Functionalized carboxylic acids and alcohols by reverse fatty acid oxidation in engineered microbes
09994881 ยท 2018-06-12
Assignee
Inventors
Cpc classification
Y02E50/10
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12N9/1029
CHEMISTRY; METALLURGY
C12P13/02
CHEMISTRY; METALLURGY
International classification
C12P13/02
CHEMISTRY; METALLURGY
C12P13/00
CHEMISTRY; METALLURGY
Abstract
Bacteria that run the beta oxidation cycle in reverse anabolic direction are provided, along with many novel primers to start the reverse cycle, pathways to make such primers, and a large variety of products produced thereby. Methods for making desired product by using such primers in the reverse pathway are also disclosed.
Claims
1. A genetically engineered microbe, comprising one or more overexpressed enzymes forming a reverse beta oxidation pathway, wherein overexpression of an enzyme is compared to wild type activity of that enzyme before said microbe is genetically engineered to overexpress that enzyme, wherein said reverse beta oxidation pathway comprises: a) overexpressed enzyme(s) that allow the production of an omega-functionalized acyl-CoA thioester primer selected from oxalyl-CoA, malonyl-CoA, succinyl-CoA, hydroxyacetyl-CoA, 3-hydroxypropionyl-CoA, 4-hydroxybutyryl-CoA, 2-aminoacetyl-CoA, 3-aminopropionoyl-CoA, 4-aminobutyrylCoA, isobutyryl-CoA, 3-methyl-butyryl-CoA, 2-hydroxypropionyl-CoA, 3-hydroxybutyryl-CoA, and 2-aminopropionyl-CoA; b) an overexpressed thiolase able to condense said omega-functionalized acyl-CoA primer with acetyl-CoA, and encoded by atoB, fadA, fadI, bktB, catF, paaJ, pcaF, phaA, thlA, thlB, dcaF or yqeF; c) an overexpressed 3-hydroxyacyl-CoA dehydrogenase able to act on an omega-functionalized 3-ketoacyl-CoA substrate; d) an overexpressed enoyl-CoA hydratase or 3-hydroxyacyl-CoA dehydratase able to act on an omega-functionalized 3-hydroxyacyl-CoA substrate; e) an overexpressed acyl-CoA dehydrogenase or trans-enoyl-CoA reductase able to act on an omega-functionalized trans-enoyl-CoA substrate; and f) an overexpressed termination enzyme able to act on an omega-functionalized CoA-thioester substrate or their beta-functionalized derivatives, wherein said termination enzyme is selected from: i) a thioesterase, or an acyl-CoA:acetyl-CoA transferase, or a phosphotransacylase and a carboxylate kinase; ii) an alcohol-forming coenzyme-A thioester reductase; iii) an aldehyde-forming CoA thioester reductase and an alcohol dehydrogenase; iv) an aldehyde-forming CoA thioester reductase and an aldehyde decarbonylase; v) an olefin-forming enzyme; and vi) an aldehyde-forming CoA thioester reductase and a transaminase.
2. The microbe of claim 1, wherein said overexpressed 3-hydroxyacyl-CoA dehydrogenase is encoded by fadB, fadJ, dcaH or paaH.
3. The microbe of claim 1, wherein said overexpressed enoyl-CoA hydratase is encoded by fadB, fadJ, phaJ4, phaJ1, phaJ, paaZ, dcaE or paaF.
4. The microbe of claim 1, wherein said overexpressed acyl-CoA dehydrogenase or trans-enoyl-CoA reductase is encoded by Euglena gracilis TER, fabI, Cytophaga hutchinsonii TER, Treponima denticola TER, Idiomarina loihiensis TER, Methylobacillus flagellates TER, ydiO, dcaA or fadE.
5. The microbe of claim 1, wherein said overexpressed thioesterase is encoded by tesA, tesB, yciA, fadM, ydil, ybgC, E. coli paal, ybdB, A. Borkumensis tesB, A. thaliana ACH2, M. musculus acot8 or S. cerevisiae PTE1.
6. The microbe of claim 1, wherein said microbe is E. coli and comprises fadR, atoC(c), arcA, crp, and crp*, wherein the symbol means a stop mutation, deletion or frameshift.
7. The microbe of claim 1, wherein said microbe comprises adhE, pta or ackA or ackApta, poxB, ldhA, and frdA, wherein the symbol means a stop mutation, deletion or frameshift.
8. The microbe of claim 1, further comprising overexpression of omega-oxidation enzymes selected from a cytochrome P450 monooxygenase, an alkane monooxygenase, an alcohol dehydrogenase, and an aldehyde dehydrogenase.
9. The microbe of claim 1, further comprising overexpression of alpha-oxidation enzymes selected from an acyl-CoA synthase, an acyl-CoA 2-hydroxylase, a 2-hydroxyacyl-CoA lyase, an aldehyde dehydrogenase, a fatty acid alpha-hydroxylase and an alcohol dehydrogenase.
10. The microbe of claim 1, wherein said microbe is E. coli and has a genotype selected from: a) ldhA poxB pta adhE frdA THIL+ fadB+ fadE+ ydiQRST+ ydbK+ ACR+ ADH+ b) ldhA poxB pta adhE frdA THIL+ fadB+ fadE+ ydiQRST+ ydbK+ THIE+ c) ldhA poxB pta adhE frdA THIL+ fadB+ Ter+ ACR+ ADH+ d) ldhA poxB pta adhE frdA THIL+ fadB+ Ter+ THIE+ e) ldhA poxB pta adhE frdA THIL+ fadB+ ydiO+ ydiQRST+ ydbK+ ACR+ ADH+ f) ldhA poxB pta adhE frdA THIL+ fadB+ ydiO+ ydiQRST+ ydbK+ THIE+ g) ldhA poxB pta adhE frdA THIL+ fadBA+ fadE+ ydiQRST+ ydbK+ ACR+ ADH+ h) ldhA poxB pta adhE frdA THIL+ fadBA+ fadE+ ydiQRST+ ydbK+ THIE+ i) ldhA poxB pta adhE frdA THIL+ fadBA+ Ter+ ACR+ ADH+ j) ldhA poxB pta adhE frdA THIL+ fadBA+ Ter+ THIE+ k) ldhA poxB pta adhE frdA THIL+ fadBA+ ydiO+ ydiQRST+ ydbK+ ACR+ ADH+ l) ldhA poxB pta adhE frdA THIL+ fadBA+ ydiO+ ydiQRST+ ydbK+ THIE+ m) ldhA poxB pta adhE frdA THIL+ fadBA+ ydiO+ ydiQRST+ ydbK+ THIE+ n) ldhA poxB pta adhE frdA THIL+ fadBA+ ydiO+ ydiQRST+ ydbK+ THIE+ o) ldhA poxB pta adhE frdA fadB fadJ paaH THIL+ ACR+ ADH+ p) ldhA poxB pta adhE frdA fadB fadJ paaH THIL+ THIE+ q) ldhA poxB pta adhE frdA fadB fadJ DpaaH THIL+ ACR+ ADH+ r) ldhA poxB pta adhE frdA fadE ydiO THIL+ fadB+ THIE+ s) ldhA poxB pta adhE frdA fadE ydiO THIL+ fadB+ ACR+ ADH+ and t) ldhA poxB pta adhE frdA fadE ydiO THIL+ fadB+ THIE+ wherein means stop mutation, deletion or frameshift.
11. A method of making a desired product, comprising growing the genetically engineered microbe of claim 1 in a culture broth, extending said primer by using a reverse beta oxidation pathway to produce a product at least two carbons longer than said primer, and isolating said product, wherein said product is selected from a diol, a dicarboxylic acid, a hydroxy acid, a carboxylated alcohol, an amine, an amino acid, a hydroxylated amine, a diamine, an amide, a carboxylated amide, a hydroxylated amide, a diamide, a hydroxamic acid, and -substituted or omega-substituted derivatives thereof.
12. A method of making a desired product, comprising growing the genetically engineered microbe of claim 10 in a culture broth, extending said primer by using a reverse beta oxidation pathway to produce a product at least two carbons longer than said primer, and isolating said product, wherein said product is selected from a diol, a dicarboxylic acid, a hydroxy acid, a carboxylated alcohol, an amine, an amino acid, a hydroxylated amine, a diamine, an amide, a carboxylated amide, a hydroxylated amide, a diamide, a hydroxamic acid, and -substituted or omega-substituted derivatives thereof.
Description
DESCRIPTION OF THE FIGURES
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
DETAILED DESCRIPTION OF THE INVENTION
(17) Two general approaches are used in the invention to functionalize the alpha and omega carbons:
(18) i) use of a primer or starter with a functionalized omega carbon, or
(19) ii) functionalizing the alpha/omega carbon of an intermediate or a product of the engineered reversal of the -oxidation cycle.
(20) The latter could take place before or after the intermediates of the engineered reversal of the -oxidation cycle have been converted to carboxylic acids and n-alcohols by the appropriate termination enzymes.
(21) These two approaches are detailed below.
(22) Use of Omega Hydroxylated and Omega Carboxylated Primer/Starter Molecules in the Engineered Reversal of the -Oxidation Cycle:
(23) The normal/standard starter/primer used in the engineered reversal of the -oxidation cycle is acetyl-CoA, which leads to the synthesis of even-chain n-alcohols and carboxylic acids (61/440,192). Propionyl-CoA can also be used as starter unit/primer by thiolase(s) thus enabling the synthesis of odd-chain carboxylic acids and n-alcohols (61/440,192).
(24) A methyl group is always found at the omega end (omega or is the carbon most distant from the carboxyl group of the fatty acid) of both of the aforementioned starter/primer molecules. The use of starter/primer molecules with an omega hydroxylated or omega carboxylated carbon (i.e. a functionalized omega end) will then lead to the synthesis of carboxylic acids and alcohols through the -oxidation reversal that will contained a functionalized omega end: e.g., omega-hydroxylated carboxylic acids, omega-carboxylated n-alcohols, dicarboxylic acids, and diols.
(25) The use of omega-hydroxylated and omega-carboxylated starter/primer molecules requires: i) a native or engineered thiolase that will use them as substrates to initiate the reversal of the -oxidation cycle (
(26) In one scenario, the invention includes having two separate thiolases: a short-chain thiolase/acyltransferase with high affinity for the desired primer/starter molecule (native enzyme with desired properties or engineered AtoB/YqeF) (
(27) In some cases YqeF/AtoB will need to be engineered to obtain mutants with preference for hydroxyacetyl-CoA, hydroxypropionyl-CoA, hydroxybutyryl-CoA, oxalyl-CoA, malonyl-CoA or succinyl-CoA as a primer/starter molecule over acetyl-CoA.
(28) Some of these thiolases are already available in nature; for example E. coli PaaJ (Mascaraque et al., 2010, PNAS 107:14390-14395; Nogales et al., 2007, Microbiology 153:357-365), Pseudomonas sp. Strain B13 CatF (Gobel et al., 2002, J. Bac. 184: 216-223), Rhodococcus opacus PcaF and CatF (Eulberg et al., 1998, J. Bacteriol. 180:1072-1081), and Streptomyces sp. PcaF (Iwagami et al., 2000, Appl. Environ. Microbiol. 66:1499-1508) are 3-oxoadipyl-CoA thiolases that catalyze the reversible conversion of 3-oxoadipyl-CoA to succinyl-CoA and acetyl-CoA during the degradation of aromatic compounds and hence can use succinyl-CoA as a primer/starter molecule.
(29) Metabolic routes that would support the synthesis of the aforementioned omega-carboxylated and omega-hydroxylated primer/starter molecules are shown in
(30) Omega Carboxylated PrimersOxalyl-CoA, Malonyl-CoA or Succinyl-CoA:
(31) The use of malonyl-CoA as starter/primer molecule will support the synthesis of odd-chain dicarboxylic acids and omega-carboxylated n-alcohols. The use of oxalyl-CoA and succinyl-CoA as primers/starter molecules will support the synthesis of even-chain dicarboxylic acids and omega-carboxylated n-alcohols.
(32)
(33) Omega Hydroxylated PrimersHydroxyacetyl-CoA, Hydroxypropionyl-CoA, and Hydroxybutyryl-CoA:
(34) The use of hydroxyacetyl-CoA and hydroxybutyryl-CoA as starters/primer molecules will lead to the synthesis of even-chain 1,n-diols and omega-hydroxylated carboxylic acids.
(35)
(36) In the case of the thiolase reaction, engineered thiolases capable of using hydroxyacetyl-CoA, hydroxypropionyl-CoA and hydroxybutyryl-CoA as primers/starter molecules in a condensation reaction with acetyl-CoA (
(37) Functionalization of Omega Carbons Using the -Oxidation Pathway:
(38) Alkanes and long chain fatty acids are metabolized by industrially important yeasts and bacteria using the -oxidation pathway, a minor pathway for medium chain fatty acids. The methyl group at the carbon is first oxidized to a hydroxyl group, then to an oxo group, and finally to a carboxyl group. The long chain dicarboxylates derived from -oxidation then enter the -oxidation cycle for further degradation. These enzymes are used in this invention to functionalize the carbon of carboxylic acids and n-alcohols generated in the -oxidation reversal using as primer/starter one of the following molecules: acetyl-CoA, hydroxyacetyl-CoA, hydroxypropionyl-CoA, hydroxybutyryl-CoA, oxalyl-CoA, malonyl-CoA or succinyl-CoA. The functionalization involves the introduction of hydroxyl, aldehyde, or carboxylic groups in the carbon.
(39) Omega Oxidation as the Key Pathway:
(40) oxidation of an omega methyl group to either alcohol (1 step, generating a hydroxylated end) or carboxylic acid (2 steps from hydroxy to oxo to carboxy, generating a carboxylated end). The omega oxidation enzymes will act on the carbon of carboxylic acids or alcohols generated by the action of thioesterases and aldehyde-forming acyl-CoA reductases and alcohol dehydrogenases, respectively, on the different intermediates of the -oxidation reversal.
(41) The three enzymatic steps employed in this part of the invention are summarized below and are shown in
(42) (1) Hydroxylation (Omega-Hydroxylation): Fatty acid+2 NADPH+O2.fwdarw.-hydroxy fatty acid+2NADP+H2O long-chain fatty acid -hydroxylase: CYP704B1 (Arabidopsis thaliana col) Laurate+NADPH/NADH+O2.fwdarw.-hydroxy laurate+NADP/NAD+H2O laurate monooxygenase (Helianthus tuberosus) NADPH-dependent laurate monoxygenase: IMT-2 (Petuniahybrida) NADPH-dependent lauric acid dehydroxylase: CYP76J1 (Petuniahybrida) NADPH-dependent laurate -hydroxylase (Pisum sativum): NADH-dependent a fatty acid+2 NADPH+oxygen<=>a in-chain hydroxy fatty acid+2 NADP++H2O
(43) Many other examples of P450 hydroxylases are provided in: Pinot F, Beisson F. (2011). Cytochrome P450 metabolizing fatty acids in plants: characterization and physiological roles. FEBS J, 278 (2), 195-205.
(44) (2) Alcohol Oxidation -hydroxy fatty acid+O2.fwdarw.-oxo fatty acid+H2O2 omega-hydroxy fatty acid oxidase: AtFAO3 (Arabidopsis thaliana col) -hydroxy fatty acid oxidase: fao2 (Candida cloacae) -hydroxy fatty acid oxidase: fao1 (Candida cloacae)
(45) (3) Keto Oxidation -oxo fatty acid+NAD.fwdarw.dicarboxylic acid+NADH
(46) Representative aldehyde oxidoreductases capable of this enzymatic step are provided in the following references: Hommel R and Kleber H P 1984. FEMS Microbiol. Lett. 22, 139-142; Shinagawa E, Toyama H, Matsushita K, Tuitemwong P, Theeragool G, Adachi O. 2006. Biosci. Biotechnol. Biochem. 70:850-857; Groen B, Frank J, Duine J A. 1984. Biochem. J. 223: 921-924; Zarnt G, Schrader T, Andreesen J R. 2001 J. Bacteriol. 183:1954-1960.
(47) Functionalization of Alpha-Carbons Using the -Oxidation Pathway:
(48) Alpha oxidation (-oxidation) is a process by which certain fatty acids are broken down by removal of a single carbon from the carboxyl end. Since 3-methyl fatty acids cannot be degraded through the -oxidation cycle, the terminal carboxyl group is first removed by alpha-oxidation. Alpha-oxidation pathways are exemplified in
(49) The enzymatic steps involved in the alpha-oxidation pathway have been reported elsewhere (Jansen and Wanders: Biochimica et Biophysica Acta 1763 (2006) 1403-1412, see also en.wikipedia.org/wiki/Alpha_oxidation). Alpha-oxidation of phytanic acid has been investigated in detail. The pathway involves first the activation of phytanic acid to phytanoyl-CoA followed by 2-hydroxylation of phytanoyl-CoA by phytanoyl-CoA hydroxylase (PhyH/Pahx) to form 2-hydroxyphytanoyl-CoA.
(50) Fatty acid hydroxylases from Myxococcus xanthus (MXAN_0191) and Stigmatella aurantiaca (STIAU_3334) (Ring M W, Schwar G, Bode H B. 2009. ChemBioChem 10:2003-20) represent candidate enzymes for performing alpha hydroxylation on the products generated from a reversal of the -oxidation cycle
THEORY OF THE INVENTION
(51) The exploitation and engineering of biological systems enabling carbon-chain elongation has garnered significant attention in recent years due to the growing demand for the development of new technologies capable of producing advanced (long-chain) fuels and chemicals from renewable materials.sup.1-4. While the use of the fatty acid biosynthesis pathway has attracted the most attention.sup.5-7, a recently engineered reversal of the -oxidation cycle shows great promise as a metabolic platform for the synthesis of alcohols and carboxylic acids of varying carbon lengths and functionalities.sup.8. In contrast to the fatty acid biosynthesis pathway, this pathway operates with coenzyme A (CoA) intermediates and directly uses acetyl-CoA for acyl-CoA chain elongation, characteristics that could enable product synthesis at maximum carbon and energy efficiency.sup.8.
