METHODS FOR RNA PROMOTER IDENTIFICATION

20180155713 ยท 2018-06-07

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided are constructs and methods for RNA promoter identification.

Claims

1. A DNA construct comprising the following operably linked polynucleotide elements in the 5 to 3 direction: i) a promoter; ii) a hammerhead ribozyme cleavage site; iii) a hammerhead ribozyme catalytic core; iv) a first hairpin ribozyme cleavage site in the antisense orientation; v) a non-functional or stuffer polynucleotide; vi) a second hairpin ribozyme cleavage site in the antisense orientation; vii) a hairpin ribozyme catalytic core in the antisense orientation; viii) reverse and forward primer annealing sites in the antisense orientation; ix) an inserted polynucleotide suspected of comprising a RNA promoter; and x) a third ribozyme catalytic core, wherein the third ribozyme catalytic core is in the sense orientation, is not a hairpin ribozyme catalytic core and does not comprise a hairpin ribozyme cleavage site.

2. The DNA construct of claim 1, wherein the promoter is functional in a prokaryotic cell.

3. The DNA construct of claim 2, wherein the promoter functional in a prokaryotic cell comprises a bacteriophage promoter selected from the group consisting of T7, T3 and SP6.

4. The DNA construct of claim 1, wherein the promoter is functional in a eukaryotic cell.

5. A RNA construct comprising the following operably linked polynucleotide elements in the 5 to 3 direction: i) a hammerhead ribozyme catalytic core; ii) a first hairpin ribozyme cleavage site in the antisense orientation; iii) a non-functional or stuffer polynucleotide; iv) a second hairpin ribozyme cleavage site in the antisense orientation; v) a hairpin ribozyme catalytic core in the antisense orientation; vi) reverse and forward primer annealing sites in the antisense orientation; and vii) an inserted polynucleotide suspected of comprising a RNA promoter.

6. The RNA construct of claim 5, comprising a hydroxyl group at the 5-end.

7. The RNA construct of any one of claims 5 to 6, comprising a 2:3 cyclic phosphodiester at the 3-end.

8. The DNA or RNA construct of any one of claims 1 to 7, wherein the hammerhead ribozyme catalytic core is from a hammerhead ribozyme selected from the group consisting of Type I, Type II, Type III, HH9 and HH10.

9. The DNA or RNA construct of claim 8, wherein the hammerhead ribozyme catalytic core is from a Type III hammerhead ribozyme.

10. The DNA or RNA construct of any one of claims 1 to 8, wherein the first and/or second hairpin ribozyme cleavage sites have a polynucleotide of SEQ ID NO:7.

11. The DNA or RNA construct of any one of claims 1 to 8, wherein the first and/or second hairpin ribozyme cleavage sites have a polynucleotide of SEQ ID NO:6.

12. The DNA or RNA construct of any one of claims 1 to 11, wherein the non-functional or stuffer polynucleotide does not comprise any one of a functional RNA promoter, a primer annealing site, or a transcription modifying sequence.

13. The DNA or RNA construct of any one of claims 1 to 12, wherein the non-functional or stuffer polynucleotide comprises from about 200 base pairs (bp) to 1000 base pairs.

14. The DNA or RNA construct of any one of claims 1 to 13, wherein the hairpin ribozyme catalytic core is derived from the negative strand self-cleavage domain of a plant virus satellite RNA selected from the group consisting of the satellite RNA of tobacco ringspot virus (sTRSV), the satellite RNA of arabis mosaic virus (sArMV), and the satellite RNA of chicory yellow mottle virus (sCYMV).

15. The DNA or RNA construct of any one of claims 1 to 14, wherein the hairpin ribozyme catalytic core is derived from the negative strand self-cleavage domain of the satellite RNA of tobacco ringspot virus (sTRSV).

16. The DNA or RNA construct of any one of claims 1 to 14, wherein the hairpin ribozyme catalytic core comprises a polynucleotide of SEQ ID NO:8.

17. The DNA or RNA construct of any one of claims 1 to 14, wherein the hairpin ribozyme catalytic core comprises a polynucleotide of SEQ ID NO:3.

18. The DNA or RNA construct of any one of claims 1 to 14, wherein the hairpin ribozyme catalytic core comprises a polynucleotide of SEQ ID NO:4.

19. The DNA or RNA construct of any one of claims 1 to 14, wherein the hairpin ribozyme catalytic core comprises a polynucleotide of SEQ ID NO:5.

20. The DNA or RNA construct of any one of claims 1 to 19, wherein the inserted polynucleotide suspected of comprising a RNA promoter is from a library of randomized chemically synthesized DNA sequences.

21. The DNA or RNA construct of any one of claims 1 to 19, wherein the inserted polynucleotide suspected of comprising a RNA promoter is from cDNA of a RNA virus genome.

22. The DNA or RNA construct of any one of claims 1 to 19, wherein the inserted polynucleotide suspected of comprising a RNA promoter is from genomic DNA.

23. The DNA or RNA construct of any one of claims 1 to 19, wherein the inserted polynucleotide suspected of comprising a RNA promoter comprises a mutagenized RNA promoter.

24. The DNA or RNA construct of any one of claims 1 to 23, wherein the inserted polynucleotide suspected of comprising a RNA promoter is from about 50 bp to about 200 bp.

25. The DNA or RNA construct of any one of claims 1 to 24, wherein the third ribozyme catalytic core comprises a hammerhead ribozyme catalytic core without a hairpin cleavage site at its 3 end.

26. The DNA or RNA construct of any one of claims 1 to 25, wherein the third ribozyme catalytic core comprises a positive or negative strand hepatitis delta virus (HDV) ribozyme catalytic core.

27. The DNA or RNA construct of any one of claims 1 to 26, wherein the DNA construct has a length of from about 600 bp to about 1600 bp.

28. A DNA construct having at least about 60% sequence identity to a polynucleotide of SEQ ID NO:1.

29. A DNA construct having at least about 60% sequence identity to a polynucleotide of SEQ ID NO:9.

30. A DNA construct having at least about 60% sequence identity to a polynucleotide of SEQ ID NO:10.

31. A DNA construct having at least about 60% sequence identity to a polynucleotide of SEQ ID NO:11.

32. A DNA plasmid comprising the DNA construct of any one of claims 1 to 31.

33. The DNA plasmid of claim 32, wherein the plasmid has a size of from about 3000 bp to about 15000 bp.

34. A polynucleotide library comprising a population of the DNA or RNA constructs of any one of claims 1 to 31 or a population of the DNA plasmids of any one of claims 32 to 33, wherein each member of the population comprises a unique insert suspected of comprising a RNA promoter.

35. A host cell comprising the DNA or RNA construct of any one of claims 1 to 31 or the DNA plasmid of any one of claims 32 to 33.

36. The host cell of claim 35, wherein the host cell expresses a RNA-dependent RNA polymerase.

37. The host cell of anyone of claims 35 to 36, wherein the host cell is transfected with a polynucleotide that encodes an exogenous RNA-dependent RNA polymerase.

38. The host cell of anyone of claims 35 to 36, wherein the host cell is infected with a RNA virus.

39. The host cell of claim 38, wherein the host cell is infected with a RNA virus from a virus taxonomic Order selected from the group consisting of Mononegavirales, Nidovirales, Picornavirales, and Tymovirales.

40. The host cell of claim 38, wherein the host cell is infected with a RNA virus from a virus taxonomic Group selected from the group of arenaviridae, astroviridae, barnaviridae, benyviridae, bromoviridae, bunyaviridae, caliciviridae, carmotetraviridae, closteroviridae, flaviviridae, hepeviridae, leviviridae, luteoviridae, narnaviridae, nodaviridae, ophioviridae, orthomyxoviridae, permutotetraviridae, potyviridae, togaviridae, tombusviridae, virgaviridae.

41. The host cell of claim 38, wherein the host cell is infected with a RNA virus from a virus taxonomic Family selected from a group of celivirus, deltavirus, emaravirus, higrevirus, idaeovirus, ourmiavirus, polemovirus, sobemovirus, tenuivirus, umbravirus, or varicosavirus.

42. The host cell of anyone of claims 35 to 39, wherein the host cell is a prokaryotic cell or a eukaryotic cell.

43. The host cell of anyone of claims 35 to 42, wherein the host cell is selected from the group consisting of an archaeal cell, a bacterial cell, an animal cell (e.g., a mammalian cell or an insect cell), a plant cell or a fungal cell.

44. A method of identifying a RNA promoter comprising the steps of: a) transfecting a host cell with the DNA or RNA construct of any one of claims 1 to 27 or the DNA plasmid of any one of claims 32 to 33, wherein the 5 promoter is capable of promoting transcription in the host cell; wherein the host cell expresses a RNA-dependent RNA polymerase and rolling circle transcription of the RNA construct or RNA transcribed from the DNA construct within the host cell when the inserted polynucleotide comprises a functional RNA promoter yields a circularized RNA comprising: i) a hammerhead ribozyme catalytic core in the antisense orientation; ii) a hairpin ribozyme cleavage site; iii) a hairpin ribozyme catalytic core; iv) reverse and forward primer annealing sites; and v) the inserted polynucleotide comprising a functional RNA promoter; b) isolating the circularized RNA; c) amplifying the inserted polynucleotide comprising a functional RNA promoter; and d) sequencing the inserted polynucleotide comprising a functional RNA promoter, thereby identifying the RNA promoter.

45. A method of identifying a RNA promoter comprising the steps of: a) transcribing in vitro into RNA the DNA construct of any one of claims 1 to 31 or the DNA plasmid of any one of claims 32 to 33, thereby producing a RNA transcript of the DNA construct; b) transfecting a host cell with the RNA transcript, wherein the host cell expresses a RNA-dependent RNA polymerase and rolling circle transcription of the RNA construct within the host cell when the inserted polynucleotide comprises a functional RNA promoter yields a circularized RNA comprising: i) a hammerhead ribozyme catalytic core in the antisense orientation; ii) a ribozyme cleavage site; iii) a hairpin ribozyme catalytic core; iv) reverse and forward primer annealing sites; and v) the inserted polynucleotide comprising a functional RNA promoter; c) isolating the circularized RNA; d) amplifying the inserted polynucleotide comprising a functional RNA promoter; and e) sequencing the inserted polynucleotide comprising a functional RNA promoter, thereby identifying the RNA promoter.

