METHOD FOR IMPROVEMENT OF DRUG METABOLISM OF HUMAN STEM CELL-DERIVED HEPATOCYTES
20180163179 ยท 2018-06-14
Inventors
- Won-il JEONG (Daejeon, KR)
- Yong-mahn Han (Daejeon, KR)
- Mi Young Kim (Daejeon, KR)
- Hyuk Soo EUN (Daejeon, KR)
- Mi-Jin JANG (Daejeon, KR)
Cpc classification
G01N33/50
PHYSICS
C12N5/0672
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention relates to a method for improving drug metabolism function of human stem cell-derived hepatocytes. More precisely, the human stem cell-derived hepatocytes are similar in cell morphology to human hepatocytes but display reduced expressions of drug or alcohol metabolism associated enzymes and antioxidant enzymes. So, the inventors co-cultured the hepatocytes differentiated from human stem cells with mouse hepatic stellate cells. As a result, it was confirmed that alcohol mediated toxicity was reduced so that liver cell damage or apoptosis level was reduced. In the meantime, the expressions of drug and alcohol metabolism associated enzymes and antioxidant enzymes were increased.
Claims
1-22. (canceled)
23. A method for improving drug or alcohol metabolism of human stem cell-derived hepatocytes, wherein the hepatocytes are characteristically differentiated by the following steps: 1) culturing human stem cells to induce the differentiation ex vivo; 2) culturing the differentiated cells of step 1) in a medium supplemented with hepatocyte growth factor; and 3) treating the retinoic acid secreted from hepatic stellate cells to step 2).
24. The method for improving drug or alcohol metabolism of human stem cell-derived hepatocytes according to claim 23, wherein the human stem cells are characteristically human embryonic stem cells or somatic cell derived induced pluripotent stem cells (iPS cells).
25. The method for improving drug or alcohol metabolism of human stem cell-derived hepatocytes according to claim 23, wherein the retinoic acid is characteristically all trans retinoic acid or 9-cis retinoic acid.
26. The method for improving drug or alcohol metabolism of human stem cell-derived hepatocytes according to claim 23, wherein the hepatocytes treated with retinoic acid characteristically display the increased expressions of alcohol or drug metabolism associated enzymes and anti-oxidant enzymes.
27. The method for improving drug or alcohol metabolism of human stem cell-derived hepatocytes according to claim 26, wherein the alcohol metabolism associated enzyme is one or more enzymes selected from the group consisting of ADH1a, ADH1b, ADH1c, and CYP2E1, and the drug metabolism associated enzyme is one or more enzymes selected from the group consisting of CYP2C9, CYP2D6, and CYP3A4, and the antioxidant enzyme is either or both of catalase and Mn-SOD.
28. A human stem cell-derived hepatocyte prepared by the method of claim 23.
29. A method for evaluating drug or alcohol metabolism in hepatocytes comprising the following steps: 1) treating the human stem cell-derived hepatocytes prepared by the method of claim 6 with a test drug or alcohol ex vivo; 2) measuring the expression level of the enzyme related to the drug or alcohol metabolism in the hepatocytes of step 1); and 3) evaluating the drug or alcohol metabolism level by the expression level of the enzyme related to the drug or alcohol metabolism measured in step 2).
30. An evaluation system of drug or alcohol metabolism comprising the hepatocytes of claim 28.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0018] The application of the preferred embodiments of the present invention is best understood with reference to the accompanying drawings, wherein:
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0038] Hereinafter, the present invention is described in detail.
[0039] The present invention provides a method for improving drug metabolism function of human stem cell-derived hepatocytes comprising the step of co-culturing the hepatocytes differentiated from human stem cells with hepatic stellate cells (HSCs) ex vivo.
[0040] In the method above, the hepatocytes are preferably differentiated by the following steps, but not always limited thereto:
[0041] 1) culturing human stem cells to induce the differentiation; and
[0042] 2) culturing the differentiated cells above in a medium supplemented with hepatocyte growth factor.
[0043] In the method above, the human stem cells are preferably human embryonic stem cells or induced pluripotent stem cells (iPS cells), but not always limited thereto.
[0044] In the method above, the hepatic stellate cells are preferably mouse originated hepatic stellate cells, but not always limited thereto.
[0045] In the method above, the ratio of hepatic stellate cells to human stem cell-derived hepatocytes for the co-culture is preferably 1:2, but not always limited thereto.
[0046] In the method above, it is preferred in the cultured hepatocytes that the expressions of alcohol or drug metabolism associated enzymes and antioxidant enzymes are increased. At this time, the alcohol metabolism associated enzyme is one or more enzymes selected from the group consisting of ADH1a, ADH1b, ADH1c, and CYP2E1, and the drug metabolism associated enzyme is one or more enzymes selected from the group consisting of CYP2C9, CYP2D6, and CYP3A4, and the antioxidant enzyme is either or both of catalase and Mn-SOD, but not always limited thereto.
[0047] In a preferred embodiment of the present invention, the present inventors induced the differentiation of human embryonic stem cells into hepatocytes. Then, the inventors compared the differentiated hepatocytes originated from human embryonic stem cells with human hepatocytes. As a result, it was confirmed that the hepatocytes differentiated from human embryonic stem cells were similar in cell shape (see
[0048] Mouse hepatic stellate cells were co-cultured with human embryonic stem cell-derived hepatocytes (see
[0049] From the results of the investigation above, it was confirmed that the co-culture of the hepatocytes differentiated from human embryonic stem cells with mouse hepatic stellate cells was effective in increasing the expressions of drug metabolism and alcohol metabolism associated enzymes in human embryonic stem cell-derived hepatocytes.
[0050] Therefore, the human stem cell-derived hepatocytes of the present invention were confirmed to be similar in shape to human hepatocytes but displayed reduced expressions of drug or alcohol metabolism associated enzymes and antioxidant enzymes. Also from the result of the co-culture of human stem cell-derived hepatocytes with mouse hepatic stellate cells, it was confirmed that the alcohol dependent toxicity was reduced so that liver cell damage or apoptosis was reduced but the expressions of drug and alcohol metabolism associated enzymes and antioxidant enzymes were increased. So, the co-culture of human stem cell-derived hepatocytes with hepatic stellate cells could be used as an efficient method for improving drug metabolism function of human stem cell-derived hepatocytes.
