different reaction types in a single solution.

    Materials and Methods

    Synthesis of Templates and Reagents

    [0521] Oligonucleotides were synthesized using standard automated solid-phase techniques. Modified phosphoramidites and controlled-pore glass supports were obtained from Glen Research, Sterling, Va., USA. Unless otherwise noted, functionalized templates and reagents were synthesized by reacting 5-H.sub.2N(CH.sub.20).sub.2 terminated oligonucleotides (for templates) or 3-OP0.sub.3-CH.sub.2CH(CH.sub.2OH)(CH.sub.2).sub.4NH.sub.2 terminated oligonucleotides (for reagents) in a 9:1 mixture of aqueous 200 mM pH 7.2 sodium phosphate buffer: DMF containing 2 mg/mL of the appropriate N-hydroxysuccinimide ester (Pierce, Rockford, Ill., USA) at 25 C.

    [0522] For the aldehyde and nitroalkane-linked oligonucleotides (4b, 4c, 5b, 6a, 17, 24, and 26, FIGS. 46 and 47, WO 2004/016767 A2) the NHS esters were generated by combining the appropriate carboxylic acid (900 mM in DMF) with equal volumes of dicyclohexylcarbodiimide (900 mM in DMF) and NHS (900 mM in DMF) for 90 minutes. Phosphorane-linked oligonucleotides (2b and 20, FIGS. 46 and 47, WO 2004/016767 A2) were prepared by a 90 minute reaction of the appropriate amino-terminated oligonucleotide with 0.1 volumes of a 20 mg/mL DMF solution of the NHS ester of iodoacetic acid (SIA, Pierce, Rockford, Ill., USA) in pH 7.2 buffer as above, followed by addition of 0.1 volumes of a 20 mg/mL solution of 4-diphenylphosphinobenzoic acid in DMF.

    [0523] Thiol-linked template 16 was synthesized by reacting ethylene glycol bis(succinimidylsuccinate) (EGS, Pierce, Rockford, Ill., USA) with the appropriate oligonucleotide for 15 minutes, followed by addition of 0.1 volumes of 300 mM 2-aminoethanethiol. Reagent 5a was synthesized using 3-OP0.sub.3-(CH.sub.2).sub.3SS(CH.sub.2).sub.3ODMT functionalized controlled-pore glass (CPG) support and reduced prior to use according to the manufacturer's protocol.

    [0524] The 3-biotinylated oligonucleotides were prepared using biotin-TEG.sup.1 CPG (Glen Research, Sterling, Va., USA). Products arising from biotinylated templates were purified by mixing with 1.05 equivalents of streptavidin-linked magnetic beads (Roche), washing twice with 4 M guanidinium hydrochloride, and eluting with aqueous 10 mM Tris pH 7.6 with 1 mM biotin at 80 C.

    Synthesis of Linkers

    [0525] Linkers between DNA oligonucleotides and the functional groups in 1 a-6c are as follows. Ib and Ic: DNA-5-NH.sub.2; Ia, 2a-2c, 3a, and 3c: DNA-5-O(CH.sub.2).sub.20(CH.sub.2).sub.2NH; 5a: DNA-3-0-(CH.sub.2).sub.3SH; 4a-4c, 5b, 5c, 6a, and 6c: DNA-3-0-CH.sub.2CH(CH.sub.2OH)(CH.sub.2).sub.4NH. Oligonucleotide sequences used to generate all possible products in (WO 2004/016767 A2, FIG. 46, lanes 5, 9, and 14), with annealing regions underlined: R-TATCTACAGAG-3 [SEQ ID NO: 106](Ia-Ic); R-TATCTACAGAGTAGTCT-3 [SEQ ID NO: 107] (2a-2c); R-TATCTACAGAGTAGTCTAATGAC-3 [SEQ ID NO: 108] (3a-3c); 5-CAGCCTCTGTAGAT-R [SEQ ID NO: 109] (4a-4c); 5-CTCAGCCTCTGTAGAT-R [SEQ ID NO: 110] (5a-5c); 5-GGCTCAGCCTCTGTAGAT-R [SEQ ID NO: 111] (6a-6c). Functionalized templates and reagents were purified by gel filtration (Sephadex G-25) followed by reverse-phase HPLC (0.1 M triethylammonium acetate/acetonitrile gradient). Representative functionalized templates and reagents were further characterized by MALDI mass spectrometry.

