Recombinant strain for producing 2,3-butanediol, comprising (a) inactivated lactate dehydrogenase and (b) inactivated sucrose regulator

Abstract

The present invention relates to a recombinant strain for producing 2,3-butanediol, comprising (a) an inactivated lactate dehydrogenase and (b) an inactivated sucrose regulator. According to the present invention, it is possible to economically produce 2,3-butanediol using a cheap carbon source, and the efficiency and productivity of 2,3-butanediol is remarkable compared with a wild type.

Claims

1. A recombinant strain for producing 2,3-butanediol, comprising (a) a deletion of the strain's endogenous lactate dehydrogenase gene (IdhA), and (b) a deletion of the strain's endogenous sucrose regulator gene (scrR), such that the endogenous lactate dehydrogenase and the endogenous sucrose regulator are inactivated, wherein the sucrose regulator is a transcriptional suppressor that suppresses the expression of sucrose-6-phosphate hydrolase (ScrB), and wherein the strain is Enterbacter aerogenes or Klebsiella pneumonia.

2. The recombinant strain of claim 1, wherein the recombinant strain has a deletion, substitution, or insertion mutation further occurring in the nucleotide sequence encoding wabG.

3. The recombinant strain of claim 1, wherein the strain uses molasses as a carbon source.

4. A method for producing 2,3-butanediol, the method comprising culturing the strain of claim 1 in a culture medium.

5. The method of claim 4, wherein the culture medium contains molasses as a carbon source.

6. The method of claim 4, wherein the culture medium has an optimal pH range of pH 5.5 to pH 7.0.

7. The method of claim 4, wherein the culturing is performed by batch fermentation or fed-batch fermentation.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) The above and other objects, features and advantages of the present invention will be more apparent from the following detailed description taken in conjunction with the accompanying drawings, in which:

(2) FIGS. 1a to 1b are diagrams showing (a) Bacterial sucrose catabolic pathways with PTS and non-PTS sugar transporters and (b) the corresponding gene arrangements in the genome of three enteric bacteria. ScrA, EII transport protein for sucrose; CscB, sucrose-specific permease; ScrB and CscA, sucrose-6-phosphate hydrolase; ScrK and CscK, fructokinase; Pgm, phospoglucomutase; ScrY, outer membrane sucrose porin; ScrR and CscR, repressors of the sucrose metabolic genes.

(3) FIGS. 2a to 2d show graph for 2,3-Butanediol production of wild type (closed squares), EMY-01 (open circles), and EMY-68 (crosses) in flask cultivation with (a) glucose, (b) fructose, and (c) sucrose, or (d) sugarcane molasses as a sole carbon source. Error bars represent the standard deviations of three experiments.

(4) FIGS. 3a to 3c show graph for comparison of batch fermentations of (a) wild type, (b) EMY-01, and (c) EMY-68 with the consumption of sugars including glucose (closed circles), sucrose (crosses), fructose (open triangles) and total sugars (closed squares). Error bars represent the standard deviations of three experiments.

(5) FIG. 4 shows graph for results of fed-batch fermentation using sugarcane molasses with pH (pluses), concentrations of 2,3-butanediol (open circles), ethanol (open diamonds), acetoin (open squares), and total sugars (closed squares).

(6) FIGS. 5a to 5d illustrate results showing 2,3-butanediol productions by KMK-01 (closed quadrangle), KMK-02 (open circle), and KMK-08 (X mark). FIGS. 5a, 5b, 5c, and 5d show flask culture results using, a sole carbon source, glucose, fructose, sucrose, and molasses, respectively.

(7) FIGS. 6a to 6c show carbon source consumption tendency results with respect to glucose (closed circle), sucrose (X mark), fructose (open triangle), and total carbon source (closed quadrangle) by KMK-01 (FIG. 6a), KMK-02 (FIG. 6b), and KMK-08 (FIG. 6c).

DETAILED DESCRIPTION

(8) Hereinafter, the present invention will be described in detail with reference to examples. These examples are only for illustrating the present invention more specifically, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples.