[0051] The present invention also provides the human stem cell-derived hepatocytes prepared by the method above.
[0052] The present invention further provides a method for evaluating drug or alcohol metabolism in hepatocytes comprising the following steps:
[0053] 1) treating the said hepatocytes above with a test drug or alcohol ex vivo;
[0054] 2) measuring the expression level of the enzyme related to the drug or alcohol metabolism in the hepatocytes of step 1); and
[0055] 3) evaluating the drug or alcohol metabolism level by the expression level of the enzyme related to the drug or alcohol metabolism measured in step 2).
[0056] The human stem cells above are preferably human embryonic stem cells or somatic cell derived induced pluripotent stem cells (iPS cells), but not always limited thereto.
[0057] In the method above, it is preferred in the hepatocytes that the expressions of alcohol or drug metabolism associated enzymes and antioxidant enzymes are increased. At this time, the alcohol metabolism associated enzyme is one or more enzymes selected from the group consisting of ADH1a, ADH1b, ADH1c, and CYP2E1, and the drug metabolism associated enzyme is one or more enzymes selected from the group consisting of CYP2C9, CYP2D6, and CYP3A4, and the antioxidant enzyme is either or both of catalase and Mn-SOD, but not always limited thereto.
[0058] The test drug or alcohol above is preferably selected from the group consisting of ethanol, CCl.sub.4, and acetaminophen, but not always limited thereto.
[0059] The human stem cell-derived hepatocytes of the present invention were confirmed to be similar in shape to human hepatocytes but displayed reduced expressions of drug or alcohol metabolism associated enzymes and antioxidant enzymes. Also from the result of the co-culture of human stem cell-derived hepatocytes with mouse hepatic stellate cells, it was confirmed that the alcohol dependent toxicity was reduced so that liver cell damage or apoptosis was reduced but the expressions of drug and alcohol metabolism associated enzymes and antioxidant enzymes were increased. Therefore, the human stem cell-derived hepatocytes co-cultured with hepatic stellate cells could be efficiently used for the evaluation of drug or alcohol metabolism.
[0060] The present invention also provides an evaluation system of drug or alcohol metabolism comprising the hepatocytes above.
[0061] The present invention also provides the hepatocytes above for the evaluation system of drug or alcohol metabolism.
[0062] It is preferred in the hepatocytes that the expressions of alcohol or drug metabolism associated enzymes and antioxidant enzymes are increased. At this time, the alcohol metabolism associated enzyme is one or more enzymes selected from the group consisting of ADH1a, ADH1b, ADH1c, and CYP2E1, and the drug metabolism associated enzyme is one or more enzymes selected from the group consisting of CYP2C9, CYP2D6, and CYP3A4, and the antioxidant enzyme is either or both of catalase and Mn-SOD, but not always limited thereto.
[0063] The drug or alcohol above is preferably selected from the group consisting of ethanol, CCl.sub.4, and acetaminophen, but not always limited thereto.
[0064] The system herein is preferably a kit or a chip, but not always limited thereto.
[0065] The human stem cell-derived hepatocytes of the present invention were confirmed to be similar in shape to human hepatocytes but displayed reduced expressions of drug or alcohol metabolism associated enzymes and antioxidant enzymes. Also from the result of the co-culture of human stem cell-derived hepatocytes with mouse hepatic stellate cells, it was confirmed that the alcohol dependent toxicity was reduced so that liver cell damage or apoptosis was reduced but the expressions of drug and alcohol metabolism associated enzymes and antioxidant enzymes were increased. Therefore, the human stem cell-derived hepatocytes co-cultured with hepatic stellate cells could be efficiently used for the evaluation system of drug or alcohol metabolism.
[0066] The present invention also provides a method for improving drug metabolism of human stem cell-derived hepatocytes comprising the step of treating retinoic acid to the hepatocytes differentiated from human stem cells ex vivo.
[0067] In the method above, the hepatocytes are preferably differentiated by the following steps, but not always limited thereto:
[0068] 1) culturing human stem cells to induce the differentiation; and
[0069] 2) culturing the differentiated cells above in a medium supplemented with hepatocyte growth factor.
[0070] In the method above, the human stem cells are preferably human embryonic stem cells or somatic cell derived induced pluripotent stem cells (iPS cells), but not always limited thereto.
[0071] In the method above, the retinoic acid is preferably secreted from hepatic stellate cells, and is preferably all trans retinoic acid or 9-cis retinoic acid, but not always limited thereto.
[0072] In the method above, it is preferred in the hepatocytes treated with retinoic acid that the expressions of alcohol or drug metabolism associated enzymes and antioxidant enzymes are increased. At this time, the alcohol metabolism associated enzyme is one or more enzymes selected from the group consisting of ADH1a, ADH1b, ADH1c, and CYP2E1, and the drug metabolism associated enzyme is one or more enzymes selected from the group consisting of CYP2C9, CYP2D6, and CYP3A4, and the antioxidant enzyme is either or both of catalase and Mn-SOD, but not always limited thereto.