(52) Our previous work on engineering a functional reversal of the -oxidation cycle in Escherichia coli focused on a top-down/system-level strategy that involved the manipulation of several global regulators.sup.8. A mutation that rendered FadR non-functional, in combination with a mutation in the cytoplasmic response regulator AtoC of the AtoSC two-component regulatory system, enabled the constitutive expression of all enzymes in the -oxidation cycle in the absence of its natural substrate (fatty acids).sup.8. Since several operons encoding -oxidation cycle enzymes are also activated by the cyclic-AMP (cAMP) receptor protein (CRP)-cAMP complex and hence repressed by the presence of alternative carbon sources, we replaced the native crp gene with a cAMP-independent mutant (crp*) that confers a derepressed phenotype. Finally, since the anaerobic/microaerobic conditions used in the production of fuels and chemicals would lead to ArcA-mediated repression of most operons encoding the -oxidation cycle, the arcA gene was deleted.sup.8.
(53) These system-level manipulations were then combined with a small set of local perturbations (elimination of native fermentation pathways and expression of selected termination pathways) to achieve the synthesis of desired products. While effective, this system-level approach has some limitations due to the ill-defined nature of the individual components of the engineered pathway. This, in turn, limits the ability to effectively manipulate such individual components to fine-tune the synthesis of specific products and prevents the transfer of the engineered pathways to other host organisms (i.e. equivalent global regulators would need to be engineered in other hosts to implement a functional reversal of the -oxidation cycle).
(54) In order to overcome these limitations, the approach taken here focuses on a synthetic biology strategy in which the target pathway is built from well-defined and self-contained functional units that can be assembled in different combinations to achieve the synthesis of a wide array of products. This bottom-up approach implies that an effective design is created through the assembly of pre-defined components or building blocks (i.e. each functional units/enzymes composing the pathway).sup.9. Thus, the reconstruction of a functional reversal of the -oxidation cycle can be accomplished without engineering global regulators and hence creating a clean platform that can be readily transferred to other hosts/organisms.
(55) The implementation of the above approach entails i) in vitro kinetic characterization of individual components of the pathway, and ii) in vivo assembly and characterization of the functional pathway. To this end, suitable enzyme(s) for each functional unit comprising the thiolase, 3-hydroxyacyl-CoA dehydrogenase, enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydratase, and acyl-CoA dehydrogenase/trans-enoyl-CoA reductase elements of the core pathway (
(56) While these four principle components encompass the entire reversal of the -oxidation cycle, product synthesis also requires the integration of a termination pathway into the modular framework. In order to provide a functional assessment of each core unit as the pathway is built, thioesterases capable of converting each CoA pathway intermediate into their respective carboxylic acid counterpart were selected and utilized as the termination pathway(s). This approach enabled the use of carboxylic acids as proxy for product synthesis (e.g. 4-C carboxylic acids produced during a functional one-turn reversal of the -oxidation cycle).
(57) Once identified and characterized, the assembly and in vivo characterization of each functional unit of the core pathway was conducted. We selected E. coli as the initial chassis for pathway assembly due to its advantageous traits for industrial biofuel and biochemical production.sup.10 and as a chassis for synthetic biology applications.sup.9. In addition, to demonstrate the feedstock-independent nature of the functional components (i.e. only requires the generation of acetyl-CoA from a given carbon source), glycerol was selected as the carbon source. Finally, the metabolism of E. coli was re-programmed and tailored for the synthesis 4-C and longer chain products through local perturbations and the modular assembly of each individual component. This reconstructed pathway can now be used for the synthesis of a wide-range of products by engineering the priming (using different primers) and termination (using different termination pathways) steps, as described in this invention.
Reverse Beta Oxidation
(58) A functional reversal of the -oxidation cycle results in the two-carbon elongation of an acyl-CoA intermediate per cycle of operation. This metabolic process requires the integration of 4 key components for core pathway function: i) a thiolase that catalyzes the condensation of acetyl-CoA with an acyl-CoA, yielding a ketoacyl-CoA; ii) a hydroxyacyl-CoA dehydrogenase that reduces ketoacyl-CoA to hydroxyacyl-CoA; iii) an enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydratase that generates transenoyl-CoA from hydroxyacetyl-CoA; and iv) an acyl-CoA dehydrogenase/trans-enoyl-CoA reductase that reduces trans-enoyl-CoA to an acyl-CoA two carbons longer than the initial acyl-CoA (
(59) In its simplest form, a one-turn reversal, these reactions result in the elongation of the initial acetyl-CoA molecule to butyryl-CoA. In addition to the aforementioned components, product synthesis also requires the integration of a termination pathway capable of converting each CoA pathway intermediate into the desired product. Thus, these elongated components can be functionalized or used as intermediates in another turn, as shown in
(60) In the work reported here we used thioesterases to convert CoA thioesters intermediates into their respective carboxylic acid counterpart (
Thiolase
(61) Four E. coli thiolases involved in the -oxidation of fatty acids.sup.11 (atoB, yqeF, fadA, fadI) can potentially catalyze the condensation of acetyl-CoA with acyl-CoA of various chain lengths. Among them, AtoB and FadA have been studied the most. AtoB exhibits higher specificity for short-chain acyl-CoA molecules.sup.12,13, while FadA is part of the FadBA multienzyme complex with broad chain-length specificity for acyl-CoA substrates.sup.14.
(62) Considering their well-studied nature, AtoB and FadA were selected as the most viable thiolase candidates and further in vitro characterization were undertaken to ensure their compatibility in the framework of a functional -oxidation reversal. Upon purification and kinetic characterization, AtoB was shown to effectively catalyze the condensation of two acetyl-CoA molecules with a k.sub.cat/K.sub.M of 3.5510.sup.3 M.sup.1s.sup.1 showing its potential as a short-chain specific thiolase component for initiation of a one-turn -oxidation reversal (Table 1), and hence priming a cycle of multiple turns. On the other hand, while substrate saturation with FadA during the kinetic characterization was not possible, the estimated (See Methods) k.sub.cat/K.sub.M of 7.47 M.sup.1s.sup.1 for the condensation of acetyl-CoA molecules shows FadA is not a viable candidate for this initial condensation reaction (Table 1).
(63) It is important to note however that when one considers multiple turns of the functional reversal of the -oxidation cycle with longer chain length intermediates, the broad chain-length specificity of FadA for longer-chain acyl-CoA substrates.sup.14 could convey the ability to facilitate multiple cycle turns with a single enzyme after the initial priming of the cycle by AtoB. Also of note is the fact that both AtoB and FadA appear to be more efficient in the catabolic direction (i.e. conversion of acetoacetyl-CoA into 2 acetyl-CoA molecules) (Table 1). This could pose an issue during in the in vivo assembly of components without appropriate driving forces, such as the thermodynamic driving force of metabolite pools of substrates and products.sup.15, in place to ensure the biosynthetic reaction is favored.
3-Hydroxyacyl-CoA Dehydrogenase
(64) Three E. coli enzymes could potentially encode 3-hydroxyacyl-CoA dehydrogenase activity: two hydroxyacyl-CoA dehydrogenases (fadB and fadJ), which are involved in the -oxidation of fatty acids.sup.11, and a 3-hydroxyadipyl-CoA dehydrogenase (paaH) that participates in the degradation of phenylacetate.sup.16. While involved in degradative pathways, these three enzymes catalyze reversible reactions and hence were considered viable candidates.
(65) Of the potential candidates, FadB, the second member of the FadBA multienzyme complex, is the most studied and has been shown to possess both hydroxyacyl-CoA dehydrogenase and enoyl-CoA hydratase activity with broad chain-length specificity.sup.17, 18. Considering both of these activities are required for a functional reversal of the -oxidation cycle and multiple cycle turns would require enzymes able to act on intermediates of varying carbon length, these key traits of FadB make it a promising candidate for in vitro characterization. As seen in Table 1, upon purification, FadB exhibits efficient 3-hydroxyacyl-CoA dehydrogenase activity for the NADH dependent reduction of acetoacetyl-CoA with a k.sub.cat/K.sub.M of 6.6510.sup.4 M.sup.1 s.sup.1, providing initial evidence towards its inclusion as a member of the integrated set of components.
Enoyl-CoA Hydratase
(66) Three members of the enoyl-CoA hydratase family involved in -oxidation reactions should be able to act as 3-hydroxybutyryl-CoA dehydratase: aerobic (fadB) and anaerobic (fadJ) enoyl-CoA hydratases that participate in the -oxidation of fatty acids.sup.11, and a 2,3-dehydroadipyl-CoA hydratase (paaF) involved in phenylacetate degradation.sup.16. Despite the primary role of these enzymes in degradative pathways, the reversible nature of the reactions they catalyze indicates their potential for the dehydration of hydroxyacyl-CoAs.
(67) With the previous selection of FadB as the 3-hydroxybutyryl-CoA dehydrogenase component of a one-turn reversal of the -oxidation cycle, this protein represents the natural choice for an enoyl-CoA hydratase -hydroxybutyryl-CoA dehydratase in the context of a one turn reversal), as it is reported to encode both hydroxyacyl-CoA dehydrogenase and enoyl-CoA hydratase activities.sup.17,18. The selection of this enzyme would also provide the advantage of minimizing the number of required components of the integrated framework.
(68) As with 3-hydroxybutyryl-CoA dehydrogenase activity, the kinetic properties of purified FadB for 3-hydroxybutyryl-CoA dehydratase activity were evaluated (Table 1), and provided ample evidence for the ability of FadB to serve as the enoyl-CoA hydratase component in the modular framework. Although substrate saturation proved difficult, FadB did exhibit the required activity with an estimated (See Methods) k.sub.cat/K.sub.M of 3.1910.sup.3 M.sup.1s.sup.1 for the hydration of crotonyl-CoA, demonstrating its potential to function as a key component during the in vivo assembly of a functional reversal of the -oxidation cycle.
Acyl-CoA Dehydrogenase/Trans-Enoyl-CoA Reductase
(69) Two -oxidation enzymes were chosen as enzymes that can potentially catalyze the last step of the reversal of the cycle: an acyl-CoA dehydrogenase (fadE), involved in the aerobic catabolism of fatty acids.sup.11 and a predicted acyl-CoA dehydrogenase (ydiO) proposed to be part of the -oxidation of fatty acids under anaerobic conditions.sup.19.
(70) While there is evidence of YdiO.sup.8 and FadE.sup.20 playing roles in the reduction of crotonoyl-CoA to butyryl-CoA under certain conditions, the complexity of these enzymes make their in vitro characterization and in vivo assembly/function difficult. YdiO shares high homology with the crotonobetainyl-CoA reductase CaiA.sup.8, an enzyme that catalyzes the reduction of crotonobetainyl-CoA to -butyrobetainyl-CoA.sup.21, a reaction similar to the reduction of crotonyl-CoA to butyryl-CoA in the one-turn reversal of the -oxidation cycle. Moreover, the fixABCX operon encoding flavoproteins and a ferredoxin required for the transfer of electrons to CaiA.sup.22, 23 shows a high sequence similarity to those encoded by the ydiQRST operon.sup.8.
(71) This suggests that as with CaiA, YdiO requires auxiliary flavoproteins and a ferredoxin for the transfer of electrons during the reduction of enoyl-CoA to acyl-CoA making their modular assembly and in vivo function complicated. A further caveat for the use of these enzymes is the involvement of a ferredoxin, which is oxidized during electron transfer. Reduced ferredoxin would have to be regenerated with an additional reaction to enable continued turnover of electron transfer and hence the entire functional reversal of the -oxidation cycle. For this purpose, a predicted pyruvate:flavodoxin oxidoreductase (ydbK).sup.24 could be utilized to couple pyruvate dissimilation with ferredoxin reduction, thus enabling the continued ferredoxin-aided electron transfer to the enoyl-CoA reduction step.
(72) While the acyl-CoA dehydrogenase FadE does not catalyze a ferredoxin mediated reduction, the operation of this enzyme in its physiological direction (i.e. catabolism of fatty acids) is coupled to the electron transfer chain by flavoproteins and is thought to represent the only irreversible step in the catabolic operation of the -oxidation cycle.sup.11. This direct coupling to the electron transfer chain with the use of FadE makes an overall one-turn functional reversal of the -oxidation cycle unfavorable from a standard thermodynamic sense.sup.8. Although an electron transfer system similar to that of YdiO could be compatible with FadE, making the reaction more thermodynamically favorable, this adds a similar level of complexity to that described above for YdiO.
(73) Given the aforementioned complexities of YdiO and FadE, we faced significant challenges during their in vitro purification and characterization. Upon purification, no detectable activities were measured with either enzyme, although we were able to measure their activities in crude extract of cells expressing them (Table 1). These results could reflect the requirement for auxiliary enzymes for proper function and underlie the potential challenges for their use as a key component in the modular framework.
(74) To address these issues, we used a trans-2-enoyl-CoA reductase from the photosynthetic flagellate Euglena gracilis (egTER), shown to reduce the double bond in C4 and C6 enoyl-CoA intermediates to produce acyl-CoA via a NAD(P)H dependent mechanism.sup.25. This approach eliminates the requirement for auxiliary and coupling enzymes for proper function.
(75) Interestingly, egTER is a key enzyme of an anaerobic metabolic process in the mitochondrion of E. gracilis that leads to the synthesis of wax esters via the malonyl-CoA-independent synthesis of fatty acids (the latter a process equivalent to a functional reversal of the -oxidation cycle).sup.26. This mitochondrial process synthesizes products of chain length 8-18, suggesting the ability of egTER to catalyze reduction of enoyl-CoA molecules of various chain lengths.sup.26, 27. Considering the physiological role of egTER as a functional unit of a core process similar to the reversal of the -oxidation cycle and its broad chain-length specificity, the inclusion of this enzyme in our design holds great promise. Purification and in vitro characterization of egTER further demonstrated the validity of this enzyme as the reduction of crotonyl-CoA with NADH as a co-factor proceeded efficiently with a k.sub.cat/K.sub.M of 1.1610.sup.4 M.sup.1s.sup.1 (Table 1).
Termination: Thioesterases
(76) The combination of the four steps described above entail the functional units that form a reversal of the -oxidation cycle. However, product synthesis from this process requires the use of termination pathways capable of converting the CoA intermediates of the core pathway to desired products. While a wide array of products with varying functionalities can be synthesized from the cycle intermediates through the selection and integration of various termination pathways.sup.8, the use of thioesterases provides arguably the simplest termination pathway for the in vivo characterization of a functional one-turn reversal and also enables the assessment of each functional unit as the pathway is sequentially built. Thioesterases, part of the larger sub-family of hydrolase enzymes acting on ester bonds, catalyze the hydrolytic cleavage of thioester bonds. In the context of the functional reversal of the -oxidation cycle, thioesterases cleave the thioester bond of the CoA intermediates converting them to their carboxylic acid components.
(77) E. coli thioesterases encoded by tesA.sup.28, tesB.sup.29, yciA.sup.30, fadM.sup.31, ydiI.sup.32, and ybgC.sup.32 were selected for further characterization and integration with the framework of the in vivo assembly due to their varying substrate specificities. In vitro characterization through specific activity measurements of crude cell extract of strains expressing these various thioesterases showed YciA has the highest activity on 4-C CoA intermediates of the cycle (Table 2). However, each of the tested thioesterases showed increased activity with the longer chain intermediate decanoyl-CoA (Table 2).
(78) While the high activity of YciA for the relevant 4 carbon CoA intermediates is promising, one possible issue revealed in this characterization is the fact that YciA also appears to have significant activity toward acetyl-CoA (Table 2), which could result in competition between the cycle initiation (thiolase) and the termination pathway in this case. This was confirmed through a full kinetic characterization of YciA, as the K.sub.M for acetyl-CoA (42.7 M) was significantly lower than the K.sub.M for acetyl-CoA of AtoB (892 M) (Table 1). In addition, this analysis revealed that YciA exhibits significant catalytic efficiency for all potential CoA intermediates during a one turn reversal of the -oxidation cycle (Table 1), suggesting its ability to serve as the termination pathway from any CoA intermediate during the integrated assembly of the modules. However, given the low K.sub.M and high catalytic efficiency of YciA for acetyl-CoA, overexpression of this enzyme could also limit the flux into the core pathway during the in vivo assembly of a functional reversal of the -oxidation cycle, and thus the testing of all selected thioesterase components is required to determine optimal functionality.
Assembly of Functional Units
(79) While the in vitro characterization of selected components provides evidence of the ability of these enzymes to perform the reactions required for a functional reversal of the -oxidation cycle, only the in vivo assembly of these individual units in conjunction with selected thioesterases as termination pathways can provide an assessment of pathway functionality (i.e. synthesis of 4-C carboxylic acids) (
(80) However, before this can be achieved, the metabolism of the host organism (e.g. E. coli for our purposes) must be re-programmed to ensure that the expression of the individual components of the core and termination pathways leads to the desired biochemical product(s). Considering glycerol as the carbon source of interest, this requires shifting E. coli metabolism away from native fermentation products (
(81) To this end, a strain containing deletions of genes encoding enzymes responsible for fermentative routes to ethanol (adhE), acetate (pta and poxB), lactate (ldhA), and succinate (frdA) was constructed. As a result of these key gene deletions, glycerol metabolism was shifted from a mixture of lactate, acetate, and ethanol to a mixture of pyruvate and acetate in the engineered host (MG1655 ldhApoxBptaadhEfrdA=JC01) (
(82) As expected, the individual overexpression of atoB in JC01 resulted in the production of 4-C carboxylic acids (
(83) However, somewhat unexpected was the distribution of 4-C carboxylic acid products resulting from atoB expression. 3-oxobutyrate, the carboxylic acid product of thiol cleavage of acetoacetyl-CoA, was only present in small amounts, while the majority of the 4-C carboxylic acid production was in the form of 3-hydroxybutyrate, the thioesterase cleavage product of 3-hydroxybutyryl-CoA (
(84) In order to investigate these possibilities and provide further assessment of selected termination pathway enzymes, strains were constructed in which atoB overexpression was combined with either overexpression of a thioesterase (tesA, tesB, yciA, fadM, ydiI, ybgC) or their deletion from the chromosome of the host strain. While no clear indication of a key thioesterase for 3-oxobutyrate production was determined, as no single overexpression significantly increased or single deletion unambiguously abolished 3-oxobutyrate (
(85) While the results of the in vitro analysis of YciA indicated that this thioesterase can act on the majority of pathway intermediates seen from a one-turn reversal of the -oxidation cycle (Table 1), the large increase in acetate reinforces the conclusion from in vitro characterization that the lower K.sub.M and greater catalytic efficiency (Table 1) allows YciA to favorably compete with AtoB for acetyl-CoA when overexpressed at significant levels. In addition, the reversible nature of AtoB (Table 1) and lack of an individually expressed 3-ketobutyryl-CoA dehydrogenase to act on acetoacetyl-CoA (
(86) The latter scenario is reflected by the fact that significant amounts of 3-hydrobutyrate are observed upon atoB expression (
(87) As seen in
(88) In order to further assess FadB and integrate the 3-hydroxyacyl-CoA dehydrogenase and enoyl-CoA hydratase components into the modular framework, a controllable construct for both atoB and fadB expression (i.e. pTHatoB.fadB) was assembled and tested in vivo for 4-C carboxylic acid production. Further demonstrating the ability for this enzyme to serve as a key component of the reversal of the -oxidation cycle, the combined overexpression of atoB and fadB in JC01 lead to a 3-fold increase in 3-hydroxybutyrate production compared to atoB expression only, with 2.5 g/L of 3-hydroxybutyrate produced at a yield of 0.29 g/g (
(89) Interestingly, despite the fact the in vitro characterization of FadB (Table 1) indicates that this enzyme can serve as both a 3-ketobutyryl-CoA dehydrogenase and 3-hydroxybutyryl-CoA dehydratase during the reversal of the -oxidation cycle, only increases to 3-hydroxybutyrate production were observed upon its expression with atoB, with no detectable crotonate, the thiol cleavage product of crotonoyl-CoA (
(90) This was further assessed through the combined expression of atoB and fadB with either selected thioesterase individual overexpression (
(91) These results again underlie the importance of placing the main level of control over product formation on the individual steps expressed from the core pathway and supplementing this structure with highly specific termination pathways leading to specific product formation (such as the case of ydiI expression and crotonate formation). The promiscuity of the selected thioesterases, specifically YciA, for multiple pathway intermediates (Table 1) as well as the competition for intermediates between enzymes within the core pathway and termination pathways creates an intricate balance between the expression levels of key enzymes.