EXAMPLES

Example 1: 2,3-Butanediol Production Using Enterobacter aerogenes

(9) 1. Experimental Materials & Methods

(10) 1.1 Strain Development

(11) All E. aerogenes strains were derived from a wild type strain, KCTC 2190. Previously, a k Red recombination method for E. aerogenes was used for deleting a lactate dehydrogenase (LdhA) from KCTC 2190, generating EMY-01 (Jung et al., 2012). In this study, the gene encoding sucrose regulator of the LacI family, ScrR, was deleted in the genome of EMY-01 in a similar manner, and the resulting strain was named EMY-68. The scrR_FKF_fw and scrR_FKF_ry primers were used for the deletion, which was confirmed by the colony PCR with the primers scrR_con_A and scrR_con_B. The strains, plasmids, or primers used in this study are listed in Table 1. In order to remove scrR gene of Enterobacter aerogenes, the A Red recombination method was employed. First, Enterobacter aerogenes, prepared as competent cells, was transformed with expression vectors of exo, gamma, and beta for preventing the degradation of the liner gene introduced into cells and increasing the efficiency of homologous recombination. pKM208 vector which has a tac promoter and ampicillin resistance was used in the present invention, and the transformation was verified. Next, a linear gene for homologous recombination was created. pKD4 vector having a FRT-kanamycin-FRT cassette was used as a template. Primers were manufactured using a total of 70 nucleotide pairs containing 50 nucleotide pairs that are homologous at both sides of the scrR gene of Enterobacter aerogenes, at which homogenous combination occurs, and 20 nucleotide pairs for polymerizing the FRT-kanamycin-FRT cassette of pKD4 used as a template, and a linear gene for removing scrR gene was prepared using polymerase chain reaction. Kanamycin is an anti-drug for investigating whether or not the homogeneous combination successfully occurs, and the FRT site functions to remove an anti-drug for removing a different gene after the target gene is removed.

(12) In the next step, Enterobacter aerogenes, which has been verified to be transformed with pKM208 vector, was cultured at 30 C. Since the pKM208 vector is temperature-sensitive and thus lose its activity at 37 C. or higher, the strain was cultured at 30 C. In addition, when the OD600 value is about 0.1 after the culturing for 1 h, the expression of the A Red recombinase of pKM208 was induced by 1 mM isopropylthio--galactoside (IPTG). When the OD600 value is about 0.6 by further culturing for 1 h, competent cells for electroporation was manufactured, and then the linear gene was transformed. After culturing in LB medium at 37 C. for 1 h, the cells were spread on LB solid medium supplemented with 12.5 mg/mQ kanamycin, and then cultured for 12 h. In order to investigate whether the homogeneous combination is successful, two primers were manufactured. 20-24 nucleotide pairs that are homogenous at both sides of the lactate dehydrogenase were named scrR_con_A and _B. These two primers were used to perform colony PCR, thereby investigating whether the homogenous recombination occurred or not, through the length of PCR products.

(13) TABLE-US-00001 TABLE1 Strains, Genotype,relevant plasmids characteristics Sourceand orprimers orsequence references Strains E.aerogenes Wildtype Korean KCTC2190 Collection EMY01 E.aerogenesKCTC forType 2190-ldhA Culture EMY68 E.aerogenesKCTC (Junget 2190ldhAscrR al.,2012) Thisstudy Plasmids pKM208 lacI, Red+ Addgene Gam-producingvector, tac_promoter, f1_ori,Amp.sup.R pCP20 FLPrecombinase (Datsenko& producingvector, Wanner,2000) pSC101ori,cl857, Amp.sup.R,Cm.sup.R pKD4 FRTflankedresistance (Datsenko& cassetteinvolved Wanner,2000) vector,oriR,Km.sup.R Primers scrR_FKF_fw.sup.a CGGCCATGCATGGTAGAATAAG Thisstudy CGTTTTGCTTTCAGGC GCCTGTCTCGTGGTGTAGGCTG Thisstudy GAGCTGCTTC (SEQIDNo.3) scrR_FKF_rv.sup.a GACAATTAACCG TTAACAGTACGGGCCTGAACCA CGATCCAGGCCCGTTA TCCTCCTTAGTTCCTATTCC Thisstudy (SEQIDNo.4) scrR_con_A CCGCTTCTTTGCGGATTAT (SEQIDNo.5) scrR_con_B GCGCTCATTCATGAAAAATTC Thisstudy (SEQIDNo.6) .sup.aUnderlined sequences are the homologous sequence with scrR of E. aerogenes.