    Reaction Conditions

    [0526] All reactions were performed by dissolving reagents and templates in separate vessels in pure water before combining them into a solution of 50 mM aqueous TAPS buffer, pH 8.0, 250 mM NaCl at 25 C. for 16 hours with DNA-linked reactants at 60 nM (WO 2004/016767 A2, FIG. 47) or at 12.5 nM (WO 2004/016767 A2, FIGS. 47 and 48). NaBH.sub.3CN, EDC, and sulfo-NHS were present when appropriate as described. Products were analyzed by denaturing polyacrylamide gel electrophoresis using ethidium bromide staining and UV transillumination: Differences in charge states, attached functional groups, and partial secondary structure resulted in modest variations in gel mobility for different functionalized oligonucleotides of the same length (FIGS. 46-48).

    Example 20

    Selection for Bifunctional Molecules Capable of Binding to a Macromolecular Target.

    [0527] This is an example of a selection against 6 protein targets, by affinity selection on immobilized protein (subprocess i). The experiments are described in detail in the patent application (Liu et al., WO 2004/016767 A2, example 11, p. 171-182).

    [0528] Six proteins, GST, Carbonic anhydrase, Papain, Trypsin, Chymotrypsin, and Strepavidin, were immobilized on NHS-activated Sepharose 4 fast flow beads. For each of the proteins, a known ligand was prepared and linked to a unique DNA sequence. Solutions containing DNA-linked protein ligands and DNA-linked negative controls were used to simulate libraries of bifunctional molecules. The selections were performed by first incubating the DNA-linked ligands with immobilized protein, then beads were washed, and finally the DNA of the DNA-linked ligands that bound to the beads was amplified by PCR, to reveal the efficiency of the model selection experiment. All proteins were enriched more than 50-fold.

    Example 21

    [0529] Iterated Selection on Immobilized Target (Subprocess viii).

    [0530] This is an example of iterated rounds of selection and elution without intervening amplification of the bifunctional molecule (subprocess viii, above). The description of the experiments is taken from (Liu et al., WO 2004/016767 A2, example 11, p. 173). The figures referred to are from the same patent application.

    [0531] Selections can be iterated to multiply the net enrichment of desired molecules. To test this possibility with DNA-linked synthetic molecules, a 1:1,000 mixture of DNA-linked phenyl sulfonamide (3):DNA-linked N-formyl-Met-Leu-Phe (2) (WO 2004/016767 A2) was subjected to a selection for binding carbonic anhydrase. The molecules surviving the first selection were eluted and directly subjected to a second selection using fresh immobilized carbonic anhydrase. PCR amplification and restriction digestion revealed that the first round of selection yielded a 1:3 ratio of (3):(2), representing a 3,30-fold enrichment for the DNA-linked phenyl sulfonamide. The second round of selection further enriched (3) by more than 30-fold, such that the ratio of (3):(2) following two rounds of selection exceeded 10:1 (>10.sup.4-fold net enrichment). Similarly, three rounds of iterated selection were used to enrich a 1:10.sup.6 starting ratio of (3):DNA-linked biotin (4) by a factor of 510.sup.6 into a solution containing predominantly DNA-linked phenyl sulfonamide (3) (see WO 2004/016767 A2, FIG. 81). These findings demonstate that enormous net enrichments for DNA-linked synthetic molecules can be achieved. through iterated selection, and suggest that desired molecules represented as rarely as 1 part in 10.sup.6 within DNA-templated synthetic libraries may be efficiently isolated in this manner.

    Example 22

    Stage 2 Reactions: Reductive Amination, Amine Acylation, Carbon-Carbon Forming Reactions, and Organometallic Coupling Reactions.