(92) For the purposes of 4-C carboxylic acid production, it appears to be better to utilize native host termination pathway(s) as a means of complementing the manipulation of the individual functional units of the core pathway as the overall control strategy for the synthesis of different products.
(93) For the case of 3-hydroxybutyrate formation in E. coli, select thioesterase deletion in conjunction with atoB and fadB expression indicate that while native expression of tesB and yciA may play a role in its production, as evidenced by the slight decreases in production levels (
(94) Further evidence to the control over product formation that the core pathway exerts is seen from the presence of butyrate when atoB and fadB are individually expressed (even in conjunction with selected thioesterases other than the aforementioned yciA,
(95) In an attempt to elucidate the native enzymes involved in this conversion, gene deletions of candidates, including an acyl-CoA dehydrogenase (fadE) and a predicted acyl-CoA dehydrogenase (ydiO), were singularly added to JC01 and tested in combination with the expression of atoB and fadB (
(96) To gain further insight to the possible role and ability of these enzymes to serve as a key component of a functional reversal of the -oxidation cycle, constructs that enable the combined overexpression of fadE or ydiO in conjunction with the thiolase (AtoB), 3-hydroxyacyl-CoA dehydrogenase (FadB), and enoyl-CoA hydratase components (FadB) were developed (i.e. pTHatoB.fadB.fadE and pTHatoB.fadB.ydiO). It is also important to note that for the case of ydiO expression, a vector containing the predicted auxiliary enzymes required for proper enzyme/pathway function (See above) was also constructed (i.e. pZSydbK.ydiQRST) and tested with the aforementioned construct in the presence of 1 mM thiamine pyrophosphate (TPP), shown to increase YdbK activity.sup.24. As seen in
(97) As previously discussed, an alternative component for this step is the use of the trans-2-enoyl-CoA reductase from E. gracilis (egTER), which not only shows favorable kinetic characteristics for the reduction of crotonyl-CoA (Table 1), but is also from an organism which has been shown to possess a metabolic process (synthesis of waxes) whose core pathway is essentially equivalent to a functional reversal of the -oxidation cycle.sup.26. One advantage of this enzyme is that egTER does not require auxiliary enzymes or coupling reactions for proper function as NAD(P)H is used as the electron donor in the reaction.sup.25.
(98) While the lack of a requirement for auxiliary enzymes could help the efficiency of this enzyme when used with a variety of carbon sources, in the case of glycerol, the fact that NADH is used as the reducing equivalent also confers an advantage for the production of reduced compounds that can be achieved from the intermediates of the cycle. The reduced nature of glycerol dictates that the formation of one molecule of pyruvate generates twice the number of reducing equivalents (2 NADH) as that from glucose.sup.34, representing the exact number of reducing equivalents required for each turn of the cycle (i.e. two reduction reactions from the ketoacyl-CoA to the acyl-CoA intermediate,
(99) Given these distinct advantages of egTER compared to other candidate butyryl-CoA dehydrogenases, we investigated the impact of the combined expression of atoB, fadB, and egTER, encoding all components required in the modular framework for an efficient one turn reversal of the -oxidation cycle. As seen in
(100) Additional confirmation to this second point was provided through the expression of the key components required for a full one-turn reversal in conjunction with individual thioesterase overexpression in the host strain. No significant increase in butyrate production was observed upon overexpression of any of the thioesterases (
(101) While the modular expression of the individual components of a functional reversal of the -oxidation cycle appears to exert the most control over the products produced with thioesterase termination pathways, the subsequent deletion of native thioesterases in JC01 with atoB, fadB, and egTER expression does provide valuable insight into the identity of the native termination pathway to butyrate. Despite the ambiguous nature of thioesterase deletion with partial -oxidation cycle component expression, for a full one-turn cycle reversal YciA appears to be the most critical thioesterase for butyrate production as the deletion of yciA resulted in a near 5-fold decrease in butyrate concentration and yield (
(102) These results agree with the high catalytic efficiency observed for YciA when butyryl-CoA is used as a substrate compared to other 4-C CoA intermediates (Table 1) and the fact that no other thioesterase tested has near the levels of specific activity on butyryl-CoA as YciA (Table 2). Despite the fact that YciA appears critical for butyrate production and also exhibits high activity for all pathway intermediates of a one-turn reversal (Table 1), its overexpression actually resulted in a decrease in 4-C carboxylic acid product formation when combined with the expression of individual core pathway enzymes due to the promiscuous nature of this thioesterase for a broad range of substrates.sup.30.
(103) Overall, the in vivo assembly of the individual components of the cycle with 4-C carboxylic acids as the proxy for product synthesis demonstrated what functional units are required for the effective functioning of the pathway. This enabled the construction of a fully synthetic and transferable system for the core components of a one-turn reversal the -oxidation cycle. With this in place, the determination of the key requirements and components needed to extend the core pathway for multiple turns can be assessed, thus expanding the scope of products that can be synthesized through a functional reversal of the -oxidation cycle.
Longer-Chain Products
(104) The operation of multiple turns of a reversal of the -oxidation cycle requires the condensation of the acyl-CoA generated from a turn(s) of the cycle with an additional acetyl-CoA molecule to lengthen the acyl-CoA by 2 carbons each cycle turn (e.g. condensation of butyryl-CoA with acetyl-CoA in
(105) Therefore, with the current module enabling a functional reversal of the -oxidation cycle, the key step controlling the ability to operate multiple turns of cycle lies with the thiolase selected for the condensation of acyl-CoA intermediates. While AtoB was chosen for a one-turn reversal due to its higher specificity for short-chain acyl-CoA molecules.sup.12, 13, this trait may limit its ability to operate for continued turns of the cycle involving increasing carbon length intermediates.
(106) On the other hand, FadA exhibits broad chain-length specificity for acyl-CoA substrates.sup.14, making this enzyme an ideal candidate to support multiple cycle turns and enabling the production of longer chain products. However, the low efficiency of FadA with acetyl-CoA as a substrate (Table 1) likely requires the presence of another thiolase with higher specificity for short-chain acyl-CoA molecules (such as AtoB) to perform the initial condensation reaction (i.e. priming of the cycle).
(107) Utilizing these components, a platform for the operation of multiple turns of a functional reversal of the -oxidation cycle was developed through the modular construction of vectors encoding AtoB, the FadBA operon, and egTER. When integrated in the host strain JC01, this design enabled synthesis of extracellular longer chain fatty acids up to C12 (dodecanoic acid) through the native expression of thioesterase termination pathways (
(108) The expression of fadA was important for this purpose, as the same integrated components produced significantly less total longer chain fatty acids (C6) in the absence of FadA, and no products greater than C6 were detected (
(109) Representative expression vectors constructed for the engineering of the -oxidation reversal to use the different primers and termination pathways outlined in
(110) While this modular framework demonstrates the required components for the operation of multiple cycle turns during a functional reversal of the -oxidation cycle, the overall low levels of longer chain fatty acids demonstrate the opportunity for future investigation into the overall integration of the core pathway components as well as the identification and incorporation of highly specific termination pathways enabling the production of a wide array of products with varying carbon length and functionality.
Conclusions
(111) An engineered reversal of the -oxidation cycle was constructed using a synthetic/bottom-up approach based on the in vitro kinetic characterization of individual functional units and their in vivo assembly. This strategy enabled the synthesis of a variety of 4-C carboxylic acids resulting from a one-turn functional reversal of the -oxidation cycle, as the individual thiolase (AtoB), 3-hydroxyacyl-CoA dehydrogenase (FadB), enoyl-CoA hydratase (FadB), and acyl-CoA dehydrogenase/trans-enoyl-CoA reductase (egTER) components exerted the majority of the control over product formation with native thioesterase termination pathways. Through the integration of a thiolase capable of acting on longer chain intermediates (FadA), the initiation of multiple cycle turns leading to the production of longer chain products was also demonstrated.
(112) This modular framework for the synthesis of 4-C and higher compounds overcomes some limitations with the previously used system-level/top-down approach (due to the ill-defined nature of the individual components of the pathway), providing a clean platform that can be transferred to other hosts/organisms. The self-contained and host-independent functional units identified in this study provide the core metabolic platform required for the efficient production of a wide array of compounds attainable from key intermediates of the reversal of the -oxidation cycle. Further identification and integration of selective termination pathways should provide the required functionality to expand the portfolio of components.
(113) This combined with further optimization, should enable the integration of this pathway within other industrial hosts allowing the advantageous nature of a reversal of the -oxidation cycle to be fully exploited for the synthesis of a wide array of drop-in biofuels and biochemicals.
(114) It should be remembered that while butyrate and other simple fatty acids were chosen to exemplify a functional reverse pathway, these are to be considered exemplary only and many products can be made with the invention, such as those listed in Tables 3A-B.
Materials & Methods
(115) Wild-type K12 Escherichia coli strain MG1655.sup.35 was used as the host for all genetic modifications. Gene knockouts were introduced in MG1655 and its derivatives by P1 phage transduction.sup.36, 37. Single gene knockout mutants from the National BioResource Project (NIG, Japan).sup.38 were used as donors of specific mutations. All mutations were confirmed by polymerase chain reaction and the disruption of multiple genes in a common host was achieved as previously described.sup.36. All resulting strains used in this study are listed in Supplementary Table 51.
(116) Gene overexpression was achieved by cloning the desired gene(s) in either low-copy (pZS.sup.36) or higher copy based vectors (pTrcHis2A, abbreviated pTH.sub.A; Invitrogen, Carlsbad, Calif.) utilizing In-Fusion PCR cloning technology (Clontech Laboratories, Inc., Mountain View, Calif.). Cloning inserts were created via PCR of ORFs of interest from E. coli genomic DNA using the primers listed in Supplementary Table S2 with Phusion DNA polymerase under standard conditions described by the supplier (Thermo Scientific, Waltham, Mass.). Amplification of the trans-2-enoyl-CoA reductase gene from E. gracilis (egTER) was performed as above except using a plasmid harboring a codon-optimized egTER synthesized by GenScript (Piscataway, N.J.). When appropriate, a RBS was added via primer synthesis. Vector backbone was purified from E. coli cultures (Qiagen, Valencia, Calif.) and digested with the restriction enzymes listed in Supplementary Table S2 as according to the manufacturer (New England Biolabs, Ipswich, Mass.) to enable cloning. The resulting In-Fusion products were used to transform E. coli Stellar cells (Clontech Laboratories, Inc., Mountain View, Calif.) and positive clones confirmed by PCR, restriction digestion, and DNA sequencing.
(117) All molecular biology techniques were performed with standard methods.sup.37, 39 or by manufacturer protocol. Strains were kept in 32.5% glycerol stocks at 80 C. Plates were prepared using LB medium containing 1.5% agar, and appropriate antibiotics were included at the following concentrations: ampicillin (100 g/mL), kanamycin (50 g/mL), and chloramphenicol (34 g/mL).
(118) The minimal medium designed by Neidhardt et al..sup.40, with 100 mM MOPS and Na.sub.2HPO.sub.4 in place of K.sub.2HPO.sub.4, supplemented with 20 g/L glycerol, 10 g/L tryptone, 5 g/L yeast extract, 100 M Feso.sub.4, 5 mM calcium pantothenate, 1.48 mM Na.sub.2HPO.sub.4, 5 mM (NH.sub.4).sub.2SO.sub.4, and 30 mM NH.sub.4Cl was used for all fermentations unless otherwise stated. Antibiotics (100 g/mL ampicillin and 34 g/mL chloramphenicol) and inducers (0.1 M Isopropyl -D-1-thiogalactopyranoside and 100 ng/mL anhydrotetracycline) were included when appropriate. All chemicals were obtained from Fisher Scientific Co. (Pittsburgh, Pa.) and Sigma-Aldrich Co. (St. Louis, Mo.).
(119) Fermentations were conducted in 25 mL Pyrex Erlenmeyer flasks (narrow mouth/heavy duty rim, Corning Inc., Corning, N.Y.) filled with 20 mL of the above culture medium and sealed with foam plugs filling the necks. A single colony of the desired strain was cultivated overnight (14-16 hrs) in LB medium with appropriate antibiotics and used as the inoculum (1%) for all fermentations. After inoculation, flasks were incubated at 37 C. and 200 rpm in an NBS C24 Benchtop Incubator Shaker (New Brunswick Scientific Co., Inc., Edison, N.J.) until an optical density of 0.3-0.5 was reached, at which point IPTG and anhydrotetracycline were added. Flasks were then incubated under the same conditions for 48 hrs post-induction unless otherwise stated.
(120) Optical density was measured at 550 nm in a Thermo Spectronic Genesys 20 (Thermo Scientific, Waltham, Mass.) and used as an estimate of cell mass (1 O.D..sub.550=0.34 g dry weight/L).sup.41. Identification of short chain (C4) metabolites was conducted through nuclear magnetic resonance (NMR) as previously described.sup.8 while longer chain fatty acids were identified via gas chromatography-mass spectroscopy (GC-MS). Identification of fatty acids was performed on an Agilent 7890A GC system (Agilent Technologies, Santa Clara, Calif.), equipped with a 5975C inert XL mass selective detector (Agilent Technologies, Santa Clara, Calif.) and an Rxi-5Sil column (0.25 mm internal diameter, 0.10 m film thickness, 30 m length; Restek, Bellefonte, Pa.), following the method: an initial temperature of 35 C. held for 1 min, 6 C./min to 200 C., 30 C./min to 270 C., held for 1 min. Extraction and derivatization procedures were as described below. Helium (2.6 mL/min, Matheson Tri-Gas, Longmont, Colo.) was used as the carrier gas. The injector and detector were maintained at 280 C. A 2 L sample was injected using a 40:1 split ratio.
(121) Quantification of glycerol and metabolic products in the culture supernatant was conducted through high-performance liquid chromatography (HPLC) and gas chromatography-flame ionization detection (GC-FID). The concentrations of glycerol, ethanol, and organic acids were determined via ion-exclusion HPLC using a Shimadzu Prominence SIL 20 system (Shimadzu Scientific Instruments, Inc., Columbia, Md.) equipped with an HPX-87H organic acid column (Bio-Rad, Hercules, Calif.) with operating conditions to optimize peak separation (0.3 ml/min flowrate, 30 mM H.sub.2SO.sub.4 mobile phase, column temperature 42 C.).sup.42.
(122) Additional quantification of fatty acids (C4-C12) and fatty acid methyl esters (C14-C18) was carried out in a Varian CP-3800 gas chromatograph (Varian Associates, Inc., Palo Alto, Calif.), equipped with a flame ionization detector (GC-FID) and an HP-INNOWax capillary column (0.32 mm internal diameter, 0.50 m film thickness, 30 m length; Agilent Technologies, Inc., Santa Clara, Calif.), following the method: 50 C. held for 3 min, 10 C./min to 250 C., and 250 C. held for 10 min. Helium (1.8 mL/min, Matheson Tri-Gas, Longmont, Colo.) was used as the carrier gas. The injector and detector were maintained at 220 C. and 275 C., respectively. A 1 l sample was injected in splitless injection mode.
(123) For the identification of fatty acids, supernatant aliquots of 2 mL were transferred to 5 mL glass vials (Fisher Scientific Co., Pittsburgh, Pa.). Samples were supplemented with 1.2 L of 1-nonanol as internal standard, and extracted with 2 mL of hexane. Vials were tightly closed, vortexed for 30 s, and mixed in a Glas-Col rotator (Glas-Col, Terre Haute, Ind.) at 60 rpm for 2 hours. Samples were then vortexed again for 30 s and centrifuged at 8000 rpm at 4 C. for 1 min. Aliquots of 700 L of the top organic layer were transferred to 2 mL borosilicate glass vials with PTFE/silicone screw caps (Fisher Scientific Co., Pittsburgh, Pa.) and mixed with 50 L of pyridine and 50 L of BSTFA (N,O-bis(trimethylsilyl)trifluoroacetamide). Samples were incubated in sealed vials at 70 C. for 30 min using an AccuBlock Digital Dry Bath (LabNet, Woodbridge, N.J.) and silylated samples were analyzed via GC-MS.