[0073] In a preferred embodiment of the present invention, the present inventors induced the differentiation of human embryonic stem cells into hepatocytes. Then, the inventors compared the differentiated hepatocytes originated from human embryonic stem cells with human hepatocytes. As a result, it was confirmed that the hepatocytes differentiated from human embryonic stem cells were similar in cell shape (see
[0074] Mouse hepatic stellate cells were co-cultured with human embryonic stem cell-derived hepatocytes (see
[0075] Human embryonic stem cell-derived hepatocytes (hES-Hep) were co-cultured with the mouse hepatic stellate cells (mHSCs) separated from the liver of a wild type (WT) mouse and a genetically engineered mouse with retinoic acid metabolism deficiency (Raldh1.sup./) so that it could not metabolize retinol into retinoic acid. Then, liver cell damage was observed. As a result, the levels of AST and LDH were significantly decreased in the medium where the mouse hepatic stellate cells separated from the wild type mouse were co-cultured. However, the levels of AST and LDH were not changed in the medium where the mouse hepatic stellate cells separated from the genetically engineered mouse (Raldh1.sup./) were co-cultured (see
[0076] After treating human embryonic stem cell-derived hepatocytes with retinoic acid, the expressions of those genes involved in alcohol metabolism, drug metabolism, and anti-oxidation activity were investigated. As a result, when retinoic acid was treated to the cells, the expressions of those genes said above were all increased as shown when human embryonic stem cell-derived hepatocytes were co-cultured with the mouse hepatic stellate cells (see
[0077] From the above results, it was confirmed that the expressions of the enzymes involved in drug and alcohol metabolism and anti-oxidation activity were increased in the human embryonic stem cell-derived hepatocytes (hES-Hep) treated with retinoic acid and accordingly toxicity was reduced owing to the increased alcohol metabolism. In conclusion, the inventors confirmed that the expressions of the enzymes associated with drug and alcohol metabolism and anti-oxidation activity were increased by retinoic acid.
[0078] Therefore, the human stem cell-derived hepatocytes of the present invention were confirmed to be similar in shape to human hepatocytes but displayed reduced expressions of drug or alcohol metabolism associated enzymes and antioxidant enzymes. From the result of the co-culture of human stem cell-derived hepatocytes with mouse hepatic stellate cells, it was confirmed that the expression pattern of retinol associated gene was changed. From the co-culture of human stem cell-derived hepatocytes with the mouse hepatic stellate cells isolated from the mouse with metabolic disorder so as not to metabolize retinol into retinoic acid, it was confirmed that liver cell damage was not reduced nor the expression patterns of drug and alcohol metabolism associated enzymes and anti-oxidant enzymes were not changed. In the meantime, when retinoic acid was treated to human stem cell-derived hepatocytes, the expressions of drug and alcohol metabolism associated enzymes and anti-oxidant enzymes were increased but apoptosis was decreased. Therefore, the method of co-culturing the hepatocytes differentiated from human stem cells above with hepatic stellate cells and the method for the treatment of retinoic acid to the hepatocytes differentiated from human stem cells were confirmed to be efficiently used as methods for improving drug metabolism function of the human stem cell-derived hepatocytes.
[0079] The present invention also provides the human stem cell-derived hepatocytes prepared by the method above.
[0080] The present invention further provides a method for evaluating drug or alcohol metabolism in hepatocytes comprising the following steps:
[0081] 1) treating the said hepatocytes above with a test drug or alcohol ex vivo;
[0082] 2) measuring the expression level of the enzyme related to the drug or alcohol metabolism in the hepatocytes of step 1); and
[0083] 3) evaluating the drug or alcohol metabolism level by the expression level of the enzyme related to the drug or alcohol metabolism measured in step 2).
[0084] The human stem cells above are preferably human embryonic stem cells or somatic cell derived induced pluripotent stem cells, but not always limited thereto.
[0085] In the method above, it is preferred in the hepatocytes that the expressions of alcohol or drug metabolism associated enzymes and antioxidant enzymes are increased. At this time, the alcohol metabolism associated enzyme is one or more enzymes selected from the group consisting of ADH1a, ADH1b, ADH1c, and CYP2E1, and the drug metabolism associated enzyme is one or more enzymes selected from the group consisting of CYP2C9, CYP2D6, and CYP3A4, and the antioxidant enzyme is either or both of catalase and Mn-SOD, but not always limited thereto.
[0086] The test drug or alcohol above is preferably selected from the group consisting of ethanol, CCl.sub.4, and acetaminophen, but not always limited thereto.
[0087] The human stem cell-derived hepatocytes of the present invention were confirmed to be similar in shape to human hepatocytes but displayed reduced expressions of drug or alcohol metabolism associated enzymes and antioxidant enzymes. From the result of the co-culture of human stem cell-derived hepatocytes with mouse hepatic stellate cells, it was confirmed that the expression pattern of retinol associated gene was changed. From the co-culture of human stem cell-derived hepatocytes with the mouse hepatic stellate cells isolated from the mouse with metabolic disorder so as not to metabolize retinol into retinoic acid, it was confirmed that liver cell damage was not reduced nor the expression patterns of drug and alcohol metabolism associated enzymes and anti-oxidant enzymes were not changed. In the meantime, when retinoic acid was treated to human stem cell-derived hepatocytes, the expressions of drug and alcohol metabolism associated enzymes and anti-oxidant enzymes were increased but apoptosis was decreased. Therefore, the method for the treatment of retinoic acid to the hepatocytes differentiated from human stem cells were confirmed to be efficiently used as a method for improving drug metabolism function of the human stem cell-derived hepatocytes.
[0088] The present invention also provides an evaluation system of drug or alcohol metabolism comprising the hepatocytes above.
[0089] The present invention also provides the hepatocytes above for the evaluation system of drug or alcohol metabolism.
[0090] It is preferred in the hepatocytes that the expressions of alcohol or drug metabolism associated enzymes and antioxidant enzymes are increased. At this time, the alcohol metabolism associated enzyme is one or more enzymes selected from the group consisting of ADH1a, ADH1b, ADH1c, and CYP2E1, and the drug metabolism associated enzyme is one or more enzymes selected from the group consisting of CYP2C9, CYP2D6, and CYP3A4, and the antioxidant enzyme is either or both of catalase and Mn-SOD, but not always limited thereto.
[0091] The drug or alcohol above is preferably selected from the group consisting of ethanol, CCl.sub.4, and acetaminophen, but not always limited thereto.
[0092] The system herein is preferably a kit or a chip, but not always limited thereto.