    [0532] This is an example of reactions that can be employed in a stage 2 synthesis. By maintaining a high concentration of molecule fragments (e.g. 10-100 mM), the conditions applied to the templated synthesis hereunder, can be applied to stage 1 synthesis as well, using the same reaction types. The description of the experiments is taken from (Liu et al., WO 2004/016767 A2, example 2, p. 107-112). The figures referred to are from the same patent application.

    [0533] As described in detail herein, a variety of chemical reactions for example, DNA-templated organometallic couplings and carbon-carbon bond forming reactions can be utilized to construct small molecules.

    [0534] The ability of DNA-templated synthesis to direct reactions that require a non-DNA-linked activator, catalyst or other reagent in addition to the principal reactants has also been demonstrated herein. To test the ability of DNA-templated synthesis to mediate such reactions without requiring structural mimicry of the DNA-templated backbone, DNA-templated reductive animations between an amine-linked template (1) (WO 2004/016767 A2) and benzaldehyde- or glyoxal-linked reagents (3) (WO 2004/016767 A2) with millimolar concentrations of sodium cyanoborohydride (NaBH.sub.3CN) at room temperature in aqueous solutions can be performed (see WO 2004/016767 A2, FIG. 23A). Significantly, products formed efficiently when the template and reagent sequences were complementary, while control reactions in which the sequence of the reagent did not complement that of the template, or in which NaBH.sub.3CN was omitted, yielded no significant product (see WO 2004/016767 A2, FIGS. 23A-23D and 24). Although DNA-templated reductive aminations to generate products closely mimicking the structure of double-stranded DNA have been previously reported (see, for example, Li et al. (2002) J. AM. CHEM. SOC. 124: 746 and Gat et al. (1998) BIOPOLYMERS 48: 19), these results demonstrate that reductive animation to generate structures unrelated to the phosphoribose backbone can take place efficiently and sequence-specifically.

    [0535] Referring to (WO 2004/016767 A2, FIGS. 25A-25B, DNA-templated amide bond formations between amine-linked templates 4 and 5 and carboxylate-linked reagents 6-9 mediated by 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide (EDC) and N-hydroxylsulfosuccinimide (sulfo-NHS) generated amide products in good yields at pH 6.0, 25 C. Product formation was (i) sequence-specific, (ii) dependent on the presence of EDC, and (iii) insensitive to the steric encumbrance of the amine or carboxylate. Efficient DNA-templated amide formation was also mediated by the water-stable activator 4-(4,6-dimethoxy-1,3,5-trizin-2-yl)-4-methylmorpholinium chloride (DMT-MM) instead of EDC and sulfo-NHS (WO 2004/016767 A2, FIGS. 24 and 25A-25B). The efficiency and generality of DNA-templated amide bond formation under these conditions, together with the large number of commercially available chiral amines and carboxylic acids, make this reaction an attractive candidate in future DNA-templated syntheses of structurally diverse small molecule libraries.

    [0536] Carbon-carbon bond forming reactions are also important in both chemical and biological syntheses and thus several such reactions can be utilized in a nucleic acid-templated format. Both the reaction of nitroalkane-linked reagent (10) (WO 2004/016767 A2) with aldehyde-linked template (11) (WO 2004/016767 A2) (nitro-aldol or Henry reaction) and the conjugate addition of 10 to maleimide-linked template (12) (WO 2004/016767 A2) (nitro-Michael addition) proceeded efficiently and with high sequence specificity at pH 7.5-8.5, 25 C. (WO 2004/016767 A2, FIGS. 23A and 24). In addition, the sequence-specific DNA-templated Wittig reaction between stabilized phosphorus ylide reagent 13 (WO 2004/016767 A2) and aldehyde-linked templates 14 or 11 (WO 2004/016767 A2) provided the corresponding olefin products in excellent yields at pH 6.0-8.0, 25 C. (WO 2004/016767 A2, FIGS. 23B and 24). Similarly, the DNA templated 1,3-dipolar cycloaddition between nitrone-linked reagents 15 and 16 (WO 2004/016767 A2) and olefin-linked templates 12, 17 or 18 also afforded products sequence specifically at pH 7.5, 25 C. (WO 2004/016767 A2, FIGS. 23B, 23C arid 24).