(124) For the quantification of fatty acids and fatty acid methyl esters, supernatant aliquots of 2 mL were transferred to 5 mL glass vials (Fisher Scientific Co., Pittsburgh, Pa.). Samples were acidified with sulfuric acid, supplemented with 2 mg of tridecanoic acid as internal standard, and extracted with 2 mL of a mixture of hexane:chloroform (4:1, v/v). Vortex, rotation, and centrifugation were done as described above. For the quantification of short- and medium-chain fatty acids (C4-C12), 1 mL of the organic layer was aliquoted into 2 mL borosilicate glass vials with PTFE/silicone screw caps (Fisher Scientific Co., Pittsburgh, Pa.) and analyzed via GC-FID.
(125) For the quantification of longer-chain fatty acids (C14-C18), 1 mL of the organic layer was transferred to 2 mL glass vials (Fisher Scientific Co., Pittsburgh, Pa.). Samples were nitrogen evaporated to near dryness, re-dissolved in 1 mL of a mixture of methanol:chloroform:sulfuric acid (30:3:1, v/v/v) and incubated in a sealed vial at 90 C. for 60 min using an AccuBlock Digital Dry Bath (LabNet, Woodbridge, N.J.). Water (1 mL) was added to each tube, and fatty acid methyl esters (FAMEs) were extracted with 2 mL of hexane:chloroform (4:1, v/v). After extraction, 1 mL of the organic layer was aliquoted into 2 mL borosilicate glass vials with PTFE/silicone screw caps (Fisher Scientific Co., Pittsburgh, Pa.) and analyzed via GC-FID.
(126) Stearic (C.sub.18:0), palmitic (C.sub.16:0), myristic (C.sub.14:0), lauric (C.sub.12:0), capric (C.sub.10:0), caprylic (C.sub.8:0), caproic (C.sub.6:0), and butyric (C.sub.4:0) acids (Sigma Chemical Co., St. Louis, Mo.) were used to calibrate the gas chromatograph. Hexane (High Resolution Gas Chromatography grade) and chloroform (reagent grade) were used as extraction solvents (Fisher Scientific Co., Pittsburgh, Pa.). 1-Nonanol, pyridine (HPLC grade) and BSTFA (synthesis grade) were used for the silylation reaction (Sigma Chemical Co., St. Louis, Mo.). Methanol and concentrated sulfuric acid used for the esterification reaction were reagent grade (Fisher Scientific Co., Pittsburgh, Pa.).
(127) When stated, product yields (mmol/mmol glycerol or g/g glycerol) represent the amount of product synthesized per amount of glycerol consumed during the length of the fermentation (48 hrs unless otherwise stated).
(128) For enzyme characterization, E. coli fadA and fadB genes were cloned from MG1655 genomic DNA into the pUCBB-ntH6 vector.sup.43 to yield a constitutively expressed gene with a n-terminal 6 His-tag that can be cleaved by Thrombin. fadA was amplified as two halves with the primers fadANdeI5p:fadAmidrev (1.sup.st half) and fadAmidfor:fadANotI3p (2.sup.nd half) (Supplementary Table S3).
(129) fadB was amplified in three parts with fadBNdeI5p:fadBmid1rev (1.sup.st part), fadBmid1for:fadBmid2rev (2.sup.nd part), and fadBmid2for:fadBNotI3p (3.sup.rd part) (Supplementary Table S3). fadA and fadB PCR products sections were combined by overlap extension PCR to yield the whole genes, which were subsequently digested with NdeI and NotI restriction enzymes and ligated into pUCBB-ntH6 that was previously digested with NdeI and NotI to yield pUCBB-ntH6-FadA and pUCBB-ntH6-FadB.
(130) The hbd gene from Clostridium acetobutylicum ATCC 824 (caHBD) was cloned into pUCBB-pBAD.sup.43 to yield an arabinose inducible caHBD gene with a c-terminal His.sub.6-tag. caHBD was PCR amplified from the genome of Clostridium acetobutylicum ATCC 824 using the caHBDBglii5p and caHBDxhoI3p primers (Supplementary Table S3). The resulting PCR product was then digested with BglII and XhoI and ligated into pUCBB-pBAD previously digested with BglII and XhoI to yield pUCBB-pBAD-caHBD.
(131) For AtoB and thioesterase characterization assays, the pCA24N-gene (-gfp) plasmids from the ASKA collection.sup.44 were used. For expression of E. gracilis TER for kinetic characterization, the egTER gene was cloned into pTrcHis2A using the In-Fusion protocol (Clontech Laboratories, Inc., Mountain View, Calif.) following PCR amplification from the aforementioned codon-optimized egTER containing plasmid with the primer pair of F1pTH6hisEgter and R1pTH6hisEgter (Supplementary Table S3).
(132) Cultures for enzymatic assays were grown overnight in 100 mL of LB media at 37 C. in 250 mL baffled flasks (Wheaton Industries, Inc., Millville, N.J.) in E. coli BL21 (DE3) cells induced with either 1 mM IPTG (pCA24N, pTrcHis2A) or 1 mM Arabinose (pUCBB-pBAD) at an OD.sub.6000.6, or expressed constitutively (pUCBB-ntH6). Reactions were monitored on either a Synergy HT plate reader (BioTek Instruments, Inc., Winooski, Vt.) at 25 C. (for reactions monitored at 300 nm or higher) or in a Biomate 5 Spectrophotometer (Thermo Scientific, Waltham, Mass.) for reactions at 263 nm.
(133) Cells were lysed using Bacterial Protein Extraction Reagent (B-PER) (Thermo Scientific, Waltham, Mass.) as per the prescribed protocol in order to obtain the supernatant containing the active enzymes. FadE and YdiO were purified following previously established methods.sup.45 using the same growth conditions mentioned above.
(134) Cell pellets were resuspended in 40 mL of 50 mM potassium phosphate buffer pH 7.2 and broken by disruption EmulsiFlex-05 homogenizer (Avestin, Ottawa, ON). Disrupted cells were then spun for 90 min at 4 C. at 120,000g in a Optima L-80XP Ultracentrifuge (Beckman-Coulter, Schaumburg, Ill.) to produce the supernatant used for assays.
(135) For specific activity assays (reported in mol substrate/mg protein/min) these supernatant fractions were utilized and protein concentration was established using the Bradford Reagent (Thermo Scientific, Waltham, Mass.) using BSA as the protein standard. Linearity was established for each reaction and the background non-enzymatic rate was subtracted to establish the activity.
(136) For kinetic characterization, his-tagged proteins of AtoB, FadA, FadB, caHBD, egTER were purified from the B-PER supernatant fractions using Talon Metal Affinity Resin (Clontech Laboratories, Inc., Mountain View, Calif.) using gravity purification. In short, the supernatant was mixed for 1 hr at room temperature on a LabQuake rotator (Fisher Scientific, Pittsburgh, Pa.) with approximately 2 mL of Talon Resin (1 resin/0.3 mg supernatant protein) that was pre-washed twice with Buffer A (50 mM Tris pH 7.9, 5 mM MgCl.sub.2, 100 mM NaCl, 5 mM Imidazole). Resin was then spun at 700g for 5 min to remove the non-bound proteins, washed with 20 (40 mL) Buffer A, resuspended in 20 (40 mL) Buffer B (Buffer A with 20 mM Imidazole) and loading onto a gravity column. Buffer B was then drained off and the protein was eluted with 20 mL of Buffer C (Buffer A with 250 mM Imidazole). The eluted fraction was then concentrated and used for kinetic characterizations. Enzyme concentration was established by measuring the absorbance at 260 nm and extinction coefficients predicted for each enzyme by the ProtParam program (web.expasy.org/protparam/).
(137) For kinetic characterization, an appropriate amount of enzyme was established by checking linear range near predicted K.sub.M values. Then, the rates were measured for a range of substrates in order to establish k.sub.cat and K.sub.M. In the cases of FadB for the crotonase reaction and FadA in the forward thiolase reaction coupled with HBD, substrate saturation could not be established, as such, the k.sub.cat/K.sub.M for the reaction was determined by dividing the linear slope of Velocity vs. [Substrate] by the amount of enzyme used in the assays. For reactions that could be saturated, Velocity vs. [Substrate] was fitted by the EnzKIN Matlab module (mathworks.com/matlabcentral/fileexchange/26653) to establish V.sub.max and K.sub.M.
(138) The forward thiolase assay (i.e. biosynthetic direction) and -hydroxybutyryl-CoA dehydrogenase assays were performed in the presence of 1.5 mM DTT, 4.5 mM MgCl.sub.2, 100 mM Tris HCl pH 7.5 and 0.2 mM NADH in a total volume of 200 L at 25 C..sup.46.
(139) -hydroxybutyryl-CoA dehydrogenase activity was monitored by following the oxidation of NADH at 340 nm while thiolase activity in the forward direction was measured at 340 nm in a coupled assay in which 10U excess of caHBD was present to reduce the acetoacetyl-CoA generated from thiolase activity.
(140) Thiolase activity in the reverse direction was determined in the presence of 0.5 mM DTT, 4.5 mM MgCl.sub.2, 100 mM Tris HCl pH 7.5 and 2 mM CoA in a total volume of 200 L at 25 C..sup.47. Activity was monitored by the loss of acetoacetyl-CoA at 303 nm using an extinction coefficient of 14 mM.sup.1 cm.sup.1. Crotonase activity was monitored by following the loss of crotonoyl-CoA at 263 nm (=6.7 mM.sup.1 cm.sup.1) in the presence of 100 mM Tris HCL pH 7.5 in 200 L total volume.
(141) For egTER, crotonyl-CoA reductase activity was followed by monitoring the loss of NADH absorbance in the presence of 100 mM Tris HCL pH 7.5 and 0.2 mM NADH in a final volume of 200 L at 25 C..sup.46.
(142) For FadE and YdiO, Butyryl-CoA dehydrogenase activity was measured utilizing ferricenium ion.sup.49. Reactions were performed in 50 mM potassium phosphate pH 7.2, 0.4 mM MgSO.sub.4, 200 M ferrocenium hexafluorophosphate, and 200 M Butyryl-CoA and monitored the formation of the reduced ferrocene ion at 300 nm (=4.3 mM.sup.1 cm.sup.1).
(143) Thioesterase activity was monitored by following the production of TNB at 412 nm (=4.3 mM.sup.1 cm.sup.1).sup.30. Reactions were carried out in the presence of 100 mM Tris pH 7.5, 200 mM KCl, 25 mM DTNB and 200 M of the -CoA substrate in a volume of 200 L at 25 C.
(144) All substrates and chemicals for enzyme assays were obtained from Fisher Scientific Co. (Pittsburgh, Pa.) and Sigma-Aldrich Co. (St. Louis, Mo.).
(145) Below are the Tables:
(146) TABLE-US-00001 TABLE 1 in vitro kinetic characterization of enzymes involved in a functional reversal of the -oxidation cycle. Specific Activity Protein Substrate k.sub.cat (s.sup.1) K.sub.M (M) k.sub.cat/K.sub.M (M.sup.1 s.sup.1) (mol/mg/min) AtoB Acetyl-CoA 3.17 0.18 892.0 56.5 3.55 10.sup.3 0.919 0.002.sup.b Acetoacetyl-CoA 9.23 0.34 68.1 2.56 1.36 10.sup.5 0.36 0.05.sup.b FadA Acetyl-CoA 7.47.sup.a Not detected.sup.c Acetoacetyl-CoA 0.75 0.09 422.5 57.3 1.77 10.sup.3 0.013 0.002.sup.c FadB Acetoacetyl-CoA 25.9 1.2 390.0 19.2 6.65 10.sup.4 0.185 0.001.sup.c Crotonyl-CoA 3.19 10.sup.3a 0.051 0.004.sup.c egTER Crotonyl-CoA 1.14 0.08 98.5 7.7 1.16 10.sup.4 5.4 0.6.sup.d FadE Butyryl-CoA 0.008 0.001.sup.b YdiO Butyryl-CoA 0.009 0.003.sup.b YciA Acetyl-CoA 6.9 0.1 42.7 1.2 1.61 10.sup.5 0.222 0.007.sup.b Acetoacetyl-CoA 264.6 54.7 875.7 180.9 3.02 10.sup.5 0.672 0.007.sup.b RS-3-Hydroxybutyryl- 32.4 3.5 353.8 38.8 9.15 10.sup.5 0.441 0.009.sup.b CoA Crotonyl-CoA 46.4 7.7 1348.8 235.5 3.44 10.sup.5 0.27 0.03.sup.b Butyryl-CoA 557.5 79.6 641.8 91.9 8.69 10.sup.5 2.9 0.2.sup.b .sup.acould not be saturated .sup.bexpressed from pCA24N .sup.cexpressed from pUCBB-ntH6 .sup.dexpressed from pTrcHis2A
(147) TABLE-US-00002 TABLE 2 Specific activities of selected thioesterases on relevant CoA intermediates (mol/mg protein/min) Protein.sup.a Acetyl-CoA Acetoacetyl-CoA RS-3-Hydroxybutyryl-CoA Crotonyl-CoA Butyryl-CoA Decanyl-CoA FadM 0.0331 0.0006 0.042 0.004 0.009 0.002 0.0017 0.0003 0.027 0.001 0.034 0.003 TesA 0.036 0.002 0.044 0.005 0.02 0.01 0.007 0.003 0.049 0.002 0.47 0.04 TesB 0.030 0.001 0.056 0.001 0.032 0.002 0.010 0.001 0.101 0.002 0.6 0.1 YbgC 0.036 0.002 0.065 0.002 0.016 0.004 0.006 0.001 0.045 0.007 0.06 0.02 YciA 0.222 0.007 0.672 0.007 0.441 0.009 0.27 0.03 2.9 0.2 3.7 0.3 YdiI 0.036 0.003 0.047 0.001 0.012 0.002 0.078 0.005 0.0917 0.0007 0.18 0.04 .sup.agenes encoding each protein expressed from pCA24N
