INCREASING HYBRID SEED PRODUCTION THROUGH HIGHER OUTCROSSING RATE IN CYTOPLASMIC MALE STERILE RICE AND RELATED MATERIALS AND METHODS
20180160638 ยท 2018-06-14
Assignee
Inventors
- Kshirod K. Jena (Cuttack, IN)
- Balram Marathi (Hyderabad, IN)
- Joie Ramos (Los Banos, PH)
- Reynaldo DIOCTON IV (Samar, PH)
- Ricky Vinarao (Los Banos, PH)
- G.D. PARHALADA (Sira, IN)
- Sung-Ryul Kim (Ulsan, KR)
Cpc classification
International classification
A01H1/04
HUMAN NECESSITIES
A01H1/02
HUMAN NECESSITIES
Abstract
Methods for increasing hybrid seed production are provided. Increased hybrid seed production is achieved through higher outcrossing rates in cytoplasmic male sterile (CMS) lines of rice by introgressing the long stigma trait of Oryza longistaminata. CMS lines having higher outcrossing rates capable of high hybrid seed set are also provided.
Claims
1. A cultivated rice plant comprising an introgression including at least one Oryza longistaminata quantitative trait locus (QTL) associated with stigma length, the cultivated rice plant having an out-crossing rate of at least 60%.
2. A cultivated rice plant comprising an introgression including at least one Oryza longistaminata quantitative trait locus (QTL) associated with stigma length selected from the group consisting of: qSTGL8-1 and qSTGL8-2.
3. The rice plant of claim 1 being cytoplasmic male sterile line.
4. The rice plant of claim 1 being a maintainer line.
5. The rice plant of claim 2 having an out-crossing rate of at least 60%.
6. The rice plant of claim 1, comprising at least an additional introgression including at least one Oryza longistaminata QTL associated with stigma length, stigma area, style length, stigma breadth or total pistil length.
7. The rice plant of claim 6, wherein said at least one Oryza longistaminata QTL associated with stigma length, stigma area, style length, stigma breadth and pistil length is selected from the group consisting of qSTGL2-1, qSTGL5-1, qSTGL11-1, qSTGL11-2; qSTGA8-2; qSTYL1-1, qSTYL5-2, qSTYL8-1; qSTGB1-1, qSTGB3-1; qPSTL1-1, qPSTL1-3 and qPSTL11-1.
8. The rice plant of claim 6, wherein a marker of said at least one additional QTL is selected from the group consisting of stigma length, RM110 (qSTGL2-1), RM421 (qSTGL5-1), RM7356 (qSTGL8-1), RM5353 (qSTGL8-1), RM256 (qSTGL8-2), RM80 (qSTGL8-2), RM590 (qSTGL11-1), RM286 (qSTGL11-1), RM 120(qSTGL11-2); RM229 (qSTGL11-2); stigma area, RM80 (qSTGA8-2); style length, RM319 (qSTYL1-1), RM7653 (qSTYL5-2), RM404 (qSTYL8-1); stigma breadth, RM403 (qSTGB1-1), RM3525 (qSTGB3-1); and pistil length, RM3604 (qPSTL1-1); RM3640 (qPSTL1-3); and RM5997 (qPSTL11-1).
9. The rice plant of claim 1, wherein at least one marker for said QTL associated with stigma length is selected from the group consisting of PA08-03, RM7356, PA08-17 and PA08-18.
10. The rice plant of claim 1, said introgression comprising QTL associated with stigma length is positioned between markers PA08-03 to RM7356 or PA08-17 to PA08-18.
11. The rice plant of claim 3, being of a line selected from the group consisting of IR68897A, IR58025A, IR127841A and IR127842A.
12. A hybrid rice plant having the rice plant of claim 1 as a parent or an ancestor.
13. A processed product comprising DNA of the rice plant of claim 1.
14. (canceled)
15. The processed product of claim 13, being a meal.
16-17. (canceled)
18. A tissue culture produced from protoplasts or cells from the rice plant of claim 1, wherein the protoplasts or cells of the tissue culture are produced from a plant part selected from the group consisting of: leaves; pollen; embryos; cotyledon; hypocotyls; meristematic cells; roots; root tips; pistils; anthers; flowers; stems; glumes; and panicles.
19. (canceled)
20. The rice plant of claim 1, wherein a long stigma trait of Oryza longistaminata is detected in the rice plant by detecting at least one marker for at least one Oryza longistaminata quantitative trait locus associated with stigma length and/or associated with total stigma and style length.
21. The rice plant of claim 20, wherein the at least one marker for the at least one Oryza longistaminata quantitative trait locus associated with stigma length is selected from the group consisting of: RM110 (qSTGL2-1), RM421 (qSTGL5-1), RM7356 (qSTGL8-1), RM5353 (qSTGL8-1), RM256 (qSTGL8-2), RM80 (qSTGL8-2), RM590 (qSTGL11-1), RM286 (qSTGL11-1), RM 120(qSTGL11-2) and RM229 (qSTGL11-2).
22. The rice plant of claim 20, wherein the at least one Oryza longistaminata quantitative trait locus associated with total stigma and style length is selected from the group consisting of: qPSTL1-1, qPSTL1-3, and qPSTL11-1.
23. The rice plant of claim 20, wherein the at least one marker for the at least one Oryza longistaminata quantitative trait locus associated with total stigma and style length is selected from the group consisting of: RM3604 (qPSTL1-1); RM3746 (qPSTL1-1); RM3640 (qPSTL1-3); RM8134 (qPSTL1-3); and RM5997 (qPSTL11-1); RM254 (qPSTL11-1).
24. A method of producing a cytoplasmic male sterile rice plant comprising a long stigma trait of Oryza longistaminata, the method comprising crossing a rice plant of a stable cytoplasmic male sterile line with a rice plant of a suitable maintainer line, wherein the suitable maintainer line is a fertile rice line complementary to the cytoplasmic male sterile line, and wherein the rice plant of the maintainer line comprising an introgression including at least one Oryza longistaminata quantitative trait locus (QTL) associated with stigma length selected from the group consisting of: qSTGL8-1 and qSTGL8-2.
25-41. (canceled)
42. The cytoplasmic male sterile rice plant comprising a long stigma trait of Oryza longistaminata of claim 1, wherein the cytoplasmic male sterile rice plant comprising a long stigma trait of Oryza longistaminata has an enhanced outcrossing rate relative to a cytoplasmic male sterile rice plant that does not comprise a long stigma trait of Oryza longistaminata.
43. The cytoplasmic male sterile rice plant of claim 42, wherein the enhanced outcrossing rate presents as an increase in maximum percent of seed set.
44. The cytoplasmic male sterile rice plant of claim 43, wherein the increase in maximum percent of seed set is selected from the group consisting of: a 2.5-fold increase; a 5-fold increase; a 10-fold increase; a 15-fold increase; a 20-fold increase; a 25-fold increase; a 30-fold increase; a 35-fold increase; a 40-fold increase; a 45-fold increase; a 50-fold increase; a 55-fold increase; a 60-fold increase; a 65-fold increase; a 70-fold increase; a 75-fold increase; an 80-fold increase; and an 85-fold increase.
45. A method for increasing hybrid seed set in a rice plant comprising: providing a cytoplasmic male sterile rice plant comprising a long stigma trait of Oryza longistaminata; pollinating the cytoplasmic male sterile rice plant comprising a long stigma trait of Oryza longistaminata with pollen of a suitable restorer rice line; and enhancing hybrid rice seed set on the cytoplasmic male sterile rice plant comprising a long stigma trait of Oryza longistaminata relative to a cytoplasmic male sterile rice plant not having the long stigma trait of Oryza longistaminata.
46. The method of claim 45, wherein the suitable restorer rice line is any rice line capable of pollinating the cytoplasmic male sterile rice plant comprising a long stigma trait of Oryza longistaminata to produce fertile hybrid seeds.
47. A method for producing hybrid rice seed comprising: carrying out the method of claim 45; and collecting hybrid rice seed set on the cytoplasmic male sterile rice plant comprising the long stigma trait of Oryza longistaminata.
48. (canceled)
49. A method of producing rice meal, the method comprising: (a) growing and collecting seeds of the hybrid rice plant of claim 12; and (b) processing said seeds to meal.
Description
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWING(S)
[0073] Some embodiments of the invention are herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of embodiments of the invention. In this regard, the description taken with the drawings makes apparent to those skilled in the art how embodiments of the invention may be practiced.
[0074] In the drawings:
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION
[0095] The present invention, in some embodiments thereof, relates to rice plants with improved out-crossing rate, in particular embodiments of the invention relate to cytoplasmic male sterile rice plants with improved out-crossing rate and use thereof in the production of hybrid rice.
[0096] Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not necessarily limited in its application to the details set forth in the following description or exemplified by the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways.
Definitions
[0097] So that the invention may be more readily understood, certain terms are first defined.
[0098] As used herein, the term plant refers to an entire plant, its organs (i.e., leaves, stems, roots, flowers etc.), seeds, plant cells, and progeny of the same. The term plant cell includes without limitation cells within seeds, suspension cultures, embryos, meristematic regions, callus tissue, leaves, shoots, gametophytes, sporophytes, pollen, and microspores. According to a specific embodiment, the plant is a plant line.