46. The method of any one of claims 44 to 45, wherein the host cell is transfected with a polynucleotide that encodes an exogenous RNA-dependent RNA polymerase.

47. The method of any one of claims 44 to 45, wherein the host cell is infected with a RNA virus.

48. The method of claim 47, wherein the host cell is infected with a RNA virus from a virus taxonomic Order selected from the group consisting of Mononegavirales, Nidovirales, Picornavirales, and Tymovirales.

49. The method of claim 47, wherein the host cell is infected with a RNA virus from a virus taxonomic Group selected from the group of arenaviridae, astroviridae, barnaviridae, benyviridae, bromoviridae, bunyaviridae, caliciviridae, carmotetraviridae, closteroviridae, flaviviridae, hepeviridae, leviviridae, luteoviridae, narnaviridae, nodaviridae, ophioviridae, orthomyxoviridae, permutotetraviridae, potyviridae, togaviridae, tombusviridae, virgaviridae.

50. The method of claim 47, wherein the host cell is infected with a RNA virus from a virus taxonomic Family selected from a group of celivirus, deltavirus, emaravirus, higrevirus, idaeovirus, ourmiavirus, polemovirus, sobemovirus, tenuivirus, umbravirus, or varicosavirus.

51. The method of any one of claims 44 to 50, wherein the host cell is a prokaryotic cell or a eukaryotic cell.

52. The method of any one of claims 44 to 50, wherein the host cell is selected from the group consisting of an archaeal cell, a bacterial cell, an animal cell (e.g., a mammalian cell or an insect cell), a plant cell or a fungal cell.

53. The method of any one of claims 44 to 52, wherein the sequencing comprises deep sequencing.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0054] FIGS. 1A-C. A, Secondary structure of sTRSV. The filled box represents the region of the RNA encoding the hammerhead ribozyme. The unfilled box represents the region of the RNA, which in the negative strand encodes the hairpin ribozyme. B, A 126 nucleotide minimal sTRSV construct that is still capable of hammerhead ribozyme cleavage and which can be circularized by enzymatic action within cells. C, The proposed secondary structure of the Stem II region of a related satellite RNA from arabis mosaic virus (sArMV).

[0055] FIG. 2 illustrates the symmetrical rolling circle scheme for sTRSV replication. All sequences are RNA. The solid lines are the positive (+) strand and the dotted lines are the negative () strand. The positive strand is defined as that which is predominantly found in encapsidated in the viral capsids.

[0056] FIG. 3 illustrates a molecule for selecting RNA promoters from either viral or random sequences.

[0057] FIGS. 4A-D illustrate construct and production of molecule for selection of RNA promoters from any source, e.g., from viral cDNA, viral genomic, organismal genomic or random sequences. The uppermost line is an insert into a plasmid appropriate for either in vitro or in vivo production of RNA. Appropriate sequences for the plasmid necessary for either in vitro or in vivo use are included as appropriate or desired, for example, T-DNA borders for use in plants. DNA molecules are shown as solid lines while RNA sequences are shown as dotted lines. The promoter (Pro) could be for in vitro production, for example, the T7 RNA polymerase promoter, or for in vivo production, for example, a plant promoter for production of the desired molecules inside plant cells. The HDV ribozyme (HDV) would be substituted for what would normally be another hammerhead ribozyme (HH). The sequences that are shaded are not functional as they are the complements of the active sequences.

[0058] FIG. 5 illustrates rolling circle replication of the molecule for selection of RNA promoters. In the circular molecule, the 5 to 3 direction is clockwise on the circle. In the linear multimer produced by replication of the circular molecule the 5 to 3 direction is from left to right. The 5 most sequence of the new RNA synthesized is a fragment of the insert sequence. While the newly synthesized RNA is shown only through the second stuffer sequence, it is shown this way for convenience only and should be longer than this depending on the ability of the viral replication machinery to synthesize longer RNAs. Notice that in the newly synthesized RNA the hammerhead sequences (HH) are shaded (non-functional due to being the complementary sequence) and the E, P and D sequences are not shaded (functional).

[0059] FIG. 6 illustrates processing of the newly synthesized primary transcript. The primary transcript is shown at the top with the fully processed products are below it. For every one of the 5 most fragment, there should be multiple stuffer and insert fragments.

[0060] FIG. 7 illustrates a depiction of a generalized structure of the P-D regions and ribozyme core regions and their interactions.

[0061] FIGS. 8A-B illustrate a text map of a mini-monomer cassette sequence for RNA promoter selection.

[0062] FIG. 9 illustrates a plasmid schematic of an in vitro production construct for MiniM cassette production for RNA promoter selection.

[0063] FIGS. 10A-E illustrate a text map of an in vitro production construct for MiniM cassette production for RNA promoter selection.

[0064] FIG. 11 illustrates a plasmid schematic of an in piano production construct for MiniM cassette production for RNA promoter selection. The illustrated in planta construct is a derivative of pEAQ-HT, a known plasmid for plant expression. See, e.g., Peyret, et al., Plant Mol Biol. (2013) 83(1-2):51-8.

[0065] FIGS. 12A-P illustrate a text map of an in planta production construct for MiniM cassette production for RNA promoter selection.

[0066] FIG. 13 illustrates a plasmid schematic of an animal cell production construct for MiniM cassette production for RNA promoter selection. The illustrated animal cell construct is a derivative of pNL 3.2, a known cytomegalovirus promoter-containing expression vector (commercially available from Promega; promega.com).

[0067] FIGS. 14A-K illustrate a text map of an animal cell production construct for MiniM cassette production for RNA promoter selection.

DETAILED DESCRIPTION

[0068] 1. Introduction

[0069] Provided are constructs and methods that employ hairpin ribozyme catalytic cores, e.g., such as the satellite RNA of tobacco ringspot virus (sTRSV) for identification of RNA promoters. sTRSV is a linear, 359 nucleotide, single stranded RNA which parasitizes the virus infections of its helper virus tobacco ringspot virus (TRSV). When present, it ameliorates the symptoms caused by the virus infection. It is encapsidated as a linear molecule in the virus capsid protein and uses the virus-encoded replication machinery to replicate. It has a complex secondary structure, shown in FIG. 1A that has a high degree of secondary structure.

[0070] Within the secondary structure are two of the known ribozyme motifsa hammerhead ribozyme (the filled box in FIG. 1A) in the positive (+) strand and a hairpin ribozyme (the unfilled boxes in FIG. 1A) in the negative () strand. Each is inactive when found in the complementary strand. One should also notice two things about these ribozymes, one, that while the hammerhead ribozyme is a contiguous region, the hairpin ribozyme is in two regionsthe P and D regions, which function as the substrate for the more distant E region, which is the ribozyme core, and two, that the hammerhead and D region overlap by 5 nucleotides. These ribozymes play essential roles in sTRSV replication.

[0071] sTRSV replicates via a symmetrical rolling circle replication scheme as shown in FIG. 2. Linear (+) monomer sTRSV RNAs are found in the viral capsids. Inside cells this linear RNA is converted to a circular template by the action of a cellular enzyme (see, Chay, Guan and Bruening, Virology. (1997) 239(2):413-25) (step 6 in FIG. 2). This circular (+) sTRSV RNA is used by the TRSV helper virus RNA replication machinery as a template for rolling circle replication. Multimeric () sTRSV RNAs are produced (step 1 in FIG. 2). The hairpin ribozyme then cleaves these multimeric () sTRSV RNAs into linear () sTRSV monomers (step 2 in FIG. 2). Again through the reversible action of the hairpin ribozyme, the linear () sTRSV monomers are circularized (step 3 in FIG. 2). The circular () sTRSV RNAs are then used by the viral RNA replication machinery are then used for rolling circle replication producing multimeric (+) sTRSV RNA (step 4 in FIG. 2). The hammerhead ribozyme in the (+) sTRSV RNA then cleaves the multimeric (+) sTRSV RNA into monomers (step 5 in FIG. 2), completing the cycle.

[0072] Chay, Guan and Bruening found that a much smaller construct containing the entire hammerhead region, but little else was capable of being efficiently circularized when produced inside cells (FIG. 1B). One should notice that the hairpin ribozyme core has been entirely deleted from this minimal circularizable (+) sTRSV RNA. Using this information and the smaller structure of Stem II from another related satellite RNA from arabis mosaic virus (sArMV) as shown in FIG. 1C, a molecule with the structure shown in FIG. 3 is constructed.

[0073] This molecule contains sequences for both ribozymes to function as well as the entire sequence of Stem III compared to the truncated Stem III sequence in the minimal circularizable (+) sTRSV RNA (FIG. 1B) and a truncated Stem II consistent with the structure of the sArMV sTRSV Stem II. New structures are attached to these Stem II and Stem III to form enlarged loops. The loop of the truncated Stem II contains a stuffer RNA sequence, which increases the overall size of the RNA, but provides no other function, and a second copy of the P and D regions of the hairpin ribozyme, the regions that are acted on by the ribozyme core. The loop of Stem III contains an insert sequence, which can either be fragments of viral RNA, organismal genomic or random sequences, for example 50 random nucleotides (50 Ns, where N could be any nucleotide) and primer binding sites for reverse transcriptase-polymerase chain reaction.

[0074] This molecule is produced from the construct shown in FIG. 4. This construct can be used for in vitro production of the linear molecule shown after cleavage or the in vivo production of the circular molecule shown after enzymatic ligation. In vitro produced linear molecules are circularized by introduction into cells. Another known ribozyme, one of the two found in the hepatitis delta virus (HDV) sequence would substitute for a second hammerhead ribozyme to produce the 3 termini of the molecule. This embodiment removes the D region that is found overlapping with the hammerhead ribozyme sequence to prevent accidental formation of negative circular RNAs from spurious transcription in the opposite direction of the promoter shown (Pro) by sequences outside those shown. Transcription produces the unprocessed primary transcript followed by hammerhead and HDV ribozyme cleavage to generate the appropriate 5 and 3 termini respectively.

[0075] Production of the circular RNA or introduction of the linear RNA followed by circularization would take place in virus infected material (plants, animal cells culture, etc.). In this way, viral replication machinery is already present within the cells. In most cases, the inserted sequences within the left terminal loop do not contain a sequence that can interact with the viral replication machinery so no complementary RNA is generated. In some cases, the viral replication machinery interacts with the insert sequence and complementary sequences are generated as shown in FIG. 5. Processing of this newly synthesized primary transcript is shown in FIG. 6. The newly synthesized stuffer-containing fragments are not circularized because they do not contain a ribozyme core. The stuffer sequences also do not contain the primer binding sites and so are not recovered after RT-PCR. The newly synthesized insert-containing fragments do contain a ribozyme core and therefore are circularized and recoverable by RT-PCR with reverse and forward primers (e.g., primers 1 and 2). Deep sequencing of the insert-containing fragments identifies the sequences that are recognizable by the viral replication machinery. Subsequent rounds of selection after mutagenesis can improve the RNA promoter function.