(14) 1.2. Media and Culture Conditions

(15) The fermentation medium contained (g/L): 3 g KH.sub.2PO.sub.4, 6.8 g Na.sub.2HPO.sub.4, 0.75 g KCl, 0.35 g (NH.sub.4).sub.2SO.sub.4, 0.28 g Na.sub.2SO.sub.4, 0.26 g MgSO.sub.4.7H.sub.2O, 0.42 g citric acid, 5 g yeast extract, 10 g casamino acid and 0.3 ml microelement solution containing 34.2 g/L ZnCl.sub.2, 2.7 g/L FeCl.sub.3.sub._6H.sub.2O, 10 g/L MnCl.sub.2.sub._4H.sub.2O, 0.85 g/L CuCl.sub.2.sub._2H.sub.2O, and 0.31 g/L H.sub.3BO3, as described previously (Jung et al., 2012). In a flask culture, 60 g/L of the individual sugars: glucose, fructose, sucrose, or sugarcane molasses, were additionally added to the medium as the sole carbon source. Glucose, fructose, sucrose and all other compositions of medium were purchased from Sigma (St. Louis, Mo., USA). A Brazilian sugarcane molasses was used, the specific details of which are presented in Table 2, and its measured sugar contents were 87 g/L fructose, 81 g/L glucose, and 387 g/L sucrose. Differently from the media containing other carbon sources (pH 6.8), the pH of the medium with sugarcane molasses was low, so that it adjusted to above 6.2 by addition of 5 M NaOH. The flask sealed with silicon stopper was incubated at 37 C. and 250 rpm in a 250 ml flask containing 50 ml media for 12 h.

(16) TABLE-US-00002 TABLE 2 Composition Portion Total sugars 57.02% Non fermentative sugars below 4% N 0.5-1.5% P.sub.2O.sub.5 0.1-0.4% Ash below 15% pH 4.94 Sludge below 0.71% Country of origin Brazil

(17) The batch and fed-batch fermentations were carried out in a 5 L stirred bioreactor (Bio Control and System, Daejeon, Korea) containing 3 L of fermentation medium with 5% (v/v) inoculum. The operating temperature, agitation speed, and air flow were maintained at 37 C., 280 rpm, and 1.5 wm, respectively. All fermentation processes were initiated at pH 6.8, and were then maintained at pH 6.0 by the automatic addition of 5 M NaOH. Antifoam 204 (Sigma) was used when needed. Batch fermentations were carried out with 80 g/L of sugar cane molasses, as indicated in the results and discussion section. The total sugar concentration of fed-batch fermentations was maintained under 60 g/L by feeding sterilized sugar cane molasses.

(18) 1.3. Analytical Methods

(19) The metabolites, as obtained from flask and fermentation cultures, were analyzed by high performance liquid chromatography (Waters HPLC 1500 series, MA, USA) equipped with a RI detector at 45_C. Organic acids, 2,3-butanediol, acetoin, and ethanol were measured using Sugar SH1011 column (Shodex, Tokyo, Japan) at 75 C. and 10 mM sulfuric acid was used as the mobile phase. Fructose, glucose, and sucrose were determined using High Performance Carbohydrate Column (Waters) at 35 C. and 80% acetonitrile was used as the mobile phase. The flow rate of both mobile phases was 0.5 ml/min.

(20) Cell growth was monitored by a measurement of optical density at 600 nm (OD600) with a UV-Vis spectrophotometer (Shimadzu UV mini 1240, Tokyo, Japan).

(21) 2. Results and Discussion

(22) 2.1. Carbon Sources Effects on E. aerogenes Mutants in Flask Culture

(23) The gene cluster for sucrose catabolism in K. pneumonia is repressed by a sucrose regulator of the LacI family, ScrR (Reid and Abratt, 2005). Therefore, the knockout of scrR gene was expected to improve sucrose utilization. The scrR gene was searched for in the E. aerogenes KCTC 2190 genome (Shin et al., 2012) using BLAST (Basic Local Alignment Search Tool) with the sequence of ScrR protein of K. pneumonia (Mortlock, 1982). A 92% homolog in protein sequence was found in E. aerogenes. As listed in Table 1, the primers were designed and scrR gene was successfully deleted from the genomic DNA (data not shown).