[0099] According to a specific embodiment the plant line is an elite line. The phrase plant part refers to a part of a plant, including single cells and cell tissues such as plant cells that are intact in plants, cell clumps, and tissue cultures from which plants can be regenerated. Examples of plant parts include, but are not limited to, single cells and tissues from pollen, ovules, leaves, embryos, roots, root tips, anthers, flowers, fruits, stems, shoots, and seeds; as well as scions, rootstocks, protoplasts, calli, and the like. According to a specific embodiment, the plant part comprises the nucleic acid sequence conferring long stigma from Oryza longistaminata. According to a specific embodiment, the plant part is a seed. According to a specific embodiment, the plant part is a hybrid seed.
[0100] As used herein, the phrases progeny plant refers to any plant resulting as progeny from a vegetative or sexual reproduction from one or more parent plants or descendants thereof. For instance, a progeny plant can be obtained by cloning or selfing of a parent plant or by crossing two parental plants and include selfings as well as the F1 or F2 or still further generations. An F1 is a first-generation progeny produced from parents at least one of which is used for the first time as donor of a trait, while progeny of second generation (F2) or subsequent generations (F3, F4, and the like) are specimens produced from selfings, intercrosses, backcrosses, or other crosses of F1s, F2s, and the like. An F1 can thus be (and in some embodiments is) a hybrid resulting from a cross between two true breeding parents (i.e., parents that are true-breeding are each homozygous for a trait of interest or an allele thereof, e.g., in this case male sterile having long stigma as described herein and a restorer line), while an F2 can be (and in some embodiments is) a progeny resulting from self-pollination of the F1 hybrids.
[0101] As used herein the term cultivated Oryza plant refers to a cultivated grass species having a diploid genome, 2n=24 (AA genome). Examples of domesticated Oryza species include but are not limited to, Oryza sativa (Asian rice) or Oryza glaberrima (African rice). The term may be interchanged with the term rice.
[0102] Domesticated Oryza varieties contemplated herein according to exemplary embodiments refer to long grain, short grain, white, brown, red and black.
[0103] There are three main varieties of Oryza sativa:
[0104] Indica: The indica variety is long-grained, for example Basmati rice, grown notably on the Indian sub-continent.
[0105] Japonica: Japonica rice is short-grained and high in amylopectin (thus becoming sticky when cooked), and is grown mainly in more temperate or colder regions such as Japan.
[0106] Javanica: Javanica rice is broad-grained and grown in tropical climates.
[0107] Other major varieties include Aromatic and Glutinos.
[0108] According to a specific embodiment, the rice variety contemplated herein is Indica.
[0109] According to a specific embodiment, the rice variety contemplated herein is Japonica.
[0110] According to a specific embodiment, the rice variety contemplated herein is Indica basmatic.
[0111] Within each variety, there are many cultivars, each favored for particular purposes or regions. Any genetic background of domesticated Oryza e.g., Oryza sativa, can be used. Other varieties and germplasms which can be used according to the present teachings are selected from the group consisting of: IR64; Nipponbare; PM-36, PS 36, Lemont, S 27, Arkansas Fortuna, Sri Kuning, IR36, IR72, Gaisen Ibaraki 2, Ashoka 228, 1R74, NERICA 4, PS 12, Bala, Moroberekan, IR42, Akihikari, Nipponbare, IR20, IR56, IR66, NSIC Rc158, NSIC Rc222, and NSIC Rc238.
[0112] The term crossed or cross in the context of this invention means the fusion of gametes via pollination to produce progeny (i.e., cells, seeds or plants). The term encompasses both sexual crosses (the pollination of one plant by another) and selfing (self-pollination, i.e., when the pollen and ovule are from the same plant or from genetically identical plants).
[0113] Backcrossing is a process in which a breeder repeatedly crosses hybrid progeny back to one of the parents, for example, crossing a first generation hybrid F1 with one of the parental genotypes of the F1 hybrid. The parent to which the hybrid is backcrossed is the recurrent parent.
[0114] Marker assisted selection may be used to augment or replace the phenotypic selection (such as by the use of molecular markers of chromosome 8).
[0115] Regardless of the selection method, following trait selection and backcrossing the genome of the domesticated rice plant of the recurrent parent is recovered to at least 85%, at least 87%, at least 90%, at least 92%, at least 94%, at least 96%, or at least 98%. That is, the plant of the invention has a genome being at least 85%, e.g., 85-99.9% that of the recurrent parent e.g., Oryza sativa.
[0116] Also provided are such methods, wherein the recovery of the recurrent rice plant's genome (e.g., Oryza sativa) is between 92% and 97%.
[0117] As used herein, outcross and outcrossing refers to cross-pollinations with a plant of differing genetic constitution, as opposed to self-pollination i.e., selfing. Preferably, the two plants or of a same kind, e.g., rice, e.g., cultivated rice e.g., O. sativa of the same subspecies e.g., Japonica, Indica etc.
[0118] Outcrossing rate refers to the rate that a particular plant pollinates or is pollinated by another plant. This is in contrast to self pollination.
[0119] Improved outcrossing rate or increased outcrossing rate refers to at least 50%, 60%, 70%, 80%, 90%, 100% or even 120%, 130%, 150% 200%, 250%, 300% or even more increase in outcrossing rate as compared to that of a non-converted plant of the same genetic background. An exemplary embodiment is provided in Table 3 in which an increase of at least 2.3 fold is evident.
[0120] Thus, according to some embodiment of the invention, the rice plant of the invention is endowed with an out-crossing rate which is more than 100% compared non-converted plant.
[0121] As used herein the term heterosis refers to hybrid vigor, or outbreeding enhancement, that is the improved or increased function of any biological quality in a hybrid offspring. An offspring exhibits heterosis if its traits are enhanced as a result of mixing the genetic contributions of its parents.
[0122] According to a specific embodiment, the increased outcrossing rate is manifested by an increase in maximum percent of seed set that can be selected from the group consisting of: a 1.5-fold increase, 2-fold increase, 2.5-fold increase; a 5-fold increase; a 10-fold increase; a 15-fold increase; a 20-fold increase; a 25-fold increase; a 30-fold increase; a 35-fold increase; a 40-fold increase; a 45-fold increase; a 50-fold increase; a 55-fold increase; a 60-fold increase; a 65-fold increase; a 70-fold increase; a 75-fold increase; an 80-fold increase; and an 85-fold increase.
[0123] Yield describes the amount of grain produced by a plant or a group, or crop, of plants. Yield can be measured in several ways, e.g. t ha.sup.1, and average grain yield per plant in grams.
[0124] The term quantitative trait locus or QTL refers to a polymorphic genetic locus with at least two alleles that reflect differential expression of a continuously distributed phenotypic trait.
[0125] As used herein, introgression means the movement of one or more genes, or a group of genes, from one plant variety into the gene complex of another as a result of breeding methods (e.g. outcrossing). Introgression also refers to movement of a trait encoded by one or more genes, or a group of genes, from one plant variety into the another.
[0126] Converted refers to a plant that has been introgressed with a trait of another plant. According to some embodiments, the term refers to a plant introgressed with the long stigma trait of Oryza longistaminata. Introgression of the trait may result from introgression of one or more QTLs associated with the trait. For example a converted maintainer line is a maintainer line introgressed with the long stigma trait of Oryza longistaminata.
[0127] A plant having essentially all the physiological and morphological characteristics of a specified plant refers to a plant having the same general physiological and morphological characteristics, except for those characteristics derived from a particular converted gene or group of genes (e.g., long stigma). The following definitions are further explained in
[0128] As used herein stigma length refers to the total length consisting of brushy and non-brushy parts of the female reproductive organ which is pistil A QTL associated with stigma length is abbreviated as qSTGL.
[0129] As used herein stigma area refers to the length and breadth of stigma. A QTL associated with stigma area is abbreviated as qSTGA.
[0130] As used herein style length refers to the length of the stalk (filament) of the bifid stigma. A QTL associated with style length is abbreviated as qSTYL.
[0131] As used herein stigma breadth refers to the distance or measurement from side to side of stigma (brushy) part. A QTL associated with stigma breadth is abbreviated as qSTGB.
[0132] As used herein pistil length or total pistil length which are interchangeably used refers to the total stigma length and style length. Although the word pistil includes ovary, style and stigma, the ovary length is not significantly different between the normal lines and the converted lines, Hence, total stigma and style length as pistil length. A QTL associated with pistil length is abbreviated as qPSTL.
[0133] The term associated with or associated in the context of this invention refers to, for example, a QTL and a phenotypic trait (e.g., long stigma), that are in linkage disequilibrium, i.e., the QTL and the trait are found together in progeny plants more often than if the nucleic acid and phenotype segregated independently. The term marker or molecular marker or genetic marker refers to a genetic locus (a marker locus) used as a point of reference when identifying genetically linked loci such as a QTL.
[0134] A probe is an isolated nucleic acid to which is attached a conventional detectable label or reporter molecule, e.g., a radioactive isotope, ligand, chemiluminescent agent, or enzyme. Such a probe is complementary to a strand of a target nucleic acid, in the case of the present invention, to a strand of genomic DNA of the long stigma introgression from Oryza longistaminata, whether from a rice plant or from a sample that includes DNA from the rice plant (e.g., meal). Probes according to the present invention include not only deoxyribonucleic or ribonucleic acids but also polyamides and other probe materials that bind specifically to a target DNA sequence and can be used to detect the presence of that target DNA sequence.
[0135] Primers are isolated nucleic acids that are annealed to a complementary target DNA strand by nucleic acid hybridization to form a hybrid between the primer and the target DNA strand, then extended along the target DNA strand by a polymerase, e.g., a DNA polymerase. Primer pairs of the present invention refer to their use for amplification of a target nucleic acid sequence, e.g., by the polymerase chain reaction (PCR) or other conventional nucleic-acid amplification methods.