[0093] The human stem cell-derived hepatocytes of the present invention were confirmed to be similar in shape to human hepatocytes but displayed reduced expressions of drug or alcohol metabolism associated enzymes and antioxidant enzymes. From the result of the co-culture of human stem cell-derived hepatocytes with mouse hepatic stellate cells, it was confirmed that the expression pattern of retinol associated gene was changed. From the co-culture of human stem cell-derived hepatocytes with the mouse hepatic stellate cells isolated from the mouse with metabolic disorder so as not to metabolize retinol into retinoic acid, it was confirmed that liver cell damage was not reduced nor the expression patterns of drug and alcohol metabolism associated enzymes and anti-oxidant enzymes were not changed. In the meantime, when retinoic acid was treated to human stem cell-derived hepatocytes, the expressions of drug and alcohol metabolism associated enzymes and anti-oxidant enzymes were increased but apoptosis was decreased. Therefore, the method for the treatment of retinoic acid to the hepatocytes differentiated from human stem cells were confirmed to be efficiently used as a method for improving drug metabolism function of the human stem cell-derived hepatocytes.
[0094] Practical and presently preferred embodiments of the present invention are illustrative as shown in the following Examples.
[0095] However, it will be appreciated that those skilled in the art, on consideration of this disclosure, may make modifications and improvements within the spirit and scope of the present invention.
Example 1: Induction of the Differentiation of Human Embryonic Stem Cells into Hepatocytes
[0096] CHA15 (human embryonic stem cell line, CHA Research Institute) was maintained according to the standard protocol. The human embryonic stem cells were cultured with feeder cells on the plate coated with matrigel (BD biosciences) for 56 days. The culture medium was RPMI 1640 (Welgene, Korea), which was replaced every 24 hours. The colony of the human embryonic stem cells was cut into 69 pieces. The cell mass was placed on the plate coated with matrigel but not containing feeder cells, followed by culture in a 37 C. incubator for 72 hours. It was the step of stabilization. After confirming the growth of the human embryonic stem cell colony, other cell fractions and culture fluid were eliminated therefrom by pipetting. The colony was differentiated into endoderm by using RPMI 1640 supplemented with 50B27 (Gibco), and 50 ng/uL of activin A for 05 days. The culture medium was replaced with fresh RPMI 1640 every 24 hours. The differentiated cells were further differentiated into hepatocytes in RPMI supplemented with 50B27, 100 ng/uL of fibroblast growth factor-4, and 50 ng/uL of (bone morphogenetic protein-2 for 510 days. Then, 50 ng/uL of hepatocyte growth factor (HGF; Peprotech) was added to high concentration culture fluid bulletkit, followed by culture for 1015 days. 50 ng/uL of oncostatin M and 1 mM dexametasone were added to the high concentration culture fluid, followed by culture for 1519 days to induce maturation of the hepatocytes. The culture medium in every differentiation stage was replaced every 24 hours. The primary human hepatocytes were maintained in DMEM containing a low concentration of glucose at 37 C. with 5% CO.sub.2 until use. To compare the function, the human hepatocytes (Lot no. Hu4246) obtained from a male at the age of 46 provided by Life Technologies Gibco (USA) as frozen were used.
Example 2: Test Animal Care
[0097] The wild type (WT) male C57BL/6 mouse was purchased from Jackson Laboratory (USA). The mouse with metabolic disorder so as not to metabolize retinol into retinoic acid (Raldh1.sup./) was prepared by the conventional method reported earlier. The animal was taken care of in a germ free animal facility at KAIST (Korea Advanced Institute of Science and Technology). The animal was taken care of according to the guide for the care and use of laboratory animals provided by NIH (National Institute of Health). All the experimental stages with the animal were approved by animal care and use committee at KAIST.
Example 3: Separation of Hepatic Stellate Cells (mHSCs) from the Test Mouse
[0098] Hepatic stellate cells were separated from the wild type (WT) mouse and the Raldh1.sup./ mouse of Example 2.
[0099] Particularly, a mouse at the body weight of 3034 g was anesthetized with 30 mg/kg of sodium pentobarbital via intraperitoneal injection. A tube was inserted in portal vein in a germ free condition. The liver was perfused with EGTA (ethylene glycol-bis(-aminoethyl ester)-N,N,N, N-tetraacetic acid) solution (5.4 mmol/L of KCl, 0.44 mmol/L of KH.sub.2PO.sub.4, 140 mmol/L of NaCl, 0.34 mmol/L of Na.sub.2HPO.sub.4, 0.5 mmol/L of EGTA, and 25 mmol/L of Tricine, pH 7.2) and HBSS (Hanks' Balanced Salt solution, Sigma-Aldrich, USA), followed by degradation with HBSS containing 0.075% type I collagenase (Warthington). For the separation, the liver cells were cultured on the plate coated with rat-tail collagen containing DMEM (Gibco-BRL) supplemented with 10% FBS until the confluence reached 6070%. To separate mouse hepatic stellate cells (mHSCs), EGTA solution was added to the mouse liver in situ, then the liver was perfused with perfusion buffer and lysis buffer (HBSS containing 0.02% DNase I and 0.009% collagenase type I) at 37 C. for 2030 minutes. The obtained cell suspension was filtered by 70 um cell strainer, followed by centrifugation at room temperature for 5 minutes at 420 rpm to eliminate liver cells. The supernatant was washed and resuspended in HBSS, which was then loaded in 11.5% OptiPrep. Centrifugation was performed at 4 for 15 minutes at 1400 g. Then, hepatic stellate cells were obtained from interface. The fat globule containing retinol was clearly observed in the isolated hepatic stellate cells.
Experimental Example 1: Comparison Between Human Embryonic Stem Cell-Derived Hepatocytes (hES-Hep) and Human Hepatocytes (Human-Hep)
[0100] <1-1> Morphological Comparison
[0101] The morphology was compared between the hepatocytes differentiated from human embryonic stem cells (hES-Hep) prepared by the same manner as described in Example 1 and human hepatocytes (human-Hep) by the observation under optical microscope.
[0102] As a result, as shown in
[0103] <1-2> Comparison of Gene Expression
[0104] The gene expression in the hepatocytes differentiated from human embryonic stem cells (hES-Hep) prepared by the same manner as described in Example 1 was compared with that of adult hepatocytes.