    [0537] In addition to the reactions described above, organometallic coupling reactions can also be utilized in the present invention. For example, DNA-templated Heck reactions were performed in the presence of water-soluble Pd precatalysts. In the presence of 170 mM Na.sub.2PdCl.sub.4, aryl iodide-linked reagent 19 (WO 2004/016767 A2) and a variety of olefin-linked templates including maleimide 12, acrylamide 17, vinyl sulfone 18 or cinnamamide 20 (WO 2004/016767 A2) yielded Heck coupling products in modest yields at pH 5.0, 25 C. (WO 2004/016767 A2, FIGS. 23D and 24). For couplings with olefins 17, 18 and 20, adding two equivalents of P(p-SO.sub.3C.sub.6H.sub.4).sub.3 per equivalent of Pd prior to template and reagent addition typically increased overall yields by 2-fold.. Control reactions containing sequence mismatches or lacking Pd precatalyst yielded no product.

    [0538] In order to evaluate the ability of the DNA-templated reactions to take place efficiently when reactants are separated by distances relevant to library encoding, the yields of reductive animation, amide formation, nitro-aldol addition, nitro-Michael addition, Wittig olefination, dipolar cycloaddition, and Heck coupling reactions were compared when either zero {n0) or ten (n=10) bases separated the annealed reactive groups. Among the reactions described here, amide bond formation, nitro-aldol

    addition, Wittig olefination, Heck coupling, conjugate addition of thiols to maleimides and S.sub.N2 reaction between thiols and alpha-iodo amides demonstrate comparable product formation when reactive groups are separated by zero or ten bases (WO 2004/016767 A2, FIG. 26B). FIG. 26B shows the results of denaturing polyacrylamide gel electrophoresis of a DNA-templated Wittig olefination between complementary 11 and 13 with either zero bases (lanes 1-3) or ten bases (lanes 4-6) separating the annealed reactants. Product yields after 13 hours at both distances were nearly quantitative.

    [0539] Control reactions containing sequence mismatches yielded no detectable product. These findings indicate that these reactions can be encoded during synthesis by nucleotides that are distal from the reactive end of the template without significantly impairing product formation.

    [0540] In addition to the DNA-templated S.sub.N2 reaction, conjugate addition, vinyl sulfone addition, amide bond formation, reductive animation, nitro-aldol (Henry reaction), nitro Michael, Wittig olefination, 1,3-dipolar cycloaddition and Heck coupling reactions described above, a variety of additional reagents can also be utilized in the method of the present invention. For example, as depicted in (WO 2004/016767 A2, FIG. 27), powerful aqueous DNA-templated synthetic reactions including, but not limited to, the Lewis acid-catalysed aldol addition, Mannich reaction, Robinson annulation reactions, additions of allyl indium, zinc and tin to ketones and aldehydes, Pd-assisted allylic substitution, Diels-Alder cycloadditions, and hetero-Diels-Alder reactions can be utilized efficiently in aqueous solvent and are important complexity-building reactions.

    [0541] Taken together, these results expand considerably the reaction scope of DNA-templated synthesis. A wide variety of reactions can proceed efficiently and selectively when the corresponding reactants are programmed with complementary sequences. By augmenting the repertoire of known DNA-templated reactions to include carbon-carbon bond forming and organometallic reactions (nitro-aldol additions, nitro-Michael additions, Wittig olefinations, dipolar cycloadditions, and Heck couplings, in addition to previously reported amide bond formation (see, Schmidt et al (1997) NUCLEIC ACIDS RES. 25:4792; Bruick et al. (1996) CHEM. BIOL. 3: 49), imine formation (Czlapinski: al. (2001) J. AM. CHEM. SOC. 123: 8618), reductive aminatiori (Lie/al. (2002) J. AM. CHEM. SOC. 124: 746; Gat et al. (1998) BiOPOLYMERS 48:19), S.sub.N2 reactions (Gartner et al. (2001) J. AM. CHEM. SOC. 123: 6961; Xu et al. (2001) NAT. BIOTECHNOL 19: 148; Herrlein et al. (1995) J. AM. CHEM. SOC. 117: 10151), conjugate addition of thiols (Gartner et al. (2001) J. AM. CHEM. SOC. 123: 6961), and phosphoester or phosphonamide formation (Orgel et al. (1995) Ace. CHEM. RES. 28: 109; Luther et al. (1998) NATURE 396: 245), these results may permit the, sequence-specific translation of libraries of DNA into libraries of structurally and functionally diverse synthetic products.