[0136] Probes and primers are generally 11 nucleotides or more in length, preferably 18 nucleotides or more, more preferably 24 nucleotides or more, and most preferably 30 nucleotides or more. Such probes and primers hybridize specifically to a target sequence under high stringency hybridization conditions. According to some embodiment, probes and primers according to the present invention have complete sequence similarity with the target sequence, although probes differing from the target sequence and that retain the ability to hybridize to target sequences may be designed by conventional methods.
[0137] Methods for preparing and using probes and primers are described, for example, in Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, ed. Sambrook et al., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989 (hereinafter, Sambrook et al., 1989); Current Protocols in Molecular Biology, ed. Ausubel et al., Greene Publishing and Wiley-Interscience, New York, 1992 (with periodic updates) (hereinafter, Ausubel et al., 1992); and Innis et al., PCR Protocols: A Guide to Methods and Applications, Academic Press: San Diego, 1990. PCR-primer pairs can be derived from a known sequence, for example, by using computer programs intended for that purpose such as Primer (Version 0.5, .COPYRGT. 1991, Whitehead Institute for Biomedical Research, Cambridge, Mass.).
[0138] The term specific for (a target sequence) indicates that a probe or primer hybridizes under stringent hybridization conditions only to the target sequence in a sample comprising the target sequence.
[0139] As used herein, amplified DNA or amplicon refers to the product of nucleic-acid amplification of a target nucleic acid sequence that is part of a nucleic acid template.
[0140] General Description
[0141] Heterosis is the phenomenon in which F.sub.1 hybrids derived from diverse parents show superiority over their parents by displaying higher yield, higher uniformity, higher levels of disease resistance, higher levels of pest resistance, increased vigor, higher number of spikelets per panicle, higher number of productive tillers, etc. Heterosis is expressed in the first generation only. And while farmers tend to use a lower seed rate for hybrids than for conventional varieties because of their better seed quality relative to non-hybrids, it is necessary to purchase fresh seeds every season. The added expense of hybrid seeds, especially the difficult to produce rice hybrid seed, often puts the seed out of reach of the farmer.
[0142] Hybrid rice is developed by exploiting the phenomenon of heterosis. Rice, being a strictly self-pollinated crop, requires the use of a male sterility system to develop commercial rice hybrids. Male sterility (genetic or nongenetic) makes the pollen of the plant unviable, so that rice spikelets are incapable of setting seeds through selfing. A male sterile line is used as a female parent, and grown next to a pollen parent in an isolated plot to produce a bulk quantity of hybrid seed resulting from cross pollination from the pollen parent. The seed set on the male sterile plants is the hybrid seed that is used to grow the commercial hybrid crop.
[0143] The three-line method of hybrid rice breeding is based on cytoplasmic male sterility (CMS) and the fertility restoration system, and involves three lines: the CMS line (A line); maintainer line (B line), and restorer (pollinator; R line).
[0144] Male sterility is controlled by the interaction of a genetic factor S present in the cytoplasm and nuclear gene(s). The male sterility factor S is located in the mitochondrial DNA. A line is male sterile when the male sterility-controlling factor S in the cytoplasm and recessive alleles (rf) of fertility-restoring genes are present in the nucleus. The maintainer line (B line) is iso-cytoplasmic to the CMS line since it is similar to it for nuclear genes but differs in cytoplasmic factor (N), which makes it self-fertile, but it has the capacity to maintain the sterility of the A line when crossed with it. A restorer or R line possesses dominant fertility-restoring genes (Rf) and it is dissimilar to or diverse from the A line. Crossing a restorer line as a pollen parent with a CMS (A) line as a female parent restores the fertility in the derived F.sub.1 hybrid, allowing plants grown from the hybrid seed to self pollinate and set seed.
[0145] Hybrid seed production using the CMS-based three-line method involves two basic steps: multiplication of the CMS line and production of hybrid seeds. Multiplication of the CMS line with its maintainer line by outcrossing by hand for a small quantity of seed, or in the field under isolation by space or time to produce bulk quantity of seed. For production of the CMS line, it is grown, for example, in six or eight rows interspersed by two rows of maintainer line in an alternating manner.
[0146] Because there usually small differences between the growth duration of A and B lines, their sowing dates can be adjusted to achieve good synchronization of their flowering. Several other techniques (including but not limited to flag-leaf clipping, gibberellic acid application, and supplementary pollination by rope pulling or shaking) are used to improve the outcrossing rate and seed yield of the CMS line.
[0147] The production of hybrid seeds involves the use of CMS lines with a selected restorer line (pollinator; R line) by growing them in a specific female:male ratio in the field under isolation by space or time (
[0148] The extent of outcrossing in the female seed parent (CMS line) is influenced by floral traits such as stigma size (length and breadth), length of style, stigma exsertion, and angle and duration of glume opening. The length of stigma and style, and total length (stigma+style), were characterized in 47 accessions of the 24 species of Oryza (Table XX of Example 1). Oryza longistaminata, a wild species of the AA genome, had significantly long and wider stigma, longer style, and greater total length than the other species. Oryza longistaminata was thus identified as a potential donor for the long stigma trait.
[0149] Oryza longistaminata (acc. no. 110404) is first crossed with a maintainer line, thereby introgres sing the long and wide stigma trait into one or more plants of the maintainer line. Any maintainer line can be crossed with Oryza longistaminata. In particular embodiments, the two popular indica maintainer lines IR58025B and IR68897B are crossed with Oryza longistaminata, thereby introgressing the long and wide stigma trait into at least one plant of the maintainer line. Progeny are selected for long and wide stigma in F.sub.1, BC.sub.1F.sub.1, BC.sub.2F.sub.1, and their segregating generations.
[0150] In one embodiment, F.sub.1 progeny are backcrossed with a rice plant of the maintainer line to produce a BC.sub.1F.sub.1 generation. Fertile BC.sub.1F.sub.1 with increased stigma length relative to rice plants of the maintainer line are selected for backcrossing. Backcrossing with the recurrent parent can be done 1 to 5 times, producing BC.sub.2F.sub.1 to BC.sub.6F.sub.1 progeny rice plants. Fertile progeny are again selected, where selected plants have all the physiological and morphological characteristics of the maintainer line, except for the desired trait of increased stigma length. Selected plants are intercrossed or selfed to produce F.sub.2 or later generations, which are stable for the long stigma trait. Those skilled in the art will recognize that modifications to this general strategy may be made, but still result in a converted maintainer line. Such modifications are to be recognized as being within the scope of the present invention.
[0151] In certain embodiments, progeny plants of a cross between Oryza longistaminata and the maintainer line, or later backcross progeny, are produced via embryo rescue.
[0152] The long and wide stigma trait is then introgressed into a cytoplasmic male sterile (CMS) line by crossing the CMS line with a corresponding maintainer line, wherein the corresponding maintainer line expresses the long and wide stigma trait derived from Oryza longistaminata (i.e., converted). For example, CMS line IR58025A is crossed with selected IR58025B progeny from the cross with Oryza longistaminata, where the selected progeny express the long and wide stigma trait. CMS line IR68897A is crossed with long and wide stigma-introgressed maintainer line IR68897A. Other CMS lines can be similarly crossed with selected plants of an appropriate maintainer line, where the selected plants express the long and wide stigma trait of Oryza longistaminata. Progeny of the CMSconverted maintainer line are selected for long and wide stigma. In certain embodiments, fertile F.sub.1 progeny with long stigma are backcrossed with the CMS recurrent parent line, followed by backcrossing fertile BC.sub.1F.sub.1 progeny with long stigma with the CMS recurrent parent. Backcross progeny with complete male sterility and long stigma are selected. In some embodiments, backcross progeny with complete male sterility and long stigma are selected for generating a stable CMS line having long stigma. The stable CMS line is preferably generated by backcrossing.
[0153] In certain embodiments of the breeding methods described above, increased stigma length is selected when stigma length is at least 30% greater, at least 40% greater, at least 50% greater, or at least 60% greater than stigma length of rice plants of the maintainer line not introgressed with the long stigma trait of Oryza longistaminata. In a preferred embodiment, increased stigma length is selected when stigma length is at least 50% greater than stigma length of rice plants of the maintainer line not introgressed with the long stigma trait of Oryza longistaminata.
[0154] Converted CMS lines are then pollinated by a restorer line comprising a dominant fertility-restoring genes (Rf;
[0155] In particular embodiments, the converted CMS line, restorer line, or both, comprise one or more desirable agronomic characteristics. Desirable agronomic characteristics include, but are not limited to semi-dwarf plant height, high yield, uniformity, bacterial leaf blight disease resistance, brown planthopper pest resistance, and/or drought tolerance. In a preferred embodiment, rice grown from hybrid seed set on converted CMS lines described herein outperforms its parents in at least one desirable agronomic characteristic. For example, hybrid seeds described herein can result in higher yield, higher uniformity, higher levels of disease resistance, higher levels of pest resistance, and/or improved drought tolerance.
[0156] Thus, in an aspect of the invention there is provided a cultivated rice plant comprising an introgression including at least one Oryza longistaminata quantitative trait locus (QTL) associated with stigma length, the cultivated rice plant having an out-crossing rate of at least 60%.
[0157] In an aspect of the invention there is provided a cultivated rice plant comprising an introgression including at least one Oryza longistaminata quantitative trait locus (QTL) associated with stigma length selected from the group consisting of: qSTGL8-1 and qSTGL8-2.