[0076] Once selected, these viral RNA promoter molecules can be used directly as antiviral agents as they compete for viral RNA replication machinery, or the viral RNA promoters can be combined with an anti-RNA virus gene, like RNase to make a novel anti-viral gene, which is only be expressed when the virus is present. These novel anti-viral genes can be used directly as RNAs by introduction into virus-infected cells by liposome or other means, or can be used to make transgenic organisms resistant to virus infection.

[0077] 2. Constructs

[0078] The constructs described herein are generally synthetic and/or recombinant. The constructs can be comprised wholly of naturally occurring nucleic acids, or in certain embodiments can contain one or more nucleic acid analogues or derivatives. The nucleic acid analogues can include backbone analogues and/or nucleic acid base analogues and/or utilize non-naturally occurring base pairs. Illustrative artificial nucleic acids that can be used in the present constructs include, without limitation, nucleic backbone analogs peptide nucleic acids (PNA), morpholino and locked nucleic acids (LNA), bridged nucleic acids (BNA), glycol nucleic acids (GNA) and threose nucleic acids (TNA). Nucleic acid base analogues that can be used in the present constructs include, without limitation, fluorescent analogs (e.g., 2-aminopurine (2-AP), 3-Methylindole (3-MI), 6-methyl isoxanthoptherin (6-MI), 6-MAP, pyrrolo-dC and derivatives thereof, furan-modified bases, 1,3-Diaza-2-oxophenothiazine (tC), 1,3-diaza-2-oxophenoxazine); non-canonical bases (e.g., inosine, thiouridine, pseudouridine, dihydrouridine, queuosine and wyosine), 2-aminoadenine, thymine analogue 2,4-difluorotoluene (F), adenine analogue 4-methylbenzimidazole (Z), isoguanine, isocytosine; diaminopyrimidine, xanthine, isoquinoline, pyrrolo[2,3-b]pyridine; 2-amino-6-(2-thienyl)purine, pyrrole-2-carbaldehyde, and universal bases (e.g., 2 deoxyinosine (hypoxanthine deoxynucleotide) derivatives, nitroazole analogues). Non-naturally occurring base pairs that can be used in the present constructs include, without limitation, isoguanine and isocytosine; diaminopyrimidine and xanthine; 2-aminoadenine and thymine; isoquinoline and pyrrolo[2,3-b]pyridine; 2-amino-6-(2-thienyl)purine and pyrrole-2-carbaldehyde; two 2,6-bis(ethylthiomethyl)pyridine (SPy) with a silver ion; pyridine-2,6-dicarboxamide (Dipam) and a mondentate pyridine (Py) with a copper ion.

[0079] Provided are constructs useful for the identification of RNA promoters, e.g., from sequences suspected of encoding a RNA promoter. The constructs can be DNA or RNA and generally comprise following operably linked polynucleotide elements in the 5 to 3 direction: [0080] i) a hammerhead ribozyme catalytic core; [0081] ii) a first hairpin ribozyme cleavage site in the antisense orientation; [0082] iii) a non-functional or stuffer polynucleotide; [0083] iv) a second hairpin ribozyme cleavage site in the antisense orientation; [0084] v) a hairpin ribozyme catalytic core in the antisense orientation; [0085] vi) reverse and forward primer annealing sites in the antisense orientation; and [0086] vii) an inserted polynucleotide suspected of comprising a RNA promoter. See, FIG. 4. In varying embodiments, the DNA and/or RNA constructs have a length of about 600 bp to about 1600 bp.

[0087] a. DNA Constructs

[0088] The DNA constructs generally comprise the following operably linked polynucleotide elements in the 5 to 3 direction: [0089] i) a promoter; [0090] ii) a hammerhead ribozyme cleavage site; [0091] iii) a hammerhead ribozyme catalytic core; [0092] iv) a first hairpin ribozyme cleavage site in the antisense orientation; [0093] v) a non-functional or stuffer polynucleotide; [0094] vi) a second hairpin ribozyme cleavage site in the antisense orientation; [0095] vii) a hairpin ribozyme catalytic core in the antisense orientation; [0096] viii) reverse and forward primer annealing sites in the antisense orientation; [0097] ix) an inserted polynucleotide suspected of comprising a RNA promoter; and [0098] x) a third ribozyme catalytic core, wherein the third ribozyme catalytic core is in the sense orientation, is not a hairpin ribozyme catalytic core and does not comprise a hairpin ribozyme cleavage site.

[0099] i. Promoter

[0100] The 5 or upstream promoter allows transcription of the entire or full length of the construct into RNA. The ribozyme cleavage sites within the first and third ribozyme catalytic core sequences can then be cleaved by the first and third ribozyme catalytic cores, respectively.

[0101] For in vivo transcription of the full length of construct, the selected promoter is active in a selected host cell. For example, if the DNA construct is introduced into a eukaryotic cell, the selected 5 or upstream promoter is biologically active in the eukaryotic cell. As appropriate, the 5 or upstream promoter can be a mammalian promoter that actively promotes transcription in a mammalian host cell. In some embodiments, the 5 or upstream promoter can be a plant promoter that actively promotes transcription in a plant host cell.

[0102] For in vitro transcription of the full length of construct, the 5 or upstream promoter is any RNA polymerase promoter suitable for in vitro transcription. In varying embodiments, the 5 or upstream promoter is a bacteriophage promoter, e.g., a T7, a T3 or SP6 bacteriophage promoter.

[0103] In vivo and in vitro transcription of the DNA construct produces a RNA construct as described herein. The RNA construct may or may not be cleaved at the ribozyme cleavage sites within the first and third ribozyme cleavage sites.

[0104] ii. 5 Hammerhead Ribozyme Catalytic Core

[0105] The first and 5-most ribozyme catalytic core is a hammerhead ribozyme catalytic core. This first and 5-most hammerhead ribozyme catalytic core is in the positive strand orientation and includes a hammerhead ribozyme cleavage site at or near its 5-end. The first and 5-most hammerhead ribozyme catalytic core is positioned or located 5 to the first hairpin ribozyme cleavage site, as depicted in FIG. 4.

[0106] The minimal hammerhead sequence required for the self-cleavage reaction includes approximately 13 conserved or invariant core nucleotides, most of which are not involved in forming canonical Watson-Crick base-pairs. The core region is flanked by Stems I, II and III, which are in general made of canonical Watson-Crick base-pairs but are otherwise not constrained with respect to sequence. Functionally, a hammerhead ribozyme performs a chemical reaction that results in the breakage of the substrate strand of RNA, specifically at C17, the cleavage-site nucleotide.

[0107] Structurally, the hammerhead ribozyme is composed of three base paired helices, separated by short linkers of conserved sequences. These helices are called I, II and III. Hammerhead ribozymes can be classified into three types based on which helix the 5 and 3 ends are found in. If the 5 and 3 ends of the sequence contribute to stem I then it is a type I hammerhead ribozyme, to stem II is a type II and to stem III then it is a type III hammerhead ribozyme. In varying embodiments, the first and 5-most hammerhead ribozyme catalytic core can be a Type I, Type II, Type III, HH9 and HH10 hammerhead ribozyme catalytic core.

[0108] The structure and function of hammerhead ribozymes is well-characterized in the art, and has been reviewed in, e.g., Scott, et al., Prog Mol Biol Transl Sci. (2013) 120:1-23; Lee, et al., Prog Mol Biol Transl Sci. (2013) 120:25-91; and Hammann, et al., RNA. (2012) 18(5):871-85.

[0109] iii. 5 Hammerhead Ribozyme Cleavage Site

[0110] A hammerhead ribozyme cleavage site is located or positioned within and near the 5-end of the first and 5-most hammerhead ribozyme catalytic core.

[0111] The hammerhead ribozyme becomes active to cleave at the hammerhead ribozyme cleavage site when the construct is RNA. As a result of cleavage at the hammerhead ribozyme cleavage site within the hammerhead ribozyme catalytic core, the 5-product possesses a 2,3-cyclic phosphate terminus, and the 3-product possesses a 5-OH terminus.

[0112] The hammerhead ribozyme is capable of cleaving immediately after a NHH sequence, where N is any nucleotide and H is an A, C or U nucleotide. There is also a structural requirement for the N and first H nucleotide to be base paired, reviewed in Kore, et al., Nucl. Acid Res., (1998), 26, 4116-20.

[0113] iv. Hairpin Ribozyme Cleavage Sites

[0114] The DNA and RNA constructs comprise first (upstream) and second (downstream) antisense hairpin ribozyme cleavage sites. The first or upstream antisense ribozyme cleavage site is located 3 to or downstream of the first or upstream hammerhead ribozyme catalytic core and 5 to or upstream of the non-functional stuffer polynucleotide. The second or downstream antisense ribozyme cleavage site is located 3 to or downstream of the non-functional stuffer polynucleotide and 5 to or upstream of the antisense hairpin ribozyme catalytic core. See, FIG. 4, which depicts the primary DNA construct and primary RNA transcript.