(24) Flask cultivations of wild type KCTC 2190, EMY-01, and EMY-68 were performed with 60 g/L of various carbon sources such as glucose, fructose, sucrose, and sugarcane molasses for 12 h to confirm the effect of scrR deletion. In our previous study, EMY-01, the lactate dehydrogenase deletion mutant, had showed enhanced utilization of several carbon sources compared to its parent strain (Jung et al., 2012). Similar to the previous results, the consumption of carbon sources, cell growth, 2,3-butanediol production, yield, and productivity of EMY-01 were significantly increased compared to those of the wild type strain in all four carbon sources (Table 3).

(25) TABLE-US-00003 TABLES 3 AND 4 Comparison of optical density (OD600) and metabolite profiles obtained from wild type and its mutants using several carbon sources in a 12 h flask cultivation.sup.a. Glucose Fructose Sucrose Molasses Carbon source Wild EMY- Wild EMY- Wild Wild Strain type 01 EMY-68 type 01 EMY-68 type EMY-01 EMY-68 type EMY-01 EMY-68 OD.sub.600 11.73 17.7 18.2 13.18 16.58 16.88 10.27 11.97 15.17 Consumption 39.19 62.00 61.91 35.58 51.31 51.43 31.94 40.62 57.65 33.83 41.77 60.42 of sugars (g/L) 2,3-BDO 11.54 20.46 21.00 9.74 16.21 16.49 8.12 11.31 18.05 10.02 13.25 22.51 production (g/L) 2,3-BDO yield 0.28 0.31 0.32 0.27 0.32 0.32 0.26 0.29 0.31 0.29 0.31 0.37 (g/g/sugars) 2,3-BDO 0.96 1.70 1.75 0.81 1.35 1.37 0.68 0.94 1.50 0.84 1.10 1.86 productivity (g/L/h) Acetoin (g/L) 0.43 0.84 0.60 0.51 0.63 0.63 0.84 0.89 0.98 0.34 0.34 0.82 Ethanol (g/L) 6.00 10.46 10.38 4.50 7.10 7.30 4.03 5.94 9.21 6.08 6.47 12.76 Lactate (g/L) 4.66 0.69 0.56 3.67 0.80 0.46 0.44 0 0.77 1.06 0 0.01 Succinate (g/L) 2.11 3.30 3.58 2.79 3.58 3.69 3.86 4.30 3.25 0.21 0.51 1.29 Initial pH 6.73 6.73 6.73 6.85 6.85 6.85 6.86 6.86 6.86 6.14 6.14 6.14 Final pH 4.64 5.2 5.17 4.7 5.47 5.48 5.42 5.39 5.47 5.54 5.65 5.55 .sup.aThe data were averages and standard deviations of three experiments.

(26) As shown in FIGS. 2a and b, EMY-68 had a phenotype almost identical to EMY-01 when grown in glucose and fructose, suggesting that the disruption of scrR did not affect the consumption of these carbon sources. However, the growth and 2,3-butanediol production of EMY-01 were not significantly improved in sucrose and molasses compared to the wild type, while EMY-68 showed a much improved sucrose utilization and 2,3-butanediol production than its parent strain (FIGS. 2c and d). EMY-68 produced 18.05 g/L 2,3-butanediol and consumed 57.65 g/L sucrose in 12 h, representing increases of 59.6% and 41.9%, respectively, compared to that of EMY-01. Higher improvements were observed with sugarcane molasses, showing 2,3-butanediol production and consumption of carbon sources of EMY-68 increased by 69.9% and 44.6%, respectively, compared to those of EMY-01 (Table 3).