[0158] In one particular embodiment, the rice plant is a cytoplasmic male sterile line.
[0159] In one particular embodiment, the rice plant is a maintainer line.
[0160] In one particular embodiment, the rice plant has an out-crossing rate of at least 60% (or as described herein).
[0161] In one particular embodiment, the rice plant comprises at least an additional introgression including at least one Oryza longistaminata QTL associated with stigma length, stigma area, style length, stigma breadth or total pistil length.
[0162] In one particular embodiment, the at least one Oryza longistaminata QTL associated with stigma length, stigma area, style length, stigma breadth and pistil length is selected from the group consisting of qSTGL2-1, qSTGL5-1, qSTGL8-1, qSTGL8-2, qSTGL11-1, qSTGL11-2; qSTGA8-2; qSTYL1-1, qSTYL5-2, qSTYL8-1; qSTGB1-1, qSTGB3-1; qPSTL1-1, qPSTL1-3 and qPSTL11-1.
[0163] In one particular embodiment, a marker of the at least one additional QTL is selected from the group consisting of stigma length, RM110 (qSTGL2-1), RM421 (qSTGL5-1), RM7356 (qSTGL8-1), RM5353 (qSTGL8-1), RM256 (qSTGL8-2), RM80 (qSTGL8-2), RM590 (qSTGL11-1), RM286 (qSTGL11-1), RM 120(qSTGL11-2); RM229 (qSTGL11-2); stigma area, RM80 (qSTGA8-2); style length, RM319 (qSTYL1-1), RM7653 (qSTYL5-2), RM404 (qSTYL8-1); stigma breadth, RM403 (qSTGB1-1), RM3525 (qSTGB3-1); and pistil length, RM3604 (qPSTL1-1); RM3640 (qPSTL1-3); and RM5997 (qPSTL11-1).
[0164] In one particular embodiment, at least one marker for the QTL associated with stigma length is selected from the group consisting of PA08-03, RM7356, PA08-17 and PA08-18.
[0165] In one particular embodiment, the introgression comprising QTL associated with stigma length is positioned between markers PA08-03 to RM7356 or PA08-17 to PA08-18.
[0166] In one particular embodiment, the rice plant is a line selected from the group consisting of IR68897A, IR58025A, IR127841A and IR127842A.
[0167] In an aspect of the invention there is provided a hybrid rice plant having the rice plant having the long stigma, as described herein, as a parent or an ancestor.
[0168] In an aspect of the invention there is provided a tissue culture produced from protoplasts or cells from the rice plant having the long stigma, as described herein, wherein the protoplasts or cells of the tissue culture are produced from a plant part selected from the group consisting of: leaves; pollen; embryos; cotyledon; hypocotyls; meristematic cells; roots; root tips; pistils; anthers; flowers; stems; glumes; and panicles.
[0169] In an aspect of the invention there is provided a rice plant regenerated from the tissue culture, wherein the rice plant is a cytoplasmic male sterile rice plant having all the morphological and physiological.
[0170] In one particular embodiment, a CMS plant of line IR58025A is bred by the methods described herein to comprise the long stigma trait of Oryza longistaminata. A suitable maintainer line for the converted CMS line IR58025A is line IR58025B. In another particular embodiment, a CMS plant of line IR68897A is bred by the methods described herein to comprise the long stigma trait of Oryza longistaminata. A suitable maintainer line for the converted CMS line IR68897A is line IR68897B.
[0171] In another aspect, the present invention provides regenerable cells for use in tissue culture of a CMS plant comprising the long stigma trait of Oryza longistaminata. The tissue culture will preferably be capable of regenerating plants having the physiological and morphological characteristics of the foregoing rice plant, and of regenerating plants having substantially the same genotype. Preferably, the regenerable cells in such tissue cultures will be produced from embryo, protoplast, meristematic cell, callus, pollen, leaf, stem, petiole, root, root tip, fruit, seed, flower, anther, pistil or the like. Still further, the present invention provides converted CMS rice plants regenerated from tissue cultures of the invention.
[0172] Marker Assisted Selection of Converted Maintainer Lines and CMS Lines
[0173] In another embodiment described herein, the development of converted maintenance and CMS lines is enhanced by marker assisted selection. Basic protocols for marker assisted selection are well known to one of ordinary skill in the art. Given the benefit of this disclosure, including the quantitative trait loci (QTLs) and markers described herein, one of skill in the art will be able to carry out the invention as described.
[0174] A genetic mapping population is generated by crossing Oryza longistaminata with a variety of cultivated rice (e.g., IR64). Markers associate with genomic regions controlling stigma length (e.g., QTLs) can then be identified via molecular mapping. These markers are then used to aid in selecting rice plants of maintainer or CMS lines successfully introgressed with the long stigma trait of Oryza longistaminata.
[0175] A single plant of Oryza longistaminata was crossed with the high yielding cultivar IR64, as described in Example 6. The linkage map of the detected QTLs are shown in
[0176] Marker-assisted selection (MAS) involves the use of one or more of the molecular markers for the identification and selection of those progeny plants that contain one or more of the genes that encode for the desired trait. In the present instance, such identification and selection is based on the long and wide stigma trait of Oryza longistaminata, and QTLs of the present invention or markers associated therewith. MAS can be used to select progeny plants having the desired trait during the development of the converted maintainer and/or CMS lines by identifying plants harboring the QTL(s) of interest, allowing for timely and accurate selection. Rice plants developed according to this embodiment can advantageously derive a majority of their traits from the recipient plant (i.e., plant of maintainer or CMS line), and derive the long stigma trait from the donor plant (Oryza longistaminata).
[0177] In certain embodiments, one or more markers in progeny plants during the development of converted maintainer lines, converted CMS lines, or both. Detection of one or more markers in a converted line, wherein the marker is linked to a QTL of Oryza longistaminata associated with stigma length and/or total length of stigma and style, is indicative of introgression of the target trait. The QTL can be any one of those QTLs of Table 5 associated with stigma length and/or total length of stigma and style. A QTL of the present invention is detected using any marker associated with a given QTL, as provided in Table 5. In a particular embodiment, the QTL detected is at least one Oryza longistaminata quantitative trait locus associated with stigma length is selected from the group consisting of: qSTGL2-1; qSTGL5-1; qSTGL8-1; qSTGL8-2 and qSTGL11-1. At least one marker for at least one Oryza longistaminata quantitative trait locus associated with stigma length is selected from the group consisting of: RM110 (qSTGL2-1); RM421 (qSTGL5-1); RM7356 (qSTGL8-1); RM5353 (qSTGL8-1); RM256 (qSTGL8-2); RM80 (qSTGL8-2); RM590 (qSTGL11-1); RM286 (qSTGL11-1); RM120(qSTGL11-2); and RM229 (qSTGL11-2). The QTLs detected for other floral traits are qPSTL1-1; qPSTL1-3; and qPSTL11-1. At least one marker for at least one Oryza longistaminata quantitative trait locus associated with total stigma and style length can be selected from the group consisting of: RM3604 (qPSTL1-1); RM3640 (qPSTL1-3); and RM5997 (qPSTL11-1).
[0178] According to an exemplary embodiment, the introgression of qSTGL8-1; qSTGL8-2 can be detected using SEQ ID NOs: 13, 14 and 9, 10 (The InDel marker, PA08-18 or PA08-03).
[0179] Primers which can be used to detect the introgressions described according to some embodiments of the invention are listed in Table 8, which is considered as part of the general specification.
[0180] Also contemplated are primers, probes, amplicons and/or kits comprising same which can be diagnostic of the introgression of the invention (long stigma from Oryza logistaminata).
[0181] The nucleic acid probes and primers of the present invention hybridize under stringent conditions to a target DNA sequence. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence the long stigma introgression from Oryza longistaminata in a sample. Nucleic acid molecules or fragments thereof are capable of specifically hybridizing to other nucleic acid molecules under certain circumstances. As used herein, two nucleic acid molecules are capable of specifically hybridizing to one another if the two molecules are capable of forming an anti-parallel, double-stranded nucleic acid structure. A nucleic acid molecule is said to be the complement of another nucleic acid molecule if they exhibit complete complementarity. As used herein, molecules are said to exhibit complete complementarity when every nucleotide of one of the molecules is complementary to a nucleotide of the other. Two molecules are said to be minimally complementary if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under at least conventional low-stringency conditions. Similarly, the molecules are said to be complementary if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under conventional high-stringency conditions. Conventional stringency conditions are described by Sambrook et al., 1989, and by Haymes et al., In: Nucleic Acid Hybridization, A Practical Approach, IRL Press, Washington, D.C. (1985), Departures from complete complementarity are therefore permissible, as long as such departures do not completely preclude the capacity of the molecules to form a double-stranded structure. In order for a nucleic acid molecule to serve as a primer or probe it need only be sufficiently complementary in sequence to be able to form a stable double-stranded structure under the particular solvent and salt concentrations employed.
[0182] Regarding the amplification of a target nucleic acid sequence (e.g., by PCR) using a particular amplification primer pair, stringent conditions are conditions that permit the primer pair to hybridize only to the target nucleic-acid sequence to which a primer having the corresponding wild-type sequence (or its complement) would bind and preferably to produce a unique amplification product, the amplicon, in a DNA thermal amplification reaction.