[0115] The hairpin ribozyme cleavage sites in the DNA and RNA constructs can be any polynucleotide sequence capable of being cleaved by a hairpin ribozyme. A generalized or consensus ribozyme is provided in SEQ ID NO:7. As depicted in FIG. 7, the sequence and structure of the ribozyme cleavage sites are guided by the polynucleotide sequence of the hairpin ribozyme catalytic core. Interactions between the ribozyme cleavage site (as generalized in SEQ ID NO:7) and the negative strand self-cleavage domain (as generalized in SEQ ID NO:8) are via hydrogen bonds forming two stems1 and 2 (as depicted in FIG. 7). [0116] Stem 1 is formed by hydrogen bonds between NS1 and NE1, NS2 and NE2, NS3 and NE3, NS4 and NE4 [0117] Stem 2 is formed by hydrogen bonds between NS5 and NE5, NS6 and NE6, NS7 and NE7, NS8 and NE8, NS9 and NE9 [0118] Interactions within the generalized negative strand self-cleavage and ligation domain form 2 stems3 and 4 [0119] Stem 3 is formed by hydrogen bonds between NE10 and NE10, NE11 and NE11, NE12 and NE12, NE13 and NE13, NE14 and NE14 [0120] Stem 4 is formed by hydrogen bonds between NE20 and NE20, NE21 and NE21, and NE22 and NE22 [0121] Stem 1 is essentially universally 4 base pairs long [0122] Stem 2 can be as short as 4 base pairs, but can be longer [0123] Stem 3 is essentially universally 5 base pairs long [0124] Stem 4 is from 2 to 4 base pairs long depending on the source [0125] Loop 1 can be as small as 4 nucleotides, if it is a special sequence called a tetra-loop, but can be longer, e.g., 100's of nucleotides up to 1000 nucleotides [0126] Loop 2 varies from 4 to 6 bases long in natural sequences

[0127] The polynucleotide sequences of an illustrative hairpin ribozyme cleavage site is provided herein as SEQ ID NO:6. In varying embodiments, the hairpin ribozyme cleavage site comprises a polynucleotide sequence having at least about 60% sequence identity, e.g., at least about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO:6.

[0128] Generally, the polynucleotide sequences of the first and second hairpin ribozyme cleavage sites are the same.

[0129] v. Hairpin Ribozyme Catalytic Core

[0130] The DNA and RNA constructs and DNA plasmids described herein can comprise the antisense of any functional hairpin ribozyme catalytic core known in the art. The antisense hairpin ribozyme catalytic core is positioned or located 3 to or downstream of the second antisense hairpin ribozyme cleavage site and 5 to or upstream of the forward and reverse primer annealing polynucleotides. This hairpin ribozyme catalytic core is in the negative strand orientation (e.g., antisense orientation to the hammerhead ribozyme catalytic core).

[0131] The hairpin ribozyme catalytic core polynucleotides of use, when in the sense orientation, are capable of self-cleaving itself and flanking sequences within ribozyme cleavage sites out of the context of a longer polynucleotide sequence and then ligating the excised polynucleotide into a circularized polynucleotide. The hairpin ribozyme catalytic core polynucleotides are in the inactive, antisense form in the primary RNA transcript. In varying embodiments, the hairpin ribozyme catalytic core can be derived from a naturally occurring source. For example, Rubino, et al, J Gen Virol (1990) 71:1897-1903 describes examples of naturally-derived and consensus sequences of hairpin ribozyme catalytic core polynucleotides. In varying embodiments, the hairpin ribozyme catalytic core is or is derived from the negative strand self-cleavage domain of a satellite RNA of a plant virus, e.g., the satellite RNA of tobacco ringspot virus (sTRSV), the satellite RNA of arabis mosaic virus (sArMV), and the satellite RNA of chicory yellow mottle virus (sCYMV). In varying embodiments, the hairpin ribozyme catalytic core is or is derived from the negative strand self-cleavage domain of a satellite RNA of the plant virus tobacco ringspot virus (sTRSV). In some embodiments, the hairpin ribozyme catalytic core polynucleotide is a synthetic sequence, e.g., based on naturally occurring or consensus hairpin ribozyme catalytic core sequences. The general structure for a hairpin ribozyme catalytic core is provided in FIG. 7. The structure of hairpin ribozyme catalytic cores are well known in the art, and described, e.g., in Mller, et al., IUBMB Life. (2012) 64(1):36-47; Fedor, J Mol Biol. (2000) 297(2):269-91; and Ferr-D'Amar, Biopolymers. (2004) 73(1):71-8.

[0132] In varying embodiments, the hairpin ribozyme catalytic core can be or can be derived from (e.g., can be a variant of) a circularizing ribozyme. Examples include the Neurospora Varkud Satellite ribozyme (VS ribozyme) and circularizing group I intron ribozyme (e.g., circularizing introns from Tetrahymena. The structure and sequence of the VS ribozyme is known in the art, and described, e.g., in Bonneau, et al., Biochemistry (2014) 53(39):6264-75; Bouchard, et al., RNA. (2014) 20(9):1451-64; and Desjardins, et al, Nucleic Acids Res. (2011) 39(10):4427-37. The structure and sequence of circularizing group I intron ribozymes, including circularizing introns from Tetrahymena are known in the art and described, e.g., in Puttaraju and Been, Nucl. Acid Res. (1992), 20:5357-64; Puttaraju and Been, J Biol Chem (1996), 271:26081-7, Ford and Ares, PNAS (1994), 91:3117-21. Ribozyme structures and mechanisms are also reviewed in Doherty, et al., Annu Rev Biochem. (2000) 69:597-615.

[0133] A generalized or consensus negative strand self-cleavage domain of a hairpin ribozyme catalytic core is provided in SEQ ID NO:8. The polynucleotide sequences of illustrative hairpin ribozyme catalytic core molecules are provided herein as SEQ ID NOs: 3, 4 and 5. In varying embodiments, the hairpin ribozyme catalytic core comprises a polynucleotide sequence having at least about 60% sequence identity, e.g., at least about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NOs:3, 4 or 5.

[0134] vi. Non-Functional or Stuffer Polynucleotide

[0135] The DNA and RNA constructs comprise a non-functional or stuffer polynucleotide. Generally, the non-functional or stuffer polynucleotide does not comprise any one of a functional RNA promoter, a primer annealing site, or a transcription modifying sequence. Accordingly, the non-functional or stuffer polynucleotide does not circularize and is not amplified. Generally, the non-functional or stuffer polynucleotide is located or positioned 3 to or downstream of the first hairpin ribozyme cleavage site and 5 to or upstream of the second ribozyme cleavage site. See, e.g., FIG. 4.

[0136] In varying embodiments, the non-functional or stuffer polynucleotide comprises from about 200 base pairs (bp) to 1000 base pairs. The non-functional or stuffer polynucleotide can be any size or length such that when it is cleaved out after rolling circle replication, it is of a distinguishable size (e.g., by electrophoresis) from the cleaved out polynucleotide comprising the hammerhead ribozyme catalytic core, insert containing a RNA promoter, primer annealing polynucleotides and hairpin ribozyme catalytic core. See, FIG. 6.

[0137] vii. Forward and Reverse RT-PCR Primer Annealing Polynucleotides

[0138] The DNA and RNA constructs comprise forward and reverse RT-PCR primer annealing polynucleotides. The forward and reverse RT-PCR primer annealing polynucleotides are each unique sequences in the constructs or DNA plasmids and generally abut each other or are located proximally to each other (e.g., within about 500, 400, 300, 200 or 100 nucleotides from one another) with the reverse RT-PCR primer annealing polynucleotide positioned 5 to the forward RT-PCR primer annealing polynucleotide. The forward and reverse RT-PCR primer annealing polynucleotides are positioned or located such that they are between the two ribozyme cleavage sites (e.g., the P-D regions) so they are excised as part of the mini-monomer cassette, and they face each other across the P-D region formed from the first and second P-D regions by ribozyme cleavage and ligation. The PCR product they make contains the insert region. In varying embodiments, the forward and reverse RT-PCR primer annealing polynucleotides are positioned or located such that they are 5 to or upstream of the insert suspected of containing a RNA promoter and 3 to or downstream of the hairpin ribozyme catalytic core. See, e.g., FIG. 4.

[0139] viii. Inserted Polynucleotide Suspected of Comprising a RNA Promoter

[0140] The DNA and RNA constructs comprise an inserted polynucleotide suspected of comprising a RNA promoter. The inserted polynucleotide suspected of comprising a RNA promoter is positioned or located 3 to or downstream of the forward and reverse primer annealing polynucleotides and 5 to or upstream of the third ribozyme catalytic core.

[0141] The inserted polynucleotide suspected of comprising a RNA promoter can be from any source, for example, a randomly generated library, a naturally occurring source (e.g., a genomic library), a chemically synthesized source, a mutated or mutagenized known RNA promoter, random polynucleotides, restriction fragments of eukaryotic DNA, or randomized PCR fragments of eukaryotic DNA. In varying embodiments, the inserted polynucleotide suspected of comprising a RNA promoter is variously fragmented genomic DNA from an organism, e.g., there may be RNA promoters present in genomic DNA. Generally, the polynucleotide suspected of comprising a promoter has from about 50 bp to about 200 bp. In varying embodiments, the polynucleotide suspected of comprising a promoter contains an entire promoter or a partial promoter. Within the inserted or captured polynucleotide suspected of comprising a promoter, the promoter may be centered or located more proximal to the 3 or 5 end. The methods of employing the DNA constructs described herein identify functional promoters, e.g., promoters capable of inducing, directing or promoting transcription, regardless of whether the entire promoter or a partial promoter is captured, or the location of the RNA promoter within the captured insert.

[0142] ix. Third Ribozyme Catalytic Core

[0143] The third ribozyme catalytic core is located or positioned 3 to or downstream of the inserted polynucleotide suspected of comprising a RNA promoter. The third or 3 ribozyme catalytic core is not a hairpin ribozyme catalytic core but can be in varying embodiments a hammerhead ribozyme catalytic core so long as the hammerhead ribozyme catalytic core does not comprise a hairpin cleavage site at its 3 end. Generally, the third ribozyme catalytic core is in the positive strand orientation (e.g., same or sense orientation to the hammerhead ribozyme catalytic core). In varying embodiments, the third ribozyme catalytic core comprises a positive or negative strand hepatitis delta virus (HDV) ribozyme catalytic core or a ribozyme catalytic core from a member of the HDV family. The structure of hepatitis delta virus (HDV) and HDV family members are known in the art. See, e.g., Riccitelli, et al., Prog Mol Biol Transl Sci. (2013) 120:123-71; Kapral, et al., Nucleic Acids Res. (2014) 42(20):12833-46.

[0144] Consensus sequences for the HDV negative strand (antigenomic) ribozyme has been examined by Nehdi and Perreault, Nucl. Acid Res. (2006) 34:584-92, and for the HDV positive strand (genomic) ribozyme has been examined by Chadalavada et al., RNA (2007) 13:2189-2201. General aspects of the HDV ribozyme structures and mechanisms of action are reviewed in Doherty and Doudna, Ann. Rev. Biochem. (2000) 69:597-615.