    [0542] Because minute quantities of templates encoding desired molecules can be amplified by PCR, the yields of DNA-templated reactions arguably are less critical than the yields of traditional synthetic transformations. Nevertheless, many of the reactions discussed in this example proceed efficiently.

    Materials and Methods

    [0543] Functionalized templates and reagents were typically prepared by reacting 5-NH.sub.2 terminated oligonucleotides (for template 1), 5-NH.sub.2(CH.sub.20).sub.2 terminated oligonucleotides (for all other templates) or 3-OP0.sub.3-CH(CH.sub.2OH)(CH.sub.20H)(CH).sub.4NH.sub.2 terminated nucleotides (for all reagents) with the appropriate NHS esters (0.1 volumes of a 20 mg/mL solution in DMF) in 0.2 M sodium phosphate buffer, pH 7.2, 25 C., for 1 hour to provide the template and reagent structures shown in (WO 2004/016767 A2, FIGS. 23A-23D and 25A-25B). For amino acid linked reagents 6-9, 3-OP0.sub.3CH.sub.2CH(CH.sub.20H)(CH.sub.2).sub.4NH.sub.2 terminated oligonucleotides in 0.2 M sodium phosphate-buffer, pH 7.2 were reacted with 0.1 volumes of a 100 mM bis[2-(succinimidyloxycarbonyloxy)ethyl]sulfone (BSOCOES, Pierce, Rockford, Ill., USA) solution in

    DMF for 10 minutes at 25 C., followed by 0.3 volumes of a 300 mM amino acid in 300 mM sodium hydroxide (NaOH) for 30 minutes at 25 C.

    [0544] Functionalized templates and reagents were purified by gel filtration using Sephadex G-25 followed by reverse-phase HPLC (0.1 triethylammonium acetate-acetonitrile gradient) and characterized by MALDI mass spectrometry. For the DNA templated reactions described in (WO 2004/016767 A2, FIGS. 23A-23D) reactions were conducted at 25 C. with one equivalent each of template and reagent at 60 nM final concentration unless otherwise specified. Conditions: (a) 3 mM NaBH.sub.3CN, 0.1 M/V-[2-morpholinoethane] sulfonic acid (MES) buffer pH 6.0, 0.5 M NaCl, 1.5 hours; b) 0.1 M N-tris[hydroxymethyl] methyl-3-aminopropanesulfonic acid (TAPS) buffer pH 8.5, 300 mM NaCl, 12 hours; c) 0.1 M pH 8.0 TAPS buffer, 1 M NaCl, 5 C., 1.5 hours; d) 50 mM MOPS buffer pH 7.5, 2.8 M NaCl, 22 hours; e) 120 nM 19, 1.4 mM Na.sub.2PdCl.sub.4, 0.5 M NaOAc buffer pH 5.0, 18 hours; (f) Premix NaaPdCL} with two equivalents of P(p-SO.sub.3CeH.sub.4).sub.3 in water for 15 minutes, then add to reactants in 0.5 M NaOAc buffer pH 5.0, 75 mM NaCl, 2 hours (final [Pd]=0.3 mM, [19]=120 nM). The olefin geometry of products from 13 and the regiochemistries of cycloaddition products from 14 and 16 are presumed but not verified (WO 2004/016767 A2, FIGS. 23A-23D). Products were characterized by denaturing polyacrylamide gel electrophoresis and MALDI mass spectrometry. For all reactions under the specified conditions, product yields of reactions with matched template and reagent sequences were greater than 20-fold higher than that of control reactions with scrambled reagent sequences.