[0183] For example, to determine whether the rice plant resulting from a sexual cross contains the long stigma introgression from Oryza longistaminata from the rice plant of the present invention, DNA extracted from a rice plant tissue sample (e.g., endosperm of a seed/meal/grain of a rice plant having long stigma as described herein e.g., of a hybrid plant) may be subjected to nucleic acid amplification method using a primer pair that includes a primer derived from flanking sequence in the genome of the plant adjacent to the insertion site of inserted heterologous DNA, and a second primer derived from the inserted heterologous DNA to produce an amplicon that is diagnostic for the presence of the long stigma introgression from Oryza longistaminata. The amplicon is of a length and has a sequence that is also diagnostic for the long stigma introgression from Oryza longistaminata. The amplicon may range in length from the combined length of the primer pairs plus one nucleotide base pair, preferably plus about fifty nucleotide base pairs, more preferably plus about two hundred-fifty nucleotide base pairs, and even more preferably plus about four hundred-fifty nucleotide base pairs. Alternatively, a primer pair can be derived from flanking sequence on both sides of the inserted DNA so as to produce an amplicon that includes the entire insert nucleotide sequence. A member of a primer pair derived from the plant genomic sequence may be located a distance from the inserted DNA molecule, this distance can range from one nucleotide base pair up to about twenty thousand nucleotide base pairs. The use of the term amplicon specifically excludes primer dimers that may be formed in the DNA thermal amplification reaction.
[0184] Nucleic-acid amplification can be accomplished by any of the various nucleic-acid amplification methods known in the art, including the polymerase chain reaction (PCR). A variety of amplification methods are known in the art and are described, inter alia, in U.S. Pat. Nos. 4,683,195 and 4,683,202 and in PCR Protocols: A Guide to Methods and Applications, ed. Innis et al., Academic Press, San Diego, 1990. PCR amplification methods have been developed to amplify up to 22 kb of genomic DNA and up to 42 kb of bacteriophage DNA (Cheng et al., Proc. Natl. Acad. Sci. USA 91:5695-5699, 1994). These methods as well as other methods known in the art of DNA amplification may be used in the practice of the present invention. The sequence of the introgression or flanking sequence can be verified (and corrected if necessary) by amplifying such sequences from the long stigma introgression from Oryza longistaminata using primers derived from the sequences provided herein followed by standard DNA sequencing of the PCR amplicon or of the cloned DNA.
[0185] The amplicon produced by these methods may be detected by a plurality of techniques. One such method is Genetic Bit Analysis (Nikiforov, et al. Nucleic Acid Res. 22:4167-4175, 1994) where an DNA oligonucleotide is designed which overlaps both the adjacent flanking genomic DNA sequence and the inserted DNA sequence. The oligonucleotide is immobilized in wells of a microwell plate. Following PCR of the region of interest (using one primer in the inserted sequence and one in the adjacent flanking genomic sequence), a single-stranded PCR product can be hybridized to the immobilized oligonucleotide and serve as a template for a single base extension reaction using a DNA polymerase and labeled ddNTPs specific for the expected next base. Readout may be fluorescent or ELISA-based. A signal indicates presence of the insert/flanking sequence due to successful amplification, hybridization, and single base extension.
[0186] Another method is the pyrosequencing technique as described by Winge (Innov. Pharma. Tech. 00:18-24, 2000). In this method an oligonucleotide is designed that overlaps the adjacent genomic DNA and insert DNA junction. The oligonucleotide is hybridized to single-stranded PCR product from the region of interest (one primer in the inserted sequence and one in the flanking genomic sequence) and incubated in the presence of a DNA polymerase, ATP, sulfurylase, luciferase, apyrase, adenosine 5 phosphosulfate and luciferin. dNTP's are added individually and the incorporation results in a light signal which is measured. A light signal indicates the presence of the long stigma introgression from Oryza longistaminata due to successful amplification, hybridization, and single or multi-base extension.
[0187] Fluorescence polarization as described by Chen, et al., (Genome Res. 9:492-498, 1999) is a method that can be used to detect the amplicon of the present invention. Using this method an oligonucleotide is designed which overlaps the genomic flanking and inserted DNA junction. The oligonucleotide is hybridized to single-stranded PCR product from the region of interest (one primer in the inserted DNA and one in the flanking genomic DNA sequence) and incubated in the presence of a DNA polymerase and a fluorescent-labeled ddNTP. Single base extension results in incorporation of the ddNTP. Incorporation can be measured as a change in polarization using a fluorimeter. A change in polarization indicates the presence of the long stigma introgression from Oryza longistaminata due to successful amplification, hybridization, and single base extension.
[0188] Taqman. (PE Applied Biosystems, Foster City, Calif.) is described as a method of detecting and quantifying the presence of a DNA sequence and is fully understood in the instructions provided by the manufacturer. Briefly, a FRET oligonucleotide probe is designed which overlaps the genomic flanking and insert DNA junction. The FRET probe and PCR primers (one primer in the insert DNA sequence and one in the flanking genomic sequence) are cycled in the presence of a thermostable polymerase and dNTPs. Hybridization of the FRET probe results in cleavage and release of the fluorescent moiety away from the quenching moiety on the FRET probe. A fluorescent signal indicates the presence of the long stigma introgression from Oryza longistaminata due to successful amplification and hybridization.
[0189] Molecular Beacons have been described for use in sequence detection as described in Tyangi, et al. (Nature Biotech. 14:303-308, 1996) Briefly, a FRET oligonucleotide probe is designed that overlaps the flanking genomic and insert DNA junction. The unique structure of the FRET probe results in it containing secondary structure that keeps the fluorescent and quenching moieties in close proximity. The FRET probe and PCR primers (one primer in the insert DNA sequence and one in the flanking genomic sequence) are cycled in the presence of a thermostable polymerase and dNTPs. Following successful PCR amplification, hybridization of the FRET probe to the target sequence results in the removal of the probe secondary structure and spatial separation of the fluorescent and quenching moieties that results in the production of a fluorescent signal. The fluorescent signal indicates the presence of the long stigma introgression from Oryza longistaminata due to successful amplification and hybridization.
[0190] Other described methods, such as, microfluidics (US Patent pub. 2006068398, U.S. Pat. No. 6,544,734) provide methods and devices to separate and amplify DNA samples. Optical dyes used to detect and quantitate specific DNA molecules (WO/05017181). Nanotube devices (WO/06024023) that comprise an electronic sensor for the detection of DNA molecules or nanobeads that bind specific DNA molecules and can then be detected.
[0191] DNA detection kits are provided using the compositions disclosed herein. The kits are useful for the identification of the long stigma introgression from Oryza longistaminata in a sample and can be applied at least to methods for breeding rice plants containing the appropriate introgressed DNA. The kits contain DNA primers and/or probes that are homologous or complementary to segments selected from the sequences as set forth at SEQ ID NO: 1-56, as set forth in the Sequence Listing. These DNA sequences can be used in DNA amplification reactions or as probes in a DNA hybridization method for detecting the presence of polynucleotides diagnostic for the presence of the target DNA in a sample. The production of a predefined amplicon in a thermal amplification reaction is diagnostic for the presence of DNA corresponding to the long stigma introgression from Oryza longistaminata in the sample. If hybridization is selected, detecting hybridization of the probe to the biological sample is diagnostic for the presence of the long stigma introgression from Oryza longistaminata in the sample. Typically, the sample is rice, or rice products or by-products of the use of rice. Also provided are processed rice products which are produced from the plants described herein and preferably contain the nucleic acid sequence conferring the improved out-crossing rate described herein. Also provided are methods of processing the rice (e.g., to produce meal) or other processed products.
[0192] Food Characteristics:
[0193] Rice starch is a major source of carbohydrate in the human diet, particularly in Asia, and the grain of the invention and products derived from it can be used to prepare food. The food may be consumed by man or animals, for example in livestock production or in pet-food. The grain derived from the rice plant can readily be used in food processing procedures, and therefore the invention includes milled, ground, kibbled, cracked, rolled, boiled or parboiled grain, or products obtained from the processed or whole grain of the rice plant, including flour, brokers, rice bran and oil. The products may be precooked or quick-cooking rice, instant rice, granulated rice, gelatinized rice, canned rice or rice pudding. The grain or starch may be used in the production of processed rice products including noodles, rice cakes, rice paper or egg roll wrapper, or in fermented products such as fermented noodle or beverages such as sake. The grain or starch derived therefrom may also be used in, for example, breads, cakes, crackers, biscuits and the like, including where the rice flour is mixed with wheat or other flours, or food additives such as thickeners or binding agents, or to make drinks, noodles, pasta or quick soups. The rice products may be suitable for use in wheatfree diets. The grain or products derived from the grain of the invention may be used in breakfast cereals such as puffed rice, rice flakes or as extruded products.
[0194] Dietary Fiber:
[0195] Dietary fiber, in this specification, is the carbohydrate and carbohydrate digestion products that are not absorbed in the small intestine of healthy humans but enter the large bowel. This includes resistant starch and other soluble and insoluble carbohydrate polymers. It is intended to comprise that portion of carbohydrates that are fermentable, at least partially, in the large bowel by the resident microflora.
[0196] Non-Food Applications:
[0197] Rice is widely used in non-food industries, including the film, paper, textile, corrugating and adhesive industries, for example as a sizing agent. Rice starch may be used as a substrate for the production of glucose syrups or for ethanol production.
[0198] DNA detection in the processed products can be performed using methods which are well known in the art and are described in some detail hereinabove.
[0199] Thus, the markers can be to any of the loci (e.g., Table 5) described herein which are associated with high out-cross rate.