[0145] b. RNA Constructs

[0146] The DNA constructs generally comprise the following operably linked polynucleotide elements in the 5 to 3 direction: [0147] i) a hammerhead ribozyme catalytic core; [0148] ii) a first hairpin ribozyme cleavage site in the antisense orientation; [0149] iii) a non-functional or stuffer polynucleotide; [0150] iv) a second hairpin ribozyme cleavage site in the antisense orientation; [0151] v) a hairpin ribozyme catalytic core in the antisense orientation; [0152] vi) reverse and forward primer annealing sites in the antisense orientation; and [0153] vii) an inserted polynucleotide suspected of comprising a RNA promoter.
Embodiments of the hammerhead ribozyme catalytic core, the hairpin ribozyme cleavage sites, the non-functional or stuffer polynucleotide, the hairpin ribozyme catalytic core, the reverse and forward primer annealing sites and inserted polynucleotide suspected of comprising a RNA promoter are as described above for the DNA constructs. In addition, the RNA constructs comprise an hydroxyl group at the 5-end and a 2:3 cyclic phosphodiester at the 3-end in order to get cyclization of the RNA inside a host cell.

[0154] 3. Plasmids and Viral Replicating Vectors

[0155] Further provided are DNA plasmids and viral replicating vectors comprising the DNA constructs described above and herein. In varying embodiments, the entire size of the DNA plasmids that are designed for screening and identifying functional RNA promoter sequences is from about 3000 bp to about 15,000 bp. Generally, the plasmid backbone comprises an origin of replication and an expression cassette for expressing a selection gene. In varying embodiments, the expression cassette for expressing a selection gene is in the antisense orientation from the 5 hammerhead ribozyme catalytic core. The selection gene can be any marker known in the art for selection of a host cell that has been transformed with a desired plasmid. In varying embodiments, the selection marker comprises a polynucleotide encoding a gene or protein conferring antibiotic resistance, heat tolerance, fluorescence, or luminescence.

[0156] Viral replicating vectors can be used to express the DNA or RNA constructs as described. Due to the presence of ribozymes in both strands of the RNA constructs, RNA virus vectors can be used by implementing adjustments to the RNA constructs. In planta, geminiviruses are a representative DNA virus that can be used as an expression system. Reviewed in, e.g., Hefferon, Vaccines (2014) 2:642-53. In animal cells, there are more choices. Plasmid expression constructs containing viral origins of replication, while not truly viral replicating systems, are stably maintained in cells. Truly replicating viral systems of use include without limitation, e.g., adenovirus, adeno-associated virus, baculovirus, and Vaccinia virus vectors, which are known in the art.

[0157] 4. Rost Cells

[0158] Further provided are host cells comprising the DNA or RNA constructs as described above and herein.

[0159] In varying embodiments, the host cell expresses a RNA dependent RNA polymerase. For example, in some embodiments, the host cell is transfected with a polynucleotide that encodes an exogenous RNA-dependent RNA polymerase. In some embodiments, the host cell is infected with a RNA virus. Illustrative RNA viruses include a virus of the taxonomic Orders Mononegavirales, Nidovirales, Picornavirales, and Tymovirales. Further illustrative RNA viruses include a virus of the taxonomic Groups arenaviridae, astroviridae, barnaviridae, benyviridae, bromoviridae, bunyaviridae, carmotetraviridae, closteroviridae, flaviviridae, hepeviridae, leviviridae, luteoviridae, narnaviridae, nodaviridae, ophioviridae, orthomyxoviridae, permutotetraviridae, potyviridae, togaviridae, tombusviridae, and virgaviridae. Further illustrative RNA viruses include a virus of the taxonomic Family celivirus, deltavirus, emaravirus, higrevirus, idaeovirus, ourmiavirus, polemovirus, sobemovirus, tenuivirus, umbravirus, or varicosavirus.

[0160] In varying embodiments, the host cell is a prokaryotic cell, e.g., a bacterial cell, an archaeal cell, or an archaebacterial cell. In varying embodiments, the host cell is a eukaryotic cell, e.g., an animal cell (e.g., a mammalian cell or an insect cell), a plant cell or a fungal cell.

[0161] Illustrative plant cells include without limitation, e.g., Brassicaceae, Solanaceae, Phaseoleae, Zea and Oryzeae.

[0162] 5. Methods of Identifying RNA Promoters

[0163] Further provided are methods of identifying RNA Promoters. In the first instance, the methods employ one or more of the DNA or RNA constructs and one or more host cells, the embodiments of which are described above and herein.

[0164] In varying embodiments, the methods entail the following steps: [0165] a) transfecting a host cell with the DNA or RNA construct as described above and herein, wherein the 5 promoter is capable of promoting transcription in the host cell; wherein the host cell expresses a RNA-dependent RNA polymerase and rolling circle transcription of the RNA construct or RNA transcribed from the DNA construct within the host cell when the inserted polynucleotide comprises a functional RNA promoter yields a circularized RNA comprising: [0166] i) a hammerhead ribozyme catalytic core in the antisense orientation; [0167] ii) a hairpin ribozyme cleavage site; [0168] iii) a hairpin ribozyme catalytic core; [0169] iv) reverse and forward primer annealing sites; and [0170] v) the inserted polynucleotide comprising a functional RNA promoter; [0171] b) isolating the circularized RNA; [0172] c) amplifying the inserted polynucleotide comprising a functional RNA promoter; and [0173] d) sequencing the inserted polynucleotide comprising a functional RNA promoter, thereby identifying the RNA promoter.

[0174] In varying embodiments, the methods entail the following steps: [0175] a) transcribing in vitro into RNA the DNA construct as described above and herein, thereby producing a RNA transcript of the DNA construct; [0176] b) transfecting a host cell with the RNA transcript, wherein the host cell expresses a RNA-dependent RNA polymerase and rolling circle transcription of the RNA construct within the host cell when the inserted polynucleotide comprises a functional RNA promoter yields a circularized RNA comprising: [0177] i) a hammerhead ribozyme catalytic core in the antisense orientation; [0178] ii) a ribozyme cleavage site; [0179] iii) a hairpin ribozyme catalytic core; [0180] iv) reverse and forward primer annealing sites; and [0181] v) the inserted polynucleotide comprising a functional RNA promoter; [0182] c) isolating the circularized RNA; [0183] d) amplifying the inserted polynucleotide comprising a functional RNA promoter; and [0184] e) sequencing the inserted polynucleotide comprising a functional RNA promoter, thereby identifying the RNA promoter.

[0185] a. Transcribing In Vitro into RNA the DNA Construct

[0186] In varying embodiments, the one or more DNA constructs, as described above and herein, are first transcribed in vitro into RNA and then the RNA transcript is transfected into a host cell. The step of transcribing the one or more DNA constructs into RNA in vitro can be performed using any methodologies known in the art. In vitro transcription of one or more (e.g., a population of) DNA constructs comprising a library of inserts suspected of comprising a functional RNA promoter sequence can be achieved using purified RNA polymerases, e.g. T7 RNA polymerase. Such methodologies are described, e.g., in Green and Sambrook, Molecular Cloning, A Laboratory Manual, 4th Ed., Cold Spring Harbor Press, (2012). A schematic of the starting material DNA construct is depicted in FIG. 4A. The transcribed RNA construct is depicted in FIG. 4B. Cleavage will take place producing the RNA depicted in FIG. 4C. The in vitro transcribed and cleaved RNA construct remains linear.

[0187] b. Transfecting a Host Cell with the DNA or RNA Construct

[0188] In varying embodiments, the DNA construct or in vitro transcribed RNA construct is transfected into a suitable host cell of closed circular DNA plasmid using any method known in the art, e.g., by electroporation of protoplasts, fusion of liposomes to cell membranes, cell transfection methods using calcium ions or PEG, use of gold or tungsten microparticles coated with plasmid with the gene gun. Such methodologies are described, e.g., in Green and Sambrook, Molecular Cloning, A Laboratory Manual, 4th Ed., Cold Spring Harbor Press, (2012). As discussed above, the cells of all eukaryotic organisms (plants, animals, fungi, etc.) can be used. In varying embodiments, the host cell is a prokaryotic cell, e.g., a bacterial cell, an archaeal cell, or an archaebacterial cell.

[0189] In vitro produced linear molecules are circularized by introduction into cells. Production of the circular RNA or introduction of the linear RNA followed by circularization occurs in a host cell that expresses a RNA dependent RNA promoter. In varying embodiments, the host cell is infected with a RNA virus, as described above. In this way, viral replication machinery is already present within the transfected host cells. In most cases, the insert sequences suspected of comprising a RNA promoter (e.g., within the left terminal loop) do not contain a sequence that can interact with the viral replication machinery so no complementary RNA is generated. In some cases, the viral replication machinery will interact with the insert sequence suspected of comprising a RNA promoter and complementary sequences will be generated as shown in FIG. 5. Constructs having inserts that actually contain a RNA promoter construct undergo rolling circle replication. The mini-monomer cassette polynucleotide subsequences containing the hairpin ribozyme catalytic core, the insert containing a RNA promoter and the RT-PCR primer annealing sites are cleaved by the hairpin ribozyme catalytic core and circularize. Processing of this newly synthesized primary transcript is shown in FIG. 6. In contrast, the newly synthesized stuffier-containing fragments are not circularized because they do not contain a hairpin ribozyme catalytic core. Further the stuffer-containing fragments do not contain the primer binding sites and so are not recovered after RT-PCR.

[0190] c. Isolating the Circularized RNA

[0191] The step of isolating the circularized RNA molecules can be performed using any methodologies known in the art. Such methodologies are described, e.g., in Green and Sambrook, Molecular Cloning, A Laboratory Manual, 4th Ed., Cold Spring Harbor Press, (2012).

[0192] d. Amplifying the Inserted Polynucleotide Comprising a Functional RNA Promoter

[0193] The inserts containing a RNA promoter sequence in the circularized RNA molecules are amplified by RT-PCR, usually from the forward and reverse RT-PCR primer annealing polynucleotides. The step of reverse-transcribing the inserts containing a RNA promoter sequence in the circularized RNA molecules into cDNA can be performed using any methodologies known in the art. Such methodologies are described, e.g., in Green and Sambrook, Molecular Cloning, A Laboratory Manual, 4th Ed., Cold Spring Harbor Press, (2012).