[0105] Particularly, RNA was extracted from the human embryonic stem cell-derived hepatocytes and the adult hepatocytes. Each chip was hybridized with each pool and illumina human HT-12 (v3) beadchip was treated at KRIBB (Korea Research Institute of Bioscience & Biotechnology). Statistical analysis of the microarray was performed by using the free software R obtainable at http://www.r-project.org/. Heat map was made by standardizing the log gene expression level (0 indicates the standard error) by color-coding genewise. The diagram was made by using the matrix2png program (http://www.chibi.ubc.ca/matrix2png/).
[0106] As a result, as shown in
[0107] <1-3> Comparison of Drug or Alcohol Metabolism Associated Enzyme Expression
[0108] Gene expression pattern was compared between adult-Hep and Fetal-Hep and between Fetal liver and hES-Hep, in order to compare the expression pattern of drug or alcohol metabolism associated enzymes.
[0109] Particularly, total RNA was extracted from the adult Hep, Fetal-Hep, and human embryonic stem cell-derived hepatocytes by using Trizol reagent (Invitrogen), followed by cDNA synthesis by using amfi-rivert II cDNA synthesis Master Mix (Gendepot) according to the manufacturer's protocol. Genes in interest were amplified from the transcript by using the primers listed in the Table 1 below by using SYBR green real-time PCR master mix (Toyobo, Japan). The real-time PCR was performed by using Bio-rad CFX96 real-time PCR detection system (Bio-rad). The gene expression level was calculated by Ct method and by using -actin as a denominator of the gene expression. Compared with the control gene expression, the obtained value was presented as fold change.
TABLE-US-00001 TABLE1 Name Size Forward Reverse ADH1a 102 AGTCATCCCACTCGCTATTCC GTCCCCTGAGGATTGCTTACA (SEQ.ID.NO:1) (SEQ.ID.NO:2) ADH1b 224 CCCGGAGAGCAACTACTGC AACCAGTCGAGAATCCACAGC (SEQ.ID.NO:3) (SEQ.ID.NO:4) ADH1c 223 CTCGCCCCTGGAGAAAGTC GGCCCCCAACTCTTTAGCC (SEQ.ID.NO:5) (SEQ.ID.NO:6) ALDH2 196 TCGGCTACATCAACACGG TCTCCCAACAACCTCCTCT (SEQ.ID.NO:7) (SEQ.ID.NO:8) CYP2E1 67 GCAAGAGATGCCCTACATGGA GGGCACGAGGGTGATGAA (SEQ.ID.NO:9) (SEQ.ID.NO:10) CYP2C9 137 CCTCTGGGGCATTATCCATC ATATTTGCACAGTGAAACATAGGA (SEQ.ID.NO:11) (SEQ.ID.NO:12) CYP2D6 289 CTAAGGGAACGACACTCATCAC CTCACCAGGAAAGCAAAGACAC (SEQ.ID.NO:13) (SEQ.ID.NO:14) CYP3A4 78 CAGGAGGAAATTGATGCAGTTTT GTCAAGATACTCCATCTGTAGCACAGT (SEQ.ID.NO:15) (SEQ.ID.NO:16) Catalase 129 GTTACTCAGGTGCGGGCATTCTAT GAAGTTCTTGACCGCTTTCTTCTG (SEQ.ID.NO:17) (SEQ.ID.NO:18) Mn-SOD 369 CTCCCCGACCTGCCCTACGACTAC AAACCAAGCCAACCCCAACCTGAG (SEQ.ID.NO:19) (SEQ.ID.NO:20) b-actin 285 AGCGAGCATCCCCCAAAGTT GGGCACGAAGGCTCATCATT (SEQ.ID.NO:21) (SEQ.ID.NO:22)
[0110] As a result, as shown in
Experimental Example 2: Effect of the Co-Culture of Mouse Hepatic Stellate Cells with Human Embryonic Stem Cell-Derived Hepatocytes
[0111] <2-1> Co-Culture of Mouse Hepatic Stellate Cells with Human Embryonic Stem Cell-Derived Hepatocytes
[0112] Mouse hepatic stellate cells were co-cultured with human embryonic stem cell-derived hepatocytes.
[0113] Particularly, as shown in
[0114] <2-2> Investigation of Liver Cell Damage after the Co-Culture of Mouse Hepatic Stellate Cells with Human Embryonic Stem Cell-Derived Hepatocytes
[0115] After the co-culture of mouse hepatic stellate cells with human embryonic stem cell-derived hepatocytes, the levels of AST (aspartate aminotransferase), ALT (alanine aminotransferase), and LDH (lactate dehydrogenase) were measured in order to investigate liver cell damage.
[0116] Particularly, mouse hepatic stellate cells were co-cultured with human embryonic stem cell-derived hepatocytes by the same manner as described in Experimental Example <2-1>. Then, the medium was collected and liver cell damage was investigated. The levels of AST, ALT, and LDH were analyzed by using the kit purchased from IDEX Laboratories (USA).
[0117] As a result, as shown in
[0118] <2-3> Investigation of Apoptosis after the Co-Culture of Human Embryonic Stem Cell-Derived Hepatocytes with Mouse Hepatic Stellate Cells
[0119] Human embryonic stem cell-derived hepatocytes were co-cultured with mouse hepatic stellate cells. Then, TUNEL assay was performed to investigate apoptosis therein.
[0120] Particularly, human embryonic stem cell-derived hepatocytes were co-cultured with mouse hepatic stellate cells by the same manner as described in Experimental Example <2-1>. Then, the cells were treated with ethanol, followed by fixation with 4% paraformaldehyde. The fixed cells were treated with 100% methanol (Merck, Millipore) for 15 minutes in order for them to be permeabilized. Apoptosis was investigated by using In Situ Cell Death Detection Kit (Fluorescence, Roche). Nucleus of the cell was stained with DAPI, followed by visualization using Leica DMI 4000B automatic vertical microscope system (Germany) equipped with Leica EL6000 and Leica CTR 4000 CCD camera. Computer assisted images were analyzed with Leica Application Suite Advanced Fluorescence (LAS AF, Leica).