[0200] According to some exemplary embodiments, the DNA locus is a quantitative trait locus associated with stigma length which can be selected from the group consisting of: qSTGL2-1; qSTGL5-1; qSTGL8-1; qSTGL8-2 and qSTGL11-1. At least one marker for at least one Oryza longistaminata quantitative trait locus associated with stigma length is selected from the group consisting of: RM110 (qSTGL2-1); RM421 (qSTGL5-1); RM7356 (qSTGL8-1); RM5353 (qSTGL8-1); RM256 (qSTGL8-2); RM80 (qSTGL8-2); RM590 (qSTGL11-1); RM286 (qSTGL11-1); RM120(qSTGL11-2); and
[0201] RM229 (qSTGL11-2).
[0202] In another embodiment described herein, at least one Oryza longistaminata quantitative trait locus associated with total stigma and style length can be selected from the group consisting of: qPSTL1-1; qPSTL1-3; and qPSTL11-1. At least one marker for at least one Oryza longistaminata quantitative trait locus associated with total stigma and style length can be selected from the group consisting of: RM3604 (qPSTL1-1); RM3640 (qPSTL1-3); and RM5997 (qPSTL11-1).
[0203] Exemplary markers for validation of the long stigma trait are provided as follows: PA08-03 (GCTCTCTACATGCCCTCGT; CCGTGTGTTGGTAGGTCAGA) and PA08-18 (GATCAATGTTTGGTCACCATCC; GTAGTCTCCTGCAATATCCC, SEQ ID NOs: 9, 10, 13 and 14). These are Indel markers we designed by genome sequence comparison between O. longistaminata and Nipponbare (O. sativa).
[0204] It is expected that during the life of a patent maturing from this application many relevant markers will be developed and the scope of the term marker is intended to include all such new technologies a priori.
[0205] As used herein the term about refers to 10%.
[0206] The terms comprises, comprising, includes, including, having and their conjugates mean including but not limited to.
[0207] The term consisting of means including and limited to.
[0208] The term consisting essentially of means that the composition, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.
[0209] As used herein, the singular form a, an and the include plural references unless the context clearly dictates otherwise. For example, the term a compound or at least one compound may include a plurality of compounds, including mixtures thereof.
[0210] Throughout this application, various embodiments of this invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.
[0211] Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases ranging/ranges between a first indicate number and a second indicate number and ranging/ranges from a first indicate number to a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween.
[0212] As used herein the term method refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.
[0213] As used herein, the term treating includes abrogating, substantially inhibiting, slowing or reversing the progression of a condition, substantially ameliorating clinical or aesthetical symptoms of a condition or substantially preventing the appearance of clinical or aesthetical symptoms of a condition.
[0214] When reference is made to particular sequence listings, such reference is to be understood to also encompass sequences that substantially correspond to its complementary sequence as including minor sequence variations, resulting from, e.g., sequencing errors, cloning errors, or other alterations resulting in base substitution, base deletion or base addition, provided that the frequency of such variations is less than 1 in 50 nucleotides, alternatively, less than 1 in 100 nucleotides, alternatively, less than 1 in 200 nucleotides, alternatively, less than 1 in 500 nucleotides, alternatively, less than 1 in 1000 nucleotides, alternatively, less than 1 in 5,000 nucleotides, alternatively, less than 1 in 10,000 nucleotides.
[0215] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.
[0216] Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.
EXAMPLES
[0217] Reference is now made to the following examples, which together with the above descriptions illustrate some embodiments of the invention in a non limiting fashion.
[0218] The materials, methods, and embodiments described herein are further defined in the following Examples. Certain embodiments of the present invention are defined in the Examples herein. It should be understood that these Examples, while indicating certain embodiments of the invention, are given by way of illustration only. From the discussion herein and these Examples, one skilled in the art can ascertain the essential characteristics of this invention and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions.
Example 1. Characterization of Pistil Traits of Oryza Species to Identify Wild Species as Donors for Transferring Floral Traits Influencing Outcrossing
[0219] To understand the variability of pistil traits, stigma length, stigma width, style length, and to stigma and style length were characterized in 47 accessions of the 24 species of genus Oryza covering eleven genomes, including cultivated rice and two unrelated plant species (Table 1;
[0220] Size variation was not observed for style length in cultivated and wild species. In our study, we observed that cultivated rice tends to have a shorter stigma than the annual wild species (O. nivara and O. barthii) which are shorter than the perennial progenitors. Among the AA genome wild species, O. longistaminata, which has longer stigma and style lengths than the remaining species, can be utilized for transfer of longer and wider stigma into maintainer and CMS lines to increase hybrid rice seed production.
TABLE-US-00001 TABLE 1 Length characteristics of stigma, style, and their total length in Oryza spp. Stigma length Style length Total length Species Min Max Mean SD Min Max Mean SD Min Max Mean SD Intraspecific Indica 0.98 1.40 1.22 0.12 1.02 1.42 1.21 0.13 2.18 2.74 2.43 0.18 Japonica 0.67 1.06 0.88 0.11 0.64 1.09 0.86 0.14 1.32 2.15 1.74 0.24 F value 48.76** 60.46** 71.85** LSD 1% 0.14 0.13 0.23 AA genome level O. sativa 0.67 1.40 1.10 0.20 0.64 1.42 1.09 0.21 1.32 2.74 2.20 0.39 O. nivara 0.80 1.86 1.29 0.46 0.50 1.20 0.92 0.21 1.30 3.06 2.21 0.66 O. rufipogon 1.48 2.10 1.74 0.22 0.81 1.11 0.97 0.10 2.44 3.21 2.71 0.30 O. glaberrima 0.86 1.11 1.01 0.08 0.79 0.90 0.86 0.04 1.69 2.01 1.87 0.10 O. barthii 1.42 2.22 1.74 0.29 0.87 1.33 1.01 0.12 2.33 3.31 2.76 0.38 O. longistaminata 2.49 3.37 2.87** 0.28 1.18 1.50 1.32** 0.10 3.80 4.87 4.19** 0.35 O. meridionalis 0.91 1.88 1.37 0.40 0.63 1.17 0.91 0.16 1.55 2.87 2.28 0.53 O. glumaepatula 1.35 1.73 1.58 0.13 0.82 1.20 1.00 0.12 2.18 2.81 2.58 0.22 F value 52.92** 8.45** 33.03** LSD 1% 0.32 0.19 0.48 Genome complex level O. sativa complex 0.67 3.37 1.49 0.59 0.50 1.50 1.03 0.20 1.30 4.87 2.52 0.73 O. officinalis 0.92 4.23 2.17 0.68 0.55 1.80 1.01 0.23 1.52 5.56 3.18 0.83 complex O. meyeriana 1.82 3.96 3.25 0.51 1.08 1.70 1.31 0.16 3.14 5.19 4.56 0.52 complex O. ridleyi complex 2.92 4.30 3.48 0.48 0.72 1.08 0.91 0.11 3.85 5.20 4.39 0.44 O. coarctata 2.31 2.73 2.60 0.17 1.45 1.64 1.54 0.07 3.94 4.25 4.14 0.12 F value 57.60** 15.79** 44.68** LSD 1% 0.82 0.28 0.99
Example 2. Development of IR58025B Maintainer Line with Long Stigma
[0221] Crosses were made between maintainer line IR58025B and O. longistaminata (acc. no. 110404) to transfer long stigma traits into IR58025B background. In BC.sub.1F.sub.1, 475 BC.sub.1F.sub.1 plants from 12 crosses were evaluated for stigma length, and lines having 50% more stigma length than the recurrent parent were selected and backcrossed to produce 46 BC.sub.2F.sub.1 crossed seeds. In BC.sub.2F.sub.1, 1653 BC.sub.2F.sub.1 plants from 46 crosses were evaluated and backcrosses were made with respective recurrent parents to produce 34 BC.sub.3F.sub.1 seeds. In BC.sub.1F.sub.2, 944 plants were evaluated and 45 plants with longer stigma were selected. In BC.sub.2F.sub.2, 1109 plants were evaluated, and 98 plants with longer stigma were selected. The stigma length in different backcross generations ranged from 0.85 to 2.88 mm whereas stigma+style length ranged from 2.22-4.57 mm (Table 2).