[0194] cDNA can be synthesized from reverse transcription of the RNA of circularized and self-cleaved mini-monomer carrying a functional promoter (e.g., eukaryotic or prokaryotic) using a primer that binds at the reverse RT-PCR primer annealing sequence. Reverse transcription can be followed by PCR with the forward and reverse primers, thereby yielding a PCR product containing the mini-monomer sequence with the RNA promoter-containing insert if the RNA template for reverse transcription is circular. Because production and processing of the circularized RNA molecules requires initiation of transcription from a RNA promoter in the original linear construct, RT-PCR-derived cDNAs can only be produced if a cloned DNA insert contains a functional RNA promoter.

[0195] e. Sequencing the Inserted Polynucleotide Comprising a Functional RNA Promoter

[0196] The step of sequencing the inserted polynucleotides comprising a functional RNA promoter in the DNA polynucleotides amplified from the isolated circularized RNA can be performed using any methodologies known in the art. Such methodologies are described, e.g., in Green and Sambrook, Molecular Cloning, A Laboratory Manual, 4th Ed., Cold Spring Harbor Press, (2012). In varying embodiments, next generation sequencing, deep sequencing or ultra deep sequencing methodologies are applied. Deep sequencing data analysis is described, e.g., in Deep Sequencing Data Analysis (Methods in Molecular Biology), Noam Shomron (Editor), Humana Press; 2013 edition. Next generation sequencing is described, e.g., in Next-Generation DNA Sequencing Informatics, Stuart M. Brown (Editor), Cold Spring Harbor Laboratory Press; 1st edition (2013); and Next-generation Sequencing: Current Technologies and Applications, Jianping Xu (Editor), Caister Academic Press (2014); Wilhelm, et al., Nature. (2008) 453:1239-1243; Nagalakshmi, et al., Science. (2008) 320:1344-1349; and Mortazavi, et al., Nat. Methods. (2008) 5:621-628.

[0197] f. Exposure to External Influences

[0198] In varying embodiments, de novo selection and subsequent evolution of externally influenced RNA promoter sequences is performed. Using a library containing inserted polynucleotides suspected of comprising a RNA promoter sequence, as described above, insertion of this library into cells with or without some external factor Ca.sup.++ ions, salt, temperature stress, hormones, etc.), followed by analysis as described previously will allow detection of sequences that are increased preferentially in the presence of the external factor. Analysis of these sequences allows determination of common features that can make the significant structural features more obvious. Reconstruction of a library of mutagenized sequences related to these initial sequences followed by reanalysis, again in the presence or absence of the external factor, will allow an evolutionary optimization of said RNA promoter sequences, ultimately leading to the selection of a de novo optimized RNA promoter sequence that can be used in the construction of novel promoters or modified genes that are responsive to the external factor in question.

[0199] g. Methods of Identifying Modifying RNA Promoter Sequences

[0200] The methods described herein can be used to identify functional RNA promoter sequences derived from known RNA promoter sequences, but having increased or decreased RNA transcriptional efficiencies or strengths. In varying embodiments, the insert suspected of comprising a RNA promoter sequence comprises a known RNA promoter sequence that has been mutated or mutagenized. The methods of RNA promoter sequence identification described above and herein allow one to take a known RNA promoter sequence, mutagenize it, then run the mutagenized sequences through the RNA promoter sequences selection procedure, thereby generating a quasispecies of new RNA promoter sequences with a range of RNA promoter sequences strengths (ability to increase or decrease RNA transcriptional efficiencies or strengths). This procedure can be done iteratively or generationally (e.g., providing a population of polynucleotides comprising mutagenized promoters, selecting for RNA promoter sequences having increased or decreased transcription efficiency (as desired), recovering RT-PCR products, performing one or more further rounds of mutagenesis and then performing the steps of the methods again, as many iterations as necessary or desired).

[0201] 6. Kits

[0202] Further provided are kits containing one or more of the DNA and/or RNA constructs described herein. In varying embodiments, the kits can further comprise in one or more containers or vessels buffers, reagents, nucleotides, enzymes, control polynucleotides, host cells as described herein, and instructions for use. In varying embodiments, the kits comprise a library of DNA and/or RNA constructs for use in screening for RNA promoters, wherein each member of the library is pre-loaded with an inserted polynucleotide suspected of comprising a RNA promoter.

EXAMPLES

[0203] The following examples are offered to illustrate, but not to limit the claimed invention.

Example 1

Selection of an RNA Promoter from a Randomized DNA Library

[0204] This example illustrates the selection of a RNA promoter from a library of randomized DNA.

[0205] Two oligonucleotides are synthesizedone oligonucleotide containing a restriction endonuclease cleavage site, 50 N residues, where N can be any nucleotide, a specific sequence 3 to the 50 N residues and a second restriction endonuclease cleavage sites and a second oligonucleotide containing the complement of the specific sequence and second restriction endonuclease cleavage site. The two oligonucleotides are hybridized, made double stranded and cloned into a plasmid forming a construct of as shown in FIG. 4A using methods known to someone skilled in the art. If in vitro production of the RNA is to be performed, the plasmid may contain a T7 or other bacteriophage RNA polymerase promoter. If in vivo production of the RNA is to be performed, the plasmid can contain an appropriate promoter as well as any other necessary sequences appropriate for the in vivo environment being used, e.g. Left and Right T-DNA borders for Agrobacterium-mediated transient expression in plant cells.

[0206] In vitro produced RNA is purified, e.g., using phenol/chloroform/iso-amyl alcohol extraction and ethanol precipitation. The in vitro produced RNA may be introduced into cells already infected with the RNA virus for which the RNA promoter is being sought. If in vivo production is done, a construct using a eukaryotic promoter appropriate for a particular cell or organism type may be used. Alternatively, intracellular production of the viral RNA dependent RNA polymerase in the cells may be done. At various times after introduction, e.g. at 12 hours, 24 hours, 48 hours and 72 hours, total RNA are extracted from the cells into which the in vitro produced RNAs were introduced, e.g., using such methods as a Trizol reagent protocol or a commercial RNA extraction kit. This RNA is used directly for further steps. Alternatively, any circular RNAs is purified, e.g., using 2-D polyacrylamide gel electrophoresis. Complementary DNA (cDNA) is synthesized, e.g., by hybridizing an oligonucleotide to the RNA followed by reverse transcription, e.g., using an enzyme such as SuperScript II or Superscript III. PCR is performed to amplify any synthesized cDNA using a set of oligonucleotide primers that only amplifies the complementary RNA that was circularized by hairpin ribozyme ligation. To ensure that any newly synthesized complementary RNA is generated by the virus replication machinery, a control experiment can be performed in uninfected cells. Sequencing of the amplified cDNA sequences from both virus-infected and uninfected cells followed by a comparison of any sequences recovered from said cells identifies those sequences that are uniquely present in the virus-infect cells. These unique sequences can be recognized by the viral RNA dependent RNA polymerase.

[0207] It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes.