(148) TABLE-US-00003 TABLE 3A Synthesis of functionalized carboxylic acids (dicarboxylic acids, hydroxy acids, aminated acids, branched chain acids) and their -substituted derivatives via engineered reversal of the b-oxidation cycle by using functionalized primers and thioesterases as termination pathways. Primer Genotype (mutations) Product(s) -hydroxylated primers Hydroxyacetyl-CoA JC01 fadB fadJ paaH [THIL+ THIE+] 4-hydroxy-3-oxo-butyric acid (glycolyl-CoA) JC01 fadE ydiO [THIL + fadB+ THIE+] 3,4-dihydroxybutyric acid JC01 fadE ydiO [THIL+ fadB+ THIE+] 4-hydroxy-trans-D.sup.2-butyric acid JC01 [THIL+ fadB+ ydiO+ ydiQRST+ ydbK+ THIE+] 4-hydroxybutyric acid JC01 [THIL+ fadB+ fadE+ ydiQRST+ ydbK+ THIE+] JC01 [THIL+ fadB+ Ter+ THIE+] JC01 [THIL+ fadBA+ ydiO+ ydiQRST+ ydbK+ THIE+] 3-oxo-n-hydroxy monocarboxylic acids, 3,n- JC01 [THIL+ fadBA+ fadE+ ydiQRST+ ydbK+ THIE+] dihydroxy monocarboxylic acids, n-hydroxy, JC01 [THIL+ fadBA+ Ter+ THIE+] trans-.sup.2 monocarboxylic acids, n-hydroxy monocarboxylic acids (even chain lengths, C4-C16) Hydroxypropionyl- JC01 fadB fadJ paaH [THIL+ THIE+] 5-hydroxy-3-oxo-pentanoic acid CoA JC01 fadE ydiO [THIL + fadB+ THIE+] 3,5-dihydroxy pentanoic acid JC01 fadE ydiO [THIL+ fadB+ THIE+] 5-hydroxy-trans-D.sup.2-pentanoic acid JC01 [THIL+ fadB+ ydiO+ ydiQRST+ ydbK+ THIE+] 5-hydroxy pentanoic acid JC01 [THIL+ fadB+ fadE+ ydiQRST+ ydbK+ THIE+] JC01 [THIL+ fadB+ Ter+ THIE+] JC01 [THIL+ fadBA+ ydiO+ ydiQRST+ ydbK+ THIE+] 3-oxo-n-hydroxy monocarboxylic acids, 3,n- JC01 [THIL+ fadBA+ fadE+ ydiQRST+ ydbK+ THIE+] hydroxy monocarboxylic acids, n-hydroxy, JC01 [THIL+ fadBA+ Ter+ THIE+] trans-.sup.2 monocarboxylic acids, n-hydroxy monocarboxylic acids (odd chain lengths, C5-C17) Hydroxybutyryl- JC01 fadB fadJ paaH [THIL+ THIE+] 6-hydroxy-3-oxo-hexanoic acid CoA JC01 fadE ydiO [THIL + fadB+ THIE+] 3,6-dihydroxy hexanoic acid JC01 fadE ydiO [THIL+ fadB+ THIE+] 6-hydroxy-trans-D.sup.2-hexanoic acid JC01 [THIL+ fadB+ ydiO+ ydiQRST+ ydbK+ THIE+] 6-hydroxy hexanoic acid JC01 [THIL+ fadB+ fadE+ ydiQRST+ ydbK+ THIE+] JC01 [THIL+ fadB+ Ter+ THIE+] JC01 [THIL+ fadBA+ ydiO+ ydiQRST+ ydbK+ THIE+] 3-oxo-n-hydroxy monocarboxylic acids, 3,n- JC01 [THIL+ fadBA+ fadE+ ydiQRST+ ydbK+ THIE+] dihydroxy monocarboxylic acids, n-hydroxy, JC01 [THIL+ fadBA+ Ter+ THIE+] trans-.sup.2 monocarboxylic acids, n-hydroxy monocarboxylic acids (even chain lengths, C6-C18) -carboxylated primers Oxalyl-CoA JC01 fadB fadJ paaH [THIL+ THIE+] 3-oxo-succinic acid JC01 fadE ydiO [THIL + fadB+ THIE+] 3-hydroxy-succinic acid JC01 fadE ydiO [THIL+ fadB+ THIE+] trans-D.sup.2-butenedioic acid (fumaric acid) JC01 [THIL+ fadB+ ydiO+ ydiQRST+ ydbK+ THIE+] butanedioic acid (succinic acid) JC01 [THIL+ fadB+ fadE+ ydiQRST+ ydbK+ THIE+] JC01 [THIL+ fadB+ Ter+ THIE+] JC01 [THIL+ fadBA+ ydiO+ ydiQRST+ ydbK+ THIE+] 3-oxo-dicarboxylic acids, 3-hydroxy dicarboxylic JC01 [THIL+ fadBA+ fadE+ ydiQRST+ ydbK+ THIE+] acids, trans-.sup.2 dicarboxylic acids, dicarboxylic JC01 [THIL+ fadBA+ Ter+ THIE+] acids (even chain lengths, C4-C16) Malonyl-CoA JC01 fadB fadJ paaH [THIL+ THIE+] 3-oxo-pentanedioic acid JC01 fadE ydiO [THIL + fadB+ THIE+] 3-hydroxy-pentanedioic acid JC01 fadE ydiO [THIL+ fadB+ THIE+] trans-D.sup.2-pentanedioic acid JC01 [THIL+ fadB+ ydiO+ ydiQRST+ ydbK+ THIE+] pentanedioic acid (glutaric acid) JC01 [THIL+ fadB+ fadE+ ydiQRST+ ydbK+ THIE+] JC01 [THIL+ fadB+ Ter+ THIE+] JC01 [THIL+ fadBA+ ydiO+ ydiQRST+ ydbK+ THIE+] 3-oxo-dicarboxylic acids, 3-hydroxy dicarboxylic JC01 [THIL+ fadBA+ fadE+ ydiQRST+ ydbK+ THIE+] acids, trans-.sup.2 dicarboxylic acids, dicarboxylic JC01 [THIL+ fadBA+ Ter+ THIE+] acids (odd chain lengths, C5-C17) Succinyl-CoA JC01 fadB fadJ paaH [THIL+ THIE+] 3-oxo-hexanedioic acid JC01 fadE ydiO [THIL + fadB+ THIE+] 3-hydroxy-hexanedioic acid JC01 fadE ydiO [THIL+ fadB+ THIE+] trans-D.sup.2-hexanedioic acid JC01 [THIL+ fadB+ ydiO+ ydiQRST+ ydbK+ THIE+] hexanedioic acid (adipic acid) JC01 [THIL+ fadB+ fadE+ ydiQRST+ ydbK+ THIE+] JC01 [THIL+ fadB+ Ter+ THIE+] JC01 [THIL+ fadBA+ ydiO+ ydiQRST+ ydbK+ THIE+] 3-oxo dicarboxylic acids, n-hydroxy dicarboxylic JC01 [THIL+ fadBA+ fadE+ ydiQRST+ ydbK+ THIE+] acids, trans-.sup.2 dicarboxylic acids, dicarboxylic JC01 [THIL+ fadBA+ Ter+ THIE+] acids (even chain lengths, C6-C18) -aminated primers 2-aminoacetyl-CoA JC01 fadB fadJ paaH [THIL+ THIE+] 4-amino-3-oxo-butyric acid JC01 fadE ydiO [THIL + fadB+ THIE+] 4-amino-3-hydroxy-butyric acid JC01 fadE ydiO [THIL+ fadB+ THIE+] 4-amino-trans-D.sup.2-butyric acid JC01 [THIL+ fadB+ ydiO+ ydiQRST+ ydbK+ THIE+] 4-amino-butyric acid JC01 [THIL+ fadB+ fadE+ ydiQRST+ ydbK+ THIE+] JC01 [THIL+ fadB+ Ter+ THIE+] JC01 [THIL+ fadBA+ ydiO+ ydiQRST+ ydbK+ THIE+] 3-oxo-n-amino monocarboxylic acids, 3- JC01 [THIL+ fadBA+ fadE+ ydiQRST+ ydbK+ THIE+] hydroxy-n-amino monocarboxylic acids, n-amino, JC01 [THIL+ fadBA+ Ter+ THIE+] trans-.sup.2 monocarboxylic acids, n-amino monocarboxylic acids (even chain lengths, C4-C16) 3-aminopropionyl- JC01 fadB fadJ paaH [THIL+ THIE+] 5-amino-3-oxo-pentanoic acid CoA JC01 fadE ydiO [THIL + fadB+ THIE+] 5-amino-3-hydroxy-pentanoic acid JC01 fadE ydiO [THIL+ fadB+ THIE+] 5-amino-trans-D.sup.2-pentanoic acid JC01 [THIL+ fadB+ ydiO+ ydiQRST+ ydbK+ THIE+] 5-amino-pentanoic acid JC01 [THIL+ fadB+ fadE+ ydiQRST+ ydbK+ THIE+] JC01 [THIL+ fadB+ Ter+ THIE+] JC01 [THIL+ fadBA+ ydiO+ ydiQRST+ ydbK+ THIE+] 3-oxo-n-amino monocarboxylic acids, 3- JC01 [THIL+ fadBA+ fadE+ ydiQRST+ ydbK+ THIE+] hydroxy-n-amino monocarboxylic acids, n-amino, JC01 [THIL+ fadBA+ Ter+ THIE+] trans-.sup.2 monocarboxylic acids, n-amino monocarboxylic acids (odd chain lengths, C5-C17) 4-aminobutyryl- JC01 fadB fadJ paaH [THIL+ THIE+] 6-amino-3-oxo-hexanoic acid CoA JC01 fadE ydiO [THIL + fadB+ THIE+] 6-amino-3-hydroxy-hexanoic acid JC01 fadE ydiO [THIL+ fadB+ THIE+] 6-amino-trans-D.sup.2-hexanoic acid JC01 [THIL+ fadB+ ydiO+ ydiQRST+ ydbK+ THIE+] 6-amino-hexanoic acid (6-aminocaproic acid) JC01 [THIL+ fadB+ fadE+ ydiQRST+ ydbK+ THIE+] JC01 [THIL+ fadB+ Ter+ THIE+] JC01 [THIL+ fadBA+ ydiO+ ydiQRST+ ydbK+ THIE+] 3-oxo-n-amino monocarboxylic acids, 3- JC01 [THIL+ fadBA+ fadE+ ydiQRST+ ydbK+ THIE+] hydroxy-n-amino monocarboxylic acids, n-amino, JC01 [THIL+ fadBA+ Ter+ THIE+] trans-.sup.2 monocarboxylic acids, n-amino monocarboxylic acids (even chain lengths, C6-C18) non-terminal/secondary carbon functionalized primers Isobutyryl-CoA JC01 fadB fadJ paaH [THIL+ THIE+] 4-methyl-3-oxo-pentanoic acid JC01 fadE ydiO [THIL + fadB+ THIE+] 4-methyl-3-hydroxy-pentanoic acid JC01 fadE ydiO [THIL+ fadB+ THIE+] 4-methyl-trans-D.sup.2-pentanoic acid JC01 [THIL+ fadB+ ydiO+ ydiQRST+ ydbK+ THIE+] 4-methyl-pentanoic acid JC01 [THIL+ fadB+ fadE+ ydiQRST+ ydbK+ THIE+] JC01 [THIL+ fadB+ Ter+ THIE+] JC01 [THIL+ fadBA+ ydiO+ ydiQRST+ ydbK+ THIE+] 3-oxo-(n-1)-methyl-monocarboxylic acids, 3- JC01 [THIL+ fadBA+ fadE+ ydiQRST+ ydbK+ THIE+] hydroxy-(n-1)-methyl-monocarboxylic acids, JC01 [THIL+ fadBA+ Ter+ THIE+] (n-1)-methyl-trans-.sup.2 monocarboxylic acids, (n-1)-methyl-monocarboxylic acids (odd chain lengths, C5-C17) 3-methyl-butyryl- JC01 fadB fadJ paaH [THIL+ THIE+] 5-methyl-3-oxo-hexanoic acid CoA JC01 fadE ydiO [THIL + fadB+ THIE+] 5-methyl-3-hydroxy-hexanoic acid JC01 fadE ydiO [THIL+ fadB+ THIE+] 5-methyl-trans-D.sup.2-hexanoic acid JC01 [THIL+ fadB+ ydiO+ ydiQRST+ ydbK+ THIE+] 5-methyl-hexanoic acid JC01 [THIL+ fadB+ fadE+ ydiQRST+ ydbK+ THIE+] JC01 [THIL+ fadB+ Ter+ THIE+] JC01 [THIL+ fadBA+ ydiO+ ydiQRST+ ydbK+ THIE+] 3-oxo-(n-1)-methyl-monocarboxylic acids, 3- JC01 [THIL+ fadBA+ fadE+ ydiQRST+ ydbK+ THIE+] hydroxy-(n-1)-methyl-monocarboxylic acids, JC01 [THIL+ fadBA+ Ter+ THIE+] (n-1)-methyl-trans-.sup.2 monocarboxylic acids, (n-1)-methyl-monocarboxylic acids (even chain lengths, C6-C18) 2- JC01 fadB fadJ paaH [THIL+ THIE+] 4-hydroxy-3-oxo-pentanoic acid hydroxypropionoyl- JC01 fadE ydiO [THIL + fadB+ THIE+] 3,4-dihydroxy-pentanoic acid CoA JC01 fadE ydiO [THIL+ fadB+ THIE+] 4-hydroxy-trans-D.sup.2-pentanoic acid JC01 [THIL+ fadB+ ydiO+ ydiQRST+ ydbK+ THIE+] 4-hydroxy-pentanoic acid JC01 [THIL+ fadB+ fadE+ ydiQRST+ ydbK+ THIE+] JC01 [THIL+ fadB+ Ter+ THIE+] JC01 [THIL+ fadBA+ ydiO+ ydiQRST+ ydbK+ THIE+] 3-oxo-(n-1)-hydroxy-monocarboxylic acids, JC01 [THIL+ fadBA+ fadE+ ydiQRST+ ydbK+ THIE+] 3,(n-1)-dihydroxy-monocarboxylic acids, JC01 [THIL+ fadBA+ Ter+ THIE+] (n-1)-hydroxy-trans-.sup.2 monocarboxylic acids, (n-1)-hydroxy-monocarboxylic acids (odd chain lengths, C5-C17) 3-hydroxybutyryl- JC01 fadB fadJ paaH [THIL+ THIE+] 5-hydroxy-3-oxo-hexanoic acid CoA JC01 fadE ydiO [THIL + fadB+ THIE+] 3,5-dihydroxy-hexanoic acid JC01 fadE ydiO [THIL+ fadB+ THIE+] 5-hydroxy-trans-D.sup.2-hexanoic acid JC01 [THIL+ fadB+ ydiO+ ydiQRST+ ydbK+ THIE+] 5-hydroxy-hexanoic acid
(149) TABLE-US-00004 TABLE 3B Synthesis of functionalized alcohols (hydroxy acids, triols, diols, aminated alcohols, branched chain alcohols) and their -substituted derivatives via engineered reversal of the b-oxidation cycle by using functionalized primers and aldehyde-forming acyl-CoA reductases and alcohol dehydrogenases as termination pathways. Primer Genotype (mutations) Product(s) -hydroxylated primers Hydroxyacetyl-CoA JC01 fadB fadJ paaH [THIL+ ACR+ ADH+] 1,4-dihydroxybutan-3-one (glycolyl-CoA) JC01 fadE ydiO [THIL + fadB+ ACR+ ADH+] butane-1,3,4-triol JC01 fadE ydiO [THIL+ fadB+ ACR+ ADH+] trans-D.sup.2-butene-1,4-diol JC01 [THIL+ fadB+ ydiO+ ydiQRST+ ydbK+ ACR+ butane-1,4-diol ADH+] JC01 [THIL+ fadB+ fadE+ ydiQRST+ ydbK+ ACR+ ADH+] JC01 [THIL+ fadB+ Ter+ ACR+ ADH+] JC01 [THIL+ fadBA+ ydiO+ ydiQRST+ ydbK+ ACR+ 3-oxo-1,n-diols, 1,3,n-triols, trans-.sup.2 1,n- ADH+] diols, 1,n-diols (even chain lengths, C4-C16) JC01 [THIL+ fadBA+ fadE+ ydiQRST+ ydbK+ ACR+ ADH+] JC01 [THIL+ fadBA+ Ter+ ACR+ ADH+] Hydroxypropionyl- JC01 fadB fadJ DpaaH [THIL+ ACR+ ADH+] 1,5-dihydroxypentan-3-one CoA JC01 fadE ydiO [THIL + fadB+ ACR+ ADH+] pentane-1,3,5-triol JC01 fadE ydiO [THIL+ fadB+ ACR+ ADH+] trans-D.sup.2-pentane-1,5-diol JC01 [THIL+ fadB+ ydiO+ ydiQRST+ ydbK+ ACR+ pentane-1,5-diol ADH+] JC01 [THIL+ fadB+ fadE+ ydiQRST+ ydbK+ ACR+ ADH+] JC01 [THIL+ fadB+ Ter+ ACR+ ADH+] JC01 [THIL+ fadBA+ ydiO+ ydiQRST+ ydbK+ ACR+ 3-oxo-1,n-diols, 1,3,n-triols, trans-.sup.2 1,n- ADH+] diols, 1,n-diols (odd chain lengths, C5-C17) JC01 [THIL+ fadBA+ fadE+ ydiQRST+ ydbK+ ACR+ ADH+] JC01 [THIL+ fadBA+ Ter+ ACR+ ADH+] Hydroxybutyryl- JC01 fadB fadJ paaH [THIL+ ACR+ ADH+] 1,6-dihydroxyhexan-3-one CoA JC01 fadE ydiO [THIL + fadB+ ACR+ ADH+] hexane-1,3,6-triol JC01 fadE ydiO [THIL+ fadB+ ACR+ ADH+] trans-D.sup.2-hexane-1,6-diol JC01 [THIL+ fadB+ ydiO+ ydiQRST+ ydbK+ ACR+ hexane-1,6-diol ADH+] JC01 [THIL+ fadB+ fadE+ ydiQRST+ ydbK+ ACR+ ADH+] JC01 [THIL+ fadB+ Ter+ ACR+ ADH+] JC01 [THIL+ fadBA+ ydiO+ ydiQRST+ ydbK+ ACR+ 3-oxo-1,n-diols, 1,3,n-triols, trans-.sup.2 1,n- ADH+] diols, 1,n-diols (even chain lengths, C6-C18) JC01 [THIL+ fadBA+ fadE+ ydiQRST+ ydbK+ ACR+ ADH+] JC01 [THIL+ fadBA+ Ter+ ACR+ ADH+] -carboxylated primers Oxalyl-CoA JC01 fadB fadJ paaH [THIL+ ACR+ ADH+] 4-hydroxy-2-oxobutanoic acid JC01 fadE ydiO [THIL + fadB+ ACR+ ADH+] 2,4-dihydroxybutanoic acid JC01 fadE ydiO [THIL+ fadB+ ACR+ ADH+] (E)-4-hydroxy-but-2-enoic acid JC01 [THIL+ fadB+ ydiO+ ydiQRST+ ydbK+ ACR+ 4-hydroxybutanoic acid ADH+] JC01 [THIL+ fadB+ fadE+ ydiQRST+ ydbK+ ACR+ ADH+] JC01 [THIL+ fadB+ Ter+ ACR+ ADH+] JC01 [THIL+ fadBA+ ydiO+ ydiQRST+ ydbK+ ACR+ (n-2)-oxo-n-hydroxy carboxylic acids, (n-2),n- ADH+] dihydroxy carboxylic acids, (E)-n-hydroxy-(n-2)- JC01 [THIL+ fadBA+ fadE+ ydiQRST+ ydbK+ ACR+ carboxylic acids, n-hydroxy carboxylic acids (even ADH+] chain lengths, C4-C16) JC01 [THIL+ fadBA+ Ter+ ACR+ ADH+] Malonyl-CoA JC01 fadB fadJ paaH [THIL+ ACR+ ADH+] 5-hydroxy-3-oxo-pentanoic acid JC01 fadE ydiO [THIL + fadB+ ACR+ ADH+] 3,5-dihydroxy-pentanoic acid JC01 fadE ydiO [THIL+ fadB+ ACR+ ADH+] (E)-5-hydroxypent-3-enoic acid JC01 [THIL+ fadB+ ydiO+ ydiQRST+ ydbK+ ACR+ 5-hydroxypentanoic acid ADH+] JC01 [THIL+ fadB+ fadE+ ydiQRST+ ydbK+ ACR+ ADH+] JC01 [THIL+ fadB+ Ter+ ACR+ ADH+] JC01 [THIL+ fadBA+ ydiO+ ydiQRST+ ydbK+ ACR+ (n-2)-oxo-n-hydroxy carboxylic acids, (n-2),n- ADH+] dihydroxy carboxylic acids, (E)-n-hydroxy-(n-2)- JC01 [THIL+ fadBA+ fadE+ ydiQRST+ ydbK+ ACR+ carboxylic acids, n-hydroxy carboxylic acids (even ADH+] chain lengths, C5-C17) JC01 [THIL+ fadBA+ Ter+ ACR+ ADH+] Succinyl-CoA JC01 fadB fadJ paaH [THIL+ ACR+ ADH+] 6-hydroxy-4-oxo-hexanoic acid JC01 fadE ydiO [THIL + fadB+ ACR+ ADH+] 4.6.