Example 3. Development of IR68897B Maintainer Line with Long Stigma
[0222] Crosses were made between maintainer line IR68897B and O. longistaminata (acc. no. 110404) to transfer long stigma traits into IR68897B background. Fifteen F.sub.1 plants were used to produce 364 BC.sub.1F.sub.1 plants and were evaluated for stigma length. From these, 29 plants were selected having 50% more stigma length than the recurrent parent and further backcrossed to produce BC.sub.2F.sub.1 seeds. Furthermore, 825 BC.sub.2F.sub.1 plants were evaluated and 43 plants having long stigma were backcrossed to produce BC.sub.3F.sub.1 plants. In BC.sub.2F.sub.2, 1609 plants were evaluated, and 109 plants with longer stigma were selected. The stigma length in different backcross generations ranged from 1.06 to 3.00 mm whereas stigma+style length ranged from 2.02-4.51 mm (Table 2). Seventy seven BC.sub.3F.sub.1 crosses of IR58025B and IR68897B have been produced. Stigma exertion in IR68897B, IR68897B improved lines, and IR68897A test cross progenies is presented in
TABLE-US-00002 TABLE 2 Stigma characteristics of parents and different backcross progenies in IR58025B and IR68897B backgrounds. stigma stigma + stigma stigma + Sl. No. of length style length No of length style length No Generation crosses (mm) (mm) crosses (mm) (mm) 1 IR64 1.13 2.26 2 IR58025B 1.12 2.36 3 IR68897B 1.29 2.56 4 O. longistaminata 2.74 4.06 IR58025B IR68897B 5 F.sub.1 26 1.86-2.74 2.81-4.25 35 1.35-2.92 2.51-4.44 6 BC.sub.1F.sub.1 12 1.52-2.88 3.17-4.28 15 1.74-2.72 2.92-4.12 7 BC.sub.2F.sub.1 46 0.85-2.80 2.22-4.57 29 1.06-3.00 2.0-4.51 8 BC.sub.3F.sub.1 34 43
Example 4. Development of Male Sterile Lines of IR58025A and IR68897A
[0223] Forty-five backcross progenies of the cross between IR58025B and O. longistaminata in BC.sub.1F.sub.2 and 36 backcross progenies in BC.sub.2F.sub.2 generations with longer stigma were testcrossed with IR58025A. Among IR68897B backcross progenies, 38 plants in BC.sub.1F.sub.2 and 33 plants in BC.sub.2F.sub.2 generations derived from the cross between IR68897B and O. longistaminata with longer stigma were testcrossed with IR68897A. A stable maintainer line with longer stigma was developed. Simultaneously, longer and wider stigma traits were introgressed into respective CMS lines.
Example 5: Development of IR127841B Maintainer Line with Long Stigma
[0224] According to Example 4 and
Example 6: Development of IR127841A Male Sterile Line with Long Stigma
[0225] According to Example 4 and
Example 7: Outcrossing Rates and Hybrid Seed Quality
[0226] We obtained agro-morphological traits of the new cytoplasmic male sterile lines (CMS), IR127841A and IR127842A lines (both the lines are from the same B line) with long stigma (produced as described in Examples 5 and 6, above) and compared with the normal CMS line, IR68897A. It was observed that major agro-morphological traits of the converted CMS lines were similar to that of the normal CMS lines specifically plant height, tiller number, panicle exertion and panicle length suggesting an efficient recovery of the normal CMS line phenotype. The out-crossing rate in the new CMS line showed a significant increase over the normal CMS line. The out-crossing rate was increased from 230%-250% compared to the normal CMS line (Table 3).
TABLE-US-00003 TABLE 3 Agro-morphological traits, out-crossing rate and hybrid seed production in converted CMS line Out- Plant Tiller Panicle Panicle Filled Unfilled crossing CMS Height Number Exertion Length Grains Grains Rate lines (cm) (No.) (cm) (cm) (No.) (No.) (%) IR127841 A 72.77 16.3 8.62 23.75 131* 72 64.60-67.08 IR127842 A 75.6 13.7 7.22 22.9 131* 60 67.20-76.76 IR68897A 73.97 16.65 8 23.95 33 86 27.68-30.31 *significant at p < 0.05
[0227] We carried out grain quality analysis of the new hybrid (IR127844H) from the cross between IR127841A (OCF15-107-1-9A) and IR71604-4-1-4-4-4-2-2-2-R as well as Mestizo 7 hybrid. Interestingly the new hybrid showed similar grain qualities of amylose content (24%) and gel consistency type compared with Mestizo 7 hybrid suggesting softer and flaky cooked rice charateristics. However, the new hybrid showed intermediate gelatinization temperature (GT) compared to low GT of Mestizo 7 suggesting better quality rice (Table 4).
TABLE-US-00004 TABLE 4 Comparative grain quality characteristics of the new hybrid Amylose Gelatinization Hybrid and Content Temperature Gel Restorer line (%) (AlkD) Consistency IR71604-4-1-4-4-4-2-2-2R 22 I 50 IR127844H* 24 I 45 (New hybrid) Mestizo7 24 L 58 (Normal hybrid) *IR127844H: IR127841A (Converted CMS line) x IR71604-4-1-4-4-4-2-2-2R
Example 8. Experiments on Out-Crossing Rate and Seed Production with Converted CMS Lines
[0228] Two CMS lines, IR58025A and IR68897A converted with long and wide stigma inherited from O. longistaminata and produced according to Example 4 were planted in two replications with 18 plants each along with the normal CMS lines. The converted and normal CMS line plants were surrounded by IR71604-4-1-4-4-4-2-2-2R as restorer pollinator (
Example 9. Molecular Mapping of QTLs Influencing Floral Traits in IR64/O. Longistaminata BC.SUB.2.F.SUB.2 .Mapping Population
[0229] A single plant of O. longistaminata (acc. no. 110404) was crossed with the high yielding elite cultivar IR64 to produce F.sub.1 seeds. The F.sub.1 plants, whose hybrid nature was confirmed through morphological and molecular markers, were used as the female parent and backcrossed to IR64 to produce 267 BC.sub.1F.sub.1 seeds. Based on their phenotypic similarity to IR64, BC.sub.1F.sub.1 plants were selected and used as the female progenitor and backcrossed to IR64 to produce 220 BC.sub.2F.sub.1 plants. A set of three hundred fifty seven (357) BC.sub.2F.sub.2 seeds from the best plants of 37 BC.sub.2F.sub.1 plants were collected for mapping of floral traits. The experiment was conducted in completely randomized block design with two replications, and 25,000 florets from 4200 plants were dissected to collect data on stigma length, style length, stigma breadth, stigma area and total length (stigma+style) during dry season 2012 at International Rice Research Institute, Los Baos, Philippines. The mean performance of parents and minimum and maximum trait values of the population indicated transgressive segregation in the direction of cultivated parents for all traits. Most of the traits were normally distributed and skewed towards cultivated rice. Parental polymorphism survey was conducted with 822 SSR and STS markers, and 147 markers found to be polymorphic between IR64 and O. longistaminata. A linkage map was developed with 147 polymorphic markers. A total of 15 QTLs were identified by composite interval mapping for five floral traits including stigma length (6), style length (3), stigma breadth(2), stigma area (1), and total pistil length (3) (Table 5).
[0230] A major QTL i.e., qSTGL8.0 on chromosome 8 was identified at marker interval RM7356 and RM5353 for stigma length with a LOD value of 33.0 explaining 25% of total phenotypic variation. A QTL for style length (qSTYL1-1) was identified at the same marker interval, i.e., RM319 and RM3640, on chromosome 1 with a LOD value of 9.97 explaining 16% of phenotypic variation. A major QTL i.e., qSTGB1-1 was identified for stigma breadth on chromosome 1 explaining 21% of phenotypic variation with a LOD value of 14.71. For pistil length, a genomic region qPSTL11-1 on chromosome 11 was identified with a LOD value of 5.63 explaining 27% of phenotypic variation.
TABLE-US-00005 TABLE 5 List of floral trait QTLs detected in IR64 O. longistaminata BC.sub.2F.sub.2 mapping population by primary mapping Composite Interval Mapping Sl. No. QTL Chr M.sub.1 M.sub.2 LOD A D R.sup.2 1 qSTGL2-1 2 RM110 S02026 4.6 0.0 0.2 0.09 2 qSTGL5-1 5 RM421 RM7653 5.6 0.0 0.0 0.06 3 qSTGL8-1 8 RM7356 RM5353 33.0 0.1 0.1 0.25 4 qSTGL8-2 8 RM256 RM80 9.5 0.1 0.1 0.10 5 qSTGL11-1 11 RM590 RM286 7.4 0.0 0.1 0.04 6 qSTGL11-2 11 RM120 RM229 5.7 0.1 0.1 0.7 7 qSTYL1-1 1 RM319 RM3640 9.97 0.10 0.00 0.16 8 qSTYL5-2 5 RM7653 RM6360 6.12 0.08 0.01 0.10 9 qSTYL8-1 8 RM404 RM1109 4.58 0.06 0.06 0.17 10 qSTGB1-1 1 RM403 RM319 14.71 0.04 0.00 0.21 11 qSTGB3-1 3 RM3525 RM520 9.77 0.04 0.01 0.09 12 qSTGA8-2 8 RM80 RM502 8.52 0.04 0.03 0.03 13 qPSTL1-1 1 RM3604 RM3746 8.06 0.13 0.02 0.08 14 qPSTL1-3 1 RM3640 RM8134 8.59 0.15 0.05 0.09 15 qPSTL11-1 11 RM5997 RM254 5.63 0.25 0.12 0.27
Example 11. QTL Fine Mapping
[0231] Six putative QTLs were detected by composite interval mapping of the genomic region conferring long exerted stigma trait (Table 6).
TABLE-US-00006 TABLE 6 List of QTLs detected by primary mapping of IR64 O. longistaminata BC.sub.2F.sub.2 mapping population through composite interval mapping *Trait Left Right Sl. No. Name Chromosome Marker Marker LOD PVE (%) **Add **Dom 1 STGL 2 RM110 SO2026 4.6 9.0 0.0 0.2 2 STGL 5 RM421 RM7653 5.6 3.0 0.0 0.0 3 STGL 8 RM7356 RM5353 33.0 25.0 0.1 0.1 4 STGL 8 RM256 RM80 9.4 10.5 0.1 0.1 5 STGL 11 RM590 RM286 7.4 4.0 0.0 0.1 6 STGL 11 RM120 RM229 5.7 7.0 0.1 0.1
[0232] Among them, the QTL locus, qSTGL8.0 was found to be a major QTL with LOD as high as 33.0 and 25% R.sup.2 was detected between the markers RM7356 and RM 5353 followed by minor QTL RM256 and RM80 with LOD 9.4 and 10.5% R.sup.2 from the 357 BCF mapping population on the long arm of chromosome 8 within 381.82 cM to 396.18 cM of these markers (Figures. 9A and 9B).