TABLE-US-00001 INFORMALSEQUENCELISTING SequenceIDNo:1-mini-monomercassettesequenceforRNA promoterselection Annotation: Hammerheadribozymeregion 8-55 D8complement 51-58 P5complement 59-63 Stufferinsertionsite 93-98 2ndD8complement 99-106 2ndP5complement 107-111 Hairpincatalyticcorecomplement 126-172 Multiplecloningsite 221-315 RTprimer1complement 281-301 Primer2complement 255-280 HDVnegativestrandribozyme 326-413 ATACCCTGTCACCGGATGTGCTTTCCGGTCTGATGAGTCCGTGAGGACGAAACAGGACTGT CAGGTGGCCGAAAGCCACCACGTAAACTAGTGGATCCAACAGGACTGTCAGCTAGTCAAGG CGTACCAGGTAATATACCACAACGTGTGTTTCTCTGGTTGACTTCTCTGTTTGTTGTGTCA TTGGTTCCCGGATCTCGCATTAGCGGCGACGGGGTATCCTGCAGGAAGCTTGGATCCGTCG ACGCGGCCGCGATCGTCGGACTGTAGAACTCTGAACCCTTGGCACCCGAGAATTCCAGAAT TCGGCGCGCCATACCCTGTCGGGTCGGCATGGCATCTCCACCTCCTCGCGGTCCGACCTGG GCATCCGAAGGAGGACAGACGTCCACTCGGATGGCTAAGGGAGAGCC SequenceIDNo:2-intentionallyleftblank SequenceIDNo:3-negativestrandself-cleavagedomainof thesatelliteRNAoftobaccoringspotvirus(sTRSV) GACAGAGAAGTCAACCAGAGAAACACACGTTGTGGTATATTACCTGGT SequenceIDNo:4-negativestrandself-cleavagedomainof thesatelliteRNAofarabismosaicvirus(sArMV) GACAGCGAAGTCAAACGGCGAAACACACCTTGTGTGGTATATTACCCGTT SequenceIDNo:5-negativestrandself-cleavagedomainof thesatelliteRNAofthesatelliteRNAofchicoryyellow mottlevirus(sCYMV) GACAGCGAAGTCAGCCAGGGAAACACACCATGTGTGGTATATTATCTGGC SequenceIDNo:6-ribozymecleavagesite TGACCGTCCTGTC SequenceIDNo:7-Generalizedribozymecleavagesite N.sub.S1N.sub.S2N.sub.S3N.sub.S4NGUCN.sub.S5N.sub.S6N.sub.S7N.sub.S8N.sub.S9 WhereinN= Anynucleotide(ForRNA,A,C,GorU) SequenceIDNo:8-Generalizednegativestrandself-cleavage domain N.sub.E9N.sub.E8N.sub.E7N.sub.E6N.sub.E5(A/C)GAAN.sub.E4N.sub.E3N.sub.E2N.sub.E1N.sub.E10N.sub.E11N.sub.E12N.sub.E13N.sub.E14AGAAACAN.sub.E20N.sub.E21N.sub.E22 N.sub.L6N.sub.L7N.sub.L8N.sub.L9N.sub.L10N.sub.E22N.sub.E21N.sub.E20GUAUAUUACN.sub.E14N.sub.E13N.sub.E12N.sub.E11N.sub.E10 WhereinN= Anynucleotide(ForRNA,A,C,GorU) Interactionsbetweenthegeneralizedribozymecleavage site(SEQIDNO:7)andthegeneralizednegativestrand self-cleavagedomain(SEQIDNO:8)areviahydrogen bondsformingtwostems-1and2 Stem1isformedbyhydrogenbondsbetweenN.sub.S1andN.sub.E1, N.sub.S2andN.sub.E2,N.sub.S3andN.sub.E3,N.sub.S4andN.sub.E4. Stem2isformedbyhydrogenbondsbetweenN.sub.S5andN.sub.E5, N.sub.S6andN.sub.E6,N.sub.S7andN.sub.E7,N.sub.S8andN.sub.E8,N.sub.S9andN.sub.E9. Interactionswithinthegeneralizednegativestrand self-cleavagedomainform2stems-3and4. Stem3isformedbyhydrogenbondsbetweenN.sub.E10andN.sub.E10, N.sub.E11andN.sub.E11,N.sub.E12andN.sub.E12,N.sub.E13andN.sub.E13,N.sub.E14andN.sub.E14. Stem4isformedbyhydrogenbondsbetweenN.sub.E20andN.sub.E20, N.sub.E21andN.sub.E21,andN.sub.E22andN.sub.E22 Stem1isessentiallyuniversally4basepairslong Stem2canbeasshortas4basepairs,butcanbelonger Stem3isessentiallyuniversally5basepairslong Stem4isfrom2to4basepairslongdependingonthesource Loop1canbeassmallas4nucleotides,ifitisa specialsequencecalledatetra-loop,butcanbelonger, e.g.,100'sofnucleotidesupto1000nucleotides Loop2variesfrom4to6baseslonginnatural sequences SEQIDNO:9-InvitroproductionconstructforMiniM cassetteproductionforRNApromoterselection FeaturesList Name location T7RNApromoter 6..23 Hammerheadribozymeregion 38..85 D8complement 81..88 P5complement 89..93 Stufferinsertionsite 123..128 2ndD8complement 129..136 2ndP5complement 137..141 Hairpincatalyticcorecomplement 156..202 Multiplecloningsite 252..345 Primer2complement 285..310 RTprimer1complement 311..330 HDVnegativestrandribozyme 357..442 seq1 2092..2121 seq2 rev:502..525 rep(pMB1) rev:451..1065 ampR rev:1225..2085 amprpromoter rev:2086..2190 AGATCTAATAGCACTCACTATAGGGGATCTATACCCTGTCACCGGATGTGCTTTCCGGTCT GATGAGTCCGTGAGGACGAAACAGGACTGTCAGGTGGCCGAAAGCCACCACGTAAACTAGT GGATCCAACAGGACTGTCAGCTAGTCAAGGCGTACCAGGTAATATACCACAACGTGTGTTT CTCTGGTTGACTTCTCTGTTTGTTGTGTCATTGGTTCCCGGATCTCGCATTAGCGGCGACG GGGTATCCTGCAGGAAGCTTGGATCCGTCGACGCGGCCGCGATCGTCGGACTGTAGAACTC TGAACCCTTGGCACCCGAGAATTCCAGAATTCGGCGCGCCATACCCTGTCGGGTCGGCATG GCATCTCCACCTCCTCGCGGTCCGACCTGGGCATCCGAAGGAGGACAGACGTCCACTCGGA TGGCTAAGGGAGAGCCATCTAGACGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTG ACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAG ATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTT ACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCT GTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCC CGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGA CACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAG GCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATT TGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCC GGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCA GAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAA CGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATC CTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTG ACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATC CATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGC CCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAA ACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCA GTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAAC GTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCA GCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGT TAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATG GTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGA CTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTG CCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATT GGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGA TGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGG GTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGT TGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCA TGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCG SEQIDNO:10-InplantaproductionconstructforMiniMcassette productionforRNApromoterselection FeaturesList Name location Rightborder 1..161 CaMV35Spromoter 470..782 Hammerheadribozymeregion 793..840 D8complement 836..843 P5complement 844..848 Stufferinsertionsite 878..883 2ndD8complement 884..891 2ndP5complement 892..896 Hairpincatalyticcorecomplement 911..957 Multiplecloningsite 1007..1100 Primer2complement 1040..1065 RTprimer1complement 1066..1085 HDVnegativestrandribozyme 1112..1197 CaMV35Sterminator 1200..1897 neomycinphosphotransferaseII 2235..3029 ColE1onfrompBR322 7644..8231 Leftborder rev:3711..3857 OriVfrompRK2 rev:4164..4779 trfA rev:4878..6026 neomycinphosphotransferaseIII rev:6325..7119 CCTGTGGTTGGCATGCACATACAAATGGACGAACGGATAAACCTTTTCACGCCCTTTTAAATATCCG ATTATTCTAATAAACGCTCTTTTCTCTTAGGTTTACCCGCCAATATATCCTGTCAAACACTGATAGT TTGTGAACCATCACCCAAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCT AAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGGAAGA AAGCGAAAGGAGCGGGCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTT CGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTT TTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTGTTAATTAAGAATTCGAGCTCCACCGCG GAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTTATTGAGAAGATAGTGGAAAAGGAAGG TGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTCTGCCGACAGT GGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTT CAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTC GCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGGTATACCCTGTCACCGGATGT GCTTTCCGGTCTGATGAGTCCGTGAGGACGAAACAGGACTGTCAGGTGGCCGAAAGCCACCACGTAA ACTAGTGGATCCAACAGGACTGTCAGCTAGTCAAGGCGTACCAGGTAATATACCACAACGTGTGTTT CTCTGGTTGACTTCTCTGTTTGTTGTGTCATTGGTTCCCGGATCTCGCATTAGCGGCGACGGGGTAT CCTGCAGGAAGCTTGGATCCGTCGACGCGGCCGCGATCGTCGGACTGTAGAACTCTGAACCCTTGGC ACCCGAGAATTCCAGAATTCGGCGCGCCATACCCTGTCGGGTCGGCATGGCATCTCCACCTCCTCGC GGTCCGACCTGGGCATCCGAAGGAGGACAGACGTCCACTCGGATGGCTAAGGGAGAGCCATCGAATT CGCTGAAATCACCAGTCTCTCTCTACAAATCTATCTCTCTCTATTTTCTCCATAAATAATGTGTGAG TAGTTTCCCGATAAGGGAAATTAGGGTTCTTATAGGGTTTCGCTCATGTGTTGAGCATATAAGAAAC CCTTAGTATGTATTTGTATTTGTAAAATACTTCTATCAATAAAATTTCTAATTCCTAAAACCAAAAT CCAGTACTAAAATCCAGATCTCCTAAAGTCCCTATAGATCTTTGTCGTGAATATAAACCAGACACGA GACGACTAAACCTGGAGCCCAGACGCCGTTCGAAGCTAGAAGTACCGCTTAGGCAGGAGGCCGTTAG GGAAAAGATGCTAAGGCAGGGTTGGTTACGTTGACTCCCCCGTAGGTTTGGTTTAAATATGATGAAG TGGACGGAAGGAAGGAGGAAGACAAGGAAGGATAAGGTTGCAGGCCCTGTGCAAGGTAAGAAGATGG AAATTTGATAGAGGTACGCTACTATACTTATACTATACGCTAAGGGAATGCTTGTATTTATACCCTA TACCCCCTAATAACCCCTTATCAATTTAAGAAATAATCCGCATAAGCCCCCGCTTAAAAATTGGTAT