    [0545] The conditions for the reactions described in (WO 2004/016767 A2, FIGS. 25A-25B) were: 60 nM template, 120 nM reagent, 50 mM DMT-MM in 0.1 M MOPS buffer pH 7.0, 1 M NaCl, for 16 hours at, 25 C.; or 60 nM template, 120 nM reagent, 20 mM EDC, 15 mM sulfo-NHS, 0.1 M MES buffer pH 6.0, 1 M NaCl, for 16 hours at 25 C. In each row of the table in (WO 2004/016767 A2, FIGS. 25A-25B), yields of DMT-MM-mediated reactions between reagents and templates complementary in sequence were followed by yields of EDC and sulfo-NHS-mediated reactions. In all cases, control reactions with mismatched reagent sequences yielded little or no detectable product and products were characterized by denaturing polyacrylamide gel electrophoresis and MALDI mass spectrometry.

    [0546] (WO 2004/016767 A2, FIG. 24) depicts the analysis by denaturing polyacrylamide gel electrophoresis of representative DNA-templated reactions listed in (WO 2004/016767 A2, FIGS. 23A-23D and 25A-25B). The structures of reagents and templates correspond to the numbering in FIGS. 23A-23D and 25A-25B. Lanes 1, 3, 5, 7, 9, 11: reaction of matched (complementary or M) reagents and templates under conditions listed in FIGS. 23A-23D and 25A-25B (the reaction between 4 and 6 was mediated. by DMT-MM). Lanes 2, 4, 6, 8, 10, 12: reaction of mismatched (non-complementary or X) reagents and templates under conditions identical to those in lanes 1, 3, 5, 7, 9 and 11, respectively.

    [0547] The sequences of oligonucleotide templates and reagents are as follows (5 to 3 direction, n refers to the number of bases between reactive groups when template and reagent are annealed as shown in (WO 2004/016767 A2, FIG. 26A).

    TABLE-US-00014 1: [SEQIDNO:45] TGGTACGAATTCGACTCGGG; 2and3matched: [SEQIDNO:46] GAGTCGAATTCGTACC; 2and3mismatched: [SEQIDNO:47] GGGCTCAGCTTCCCCA; 4and5: [SEQIDNO:48] GGTACGAATTCGACTCGGGAATACCACCTT; 6-9matched(n= 10): [SEQIDNO:49] TCCCGAGTCG; 6matched(7= 0): [SEQIDNO:50] AATTCGTACC; 6-9mismatched: [SEQIDNO:51] TCACCTAGCA; 11,12,14,17,18,20: [SEQIDNO:52] GGTACGAATTCGACTCGGGA; 10,13,16,19matched: [SEQIDNO:53] TCCCGAGTCGAATTCGTACC; 10,13,16,19mismatched: [SEQIDNO:54] GGGCTCAGCTTCCCCATAAT; 15matched: [SEQID20NO:55] AATTCGTACC; 15mismatched: [SEQIDNO:56] TCGTATTCCA; templateforn= 10vs.n= 0comparison: [SEQIDNO:57] TAGCGATTACGGTACGAATTCGACTCGGGA.

    [0548] Reaction yields were quantitated by denaturing PAGE followed by ethidium bromide staining, UV visualization, and charge-coupled device (CCD)-based densitometry of product and template starting material bands. Yield calculations assumed that templates and 25 products stained with equal intensity per base; for those cases in which products were partially double-stranded during quantitation, changes in staining intensity may have resulted in higher apparent yields.

    Example 23

    Different Stage 1 and Stage 2 Synthesis Schemes Employed in a Given Series of Experiments.

    [0549] Because of the modular nature of the stage 1, stage 2 and selection/screening protocols, it is perfectly possible to generate a first generation library using e.g. subprocess (1, i.e., no templated synthesis involved), then select (e.g. using subprocess i), and then perform a second round of library generation, and this time use the recovered templates as templates, and therefore, perform a stage 2 synthesis to make the enriched second generation library. Obviously, it is important to keep the same code for the same molecule fragments,

    [0550] It may also be advantageous to select against immobilized target in the first round, and then in the second round perform in solution selection experiments for example, or some other selection experiment that share few of the same features as the first selection assay.