[0233] The QTL locus, qSTGL8.0 was fine mapped to narrow down the gneetic distance between the marker and the QTL to attain high co-segregation of the markers. Therefore, we used the high quality whole genome sequence information of Oryza longistaminata of 60,198 scaffolds assembled from 52.5 coverage Illumina HiSeq reads by SOAPdenovo ver. 2.2 and the total sequence length of 326,442,508 bp, new InDel markers specific to O. longistaminata were designed. Although, a major QTL detected in the region between RM7356 and RM 5353 with the marker positions between 381.82 cM and 396.18 cM respectively, we also considered the minor QTLs which were expressed from RM1109 to RM256 with the marker positions 362.34 cM and 400.04 cM respectively for fine mapping. High quality whole genome sequence of O. longistaminata was aligned to Nipponbare reference genome sequence for identification of insertion deletion sequences to develop InDel markers. We developed 21 new InDel markers from RM1109 to RM256 that covered the major and minor QTLs as well. These 21 InDel markers were designed with a minimum interval of 37 kb to a maximum interval of 655 kb. Of the 21 InDel markers, 14 markers showed polymorphism between IR64 and O. longistaminata, 357 BC.sub.2F.sub.2 plants which were used previously for the primary mapping were again genotyped by using these newly developed polymorphic InDel markers and subjected to QTL analysis for fine mapping. Further QTL analysis revealed that, there were two sub QTLs: qSTGL8.1 and qSTGL8.2 which were physically positioned between PA08-03 and RM7356, and PA08-17 and PA08-18 with the sizes of 294 kb and 171 kb respectively. These markers were found associated with long stigma exertion trait transferred from O. longistaminata. We identified 78 recombinants for both the flanking markers, PA08-03 and RM7356 of qSTGL8.1 and 64 and 76 recombinants for the flanking markers, PA08-17 and PA08-18 of qSTGL8.2 respectively. The QTL locus, qSTGL8.0 was narrowed down from approximately 3.89 Mb to 294 kb (qSTGL8.1) and 171 kb (qSTGL8.2) to achieve significant high marker-trait association (
TABLE-US-00007 TABLE 7 List of QTLs detected by fine mapping of IR64 O. longistaminata BC.sub.2F.sub.2 mapping population through composite interval mapping *Trait Left Right Sl. No. Name Chromosome Position Marker Marker LOD PVE (%) **Add **Dom 1 STGL 8 283 PA08-03 RM7356 19.0 12.0 0.0 0.2 2 STGL 8 337 PA08-17 PA08-18 24.0 14.0 0.1 0.0 *STGL: Stigma length **Add: Additive effect; **Dom: Dominance effect
Example 12. Marker Validation for the Long Exerted Stigma
[0234] 135 BC.sub.2F.sub.3 plants were used for the marker validation studies. Genotype data of primary mapped flanking markers (SSRs) and fine mapped markers (InDels) and phenotype data (stigma length) were compared for the computation of percent marker-trait co-segregation (
TABLE-US-00008 TABLE8 ListofnewlydesignedO.Longistaminata-derivedgenespecificInDel markerswiththeirsequenceandproductsizes Expected Expected F R Product Product Sl. Floral Marker primer Seq primer Seq sizefor sizeforO. No. trait name sequence ID sequence ID Nipponbare(bp) longistminata(bp) 1 Stigma RM110 TCGAAGCCATCCACCAA 1 TCCGTACGCCGACGAG 2 211 length CGAAG GTCGAG (qSTGL) 2 Stigma S02026 TGGTCCATCATATTGCCA 3 TCCTCTCAGATCCGATT 4 167 length AC TTCA (qSTGL) 3 Stigma RM421 AGCTCAGGTGAAACATC 5 ATCCAGAATCCATTGA 6 610 length CAC CCCC (qSTGL) 4 Stigma RM7653 AATTCGTCCCCGTCTCCT 7 GAATTCCAGCTCTTTGA 8 236 length AC CCG (qSTGL) 5 Stigma PA08-03 GCTCTCTACATGCCCTC 9 CCGTGTGTTGGTAGG 10 190 147 length GTC TCAGA (qSTGL) 6 Stigma RM7356 CCAAGGACACATATGCA 11 GCAATTCATGGCGCTG 12 224 length TGC TTC (qSTGL) 7 Stigma PA08-18 GATCAATGTTTGGTCAC 13 GTAGTCTCCTGCAAT 14 220 188 length CATCC ATCCC (qSTGL) 8 Stigma RM5353 ACCCTCGATCTCCTAGGC 15 TCTACTCCAAACCCATT 16 226 length TG GCC (qSTGL) 9 Stigma RM256 GACAGGGAGTGATTGAA 17 GTTGATTTCGCCAAGG 18 507 length GGC GC (qSTGL) 10 Stigma RM80 TTGAAGGCGCTGAAGGA 19 CATCAACCTCGTCTTCA 20 349 length G CCG (qSTGL) 11 Stigma RM286 GGCTTCATCTTTGGCGAC 21 CCGGATTCACGAGATA 22 362 length AACTC (qSTGL) 12 Stigma RM120 CACACAAGCCCTGTCTC 23 CGCTGCGTCATGAGTA 24 190 length ACGACC TGTA (qSTGL) 13 Stigma RM229 CACTCACACGAACGACT 25 CGCAGGTTCTTGTGAA 26 323 length GAC ATGT (qSTGL) 14 Style RM319 ATCAAGGTACCTAGACC 27 TCCTGGTGCAGCTATGT 28 517 length ACCAC CTG (qSTYL) 15 Style RM6360 GCTCGGATCAATCGAGC 29 TTTCCAGCAAGATCGA 30 233 length TC CGC (qSTYL) 16 Style RM404 CCAATCATTAACCCCTGA 31 GCCTTCATGCTTCAGA 32 680 length GC AGAC (qSTYL) 17 Style RM1109 TCAAAATCACGTGTATGT 33 TTTACAAAGGACAGAG 34 224 length AAGC GGC (qSTYL) 18 Stigma RM403 GCTGTGCATGCAAGTTC 35 ATGGTCCTCATGTTCAT 36 697 breadth ATG GGC (qSTGB) 19 Stigma RM319 ATCAAGGTACCTAGACC 37 TCCTGGTGCAGCTATGT 38 517 breadth ACCAC CTG (qSTGB) 20 Stigma RM3525 ACACTCTCAGCTCATCAA 39 GGGCAAGTGGTCAAAT 40 266 breadth GACC CTTG (qSTGB) 21 Stigma RM520 AGGAGCAAGAAAAGTTC 41 GCCAATGTGTGACGCA 42 710 breadth CCC ATAG (qSTGB) 22 Stigma RM502 GCGATCGATGGCTACGA 43 ACAACCCAACAAGAAG 44 602 area C GACG (qSTGA) 23 Pistil RM3604 ATGTCAGACTCCGATCTG 45 TCTTGACCTTACCACCA 46 226 length GG GGC (qPSTL) 24 Pistil RM3746 AAATGGGCTTCCTCCTCT 47 CAGCCTTGATCGGAAG 48 234 length TC TAGC (qPSTL) 25 Pistil RM3640 TACTGGTGCAAGGATAC 49 TGCTCCAAACCTCAGT 50 228 length CCC CTCC (qPSTL) 26 Pistil RM8134 AACCCTGGTTCACATTAT 51 AAAACAGTTAGGTCAA 52 111 length ATTG (qPSTL) 27 Pistil RM5997 GCGACGACGAAGAAGCT 53 CCCATCGATAGGGTTT 54 224 length AAC CCTC (qPSTL) 28 Pistil RM254 AGCCCCGAATAAATCCA 55 CTGGAGGAGCATTTGG 56 560 length CCT TAGC (qPSTL)
[0235] McCouch-S-R, Teytelman-L, Xu-Y, Lobos-K-B, Clare-K, Walton-M, Fu-B, Maghirang-R, LiZ, Xing-Y, Zhang-Q, Kono-I, Yano-M, Fjellstrom-R, DeClerck-G, Schneider-D, Cartinhour-S, Ware-D, Stein-L, Development and mapping of 2240 new SSR markers for rice (Oryza sativa L.), DNA research: an international journal for rapid publication of reports on genes and genomes, 2002, vol. 9, pp. 199-207.
[0236] The InDel marker, PA08-18 showed the highest co-segregation of 75.0% and the marker could be effectively utilized in MAS of long stigma trait introgression into hybrid parental lines toward increasing out-crossing rate (
Example 13. Background Analysis of Improved Cytoplasmic Male Sterile Lines
[0237] We used Infinium 6K SNP chip of Illumina platform to analyze the recovery of recurrent parent IR68897B genome in the newly improved CMS line, IR127841A (OCF15-107-1-9). The improved CMS line showed the highest genome recovery (80.0%) and possesses the qSTGL8.0 (a major QTL involved in long stigma exertion) (
[0238] While the invention has been described with reference to various and preferred embodiments, it should be understood by those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof without departing from the essential scope of the invention. In addition, many modifications may be made to adapt a particular situation or material to the teachings of the invention without departing from the essential scope thereof.
[0239] Therefore, it is intended that the invention not be limited to the particular embodiments disclosed herein contemplated for carrying out this invention, but that the invention will include all embodiments falling within the scope of the claims.