[0121] As a result, as shown in
[0122] <2-4> Investigation of Gene Expression Pattern in Human Embryonic Stem Cell-Derived Hepatocytes Co-Cultured with Mouse Hepatic Stellate Cells
[0123] Human embryonic stem cell-derived hepatocytes were co-cultured with mouse hepatic stellate cells, followed by investigation of the expressions of alcohol metabolism associated enzymes, drug metabolism associated enzymes, and anti-oxidant enzymes.
[0124] Particularly, human embryonic stem cell-derived hepatocytes were co-cultured with mouse hepatic stellate cells by the same manner as described in Experimental Example <2-1>, and then the cells were treated with ethanol. Real-time PCR was performed by using the primers listed in Table 1 by the same manner as described in Experimental Example <1-3> in order to investigate the expression patterns of alcohol metabolism associated enzymes (ADH1b, ADH1c and CYP2E1), drug metabolism associated enzymes (CYP2C9, CYP2D6 and CYP3A4), and anti-oxidant enzymes (catalase and Mn-SOD).
[0125] As a result, as shown in
[0126] <2-5> Investigation of Protein Expression Pattern in Human Embryonic Stem Cell-Derived Hepatocytes Co-Cultured with Mouse Hepatic Stellate Cells
[0127] Human embryonic stem cell-derived hepatocytes were co-cultured with mouse hepatic stellate cells. Then, the expressions of alcohol metabolism associated enzymes, drug metabolism associated enzymes, and anti-oxidant enzymes were investigated.
[0128] Particularly, human embryonic stem cell-derived hepatocytes were co-cultured with mouse hepatic stellate cells by the same manner as described in Experimental Example <2-1>. Then, the cells were treated with ethanol. The cells were homogenized with RIPA buffer (30 mmol/L of Tris pH 7.5, 150 mmol/L of sodium chloride, 1 mmol/L of PMSF (phenylmethylsulfonyl fluoride), 1 mmol/L of sodium orthovanadate, 1% NP-40 (nonidet p-40), 10% glycerol, phosphatase inhibitor, and protease inhibitor) to extract protein. 5080 g of the obtained protein was loaded on SDS-PAGE. The protein was then transferred onto nitrocellulose membrane. The protein expression was investigated by reacting the membrane with the primary antibodies such as anti--actin (Sigma-Aldrich), anti--CYP2E1 (Millipore), anti-CYP3A4, anti-catalase (Cell signaling, USA), anti-ADH1, and anti-Mn-SOD (Santa-Cruz) antibodies. Alkaline phosphate conjugated anti-rabbit antibody was used as the secondary antibody. The protein expression was examined by using PhosphoImager (GE Healthcare, USA) and ECL detection system.
[0129] As a result, as shown in
[0130] <2-6> Immunocytochemistry with Human Embryonic Stem Cell-Derived Hepatocytes Co-Cultured with Mouse Hepatic Stellate Cells
[0131] Human embryonic stem cell-derived hepatocytes were co-cultured with mouse hepatic stellate cells, followed by immunofluorescence to investigate the expression of CYP2E1, the alcohol metabolism associated enzyme.
[0132] Particularly, human embryonic stem cell-derived hepatocytes were co-cultured with mouse hepatic stellate cells by the same manner as described in Experimental Example <2-1>. The cells were treated with ethanol and then fixed with 4% paraformaldehyde. The fixed cells were treated with 100% methanol (Merck, Millipore) for 15 minutes in order for them to be permeabilized. Blocking was performed by treating the cells with 5% goat serum at 37 C. for 1 hour. The cells were stained with anti-CYP2E1 antibody (Millipore, Germany). Nucleus of the cell was stained with DAPI, followed by visualization using Leica DMI 4000B automatic vertical microscope system (Germany) equipped with Leica EL6000 and Leica CTR 4000 CCD camera. Computer assisted images were analyzed with Leica Application Suite Advanced Fluorescence (LAS AF, Leica).
[0133] As a result, as shown in
[0134] <2-7> Investigation of the Activity of Anti-Oxidant Enzyme in Human Embryonic Stem Cell-Derived Hepatocytes Co-Cultured with Mouse Hepatic Stellate Cells
[0135] Human embryonic stem cell-derived hepatocytes were co-cultured with mouse hepatic stellate cells. Then, the activities of catalase and Mn-SOD, the anti-oxidant enzymes, were investigated.
[0136] Particularly, human embryonic stem cell-derived hepatocytes were co-cultured with mouse hepatic stellate cells by the same manner as described in Experimental Example <2-1>. Then, the enzyme activities of catalase and Mn-SOD were examined. The enzyme activities were measured by using a specific enzyme activity analyzing kit. The catalase analysis kit and the SOD activity analysis kit (Colorimetric, Abcam) were used according to the manufacturer's protocol.
[0137] As a result, as show in
[0138] Based on the above results, it was confirmed that the method of co-culturing the hepatocytes with mouse hepatic stellate cells was effective in increasing the expressions of drug metabolism and alcohol metabolism associated enzymes in human embryonic stem cell-derived hepatocytes.
[0139] <2-8> Investigation of Gene Expression Pattern in Human Embryonic Stem Cell-Derived Hepatocytes Co-Cultured with Mouse Hepatic Stellate Cells
[0140] Human embryonic stem cell-derived hepatocytes were co-cultured with mouse hepatic stellate cells. Then, the gene expression pattern was investigated.
[0141] Particularly, human embryonic stem cell-derived hepatocytes were co-culture with mouse hepatic stellate cells by the same manner as described in Experimental Example <2-1>. And real-time PCR was performed by using the primers listed in Table 2 by the same manner as described in Experimental Example <3-1>. Then, the expressions of retinoid metabolism associated genes (LRAT, ADH3, and Raldh1), retinoid migration associated genes (RBP1 and CRABP1), and growth factor genes (HGF and IGF-1) were investigated.