    Example 24

    Carrier Preparation by Several Different Routes.

    [0551] Because of the modular nature of the stage 1 synthesis procedures, the carrier that are employed in a stage 2 synthesis can be prepared by different synthetic routes. As an example, in order to make e.g. 2.000 identifiers, with the ability to make 1.000.000 different template-encoded molecules, one could synthesize 625 carriers by two step Lerner-like stage 1 synthesis (subprocess 1), using acylation reactions to link the molecule fragments; synthesize 1000 carriers using the DNA-routing approach by Harbury (subprocess 10), for example employing reductive amination and nucleophilic aromatic substitution reactions; synthesize 375 compounds by combinatorial chemistry and attach these to identifiers. Then use this pool of 2000 carriers in a stage 2 synthesis to generate 1.000.000 bifunctional molecules.

    Example 25

    Stage 1 Synthesis Employing the Harbury and Halpin Method (Subprocess 10).

    [0552] Subprocess 10 stage 1 synthesis involves a DNA sorting step, in which the identifiers to be linked to the molecule fragments are sorted according to their DNA sequences. Once the DNA has been sorted, the molecule fragments can be linked under conditions identical to the conditions described in the present invention, in particular, as described in all of the above examples. Thus, the preferred reactions, reductive amination, Wittig reaction, acylation, alkylhalide alkylation, nucleophilic aromatic substitution, Heck coupling, cycloaddition reactions, sulfonoylation, isocyanide addition, Michael addition and others, may be executed in exactly the same way as described here.

    APPLICATIONS OF THE PRESENT INVENTION

    [0553] The methods of the present invention provide for the identification of organic and inorganic molecules that are catalysts useful for the synthesis of complex molecules from simple substrates, inorganic compounds with useful properties as materials, may be used in the degradation of plastics, animal feed processing, etc. Also, the methods can be applied to identification of compounds with high affinity or selectivity for targets and surfaces, including protein targets, DNA, and other macromolecular structures, metal surfaces, plastics, etc. Such compounds may be useful as additives to paint, cement, textiles, and other substances where improved rigidity, strength, flexibility or stability is desired. New materials may be identified in this way, including superconductors and nanosensors. Compounds that bind with high affinity and/or selectivity to protein, RNA, DNA, polysaccharides, or other molecules of an organism, may be used in diagnostics or as therapeutics.