(27) Although sucrose is a dimer of glucose and fructose, scrR deletion only influenced sucrose metabolism, and not that of fructose. For fructose utilization in E. aerogenes, extracellular fructose is taken up by a multicomponent phosphotransferase system (PTS) and is converted into intracellular fructose-1-phosphate (Ferenci and Kornberg, 1973; Kelker et al., 1970). Fructose-1-phosphate is then phosphorylated to fructose-1,6-bisphoshate, which is subsequently consumed by glycolysis. On the other hand, the fructose moiety of sucrose is hydrolyzed and then converted to fructose-6-phosphate by fructokinase (FIG. 1a). Since ScrR was known to bind mainly to the intracellular fructose and to repress only the scr operon, scrR deletion could not affect the catabolism of fructose (Jahreis and Lengeler, 1993). The effect of sucrose regulator deletion on sucrose metabolism was qualitatively consistent with a previous report for E. coli (Arifin et al., 2011), which has a PTS non-dependent sucrose transporter. The effect of scrR deletion was also clearly observed when molasses was used as a carbon source, because sucrose is the main sugar in molasses.

(28) In a flask culture with an economic carbon source, sugarcane molasses, 2,3-butanediol titer, yield, and productivity of IdhA and scrR double mutant increased by 124.7%, 27.6%, and 121.4%, respectively, compared to those of the wild type strain (Table 3). This result demonstrated the advantage of genetic engineering in utilizing an industrial feedstock such as molasses in biorefinery.

(29) 2.2 Effects of the Mutation on Batch Fermentation Using Sugarcane Molasses and on Sugar Utilization Preference

(30) Batch fermentation of wild type KCTC 2190, EMY-01, and EMY-68 was conducted at 80 g/L initial sugarcane molasses concentration for 10 h in a 5 L fermenter. The effects of IdhA and scrR deletions were similar to those in flask cultures with molasses. EMY-68 produced 28.88 g/L 2,3-butanediol, and consumed 82.13 g/L carbon (Table 4), which was significantly higher than that of wild type and EMY-01. In this experiment, the consumptions of main sugars in molasses, glucose, fructose, and sucrose, were monitored to find the effect of scrR deletion on carbon source utilization (FIG. 3). Glucose was the preferred carbon source for all three strains. After glucose was depleted, wild type and EMY-01 utilized fructose and sucrose at similar rates (FIGS. 3a and b). Since sucrose concentrations were much greater than fructose in sugarcane molasses, fructose was depleted earlier than sucrose. Meanwhile, EMY-68 consumed sucrose much faster than the wild type, and subsequently did fructose (FIG. 3c).

(31) When provided with a mixture of several carbon sources, most bacteria generally consume carbon sources in a sequential manner (Bruckner and Titgemeyer, 2002; Goerke and Stulke, 2008; Stulke and Hillen, 1999). The use of preferred carbon sources represses or activates the activity of catabolic mechanisms that enable the utilization of secondary carbon sources. In E. aerogenes, all three sugars: glucose, fructose, and sucrose, are transferred across the cytoplasmic membrane by PTS. Therefore, a few possible mechanisms can be suggested for the change in carbon source preference. Firstly, the fru operon for fructose catabolism is regulated at a transcription level, mainly by catabolite repressor/activator protein (Cra, previously designated fruR) in E. coli (Saier and Ramseier, 1996). Recently, the Cra binding site was found on the promoter region of the csc operon encoding the genes for sucrose catabolism in E. coli (Sabri et al., 2013). Similarly, it is likely that Cra is involved in the regulation of the scroperon in E. aerogenes. When the scrR gene is eliminated, the transcription regulation of the scr operon by Cra can be perturbed and activated to a stronger degree than the fru operon upon glucose depletion. Secondly, the basal expression level of scr operon is enhanced by the deletion of scrR, resulting in a higher expression of ScrA compared to the fructose transporter. This enhanced the activation of scr operon over the fru operon. Lastly, the expression of these PTS mediated-sugar utilization operons are often modulated by transcription regulators that contain duplicated PTS-regulatory domains (PRDs) (Stulke et al., 1998; van Tilbeurgh and Declerck, 2001). The phosphorylated level of PRDs by the PTS-mediated sugar transporter EIIB or HPr has been known to enable the sequential utilization of PTS-mediated sugar (Graille et al., 2005). Therefore, the change of carbon source preference by the deletion of the scrR gene in E. aerogenes might be triggered by PRDs. Future work will be directed towards clarifying the specific molecular mechanisms which are involved in determining the preferred carbon source in the mutant.