TABLE-US-00002 TABLE2 Name Size Forward Reverse B-actin 148 AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT (SEQ.ID.NO:21) (SEQ.ID.NO:22) LRAT 370 CTGACCAATGACAAGGAACGCACTC CTAATCCCAAGACAGCCGAAGCAAGA (SEQ.ID.NO:23) (SEQ.ID.NO:24) ADH3 215 GTGGGAGTAGCTGCTTCAGG GTGCATCAGATCAAAGGCTTG (SEQ.ID.NO:25) (SEQ.ID.NO:26) ALDH1A1 248 GCTCAAGACAGTCGCAATGA TGGATAAGAACTGGGGTCACA (SEQ.ID.NO:27) (SEQ.ID.NO:28) Rbp1 155 CAGTGTGTGCAGAAGGGAGA AGGTTATCTCCTCGGGCTGT (cellular) (SEQ.ID.NO:29) (SEQ.ID.NO:30) Crabp1 223 CTTACTGGACCCGAGAGCTG GGAAAATGGGGTTGCCTAAT (SEQ.ID.NO:31) (SEQ.ID.NO:32) HGF 236 TTCCCAGCTGGTCTATGGTC TGGTGCTGACTGCATTTCTC (Hepatocyte (SEQ.ID.NO:33) (SEQ.ID.NO:34) growthfactor) IGF-1 220 CACATCATGTCGTCTTCACACC GGAAGCAACACTCATCCACAATG (SEQ.ID.NO:35) (SEQ.ID.NO:36)
[0142] As a result, as shown in
[0143] From the above results, it was confirmed that retinol preservation in hepatic stellate cells was decreased but instead retinol was metabolized into retinoic acid by Raldh1, which was conjugated with CRABP1 and then migrated into human embryonic stem cell-derived hepatocytes so that it reacted with retinoic acid nucleus receptor to affect the expressions of metabolism associated enzymes in the hepatocytes.
Experimental Example 3: Confirmation of the Importance of Retinoic Acid Metabolism in Human Embryonic Stem Cell-Derived Hepatocytes Co-Cultured with Mouse Hepatic Stellate Cells
[0144] <3-1> Investigation of Liver Cell Damage in Human Embryonic Stem Cell-Derived Hepatocytes Co-Cultured with Mouse Hepatic Stellate Cells
[0145] Human embryonic stem cell-derived hepatocytes were co-cultured with the mouse hepatic stellate cells separated from the liver of a wild type (WT) mouse and a genetically engineered mouse with retinoic acid metabolism deficiency (Raldh1.sup./) so that it could not metabolize retinol into retinoic acid. Then, the levels of AST (aspartate aminotransferase), ALT (alanine aminotransferase), and LDH (lactate dehydrogenase) were measured to confirm liver damage.
[0146] Particularly, mouse hepatic stellate cells were isolated from a mouse by the same manner as described in Example 3. Human embryonic stem cell-derived hepatocytes were co-cultured with the prepared mouse hepatic stellate cells by the same manner as described in Experimental Example <2-1> for 24 hours. The cells were treated with 0.2 M EtOH, followed by further culture for 24 hours. The medium was collected and liver cell damage was measured. The levels of AST, ALT, and LDH were analyzed by using a kit purchased from IDEXX Laboratories (USA).
[0147] As a result, as shown in
[0148] <3-2> Investigation of Gene Expression Pattern in Human Embryonic Stem Cell-Derived Hepatocytes Co-Cultured with Mouse Hepatic Stellate Cells
[0149] Human embryonic stem cell-derived hepatocytes were co-cultured with the mouse hepatic stellate cells separated from the liver of a wild type (WT) mouse and a genetically engineered mouse with retinoic acid metabolism deficiency (Raldh1.sup./) so that it could not metabolize retinol into retinoic acid. Then, the gene expressions of alcohol metabolism associated enzymes, drug metabolism associated enzymes, and anti-oxidant were investigated.
[0150] Particularly, mouse hepatic stellate cells were isolated from a mouse by the same manner as described in Example 3. Human embryonic stem cell-derived hepatocytes were co-cultured with the prepared mouse hepatic stellate cells by the same manner as described in Experimental Example <2-1> for 24 hours. The cells were treated with ethanol. Then, real-time PCR was performed with the ethanol treated cells by using the primers listed in Table 1 by the same manner as described in Experimental Example <1-3> to investigate the expressions of alcohol metabolism associated enzymes (ADH1a, ADH1b, ADH1c, ALDH2, and CYP2E1), drug metabolism associated enzymes (CYP2D6 and CYP3A4), and anti-oxidant enzymes (catalase and Mn-SOD).
[0151] As a result, as shown in
<3-3> Investigation of Protein Expression in Human Embryonic Stem Cell-Derived Hepatocytes Co-Cultured with Mouse Hepatic Stellate Cells
[0152] Human embryonic stem cell-derived hepatocytes were co-cultured with the mouse hepatic stellate cells separated from the liver of a wild type (WT) mouse and a genetically engineered mouse with retinoic acid metabolism deficiency (Raldh1.sup./) so that it could not metabolize retinol into retinoic acid. Then, the protein expressions of alcohol metabolism associated enzymes, drug metabolism associated enzymes, and anti-oxidant were investigated.
[0153] Particularly, mouse hepatic stellate cells were isolated from a mouse by the same manner as described in Example 3. Human embryonic stem cell-derived hepatocytes were co-cultured with the prepared mouse hepatic stellate cells by the same manner as described in Experimental Example <2-1>. Then, the cells were treated with ethanol. The cells were homogenized with RIPA buffer (30 mmol/L of Tris pH 7.5, 150 mmol/L of sodium chloride, 1 mmol/L of PMSF (phenylmethylsulfonyl fluoride), 1 mmol/L of sodium orthovanadate, 1% NP-40 (nonidet p-40), 10% glycerol, phosphatase inhibitor, and protease inhibitor) to extract protein. 5080 g of the obtained protein was loaded on SDS-PAGE. The protein was then transferred onto a nitrocellulose membrane. The protein expression was investigated by reacting the membrane with the primary antibodies such as anti--actin (Sigma-Aldrich), anti--CYP2E1 (Millipore), anti-CYP3A4, anti-catalase (Cell signaling, USA), anti-ADH1, and anti-Mn-SOD (Santa-Cruz) antibodies. Alkaline phosphate conjugated anti-rabbit antibody was used as the secondary antibody. The protein expression was examined by using PhosphoImager (GE Healthcare, USA) and ECL detection system.