    REFERENCES

    [0554] Baindur et al., U.S. Pat. No. 5,891,737 [0555] Baindur et al., U.S. Pat. No. 5,646,285 [0556] Boger et al., U.S. Pat. No. 6,194,612 Bi [0557] Cook et al., U.S. Pat. No. 6,191,273 [0558] Dervan et al., U.S. Pat. No. 6,090,947; [0559] Dower et al., US 1991000762522 [0560] Dower et al., EP 0604552 B1 [0561] Franch et al., WO 2004/083427 [0562] Freskgrd et al., WO 2004/039825 A2 [0563] Graybill et al., U.S. Pat. No. 6,127,191 [0564] Gustafson et al., U.S. Pat. No. 6,140,361 [0565] Harbury and Halpin, WO 00/23458 [0566] Lebi et al., U.S. Pat. No. 6,090,912 [0567] Lebl et al., U.S. Pat. No. 5,840,485 [0568] Lerner, R. et al., EP 0643778 B1 [0569] Liu et al., WO02/074929A2 [0570] Liu et al., WO 2004/016767 A2 [0571] Morgan et al., WO 2005/058479 [0572] Pedersen et al., WO02/103008A2 [0573] Pedersen et al., WO03/078625 A2 [0574] Still et al. (1998) U.S. Pat. No. 5,721,099; [0575] Abelson (1996) Methods in Enzymology, 267; 211-221; [0576] Alvarez et al. (1999), Journal of Organic Chemistry, 64; 6319-28; [0577] Ashley, G. W., Kushlan, D. M. (1991), Biochemistry, 30; 2927-2933 [0578] Bruick et al. (1996), Chem. Biol. 3; 49 [0579] Calderone et al. (2002), Angew. Chem. Int. Ed. Engl., 41; 4104; [0580] Czlapinski et al. (2001), J. Am. Chem. Soc., 123; 8618 [0581] Dapremont et al. (1995) Physiol. Chem. Phys. & Med. NMR, 27; 339-343, [0582] Dolinnaya, N. G. et al. (1993), Nucl. Acids. Res., 21; 5403-5407 [0583] Dolinnaya, N. G., et al. (1994), Nucleosides Nucleotides 13; 2169-2183 [0584] Doyon et al. (2003), J. Am. Chem. Soc., 125; 12372-12373 [0585] Feuston et al. (2002), J. Med. Chem., 45; 5640-8 [0586] Fruchart et al. (1999), Tetrahedron Lett., 40; 6225 [0587] Gao, H., et al. (1994), Bioconjugate Chem., 5; 445-453 [0588] Gartner et al. (2001), J. Am. Chem. Soc. 123; 6961 [0589] Gartner et al. (2002), Angew. Chem. Int. Ed. 41, 1796 [0590] Gat et al. (1998), Biopolymers, 48; 19 [0591] Goodwin, J. T., and Lynn, D. G. (1992), J. Am. Chem. Soc., 114; 9197-9198) [0592] Herrlein et al. (1995), J. Am. Chem. Soc., 117; 10151 [0593] Hughes (1996), Tetrahedron Lett., 37; 7595 [0594] Kool, E. T. (1991), J. Am. Chem. Soc., 113; 6265-6266 [0595] Kramer et al. (1999), Current Protocols in Mol. Biol., 3; 15.1 [0596] Jost et al. (1989), Nucleic Acids Res., 17; 2143 [0597] Lie/al. (2002), J. Am. Chem. Soc., 124; 746 [0598] Luebke, et al. (1991), J. Am. Chem. Soc., 113; 7447-7448 [0599] Luebke et al. (1992), Nucl. Acids Res., 20; 3005-3009 [0600] Luther et al. (1998), Nature, 396; 245 [0601] Lynn et al. (1998), J. Am. Chem. Soc., 120; 1627-1628 [0602] Lynn et al. (2000), 3. Am. Chem. Soc., 122; 6601-6609 [0603] Melnikov et al. (1999), Langmuir, 15; 1923-1928 [0604] Mohr et al. (1996) Organometallics, 15; 4317-4325 [0605] Orgel et al. (1995), Ace. Chem. Res., 28; 109 [0606] Pirrung et al. (1998), Journal of Organic Chemistry, 63; 241-46 [0607] Rohatgi, R., et al. (1996), J. Am. Chem. Soc., 118; 3332-3339 [0608] Schmidt et al (1997), Nucleic Acids Res., 25; 4792 [0609] Shabarova, Z. A. (1988), Biochemie, 70; 1323-1334; [0610] Sokolova, N. I. et al. (1988), FEBS Letters, 232; 153-155; [0611] Vaisman et al., (2001) J. Biol. Chem., 276; 30615-30622 [0612] Visscher, 3., Shwartz, A. W. (1988), Journal of Molecular Evolution, 28; 3-6 [0613] Walder et al. (1979), Proc. Natl. Acad. Sci., 76; 51-55 [0614] Wang, E., Yanagawa, H. (1986), Biochemistry, 25; 7423-7430 [0615] Washington et al., (2001) J. Biol. Chem., 276; 2263-2266 [0616] Yanzheng, X., and Kool, E. T. (1997), Tetrahedron Letters, 38; 5595-5598 [0617] Xu et al. (2001), Nat. Biotechnol., 19; 148 [0618] Zhang et al. (1999), J. Am. Chem. Soc. 121; 3311 [0619] Zhao et al, (1998), Journal of Organic Chemistry, 63; 7568-7572 [0620] Zarling et al., (1980), J. Immunol., 124; 913