(32) TABLE-US-00004 TABLE 5 Wild type Strains KCTC 2190 EMY-01 EMY-68 Concentration of initial sugars (g/l) 79.84 85.46 86.43 Consumption of sugars (g/l) 53.80 58.06 78.07 2,3-Butanediol (g/l) 16.05 18.92 25.68 2,3-Butanediol productivity (g/l/h) 1.33 1.58 2.14 2,3-Butanediol yield (g/g sugars) 0.298 0.326 0.329 Acetoin (g/l) 1.21 1.53 0.57 Lactate (g/L) 1.73 0.01 0.02 Ethanol (g/l) 4.41 5.22 7.15 Succinate (g/l) 1.06 1.46 1.39

(33) 2.3 Fed-Batch Fermentation with EMY-68 Using Sugarcane Molasses

(34) To further enhance 2,3-butanediol production from sugarcane molasses by EMY-68, a fed-batch fermentation with molasses feeding was performed. As shown in FIG. 4 and 202.89 g/L of sugars in sugarcane molasses was consumed and 2,3-butanediol production reached 72.89 g/L at 36 h of cultivation. The 2,3-butanediol yield and productivity were 0.359 g/g sugars and 2.02 g/L/h, respectively. Among the major byproducts, succinate was difficult to measure quantitatively, because its retention time in HPLC analysis was overlapped by an unknown substance of sugarcane molasses.

(35) A very small amount of lactate was produced due to the deletion of lactate dehydrogenase. Meanwhile, maximum 7.89 g/L ethanol was produced until 16 h of cultivation, and as a primary metabolite, ethanol was produced during the logarithmic growth phase, and then was evaporated by relatively high temperature of fermentation (37 C.).

Example 2: 2,3-Butanediol Production Using Klebsiella pneumonia

(36) 1. Experimental Materials & Methods

(37) 1.1 Strain Development

(38) The results with respect to the increase in the practical use of sucrose and molasses and the resultant increase in the production of 2,3-butanediol, through the removal of lactate dehydrogenase (LdhA) and sucrose regulator (ScrR) in the Enterobacter aerogenes KCTC 2190 strain, were applied to the Klebsiella pneumonia KCTC 2242 strain. The Klebsiella pneumonia strain is a representative 2,3-butanediol producing strain that is present in nature, together with Enterobacter aerogenes. The Klebsiella pneumonia strain has genes capable of using sucrose, and such genes have an operon (ScrA, Ell transport protein for sucrose; ScrB, sucrose-6-phosphate hydrolase; ScrK, fructokinase; ScrY, outer membrane sucrose porin) In addition, Klebsiella pneumonia has scrR gene that regulates the expression of the operon. Therefore, in order to increase the rate of utilization of sucrose and molasses in the Klebsiella pneumonia strain, scrR was deleted by the A Red recombination method. In addition, in order to reduce the production of lactate, which is a main byproduct, and prevent the acidification of medium, lactate dehydrogenase was removed by the same method. Last, the Klebsiella pneumonia strain is a pathogen pertaining to class 2, and thus has a limitation in its industrial utilization. Since pathogenicity is known to occur by extracellular capsules, the wabG gene associated with the formation of the extracellular capsules was removed by the same method. Therefore, a total of three mutation strains were developed from the Klebsiella pneumonia strain. Klebsiella pneumonia (wabG), Klebsiella pneumonia (wabG ldhA), and Klebsiella pneumonia (wabGldhAscrR) were named KMK-01, KMK-02, and KMK-03, respectively, and then the comparison test was conducted for the use of sucrose and molasses thereof and the production of 2,3-butanediol.

(39) 1.2. Media and Culture Condition

(40) The Klebsiella pneumonia mutation strain was cultured in the same conditions of the culture medium and culture condition in example 1 above.

(41) 2. Results

(42) Klebsiella pneumonia strain, KMK-08 without IdhA, scrR, and wabG through removal showed the decrease tendency by about 10% in the 2,3-butanediol production compared with the parent strain, when using glucose or fructose as a sole carbon source. However, the strain produced almost the same level of 2,3-butanediol compared with the parent strain when sucrose was given as a carbon source, and showed the increase by about 32% in the 2,3-butanediol productivity compared with the parent strain when molasses was a carbon source.