-dihydroxy-hexanoic acid JC01 fadE ydiO [THIL+ fadB+ ACR+ ADH+] (E)-6-hydroxy-hex-4-enoic acid JC01 [THIL+ fadB+ ydiO+ ydiQRST+ ydbK+ ACR+ 6-hydroxy-hexanoic acid ADH+] JC01 [THIL+ fadB+ fadE+ ydiQRST+ ydbK+ ACR+ ADH+] JC01 [THIL+ fadB+ Ter+ ACR+ ADH+] JC01 [THIL+ fadBA+ ydiO+ ydiQRST+ ydbK+ ACR+ (n-2)-oxo-n-hydroxy carboxylic acids, (n-2),n- ADH+] dihydroxy carboxylic acids, (E)-n-hydroxy-(n-2)- JC01 [THIL+ fadBA+ fadE+ ydiQRST+ ydbK+ ACR+ carboxylic acids, n-hydroxy carboxylic acids (even ADH+] chain lengths, C6-C18) JC01 [THIL+ fadBA+ Ter+ ACR+ ADH+] -aminated primers 2-aminoacetyl-CoA JC01 fadB fadJ paaH [THIL+ ACR+ ADH+] 4-amino-1-hydroxy-butan-3-one JC01 fadE ydiO [THIL + fadB+ ACR+ ADH+] 4-amino-butane-1,3-diol JC01 fadE ydiO [THIL+ fadB+ ACR+ ADH+] (E)-4-amino-but-2-en-1-ol JC01 [THIL+ fadB+ ydiO+ ydiQRST+ ydbK+ ACR+ 4-amino-butan-1-ol ADH+] JC01 [THIL+ fadB+ fadE+ ydiQRST+ ydbK+ ACR+ ADH+] JC01 [THIL+ fadB+ Ter+ ACR+ ADH+] JC01 [THIL+ fadBA+ ydiO+ ydiQRST+ ydbK+ ACR+ n-amino-3-oxo-1-alcohols, n-amino-1,3-diols, (E)- ADH+] n-amino-2-1-alcohols, n-amino-1-alcohols (even JC01 [THIL+ fadBA+ fadE+ ydiQRST+ ydbK+ ACR+ chain lengths, C4-C16) ADH+] JC01 [THIL+ fadBA+ Ter+ ACR+ ADH+] 3-aminopropionyl- JC01 fadB fadJ paaH [THIL+ ACR+ ADH+] 5-amino-1-hydroxy-pentan-3-one CoA JC01 fadE ydiO [THIL + fadB+ ACR+ ADH+] 5-amino-pentane-1,3-diol JC01 fadE ydiO [THIL+ fadB+ ACR+ ADH+] (E)-5-amino-pent-2-en-1-ol JC01 [THIL+ fadB+ ydiO+ ydiQRST+ ydbK+ ACR+ 5-amino-pentan-1-ol ADH+] JC01 [THIL+ fadB+ fadE+ ydiQRST+ ydbK+ ACR+ ADH+] JC01 [THIL+ fadB+ Ter+ ACR+ ADH+] JC01 [THIL+ fadBA+ ydiO+ ydiQRST+ ydbK+ ACR+ n-amino-3-oxo-1-alcohols, n-amino-1,3-diols, (E)- ADH+] n-amino-2-1-alcohols, n-amino-1-alcohols (odd JC01 [THIL+ fadBA+ fadE+ ydiQRST+ ydbK+ ACR+ chain lengths, C5-C17) ADH+] JC01 [THIL+ fadBA+ Ter+ ACR+ ADH+] 4-aminobutyryl- JC01 fadB fadJ paaH [THIL+ ACR+ ADH+] 6-amino-1-hydroxy-hexan-3-one CoA JC01 fadE ydiO [THIL + fadB+ ACR+ ADH+] 6-amino-hexane-1,3-diol JC01 fadE ydiO [THIL+ fadB+ ACR+ ADH+] (E)-6-amino-hex-2-en-1-ol JC01 [THIL+ fadB+ ydiO+ ydiQRST+ ydbK+ ACR+ 6-amino-hexan-1-ol ADH+] JC01 [THIL+ fadB+ fadE+ ydiQRST+ ydbK+ ACR+ ADH+] JC01 [THIL+ fadB+ Ter+ ACR+ ADH+] JC01 [THIL+ fadBA+ ydiO+ ydiQRST+ ydbK+ ACR+ n-amino-3-oxo-1-alcohols, n-amino-1,3-diols, (E)- ADH+] n-amino-2-1-alcohols, n-amino-1-alcohols (even JC01 [THIL+ fadBA+ fadE+ ydiQRST+ ydbK+ ACR+ chain lengths, C6-C18) ADH+] JC01 [THIL+ fadBA+ Ter+ ACR+ ADH+] non-terminal/secondary carbon functionalized primers Isobutyryl-CoA JC01 fadB fadJ paaH [THIL+ ACR+ ADH+] 1-hydroxy-4-methyl-pentan-3-one JC01 fadE ydiO [THIL + fadB+ ACR+ ADH+] 4-methyl-pentane-1,3-diol JC01 fadE ydiO [THIL+ fadB+ ACR+ ADH+] (E)-4-methyl-pent-2-en-1-ol JC01 [THIL+ fadB+ ydiO+ ydiQRST+ ydbK+ ACR+ 4-methylpentan-1-ol ADH+] JC01 [THIL+ fadB+ fadE+ ydiQRST+ ydbK+ ACR+ ADH+] JC01 [THIL+ fadB+ Ter+ ACR+ ADH+] JC01 [THIL+ fadBA+ ydiO+ ydiQRST+ ydbK+ ACR+ (n-1)-methyl-3-oxo-alcohols, (n-1)-methyl-1,3,- ADH+] diols, (E)-(n-1)-methyl-2-1-alcohols, (n-1)-methyl- JC01 [THIL+ fadBA+ fadE+ ydiQRST+ ydbK+ ACR+ 1-alcohols (odd chain lengths, C5-C17) ADH+] JC01 [THIL+ fadBA+ Ter+ ACR+ ADH+] 3-methyl-butyryl- JC01 fadB fadJ paaH [THIL+ ACR+ ADH+] 1-hydroxy-5-methyl-hexan-3-one CoA JC01 fadE ydiO [THIL + fadB+ ACR+ ADH+] 5-methyl-hexane-1,3-diol JC01 fadE ydiO [THIL+ fadB+ ACR+ ADH+] (E)-5-methyl-hex-2-en-1-ol JC01 [THIL+ fadB+ ydiO+ ydiQRST+ ydbK+ ACR+ 5-methylhexan-1-ol ADH+] JC01 [THIL+ fadB+ fadE+ ydiQRST+ ydbK+ ACR+ ADH+] JC01 [THIL+ fadB+ Ter+ ACR+ ADH+] JC01 [THIL+ fadBA+ ydiO+ ydiQRST+ ydbK+ ACR+ (n-1)-methyl-3-oxo-alcohols, (n-1)-methyl-1,3,- ADH+] diols, (E)-(n-1)-methyl-2-1-alcohols, (n-1)-methyl- JC01 [THIL+ fadBA+ fadE+ ydiQRST+ ydbK+ ACR+ 1-alcohols (even chain lengths, C6-C18) ADH+] JC01 [THIL+ fadBA+ Ter+ ACR+ ADH+] 2- JC01 fadB fadJ paaH [THIL+ ACR+ ADH+] 1,4-dihydroxy-pentan-3-one hydroxypropionoyl- JC01 fadE ydiO [THIL + fadB+ ACR+ ADH+] petane-1,3,4-triol CoA JC01 fadE ydiO [THIL+ fadB+ ACR+ ADH+] (E)-pent-2-ene-1,4-diol JC01 [THIL+ fadB+ ydiO+ ydiQRST+ ydbK+ ACR+ pentane-1,4-diol ADH+] JC01 [THIL+ fadB+ fadE+ ydiQRST+ ydbK+ ACR+ ADH+] JC01 [THIL+ fadB+ Ter+ ACR+ ADH+] JC01 [THIL+ fadBA+ ydiO+ ydiQRST+ ydbK+ ACR+ 3-oxo-1,(n-1)-diols, 1,3,(n-1)-triols, (E)-2-1,(n-1)- ADH+] diols, 1,(n-1)-diols (odd chain lengths, C5-C17) JC01 [THIL+ fadBA+ fadE+ ydiQRST+ ydbK+ ACR+ ADH+] JC01 [THIL+ fadBA+ Ter+ ACR+ ADH+] 3-hydroxybutyryl- JC01 fadB fadJ paaH [THIL+ ACR+ ADH+] 1,5-dihydroxy-hexan-3-one CoA JC01 fadE ydiO [THIL + fadB+ ACR+ ADH+] hexane-1,3,5-triol JC01 fadE ydiO [THIL+ fadB+ ACR+ ADH+] (E)-hex-2-ene-1,5-diol JC01 [THIL+ fadB+ ydiO+ ydiQRST+ ydbK+ ACR+ Hexane-1,5-diol ADH+] JC01 [THIL+ fadB+ fadE+ ydiQRST+ ydbK+ ACR+ ADH+] JC01 [THIL+ fadB+ Ter+ ACR+ ADH+] JC01 [THIL+ fadBA+ ydiO+ ydiQRST+ ydbK+ ACR+ 3-oxo-1,(n-1)-diols, 1,3,(n-1)-triols, (E)-2-1,(n-1)- ADH+] diols, 1,(n-1)-diols (even chain lengths, C6-C18) JC01 [THIL+ fadBA+ fadE+ ydiQRST+ ydbK+ ACR+ ADH+] JC01 [THIL+ fadBA+ Ter+ ACR+ ADH+] 2-aminopropionoyl- JC01 fadB fadJ paaH [THIL+ ACR+ ADH+] 4-amino-1-hydroxypentan-3-one CoA JC01 fadE ydiO [THIL + fadB+ ACR+ ADH+] 4-amino-pentane-1,3-diol JC01 fadE ydiO [THIL+ fadB+ ACR+ ADH+] (E)-4-amino-pent-2-en-1-ol JC01 [THIL+ fadB+ ydiO+ ydiQRST+ ydbK+ ACR+ 4-amino-pentan-1-ol ADH+] JC01 [THIL+ fadB+ fadE+ ydiQRST+ ydbK+ ACR+ ADH+] JC01 [THIL+ fadB+ Ter+ ACR+ ADH+] JC01 [THIL+ fadBA+ ydiO+ ydiQRST+ ydbK+ ACR+ (n-1)-amino-3-oxo-1-alcohols, (n-1)-amino-1,3- ADH+] diols, (E)-(n-1)-amino-2-1-alcohols, (n-1)-amino-1- JC01 [THIL+ fadBA+ fadE+ ydiQRST+ ydbK+ ACR+ alcohols ADH+] JC01 [THIL+ fadBA+ Ter+ ACR+ ADH+] Abbreviations: JC01, MG1655 ldhA poxB pta adhE frdA::FRT-Kan-FRT sequential deletion of ldhA, poxB, pta, adhE, frdA in E. coli MG1655; but any Escherichia with ldhA poxB (pta or ackA or both) adhE frdA will substitute. THIL, short-chain thiolase (E. coli paaJ, atoB, yqeF; Pseudomonas sp. Strain B13 catF; Rhodococcus opacus pcaF and catF; Streptomyces sp. pcaF; Ralstonia eutropha phaA THIL, short-chain thiolase (E. coli paaJ, atoB, yqeF; Pseudomonas sp. Strain B13 catF; Rhodococcus opacus pcaF and catF; Streptomyces sp. pcaF; Ralstonia eutropha phaA and bktB; Clostridium acetobutylicum thlA and thlB); ACR, aldehyde forming acyl-CoA reductase (Acinetobacter calcoaceticus acr1, Acinetobacter sp. Strain M-13 acr1, Clostridium kluyveri sucD, E. coli mhpF and eutE, Clostridium beijerinckii ald, Salmonella typhimurium eutE); ADH, alcohol dehydrogenase (E. coli fucO, betA, eutG, yiaY, Clostrium acetobutylicum adhE2 NOTE this enzyme catalyzes both steps); Ter, trans-enoyl-CoA reductase from E. gracilis, and other sources such as Mammaliam (Human, Rat, Chinese hamster ovary cells), bacterial (Treponema denticola, Flavobacterium johnsoniae, Polaribacter irgensii), Apicomplexas (Toxoplasma gondii, Plasmodium falciparum, Theileria parva, Babesia bovis, Cryptosporidium parvum), Plant (A. thaliana, Gossypium hirsutum L. cv. Xuzhou 142), and Yeast (S. cerevisiae).
(150) TABLE-US-00005 TABLE 4A SYNTHESIS OF b-SUBSTITUTED (b-KETO-, b-HYDROXY- AND TRANS-.sup.2-) AND UNSUBSTITUTED CARBOXYLIC ACIDS, HYDROXY ACIDS, CARBOXYLATED ALCOHOLS, DIACIDS. Product families generated using CoA thioester hydrolases/thioesterases, acyltransferase, or acyl-CoA kinase as termination enzymes and different primer or starter molecules. Primer or starter Product Family (includes both odd- and even-chain products of chain-length 4) Acetyl-CoA and propionyl- b-keto monocarboxylic b-hydroxy trans-D.sup.2 monocarboxylic unsubstituted CoA acids monocarboxylic acids acids monocarboxylic acids Hydroacetyl-CoA, b-keto w-hydroxy b-hydroxy w-hydroxy trans-D.sup.2 w-hydroxy w-hydroxy hydroxypropionyl-CoA, and monocarboxylic acids monocarboxylic acids monocarboxylic acids monocarboxylic acids hydroxysuccinyl-CoA Oxalyl-CoA, malonyl-CoA b-keto dicarboxylic acids b-hydroxy dicarboxylic trans-D.sup.2 dicarboxylic unsubstituted and Succinyl-CoA acids acids dicarboxylic acids
(151) TABLE-US-00006 TABLE 4B SYNTHESIS OF b-SUBSTITUTED (b-KETO-, b-HYDROXY- AND TRANS-.sup.2-) AND UNSUBSTITUTED ALCOHOLS, HYDROXY ACIDS, CARBOXYLATED ALCOHOLS, AND DIOLS. Product families generated using alcohol-forming CoA thioester reductases or aldehyde-forming CoA thioester reductases & alcohol dehydrogenases as termination enzymes and different primer or starter molecules. Primer or starter Product Family (includes both odd- and even-chain products of chain-length 4) Acetyl-CoA and propionyl- b-keto n-alcohols 1,3-Diols trans-D.sup.2 n-alcohols unsubstituted n- CoA alcohols Hydroacetyl-CoA, b-keto 1,n-diols 1,3,n-triols trans-D.sup.2 1,n-diols 1,n-diols hydroxypropionyl-CoA, and hydroxysuccinyl-CoA Oxalyl-CoA, malonyl-CoA b-keto w-hydroxy b-hydroxy w-hydroxy trans-D.sup.2 w-hydroxy w-hydroxy and Succinyl-CoA monocarboxylic acids monocarboxylic acids monocarboxylic acids monocarboxylic acids
(152) TABLE-US-00007 TABLE 4C SYNTHESIS OF b-SUBSTITUTED (b-KETO-, b-HYDROXY- AND TRANS-.sup.2-) AND UNSUBSTITUTED w-HYDROXY ACIDS, w-KETO ACIDS, CARBOXYLATED ALCOHOLS, AND DIACIDS. Product families generated by the action of omega-oxidation enzymes acting on carboxylic acids derived from the b-oxidation reversal. w-oxidation enzyme Product Family (includes both odd- and even-chain products of chain-length 4) Enzyme (1) FIG. 5 b-keto w-hydroxy b-hydroxy w-hydroxy trans-D.sup.2 w-hydroxy w-hydroxy monocarboxylic acids monocarboxylic acids monocarboxylic acids monocarboxylic acids Enzyme (2) FIG. 5 b-keto w-keto b-hydroxy w-keto trans-D.sup.2 w-keto w-keto monocarboxylic acids monocarboxylic acids monocarboxylic acids monocarboxylic acids Enzyme (3) FIG. 5 b-keto dicarboxylic acids b-hydroxy dicarboxylic trans-D.sup.2 dicarboxylic unsubstituted acids acids dicarboxylic acids
(153) TABLE-US-00008 TABLE 4D SYNTHESIS OF b-SUBSTITUTED (b-KETO-, b-HYDROXY- AND TRANS-.sup.2-) AND UNSUBSTITUTED w-HYDROXY ACIDS, w-ALDO ACIDS, CARBOXYLATED ALCOHOLS, AND DIOLS. Product families generated by the action of omega-oxidation enzymes acting on n-alcohols derived from the b-oxidation reversal. w-oxidation enzyme Product Family (includes both odd- and even-chain products of chain-length 4) Enzyme (1) FIG. 5 b-keto 1,n-diols 1,3,n-triols trans-D.sup.2 1,n-diols 1,n-diols Enzyme (2) FIG. 5 b-keto w-aldo n-alcohols w-aldo 1,3-diols trans-D.sup.2 w-aldo n- w-aldo n-alcohols alcohols Enzyme (3) FIG. 5 b-keto w-carboxylated b-hydroxy w- trans-D.sup.2 w-carboxylated w-hydroxy n-alcohol carboxylated n-alcohol n-alcohol monocarboxylic acids
(154) TABLE-US-00009 TABLE 4E SYNTHESIS OF b-SUBSTITUTED (b-KETO-, b-HYDROXY- AND TRANS-.sup.2-) AND UNSUBSTITUTED w-HYDROXY ACIDS, w-ALDO ACIDS, CARBOXYLATED ALCOHOLS, AND DIOLS. Product families generated by the action of alpha oxidation enzymes acting on unsubstituted n-alcohols and carboxylic acids derived from the b-oxidation reversal. a-oxidation enzyme/acting on acid or alcohol Product Family (includes both odd- and even-chain products of chain-length 4) Enzyme (4) FIG. 5/n- b-keto 1,2-diols 1,2,3-triols trans-D.sup.2 1,2-diols 1,2-diols alcohols Enzyme (4) FIG. a-hydroxy b-keto a,b-dihydroxy a-hydroxy trans-D.sup.2 a-hydroxy 5/carboxylic acids monocarboxylic acids monocarboxylic acids monocarboxylic acids monocarboxylic acids
(155) TABLE-US-00010 TABLE 5 Genes and Proteins Prot. Acc. No Gene EC NO. (species) Details ACH2 3.1.2. AAR21571.1 (Arabidopsis) Gene encoding acyl-CoA thioesterase from Arabidopsis thaliana acot8 3.1.2. AAH05792.1 (Mus musculus) Gene encoding acyl-CoA thioesterase 8 from Mus musculus ackA 2.7.2.1 NP_416799.1 (E. coli) Gene encoding acetate kinase, required for synthesis of acetate from acetyl- CoA. act 2.8.3. CAG29276.1 (Clostridium) Gene encoding beta-alanine CoA transferase from Clostridium propionicum adhE 1.2.1.10 NP_415757.1 (E. coli) Gene encoding aldehyde/alcohol dehydrogenase, required for synthesis of 1.1.1.1 ethanol from acetyl-CoA adhE2 1.2.1.10 AAK09379.1 (Clostridium) Gene encoding aldehyde/alcohol dehydrogenase from Clostridium 1.1.1.1 acetobutylicum ald 1.2.1.10 AAT48939.1 (Clostridium) Gene encoing acyl-CoA reductase from Clostridium beijerinckii aldA 1.2.1.21 NP_415933.1 (E. coli) Gene encoding NAD linked aldehyde dehydrogenase A (aka 1.2.1.22 glycolaldehyde:NAD+ oxidoreductase) arcA NA NP_418818.1 (E. coli) Encodes the cytosolic transcription factor of E. coli's ArcAB two-component system, a global regulator of gene expression under microaerobic and anaerobic conditions. ArcAB regulates the expression of a large number of operons involved in respiratory and fermentative metabolism (including repression of fad regulon). arcB NA YP_026207.1 (E. coli) Encodes the membrane associated sensor kinase and phosphatase of E. coli's ArcAB two-component system, a global regulator of gene expression under microaerobic and anaerobic conditions. ArcAB regulates the expression of a large number of operons involved in respiratory and fermentative metabolism (including repression of fad regulon). AtFAO3 1.1.3.20 AEE76762.1 (Arabidopsis) Gene encoding long chain alcohol oxidase from Arabidopsis (AtFAO3) atoC NA NP_416724.1 (E. coli) Encodes the cytosolic transcription factor of E. coli's AtoSC two-component system, which induces the ato operon (atoDAEB) for metabolism of short chain fatty acids in response to the presence of acetoacetatE. atoC(c) NA JF793626.1 Encodes an AtoC mutant that induces constitutive expression of the ato operon (atoDAEB) in the absence of acetoacetate. atoS NA NP_416723.1 (E. coli) Encodes the membrane associated sensor kinase of E. coli's AtoSC two- component system, which induces the ato operon (atoDAEB) for metabolism of short chain fatty acids in response to the presence of acetoacetate. betA 1.1.99.1 NP_414845.1 (E. coli) Gene encoding choline dehydrogenase (BetA) aka betaine aldehyde dehydrogenase; used as a surrogate of alcohol dehydrogenase in the synthesis of n-alcohols crp NA NP_417816.1 (E. coli) Encodes transcriptional dual regulator CRP, which upon binding to its allosteric effector cyclic AMP (cAMP) regulate the expression of about 200 genes (most of them involved in the catabolism of carbon sources, including the fad regulon). crp* NA JF781281.1 (E. coli) A CRP mutant encoding a cAMP-independent CRP (i.E. CRP*, which does not require cAMP to regulate gene expression and hence prevents catabolite repression of fad regulon in the presence of glucose) cysJ 1.8.1.2 NP_417244.1 (E. coli) Gene encoding the flavoprotein subunit (CysJ) complex of sulfite reductase. 