[0154] As a result, as shown in
[0155] <3-4> Investigation of the Retinol Associated Gene Expression in Human Embryonic Stem Cell-Derived Hepatocytes Co-Cultured with Mouse Hepatic Stellate Cells
[0156] Human embryonic stem cell-derived hepatocytes were co-cultured with the mouse hepatic stellate cells separated from the liver of a wild type (WT) mouse and a genetically engineered mouse with retinoic acid metabolism deficiency (Raldh1.sup./) so that it could not metabolize retinol into retinoic acid. Then, the retinol associated enzyme gene expression was investigated.
[0157] Particularly, mouse hepatic stellate cells were isolated from a mouse by the same manner as described in Example 3. Human embryonic stem cell-derived hepatocytes were co-cultured with the prepared mouse hepatic stellate cells by the same manner as described in Experimental Example <2-1>. Then, the cells were treated with ethanol. Real time PCR was performed with the cells by the same manner as described in Experimental Example <1-3> in order to investigate the gene expressions of the enzymes associated with retinol metabolism (LRAT and ADH3), retinol movement (RBP1), and retinoic acid movement (CRABP1).
[0158] As a result, as shown in
Experimental Example 4: Effect by the Treatment of Retinoic Acid
[0159] <4-1> Gene Expression after the Treatment of Retinoic Acid
[0160] Human embryonic stem cell-derived hepatocytes were treated with retinoic acid, followed by investigation of the gene expressions of alcohol metabolism associated enzymes, drug metabolism associated enzymes, and anti-oxidant enzymes.
[0161] Particularly, the human embryonic stem cell-derived hepatocytes differentiated by the same manner as described in Example 1 were treated with 1 ump all-trans retinoic acid or 9-cis-retinoic acid, followed by culture for 1224 hours. Then, real time PCR was performed by the same manner as described in Experimental Example <13> in order to examine the expressions of alcohol metabolism associated enzymes (AHD1a, ADH1b, ADH1c, and CYP2E1), drug metabolism associated enzymes (CYP2C9, CYP2D6, and CYP3A4), and anti-oxidant enzymes (catalase and Mn-SOD).
[0162] As a result, as shown in
[0163] <4-2> Gene Expression after the Treatment of Retinoic Acid and Ethanol
[0164] Human embryonic stem cell-derived hepatocytes were treated with retinoic acid and ethanol, followed by investigation of the gene expressions of alcohol metabolism associated enzymes, drug metabolism associated enzymes, and anti-oxidant enzymes.
[0165] Particularly, the human embryonic stem cell-derived hepatocytes differentiated by the same manner as described in Example 1 were treated with 1 ump all-trans retinoic acid and 0.2 M EtOH, followed by culture for 24 hours. Then, real time PCR was performed by the same manner as described in Experimental Example <1-3> in order to examine the expressions of alcohol metabolism associated enzymes (AHD1a, ADH1b, ADH1c, and CYP2E1) and anti-oxidant enzymes (catalase and Mn-SOD).
[0166] As a result, as shown in
[0167] <4-3> Immunocytochemistry after the Treatment of Retinoic Acid
[0168] Human embryonic stem cell-derived hepatocytes were treated with retinoic acid, followed by immunofluorescence in order to examine the expression of CYP2E1, the alcohol metabolism associated enzyme.
[0169] Particularly, the human embryonic stem cell-derived hepatocytes differentiated by the same manner as described in Example 1 were treated with 1 ump all-trans retinoic acid and 0.2 M EtOH, followed by culture for 24 hours. The cells were fixed with 4% paraformaldehyde. The fixed cells were treated with 100% methanol (Merck, Millipore) for 15 minutes in order for them to be permeabilized. Blocking was performed by treating the cells with 5% goat serum at 37 C. for 1 hour. The cells were stained with anti-CYP2E1 antibody (Millipore, Germany). Nucleus of the cell was stained with DAPI, followed by visualization using Leica DMI 4000B automatic vertical microscope system (Germany) equipped with Leica EL6000 and Leica CTR 4000 CCD camera. Computer assisted images were analyzed with Leica Application Suite Advanced Fluorescence (LAS AF, Leica).
[0170] As a result, as shown in
[0171] <4-4> Investigation of Apoptosis after the Treatment of Retinoic Acid
[0172] Human embryonic stem cell-derived hepatocytes were treated with retinoic acid. Then, TUNEL assay was performed to investigate apoptosis therein.
[0173] Particularly, the human embryonic stem cell-derived hepatocytes differentiated by the same manner as described in Example 1 were treated with 1 uM all-trans retinoic acid and 0.2 M EtOH, followed by culture for 24 hours. The cells were fixed with 4% paraformaldehyde. The fixed cells were treated with 100% methanol (Merck, Millipore) for 15 minutes in order for them to be permeabilized. Apoptosis was investigated by using In Situ Cell Death Detection Kit (Fluorescence, Roche). Nucleus of the cell was stained with DAPI, followed by visualization using Leica DMI 4000B automatic vertical microscope system (Germany) equipped with Leica EL6000 and Leica CTR 4000 CCD camera. Computer assisted images were analyzed with Leica Application Suite Advanced Fluorescence (LAS AF, Leica).
[0174] As a result, as shown in
[0175] From the above results, it was confirmed that the expressions of drug and alcohol metabolism associated enzymes and anti-oxidant enzymes were increased in the human embryonic stem cell-derived hepatocytes treated with retinoic acid, indicating that alcohol metabolism was accordingly accelerated to inhibit the toxic effect. Therefore, the increase of the expressions of those liver enzymes associated with drug and alcohol metabolism and anti-oxidation was confirmed.
[0176] Those skilled in the art will appreciate that the conceptions and specific embodiments disclosed in the foregoing description may be readily utilized as a basis for modifying or designing other embodiments for carrying out the same purposes of the present invention. Those skilled in the art will also appreciate that such equivalent embodiments do not depart from the spirit and scope of the invention as set forth in the appended Claims.