(43) All the Klebsiella pneumonia strains (KMK-01, KMK-02, and KMK-08) consume three kinds of carbon sources at the same time. In KMK-01 and KMK-02, the consumption rate of glucose was the highest and the consumption rates of sucrose and fructose were almost similar to each other. However, in KMK-08, the consumption rate of sucrose was verified to be significantly increased compared with the consumption rate of fructose.

(44) 3. Conclusion

(45) For the production of 2,3-butanediol, metabolically engineered Enterobacter aerogenes KCTC 2190 and Klebsiella pneumonia were cultured while sugar-cane molasses was used as a carbon source. When IdhA- and scrR-deleted Enterobacter aerogenes was subjected to fed-batch fermentation using sugar-cane molasses as a carbon source, the strain exhibited the 2,3-butanediol production of 72.89 g/L and sugar efficiency of 0.36 g/g of sugar for 36 h, and when IdhA, scrR, and wabG-deleted Klebsiella pneumonia was fermented using sugar-cane molasses as a carbon source, the strain exhibited the increase by 30% or more in the 2,3-butanediol production compared with those of scrR-non-deleted Klebsiella pneumonia (ldhA or ldhAwabG). Therefore, sucrose and sugar-cane molasses could be converted into 2,3-butanediol more efficiently by removing the transcriptional suppressor of the sucrose-using operon. These results suggest that the metabolically engineered strains can be 2,3-butanediol producing strains using economical carbon sources.