1.6.8.1 Along with YdbK, CysJ could form a pyruvate: NADP oxidoreductase: we propose that ydbK and cysJ would encode the N-terminal pyruvate: ferredoxin oxidoreductase domain and the C-terminal NADPH-cytochrome P450 reductase domain, respectively. egTER 1.3.1.44 AAW66853.1 (Euglena) Gene encoding an NAD(P)H-dependent transenoyl-CoA reductase from Euglena gracilis eutE 1.2.1. NP_416950.1 (E. coli) Gene encoding predicted aldehyde dehydrogenase (EutE) with high sequence AAA80209.1 (Salmonella) similarity to adhE eutG 1.1. NP_416948.4 (E. coli) Gene encoding predicted alcohol dehydrogenase (EutG) fadA 2.3.1.16 YP_026272.1 (E. coli) Gene encoding 3-ketoacyl-CoA thiolase (thiolase I) (FadA), a component of fatty acid oxidation complex FadAB fadB 5.3.3.8 NP_418288.1 (E. coli) Gene encoding hydroxyacyl-CoA dehydrogenase, aka fused 3-hydroxybutyryl- 4.2.1.17 CoA epimerase and delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase and enoyl- 5.1.2.3 CoA hydratase, part of fatty acid oxidation complex 1.1.1.35 fadBA / / Both fadA and fadB, fadD 6.2.1.3 NP_416319.1 (E. coli) Gene encoding acyl-CoA synthetase (long-chain-fatty-acid--CoA ligase) (FadD), part of fatty acyl-CoA synthetase complex fadE 1.3.99.3 NP_414756.2 (E. coli) Gene encoding acyl-CoA dehydrogenase (FadE), a medium-long-chain fatty acyl-CoA dehydrogenase fadI 2.3.1.16 NP_416844.1 (E. coli) Gene encoding 3-ketoacyl-CoA thiolase, aka yfcY (YfcY), part of fatty acid oxidation complex fadJ 4.2.1.17 NP_416843.1 (E. coli) Gene encoding hydroxyacyl-CoA dehydrogenase aka yfcX (YfcX), aka fused 5.3.3.8 enoyl-CoA hydratase, 3-hydroxybutyryl-CoA epimerase, dodecenoyl-CoA D- 5.1.2.3 isomerase, and 3-hydroxyacyl-CoA dehydrogenase, subunit of anaerobic fatty 1.1.1.35 acid oxidation complex fadJI / / Both fadJ and fadI fadK (ydiD) 6.2.1. NP_416216.4 (E. coli) Gene encoding short chain acyl-CoA synthetase (FadK) aka YdiD fadL NP_416846.2 (E. coli) Gene encoding long-chain fatty acid outer membrane transporter (FadL) fadM 3.1.2. NP_414977.1 (E. coli) Gene encoding long-chain acyl-CoA thioesterase fadR NA NP_415705.1 (E. coli) Gene encoding a dual regulator of fatty acid metabolism, which exerts negative control over the fad regulon and positive control over expression of unsaturated fatty acid biosynthesis genes fadR NA JF793627.1 fadR mutant that allows expression of the fad regulon in the absence of fatty acids fao1 1.1.3.20 XP_712386.1 (Candida) Gene encoding long-chain fatty alcohol oxidase (Fao1) in yeast, Candida cloacae. fao2 1.1.3.20 CAB75352.1 (Candida) Gene encoding the long-chain fatty alcohol oxidase (Fao2) in yeast, Candida cloacae, aka -hydroxy fatty acid oxidase fnr NA NP_415850.1 (E. coli) Gene encoding transcriptional dual regulator (Fnr), regulates genes involved in the transition from aerobic to anaerobic growth frdA 1.3.99.1 NP_418578.1 (E. coli) Gene encoding one of the catalytic subunits of fumarate reductase (FrdABCD), required for synthesis of succinate from fumarate ldhA 1.1.1.28 NP_415898.1 (E. coli) Gene encoding lactate dehydrogenase (LdhA) mgsA 4.2.3.3 NP_415483.2 (E. coli) Gene encoding methylglyoxal synthase (MgsA); key enzyme in the synthesis of lactate through the methylglyoxal bypass mhpF 1.2.1.10 NP_414885.1 (E. coli) Gene encoding an acetaldehyde dehydrogenase (MhpF) oleA Gene encoding the enzyme that catalyzes non-decarboxylative Claisen condensation of CoA-thioesters in Xanthomonas campestris oleB Gene encoding a member of the /-hydrolase superfamily in Xanthomonas campestris oleC Gene encoding a member of the AMPdependent ligase/synthase superfamily or acetyl-CoA synthetase-like superfamily in Xanthomonas campestris oleD Gene encoding a member of the short-chain dehydrogenase/reductase superfamily in Xanthomonas campestris paaI 3.1.2. NP_415914.1 (E. coli) Gene encoding hydroxyphenylacetyl-CoA thioesterase (PaaI) paaJ 2.3.1.174 NP_415915.1 (E. coli) Gene encoding -ketoadipyl-CoA thiolase (PaaJ) catalyzing two beta-oxidation steps in phenylacetate catabolism PCC7942_orf1593 4.1.99.5 YP_400610.1 Gene encoding an aldehyde decarbonylase from Synechococcus elongatus PCC7942 (Synechococcus) pct 2.8.3. YP_004765791.1 Gene encoding the CoA transferase with wide substrate range (C2-C4) from (Megasphaera) Megasphaera elsdenii PMT9312_0532 4.1.99.5 ABB49593.1 (Prochlorococcus) Gene encoding an aldehyde decarbonylase from Prochlorococcus marinus MIT9313 poxB 1.2.2.2 NP_415392.1 (E. coli) Gene encoding pyruvate oxidase (PoxB), which catalyzes the oxidative decarboxylation of pyruvate to form acetate, reduced ubiquinone (ubiquinol), and CO.sub.2 pta 2.3.1.8 NP_416800.1 (E. coli) Gene encoding phosphotransacetylase, required for synthesis of acetate from acetyl-CoA tdTER 1.3.1.44 NP_971211.1 (Treponema) Gene encoding an NAD(P)H-dependent transenoyl-CoA reductase from Treponema denticola tesA 3.1.2. NP_415027.1 (E. coli) Gene encoding multifunctional acyl-CoA thioesterase I and protease I and 3.1.1.5 lysophospholipase L1 (TesA) tesB 3.1.2. NP_414986.1 (E. coli) Gene encoding thioesterase II (TesB) CAL16477.1 (Alcanivorax) ucpA 1... NP_416921.4 (E. coli) predicted oxidoreductase, sulfate metabolism protein (used as surrogate of aldehyde-forming acyl Coenzyme A Reductase) (UcpA) ybbO 1... NP_415026.1 (E. coli) predicted oxidoreductase with NAD(P)-binding Rossmann-fold domain (used as surrogate of aldehyde-forming acyl Coenzyme A Reductase) (YbbO) ybdB 3.1.2. NP_415129.1 (E. coli) Gene encoding proofreading thioesterase EntH (YbdB) ybdH 1.1.. NP_415132.1 (E. coli) Gene encoding predicted oxidoreductase (YbdH) ybgC 3.1.2. NP_415264.1 (E. coli) Gene encoding an Acyl-CoA thioesterase (YbgC) yciA 3.1.2. NP_415769.1 (E. coli) Gene encoding acyl-CoA thioesterase (YciA) ydbK 1.2.7. NP_415896.1 (E. coli) Gene encoding fused predicted pyruvate-flavodoxin oxidoreductase (YdbK) ydiI 3.1.2. NP_416201.1 (E. coli) Gene encoding an Acyl-CoA thioesterase (YdiI) ydiL NP_416204.2 (E. coli) Gene encoding fused predicted acetyl-CoA:acetoacetyl-CoA transferase: subunit/ subunit (YdiL) ydiO 1.3.. NP_416210.4 (E. coli) Genes encoding predicted acyl-CoA dehydrogenase (YdiO) ydiQ NP_416212.1 (E. coli) Gene encoding putative subunit (YdiQ) of YdiQ-YdiR flavoprotein ydiR ??? NP_416213.1 (E. coli) Gene encoding putative subunit (YdiR) of YdiQ-YdiR flavoprotein ydiS ??? NP_416214.1 (E. coli) Gene encoding putative flavoprotein (YdiS) ydiT ??? NP_416215.1 (E. coli) Gene encoding putative ferredoxin (YdiT) yiaY 1.1.1. YP_026233.1 (E. coli) Gene encoding predicted Fe-containing alcohol dehydrogenase (YiaY) yqhD 1.1.1. NP_417484.1 (E. coli) Gene encoding NADP-dependent aldehyde/alcohol dehydrogenase aka oxidoreductase Exemplary gene/protein/species provided in this table. However, gene, protein and enzyme nomenclature varies widely, thus any protein that catalyzes the same reaction can be substituted herein. Exemplary protein sequence accession numbers provided herein, but each is linked to the corresponding DNA (or amino acid) sequence, and to related sequences. E. coli gene and protein names can be ascertained through ecoliwiki.net/ and enzymes can be searched through brenda-enzymes.info/. Many similar databases are available including PROSITE; EC2PDB; ExplorEnz; PRIAM; KEGG Ligand; IUBMB Enzyme Nomenclature; IntEnz; MEDLINE; and MetaCyc, to name a few. By convention, genes are written in italic, and corresponding proteins in regular font. E.g., ackA is the gene encoding AckA aka acetate kinase
(156) TABLE-US-00011 SUPPLEMENTARY TABLE S1 Strains and Plasmids used in this study. Strain/Plasmid Description/Genotype Source MG1655 F--ilvG-rfb-50 rph-1 Kang et al. (2004) MG1655 ldhApoxBptaadhE MG1655, ldhA::FRT poxB::FRT pta::FRT adhE::FRT sequential deletion of Blankschien et al. ldhA, poxB, pta, and adhE in MG1655 (2010) MG1655 MG1655, ldhA::FRT poxB::FRT pta::FRT adhE::FRT frdA::FRT-Kan-FRT This Study ldhApoxBptaadhEfrdA (JC01) sequential deletion of ldhA, poxB, pta, adhE, and frdA in MG1655 JC01 tesA MG1655, ldhA::FRT poxB::FRT pta::FRT adhE::FRT frdA::FRT-tesA::FRT- This Study Kan-FRT sequential deletion of ldhA, poxB, pta, adhE, frdA, and tesA in MG1655 JC01 tesB MG1655, ldhA::FRT poxB::FRT pta::FRT adhE::FRT frdA::FRT-tesB::FRT- This Study Kan-FRT sequential deletion of ldhA, poxB, pta, adhE, frdA, and tesB in MG1655 JC01 yciA MG1655, ldhA::FRT poxB::FRT pta::FRT adhE::FRT frdA::FRT-yciA::FRT- This Study Kan-FRT sequential deletion of ldhA, poxB, pta, adhE, frdA, and yciA in MG1655 JC01 fadM MG1655, ldhA::FRT poxB::FRT pta::FRT adhE::FRT frdA::FRT-fadM::FRT- This Study Kan-FRT sequential deletion of ldhA, poxB, pta, adhE, frdA, and fadM in MG1655 JC01 ydiI MG1655, ldhA::FRT poxB::FRT pta::FRT adhE::FRT frdA::FRT-ydiI::FRT- This Study Kan-FRT sequential deletion of ldhA, poxB, pta, adhE, frdA, and ydiI in MG1655 JC01 ybgC MG1655, ldhA::FRT poxB::FRT pta::FRT adhE::FRT frdA::FRT-ybgC::FRT- This Study Kan-FRT sequential deletion of ldhA, poxB, pta, adhE, frdA, and ybgC in MG1655 JC01 fadB MG1655, ldhA::FRT poxB::FRT pta::FRT adhE::FRT frdA::FRT-fadB::FRT- This Study Kan-FRT sequential deletion of ldhA, poxB, pta, adhE, frdA, and fadB in MG1655 JC01 fadE MG1655, ldhA::FRT poxB::FRT pta::FRT adhE::FRT frdA::FRT-fadE::FRT- This Study Kan-FRT sequential deletion of ldhA, poxB, pta, adhE, frdA, and fadE in MG1655 JC01 ydiO MG1655, ldhA::FRT poxB::FRT pta::FRT adhE::FRT frdA::FRT-ydiO::FRT- This Study Kan-FRT sequential deletion of ldhA, poxB, pta, adhE, frdA, and ydiO in MG1655 pTrcHis2A (pTH.sub.A) pTrcHis2A (pBR322-derived), oriR pMB1, lacI.sup.q, bla Invitrogen (Carlsbad, CA) pTH.sub.A-atoB E. coli atoB gene under trc promoter and lacI.sup.q control This Study pTH.sub.A-atoB-fadB E. coli atoB and fadB genes under trc promoter and lacI.sup.q control This Study pTH.sub.A-atoB-fadB-ydiO E. coli atoB, fadB, and ydiO genes under trc promoter and lacI.sup.q control This Study pTH.sub.A-atoB-fadB-egTER E. coli atoB and, fadB, and E. gracilis TER genes under trc promoter and lacI.sup.q This Study control pTH.sub.A-atoB-fadB-fadE E. coli atoB, fadB, and fadE genes under trc promoter and lacI.sup.q control This Study pZS-Blank oriR pSC101*, tetR, cat, contains P.sub.LtetO-1 Yazdani and Gonzalez (2008) pZS-fadM E. coli fadM gene under control of P.sub.LtetO-1(tetR, oriR SC101*, cat) Dellomonaco et al. (2011) pZS-tesA E. coli tesA gene under control of P.sub.LtetO-1(tetR, oriR SC101*, cat) Dellomonaco et al. (2011) pZS-tesB E. coli tesB gene under control of P.sub.LtetO-1(tetR, oriR SC101*, cat) Dellomonaco et al. (2011) pZS-ybgC E. coli ybgC gene under control of P.sub.LtetO-1(tetR, oriR SC101*, cat) This Study pZS-yciA E. coli yciA gene under control of P.sub.LtetO-1(tetR, oriR SC101*, cat) Dellomonaco et al. (2011) pZS-ydbK E. coli ydbK gene under control of P.sub.LtetO-1(tetR, oriR SC101*, cat) This Study pZS-ydiI E. coli ydiI gene under control of P.sub.LtetO-1(tetR, oriR SC101*, cat) This Study pZS-fadB-egTER E. coli fadB and E. gracilis TER genes under control of P.sub.LtetO-1(tetR, oriR SC101*, This Study cat) pZS-fadBA-egTER E. coli fadBA and E. gracilis TER genes under control of P.sub.LtetO-1(tetR, oriR SC101*, This Study cat) pZS-ydbK-ydiQRST E. coli ydbK and ydiQRST genes under control of P.sub.LtetO-1(tetR, oriR SC101*, cat) This Study
(157) TABLE-US-00012 SUPPLEMENTARYTABLES2 Primersusedinthisstudyforplasmidconstruction.Primerswereusedto amplifythelastgenelistedintheplasmidtocloneintothevector backbonelistedinparenthesispreviouslydigestedwiththelisted restrictionenzyme(s).Forfurtherdetails,seeMethods. SEQ Plasmid ID Construction NO PrimerSequencesandRestrictionEnzymesUsed pZS-fadM 1. 5-TTAAAGAGGAGAAAGGTACCATGCAAACACAAATCAAAGT-3 5-TGCCTCTAGCACGCGTCGTTTACTTAACCATCTGCTCCA-3 (pZS,KpnI/MluI) pZS-tesA 2. 5-TTAAAGAGGAGAAAGGTACCATGATGAACTTCAACAATGTTTTC-3 5-TGCCTCTAGCACGCGTTCCGTTGCTTTATGAGTCATG-3 (pZS,KpnI/MluI) pZS-tesB 3. 5-TTAAAGAGGAGAAAGGTACCATGAGTCAGGCGCTAAAAAA-3 5-TGCCTCTAGCACGCGTAACAGCCGGACGGTTTTC-3 (pZS,KpnI/MluI) pZS-ybgC 4. 5-TTAAAGAGGAGAAAGGTACCGTGAATACAACGCTGTTTCGAT-3 5-TGCCTCTAGCACGCGTTCACTGCTTAAACTCCGCGA-3 (pZS,KpnI/MluI) pZS-yciA 5. 5-TTAAAGAGGAGAAAGGTACCATGTCTACAACACATAACGTCCC-3 5-TGCCTCTAGCACGCGTTTCAGTAAGCAGAAAGTCAAAAGC-3 (pZS,KpnI/MluI) pZS-ydbK 6. 5-TTAAAGAGGAGAAAGGTACCATGATTACTATTGACGGTAATGGC-3 5TGCCTCTAGCACGCGTGCATTTAATCGGTGTTGCTTT-3 (pZS,KpnI/MluI) pZS-ydil 7. 5-TTAAAGAGGAGAAAGGTACCATGATATGGAAACGGAAAATCA-3 5-TGCCTCTAGCACGCGTGGTGACAACGTCACAAAATGG-3 (pZS,KpnI/MluI) pZS-fadB- 8. 5-GCAGAAGATCACGCGAAATAAGGAGGAATAAACCATGGCAATGTTTACCACGAC-3 egTER 5-TGCCTCTAGCACGCGTGCGGCCGCTTATTGCTGTGCTGCGGAC-3 (pZS-fadB,MluI) pZS-fadBA- 9 5-TTTAACCACTACGCGAATAAGGAGGAATAAACCATGGCAATGTTTACCACGAC-3 egTER 5-TGCCTCTAGCACGCGTGCGGCCGCTTATTGCTGTGCTGCGGAC-3 (pZS-fadBA,MluI) pZS-ydbK- 10. 5-TTAAATGCTGCGGCCATCGGAGATGGTTCCGTATG-3 ydiQRST 5-AGCACGCGTGCGGCCGCCATGATTAGCCGTAGCGAAA-3 (pZS-ydbK,NotI) pTH.sub.A-atoB 11. 5-GAGGAATAAACCATGAAAAATTGTGTCATCGTCA-3 5-CCCAAGCTTCGAATTCTTAATTCAACCGTTCAATCAC-3 (pTH.sub.A,NcoI/EcoRI) pTH.sub.A-atoB- 12. 5-TAAGAATTCGAAGCTGCGGATTCAGGAGACTGACA-3 fadB 5-GTTCGGGCCCAAGCTTTAAGCCGTTTTCAGGTCGC-3 (pTH.sub.A-atoB,HindIII) pTH.sub.A-atoB- 13. 5-AAACGGCTTAAAGCTAATAAGGAGGAATAAACCATGGATTTTAATTTAAATGATGAGCAG-3 fadB-caiA 5-GTTCGGGCCCAAGCTTGCGGCCGCCGGACTTAGCGGTATTGCTT-3 (pTH.sub.A-atoB-fadB,HindIII) pTH.sub.A-atoB- 14. 5-AAACGGCTTAAAGCTAATAAGGAGGAATAAACCATGGATTTTTCTTTAACTGAAGAACA-3 fadB-ydiO 5-GTTCGGGCCCAAGCTTGCGGCCGCTGCAGATTATTTGTTCTGATAGTCTTT-3 (pTH.sub.A-atoB-fadB,HindIII) pTH.sub.A-atoB- 15. 5-AAACGGCTTAAAGCTAATAAGGAGGAATAAACCATGGCAATGTTTACCACGAC-3 fadB-egTER 5-GTTCGGGCCCAAGCTTGCGGCCGCTTATTGCTGTGCTGCGGAC-3 (pTH.sub.A-atoB-fadB,HindIII) pTH.sub.A-atoB- 16. 5-AAACGGCTTAAAGCTAATAAGGAGGAATAAACCATGATGATTTTGAGTATTCTCGCTAC-3 fadB-fadE 5-GTTCGGGCCCAAGCTTGCGGCCGCCATTTACGCGGCTTCAACTT-3 (pTH.sub.A-atoB-fadB,HindIII)