REFERENCES

(46) Akaraonye, E., Moreno, C., Knowles, J. C., Keshavarz, T., Roy, I. 2012. Poly(3-hydroxybutyrate) production by Bacillus cereus SPV using sugarcane molasses as the main carbon source. Biotechnol J, 7(2), 293-303. Arifin, Y, Sabri, S., Sugiarto, H., Kromer, J. O., Vickers, C. E., Nielsen, L. K. 2011. Deletion of cscR in Escherichia coli W improves growth and poly-3-hydroxybutyrate (PHB) production from sucrose in fed batch culture. J Biotechnol, 156(4), 275-278. Bockmann, J., Heuel, H., Lengeler, J. W. 1992. Characterization of a chromosomally encoded, non-PTS metabolic pathway for sucrose utilization in Escherichia coli Ec3132. Mol Gen Genet, 235(1), 22-32. Bruckner, R., Titgemeyer, F. 2002. Carbon catabolite repression in bacteria: choice of the carbon source and autoregulatory limitation of sugar utilization. FEMS Microbiol Lett, 209(2), 141-148. Chan, S., Kanchanatawee, S., Jantama, K. 2012. Production of succinic acid from sucrose and sugarcane molasses by metabolically engineered Escherichia coli. Bioresource Technol, 103(1), 329-336. Datsenko, K. A., Wanner, B. L. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci USA, 97(12), 6640-6645. Ferenci, T., Kornberg, H. L. 1973. Utilization of fructose by Escherichia coli-Properties of a mutant defective in fructose-1-phosphate-kinase-activity. Biochem J, 132(2), 341-347. Goerke, B., Stulke, J. 2008. Carbon catabolite repression in bacteria: many ways to make the most out of nutrients. Nat Rev Microbiol, 6(8), 613-624. Graille, M., Zhou, C. Z., Receveur-Brechot, V., Collinet, B., Declerck, N., van Tilbeurgh, H. 2005. Activation of the LicT transcriptional antiterminator involves a domain swing/lock mechanism provoking massive structural changes. J Biol Chem, 280(15), 14780-14789. Jahreis, K., Lengeler, J. W. 1993. Molecular analysis of two ScrR repressors and of a ScrR-FruR hybrid repressor for sucrose and D-fructose specific regulons from enteric bacteria. Mol Microbiol, 9(1), 195-209 Ji, X. J., Huang, H., Ouyang, P. K. 2011. Microbial 2,3-butanediol production: A state-of-the-art review. Biotechnol Adv, 29(3), 351-364. Jiang, L. Q., Fang, Z., Guo, F., Yang, L. B. 2012. Production of 2,3-butanediol from acid hydrolysates of Jatropha hulls with Klebsiella oxytoca. Bioresource Technol, 107, 405-410. Jung, M. Y., Ng, C. Y., Song, H., Lee, J., Oh, M. K. 2012. Deletion of lactate dehydrogenase in Enterobacter aerogenes to enhance 2,3-butanediol production. Appl Microbiol Biotechnol, 95(2), 461-469. Kelker, N. E., Hanson, T. E., Anderson, R. L. 1970. Alternate pathways of D-fructose metabolism in Aerobacter aerogenes-a specific D-fructokinase and its preferential role in metabolism of sucrose. J Biol Chem, 245(8), 2060-&. Ma, C. Q., Wang, A. L., Qin, J. Y., Li, L. X., Ai, X. L., Jiang, T. Y., Tang, H. Z., Xu, P. 2009. Enhanced 2,3-butanediol production by Klebsiella pneumoniae SDM. Appl Microbiol Biotechnol, 82(1), 49-57. Mortlock, R. P. 1982. Regulatory mutations and the development of new metabolic pathways by bacteria. Evol Biol, 14, 205-268. Reid, S. J., Abratt, V. R. 2005. Sucrose utilisation in bacteria: genetic organisation and regulation. Appl Microbiol Biotechnol, 67(3), 312-321. Saier, M. H., Ramseier, T. M. 1996. The catabolite repressor/activator (Cra) protein of enteric bacteria. J Bacteriol, 178(12), 3411-3417. Shiloach, J., Fass, R. 2005. Growing E. coli to high cell densityA historical perspective on method development. Biotechnol Adv, 23(5), 345-357. Shin, S. H., Kim, S., Kim, J. Y., Lee, S., Um, Y, Oh, M. K., Kim, Y. R., Lee, J., Yang, K. S. 2012. Complete genome sequence of Enterobacter aerogenes KCTC 2190. J Bacteriol, 194(9), 2373-2374. Sprenger, G. A., Lengeler, J. W. 1988. Analysis of sucrose catabolism in Klebsiella Pneumoniae and in Scr+ derivatives of Escherichia coli K12. J Gen Microbiol, 134, 1635-1644. Stulke, J., Arnaud, M., Rapoport, G., Martin-Verstraete, I. 1998. PRDa protein domain involved in PTS-dependent induction and carbon catabolite repression of catabolic operons in bacteria. Mol Microbiol, 28(5), 865-874. Stulke, J., Hillen, W. 1999. Carbon catabolite repression in bacteria. Curr Opin Microbiol, 2(2), 195-201. Sun, L. H., Wang, X. D., Dai, J. Y., Xiu, Z. L. 2009. Microbial production of 2,3-butanediol from Jerusalem artichoke tubers by Klebsiella pneumoniae. Appl Microbiol Biotechnol, 82(5), 847-852. van Tilbeurgh, H., Declerck, N. 2001. Structural insights into the regulation of bacterial signalling proteins containing PRDs. Curr Opin Struc Biol, 11(6), 685-693. Vertes, A. A. 2010. Biomass to biofuels: strategies for global industries. Wiley, Hoboken, N. J. Wang, A. L., Wang, Y, Jiang, T. Y., Li, L. X., Ma, C. Q., Xu, P. 2010. Production of 2,3-butanediol from corncob molasses, a waste by-product in xylitol production. Appl Microbiol Biotechnol, 87(3), 965-970. Zhang, L. Y., Sun, J. A., Hao, Y. L., Zhu, J. W., Chu, J., Wei, D. Z., Shen, Y. L. 2010. Microbial production of 2,3-butanediol by a surfactant (serrawettin)-deficient mutant of Serratia marcescens H30. J Ind Microbiol Biotechnol, 37(8), 857-862.

(47) Features and advantages of the present invention are summarized as follows:

(48) (a) The present invention provides a strain for producing 2,3-butanediol.

(49) (b) The present invention can economically produce 2,3-butanediol by using a cheap carbon source.

(50) (c) The present invention shows superior 2,3-butanediol efficiency and productivity compared with wild-type strains.

(51) Although the present invention has been described in detail with reference to the specific features, it will be apparent to those skilled in the art that this description is only for a preferred embodiment and does not limit the scope of the present invention. Thus, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.

REFERENCE TO A SEQUENCE LISTING

(52) This application contains references to amino acid sequences and/or nucleic acid sequences which have been submitted herewith as the sequence listing text file. The aforementioned sequence listing is hereby incorporated by reference in its entirety pursuant to 37 C.F.R. 1.52(e).