(158) TABLE-US-00013 SUPPLEMENTARYTABLES3 Primersusedintheconstructionofplasmidsforenzymatic characterization.Forfurtherdetailsonconstruction, seeMethods. SEQ ID Primer NO Sequences fadANdel5p 17. CCCTTTCATATGGAACAGGTTGTCATTGTC fadAmidrev 18. CGGCACATGGCCCATGTGCTCCACGCCGCCAACCAG fadAmidfor 19. CTGGTTGGCGGCGTGGAGCACATGGGCCATGTGCCG fadANotI3p 20. GGAAAAGCGGCCGCTTAAACCCGCTCAAACACCG fadBNdel5p 21. TTTTCCCATATGCTTTACAAAGGCGACAC fadBmid1rev 22. CAGCAGCCCTTTTAGATCCGATTGCTGTTCCAGCAC fadBmid1for 23. GTGCTGGAACAGCAATCGGATCTAAAAGGGCTGCTG fadBmid2rev 24. GGTCGGCACCGGCAGGTCTTCCAGGCGATTAAACAC fadBmid2for 25. GTGTTTAATCGCCTGGAAGACCTGCCGGTGCCGACC fadBNotI3p 26. CCAAAAGCGGCCGCTTAAGCCGTTTTCAGGTC caHBDBglii5p 27. AAACCCAGATCTATGAAAAAGGTATGTGTTATAG caHBDxhoI3p 28. TTAAAACTCGAGTTTTGAATAATCGTAGAAAC F1pTH6hisEgter 29. GAGGAATAAACCATGCATCATCATCATCATCATGCAATGTTTACCACGACCGCGA R1pTH6hisEgter 30. CCCAAGCTTCGAATTCTTATTGCTGTGCTGCGGACGG
(159) All references cited herein are incorporated by reference in their entirety herein for all purposes. Certain references are listed again below for the convenience of the reader, and additional references may be found in the legends to the FIGURES. Dellomonaco C, et al., Engineered reversal of the -oxidation cycle for the synthesis of fuels and chemicals. Nature. 476(7360):355-9 (2011) Jansen and Wanders: Biochimica et Biophysica Acta 1763 (2006) 1403-1412). Pinot F, Beisson F. (2011). Cytochrome P450 metabolizing fatty acids in plants: characterization and physiological roles. FEBS J, 278 (2), 195-205. Mascaraque et al., 2010, PNAS 107:14390-14395 Nogales et al., 2007, Microbiology 153:357-365), Gobel et al., 2002, J. Bac. 184: 216-223 Eulberg et al., 1998, J. Bacteriol. 180:1072-1081 Iwagami et al., 2000, Appl. Environ. Microbiol. 66:1499-1508 U.S. Ser. No. 61/440,192, filed Feb. 7, 2011 U.S. Ser. No. 61/531/911, filed Sep. 7, 2011 PCT/US12/24051, filed Feb. 7, 2012 WO2010101651 1. Rude, M. A., and Schirmer, A. (2009) New microbial fuels: a biotech perspective, Curr. Opin. Microbiol. 12, 274-281. 2. Connor, M. R., and Liao, J. C. (2009) Microbial production of advanced transportation fuels in non-natural hosts, Curr. Opin. Biotechnol. 20, 307-315. 3. Lee, J. W., Na, D., Park, J. M., Lee, J., Choi, S., and Lee, S. Y. (2012) Systems metabolic engineering of microorganisms for natural and non-natural chemicals, Nat. Chem. Biol. 8, 536-546. 4. Peralta-Yahya, P. P., Zhang, F., del Cardayre, S. B., and Keasling, J. D. (2012) Microbial engineering for the production of advanced biofuels, Nature 488, 320-328. 5. Steen, E. J., Kang, Y. S., Bokinsky, G., Hu, Z. H., Schirmer, A., McClure, A., del Cardayre, S. B., and Keasling, J. D. (2010) Microbial production of fatty-acid-derived fuels and chemicals from plant biomass, Nature 463, 559-U182. 6. Handke, P., Lynch, S. A., and Gill, R. T. (2011) Application and engineering of fatty acid biosynthesis in Escherichia coli for advanced fuels and chemicals, Metab. Eng. 13, 28-37. 7. Lennen, R. M., Braden, D. J., West, R. M., Dumesic, J. A., and Pfleger, B. F. (2010) A Process for Microbial Hydrocarbon Synthesis: Overproduction of Fatty Acids in Escherichia coli and Catalytic Conversion to Alkanes, Biotechnol. Bioeng. 106, 193-202. 8. Dellomonaco, C., Clomburg, J. M., Miller, E. N., and Gonzalez, R. (2011) Engineered reversal of the -oxidation cycle for the synthesis of fuels and chemicals, Nature 476, 355-359. 9. Keasling, J. D. (2008) Synthetic biology for synthetic chemistry, ACS Chem. Biol. 3, 64-76. 10. Clomburg, J. M., and Gonzalez, R. (2010) Biofuel production in Escherichia coli: the role of metabolic engineering and synthetic biology, Appl. Microbiol. Biotechnol. 86, 419-434. 11. Clark, D. P., and Cronan, J. E. (October 2005 Posting Date) Two-Carbon Compounds and Fatty Acids as Carbon Sources, In EcoSal-Escherichia coli and Salmonella: cellular and molecular biology (Neidhardt, F., Curtiss, R. I., Ingraha, J., Lin, E., Low, K., Magasanik, B., Reznikoff, W., Riley, N., Schaechter, M., and Umbarger, H., Eds.) 2nd ed., ASM Press, Washington, D.C. 12. Feigenbaum, J., and Schulz, H. (1975) Thiolases of Escherichia coli: Purification and Chain-Length Specificties, J. Bacteriol. 122, 407-411. 13. Jenkins, L. S., and Nunn, W. D. (1987) Genetic and Molecular Characterization of the Genes Involved in Short-Chain Fatty-Acid Degradation in Escherichia coli: The Ato System, J. Bacteriol. 169, 42-52. 14. Yang, S. Y., Yang, X. Y. H., Healy-Louie, G., Schulz, H., and Elzinga, M. (1990) Nucleotide Sequence of the fadA Gene: Primary Structure of the 3-ketoacyl-Coenzyme A Thiolase from Escherichia coli and the Structural Organization of the fadBA Operon, J. Biol. Chem. 265, 10424-10429. 15. Nielsen, J., Villadsen, J., and Liden, G. (2003) Bioreaction Engineering Principles, Kluwer Adademic/Plenum Publishers, New York. 16. Teufel, R., Mascaraque, V., Ismail, W., Voss, M., Perera, J., Eisenreich, W., Haehnel, W., and Fuchs, G. (2010) Bacterial phenylalanine and phenylacetate catabolic pathway revealed, Proc. Natl. Acad. Sci. U.S.A. 107, 14390-14395. 17. Binstock, J. F., and Schulz, H. (1981) Fatty acid oxidation complex from Escherichia coli, Methods Enzymol. 71, 403-411. 18. He, X. Y., and Yang, S. Y. (1997) Glutamate-119 of the large alpha-subunit is the catalytic base in the hydration of 2-trans-enoyl-coenzyme A catalyzed by the multienzyme complex of fatty acid oxidation from Escherichia coli, Biochemistry 36, 11044-11049. 19. Campbell, J. W., Morgan-Kiss, R. M., and Cronan, J. E. (2003) A new Escherichia coli metabolic competency: growth on fatty acids by a novel anaerobic -oxidation pathway, Mol. Microbiol. 47, 793-805. 20. Gulevich, A. Y., Skorokhodova, A. Y., Sukhozhenko, A. V., Shakulov, R. S., and Debabov, V. G. (2012) Metabolic engineering of Escherichia coli for 1-butanol biosynthesis through the inverted aerobic fatty acid -oxidation pathway, Biotechnol. Lett. 34, 463-469. 21. Eichler, K., Bourgis, F., Buchet, A., Kleber, H. P., and Mandrandberthelot, M. A. (1994) Molecular Characterization of the Cai Operon Necessary for Carnitine Metabolism in Escherichia coli, Mol. Microbiol. 13, 775-786. 22. Walt, A., and Kahn, M. L. (2002) The fixA and fixB genes are necessary for anaerobic carnitine reduction in Escherichia coli, J. Bacteriol. 184, 4044-4047. 23. Eichler, K., Buchet, A., Bourgis, F., Kleber, H. P., and Mandrandberthelot, M. A. (1995) The fix Escherichia coli region contains 4 genes related to carnitine metabolism, J. Basic Microbiol. 35, 217-227. 24. Akhtar, M. K., and Jones, P. R. (2009) Construction of a synthetic YdbK-dependent pyruvate:H-2 pathway in Escherichia coli BL21(DE3), Metab. Eng. 11, 139-147. 25. Hoffmeister, M., Piotrowski, M., Nowitzki, U., and Martin, W. (2005) Mitochondrial trans-2-enoyl-CoA reductase of wax ester fermentation from Euglena gracilis defines a new family of enzymes involved in lipid synthesis, J. Biol. Chem. 280, 4329-4338. 26. Inui, H., Miyatake, K., Nakano, Y., and Kitaoka, S. (1984) Fatty Acid Synthesis in Mitochondria of Euglena gracilis, Eur. J. Biochem. 142, 121-126. 27. Inui, H., Miyatake, K., Nakano, Y., and Kitaoka, S. (1983) Production and Composition of Wax Esters by Fermentation of Euglena gracilis, Agric. Biol. Chem. 47, 2669-2671. 28. Cho, H. S., and Cronan, J. E. (1993) Escherichia coli thioesterase I, molecular cloning and sequencing of the structural gene and identification as a periplasmic enzyme, J. Biol. Chem. 268, 9238-9245. 29. Nie, L., Ren, Y., Janakiraman, A., Smith, S., and Schulz, H. (2008) A novel paradigm of fatty acid -oxidation exemplified by the thioesterase-dependent partial degradation of conjugated linoleic acid that fully supports growth of Escherichia coli, Biochemistry 47, 9618-9626. 30. Zhuang, Z. H., Song, F., Zhao, H., Li, L., Cao, J., Eisenstein, E., Herzberg, O., and Dunaway-Mariano, D. (2008) Divergence of function in the hot dog fold enzyme superfamily: The bacterial thioesterase YciA, Biochemistry 47, 2789-2796. 31. Feng, Y., and Cronan, J. E. (2009) A New Member of the Escherichia coli fad Regulon: Transcriptional Regulation of fadM (ybaW), J. Bacteriol. 191, 6320-6328. 32. Kuznetsova, E., Proudfoot, M., Sanders, S. A., Reinking, J., Savchenko, A., Arrowsmith, C. H., Edwards, A. M., and Yakunin, A. F. (2005) Enzyme genomics: Application of general enzymatic screens to discover new enzymes, FEMS Microbiol. Rev. 29, 263-279. 33. Vlessis, A. A., Bartos, D., and Trunkey, D. (1990) Importance of spontaneous alpha-ketoacid decarboxylation in experiments involving peroxide, Biochem. Biophys. Res. Comm. 170, 1281-1287. 34. Yazdani, S. S., and Gonzalez, R. (2007) Anaerobic fermentation of glycerol: a path to economic viability for the biofuels industry, Curr. Opin. Biotechnol. 18, 213-219. 35. Kang, Y. S., Durfee, T., Glasner, J. D., Qiu, Y., Frisch, D., Winterberg, K. M., and Blattner, F. R. (2004) Systematic mutagenesis of the Escherichia coli genome, J. Bacteriol. 186, 8548-8548. 36. Yazdani, S. S., and Gonzalez, R. (2008) Engineering Escherichia coli for the efficient conversion of glycerol to ethanol and co-products, Metab. Eng. 10, 340-351. 37. Miller, J. H. (1972) Experiments in molecular genetics, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 38. Baba, T., Ara, T., Hasegawa, M., Takai, Y., Okumura, Y., Baba, M., Datsenko, K. A., Tomita, M., Wanner, B. L., and Mori, H. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection, Mol. Syst. Biol. 2, 11. 39. Sambrook, J., Fritsch, E. F., Maniatis, T., and Russell, D. W. (2001) Molecular Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 40. Neidhardt, F. C., Bloch, P. L., and Smith, D. F. (1974) Culture Medium for Enterobacteria, J. Bacteriol. 119, 736-747. 41. Dharmadi, Y., Murarka, A., and Gonzalez, R. (2006) Anaerobic fermentation of glycerol by Escherichia coli: A new platform for metabolic engineering, Biotechnol. Bioeng. 94, 821-829. 42. Dharmadi, Y., and Gonzalez, R. (2005) A better global resolution function and a novel iterative stochastic search method for optimization of high-performance liquid chromatographic separation, J Chromatogr., A 1070, 89-101. 43. Vick, J. E., Johnson, E. T., Choudhary, S., Bloch, S. E., Lopez-Gallego, F., Srivastava, P., Tikh, I. B., Wawrzyn, G. T., and Schmidt-Dannert, C. (2011) Optimized compatible set of BioBrick vectors for metabolic pathway engineering, Appl. Microbiol. Biotechnol. 92, 1275-1286. 44. Kitagawa, M., Ara, T., Arifuzzaman, M., Ioka-Nakamichi, T., Inamoto, E., Toyonaga, H., and Mori, H. (2005) Complete set of ORF clones of Escherichia coli ASKA library (A complete Set of E. coli K-12 ORF archive): Unique resources for biological research, DNA Res. 12, 291-299. 45. Obrien, W. J., and Frerman, F. E. (1977) Evidence for a Complex of 3 -Oxidation Enzymes in Escherichia coli: Induction and Localization, J. Bacteriol. 132, 532-540. 46. Bond-Watts, B. B., Bellerose, R. J., and Chang, M. C. Y. (2011) Enzyme mechanism as a kinetic control element for designing synthetic biofuel pathways, Nat. Chem. Biol. 7, 222-227. 47. Wiesenborn, D. P., Rudolph, F. B., and Papoutsakis, E. T. (1988) Thiolase from Clostridium acetobutylicum ATCC-824 and its Role in the Synthesis of Acids and Solvents, Appl. Environ. Microbiol. 54, 2717-2722. 48. Hartmanis, M. G. N., and Gatenbeck, S. (1984) Intermediary Metabolism in Clostridium acetobutylicum: Levels of Enzymes Involved in the Formation of Acetate and Butyrate, Appl. Environ. Microbiol. 47, 1277-1283. 49. Lehman, T. C., Hale, D. E., Bhala, A., and Thorpe, C. (1990) An Acyl-Coenzyme A Dehydrogenase Assay Utilizing the Feericenium Ion, Anal. Biochem. 186, 280-284.