CAGAGCCATGAATAGGTCTATGACCAAAACTCAAGAGGATAAAACCTCACCAAAATACGAAAGAGTT CTTAACTCTAAAGATAAAAGATGGCGCGTGGCCGGCCTACAGTATGAGCGGAGAATTAAGGGAGTCA CGTTATGACCCCCGCCGATGACGCGGGACAAGCCGTTTTACGTTTGGAACTGACAGAACCGCAACGT TGAAGGAGCCACTCAGCCGCGGGTTTCTGGAGTTTAATGAGCTAAGCACATACGTCAGAAACCATTA TTGCGCGTTCAAAAGTCGCCTAAGGTCACTATCAGCTAGCAAATATTTCTTGTCAAAAATGCTCCAC TGACGTTCCATAAATTCCCCTCGGTATCCAATTAGAGTCTCATATTCACTCTCAATCCAAATAATCT GCACCGGATCTGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTG GGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTC CGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAAC TGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGA CGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCA TCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTG ATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGA AGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTC GCCAGGCTCAAGGCGCGCATGCCCGACGGCGATGATCTCGTCGTGACCCATGGCGATGCCTGCTTGC CGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGA CCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGAC CGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTG ACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGACCGACCAAGCGACGCCCAACCTGCCATCA CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGGTTGGGCTTCGGAATCGTTTTCCGGGACGCCG GCTGGATGATCCTCCAGCGCGGGGATCTCATGCTGGAGTTCTTCGCCCACGGGATCTCTGCGGAACA GGCGGTCGAAGGTGCCGATATCATTACGACAGCAACGGCCGACAAGCACAACGCCACGATCCTGAGC GACAATATGATCGCGGCGTCCACATCAACGGCGTCGGCGGCGACTGCCCAGGCAAGACCGAGATGCA CCGCGATATCTTGCTGCGTTCGGATATTTTCGTGGAGTTCCCGCCACAGACCCGGATGATCCCCGAT CGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCCGGTCTTGCGATGATTATCA TATAATTTCTGTTGAATTACGTTAAGCATGTAATAATTAACATGTAATGCATGACGTTATTTATGAG ATGGGTTTTTATGATTAGAGTCCCGCAATTATACATTTAATACGCGATAGAAAACAAAATATAGCGC GCAAACTAGGATAAATTATCGCGCGCGGTGTCATCTATGTTACTAGATCGGGACTGTAGGCCGGCCC TCACTGGTGAAAAGAAAAACCACCCCAGTACATTAAAAACGTCCGCAATGTGTTATTAAGTTGTCTA AGCGTCAATTTGTTTACACCACAATATATCCTGCCACCAGCCAGCCAACAGCTCCCCGACCGGCAGC TCGGCACAAAATCACCACTCGATACAGGCAGCCCATCAGTCCGGGACGGCGTCAGCGGGAGAGCCGT TGTAAGGCGGCAGACTTTGCTCATGTTACCGATGCTATTCGGAAGAACGGCAACTAAGCTGCCGGGT TTGAAACACGGATGATCTCGCGGAGGGTAGCATGTTGATTGTAACGATGACAGAGCGTTGCTGCCTG TGATCAAATATCATCTCCCTCGCACAGATCCGAATTATCAGCCTTCTTATTCATTTCTCGCTTAACC GTGACAGAGTAGACAGGCTGTCTCGCGGCCGAGGGGCGCAGCCCCTGGGGGGGATGGGAGGCCCGCG TTAGCGGGCCGGGAGGGTTCGAGAAGGGGGGGCACCCCCCTTCGGCGTGCGCGGTCACGCGCACAGG GCGCAGCCCTGGTTAAAAACAAGGTTTATAAATATTGGTTTAAAAGCAGGTTAAAAGACAGGTTAGC GGTGGCCGAAAAACGGGCGGAAACCCTTGCAAATGCTGGATTTTCTGCCTGTGGACAGCCCCTCAAA TGTCAATAGGTGCGCCCCTCATCTGTCAGCACTCTGCCCCTCAAGTGTCAAGGATCGCGCCCCTCAT CTGTCAGTAGTCGCGCCCCTCAAGTGTCAATACCGCAGGGCACTTATCCCCAGGCTTGTCCACATCA TCTGTGGGAAACTCGCGTAAAATCAGGCGTTTTCGCCGATTTGCGAGGCTGGCCAGCTCCACGTCGC CGGCCGAAATCGAGCCTGCCCCTCATCTGTCAACGCCGCGCCGGGTGAGTCGGCCCCTCAAGTGTCA ACGTCCGCCCCTCATCTGTCAGTGAGGGCCAAGTTTTCCGCGAGGTATCCACAACGCCGGCGGCCGC GGTGTCTCGCACACGGCTTCGACGGCGTTTCTGGCGCGTTTGCAGGGCCATAGACGGCCGCCAGCCC AGCGGCGAGGGCAACCAGCCCGGTGAGCGTCGGAAAGGCGCTCGGTCTTGCCTTGCTCGTCGGTGAT GTACACTAGTCGCTGGCTGCTGAACCCCCAGCCGGAACTGACCCCACAAGGCCCTAGCGTTTGCAAT GCACCAGGTCATCATTGACCCAGGCGTGTTCCACCAGGCCGCTGCCTCGCAACTCTTCGCAGGCTTC GCCGACCTGCTCGCGCCACTTCTTCACGCGGGTGGAATCCGATCCGCACATGAGGCGGAAGGTTTCC AGCTTGAGCGGGTACGGCTCCCGGTGCGAGCTGAAATAGTCGAACATCCGTCGGGCCGTCGGCGACA GCTTGCGGTACTTCTCCCATATGAATTTCGTGTAGTGGTCGCCAGCAAACAGCACGACGATTTCCTC GTCGATCAGGACCTGGCAACGGGACGTTTTCTTGCCACGGTCCAGGACGCGGAAGCGGTGCAGCAGC GACACCGATTCCAGGTGCCCAACGCGGTCGGACGTGAAGCCCATCGCCGTCGCCTGTAGGCGCGACA GGCATTCCTCGGCCTTCGTGTAATACCGGCCATTGATCGACCAGCCCAGGTCCTGGCAAAGCTCGTA GAACGTGAAGGTGATCGGCTCGCCGATAGGGGTGCGCTTCGCGTACTCCAACACCTGCTGCCACACC AGTTCGTCATCGTCGGCCCGCAGCTCGACGCCGGTGTAGGTGATCTTCACGTCCTTGTTGACGTGGA AAATGACCTTGTTTTGCAGCGCCTCGCGCGGGATTTTCTTGTTGCGCGTGGTGAACAGGGCAGAGCG GGCCGTGTCGTTTGGCATCGCTCGCATCGTGTCCGGCCACGGCGCAATATCGAACAAGGAAAGCTGC ATTTCCTTGATCTGCTGCTTCGTGTGTTTCAGCAACGCGGCCTGCTTGGCCTCGCTGACCTGTTTTG CCAGGTCCTCGCCGGCGGTTTTTCGCTTCTTGGTCGTCATAGTTCCTCGCGTGTCGATGGTCATCGA CTTCGCCAAACCTGCCGCCTCCTGTTCGAGACGACGCGAACGCTCCACGGCGGCCGATGGCGCGGGC AGGGCAGGGGGAGCCAGTTGCACGCTGTCGCGCTCGATCTTGGCCGTAGCTTGCTGGACCATCGAGC CGACGGACTGGAAGGTTTCGCGGGGCGCACGCATGACGGTGCGGCTTGCGATGGTTTCGGCATCCTC GGCGGAAAACCCCGCGTCGATCAGTTCTTGCCTGTATGCCTTCCGGTCAAACGTCCGATTCATTCAC CCTCCTTGCGGGATTGCCCCGACTCACGCCGGGGCAATGTGCCCTTATTCCTGATTTGACCCGCCTG GTGCCTTGGTGTCCAGATAATCCACCTTATCGGCAATGAAGTCGGTCCCGTAGACCGTCTGGCCGTC CTTCTCGTACTTGGTATTCCGAATCTTGCCCTGCACGAATACCAGCGACCCCTTGCCCAAATACTTG CCGTGGGCCTCGGCCTGAGAGCCAAAACACTTGATGCGGAAGAAGTCGGTGCGCTCCTGCTTGTCGC CGGCATCGTTGCGCCACATCTAGGTACTAAAACAATTCATCCAGTAAAATATAATATTTTATTTTCT CCCAATCAGGCTTGATCCCCAGTAAGTCAAAAAATAGCTCGACATACTGTTCTTCCCCGATATCCTC CCTGATCGACCGGACGCAGAAGGCAATGTCATACCACTTGTCCGCCCTGCCGCTTCTCCCAAGATCA ATAAAGCCACTTACTTTGCCATCTTTCACAAAGATGTTGCTGTCTCCCAGGTCGCCGTGGGAAAAGA CAAGTTCCTCTTCGGGCTTTTCCGTCTTTAAAAAATCATACAGCTCGCGCGGATCTTTAAATGGAGT GTCTTCTTCCCAGTTTTCGCAATCCACATCGGCCAGATCGTTATTCAGTAAGTAATCCAATTCGGCT AAGCGGCTGTCTAAGCTATTCGTATAGGGACAATCCGATATGTCGATGGAGTGAAAGAGCCTGATGC ACTCCGCATACAGCTCGATAATCTTTTCAGGGCTTTGTTCATCTTCATACTCTTCCGAGCAAAGGAC GCCATCGGCCTCACTCATGAGCAGATTGCTCCAGCCATCATGCCGTTCAAAGTGCAGGACCTTTGGA ACAGGCAGCTTTCCTTCCAGCCATAGCATCATGTCCTTTTCCCGTTCCACATCATAGGTGGTCCCTT TATACCGGCTGTCCGTCATTTTTAAATATAGGTTTTCATTTTCTCCCACCAGCTTATATACCTTAGC AGGAGACATTCCTTCCGTATCTTTTACGCAGCGGTATTTTTCGATCAGTTTTTTCAATTCCGGTGAT ATTCTCATTTTAGCCATTTATTATTTCCTTCCTCTTTTCTACAGTATTTAAAGATACCCCAAGAAGC TAATTATAACAAGACGAACTCCAATTCACTGTTCCTTGCATTCTAAAACCTTAAATACCAGAAAACA GCTTTTTCAAAGTTGTTTTCAAAGTTGGCGTATAACATAGTATCGACGGAGCCGATTTTGAAACCAC AATTATGGGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGC TTCTGTTTCTATCAGCTGTCCCTCCTGTTCAGCTACTGACGGGGTGGTGCGTAACGGCAAAAGCACC GCCGGACATCAGCGCTATCTCTGCTCTCACTGCCGTAAAACATGGCAACTGCAGTTCACTTACACCG CTTCTCAACCCGGTACGCACCAGAAAATCATTGATATGGCCATGAATGGCGTTGGATGCCGGGCAAC AGCCCGCATTATGGGCGTTGGCCTCAACACGATTTTACGTCACTTAAAAAACTCAGGCCGCAGTCGG TAACTATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCTCTTCCGC TTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAG GCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGC AAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGA GCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCG TTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCG CCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTA GGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCC GGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGGTAACCTCG CGCATACAGCCGGGCAGTGACGTCATCGTCTGCGCGGAAATGGACGGGCCCCCGGCGCCAGATCTGG GGAAC SEQIDNO:11-AnimalcellproductionconstructforMiniMcassette productionforRNApromoterselection FeaturesList Name location CMVpromoter 15..754 Hammerheadribozymeregion 866..913 D8complement 909..916 P5complement 917..921 Stufferinsertionsite 951..956 2ndD8complement 957..964 2ndP5complement 965..969 Hairpincatalyticcorecomplement 984..1030 Multiplecloningsite 1080..1173 Primer2complement 1113..1138 RTprimer1complement 1139..1158 HDVnegativestrandribozyme 1185..1270 polyAsignalsequence 1313..1532 SV40earlyenhancer/promoter 1582..1998 hygR 2024..3061 ColE1originfrompBR322 3274..3812 polyAsignalsequence 5213..5260 ampR rev:4248..5108 GGCCTAACTGGCCTCAATATTGGCCATTAGCCATATTATTCATTGGTTATATAGCATAAATCAATAT TGGCTATTGGCCATTGCATACGTTGTATCTATATCATAATATGTACATTTATATTGGCTCATGTCCA ATATGACCGCCATGTTGGCATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAG TTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCC CAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTC CATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATA TGCCAAGTCCGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACAT GACCTTACGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATG CGGTTTTGGCAGTACACCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACC CCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAATAA CCCCGCCCCGTTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGT TTAGTGAACCGTCAGATCACTAGAAGCTTTATTGCGGTAGTTTATCACAGTTAAATTGCTAACGCAG TCAGTGGGCCTCGGCGGCCAAGCTTGGCAATCCGGTACTGTTGGTAAAGCCACCATACCCTGTCACC GGATGTGCTTTCCGGTCTGATGAGTCCGTGAGGACGAAACAGGACTGTCAGGTGGCCGAAAGCCACC ACGTAAACTAGTGGATCCAACAGGACTGTCAGCTAGTCAAGGCGTACCAGGTAATATACCACAACGT GTGTTTCTCTGGTTGACTTCTCTGTTTGTTGTGTCATTGGTTCCCGGATCTCGCATTAGCGGCGACG GGGTATCCTGCAGGAAGCTTGGATCCGTCGACGCGGCCGCGATCGTCGGACTGTAGAACTCTGAACC CTTGGCACCCGAGAATTCCAGAATTCGGCGCGCCATACCCTGTCGGGTCGGCATGGCATCTCCACCT CCTCGCGGTCCGACCTGGGCATCCGAAGGAGGACAGACGTCCACTCGGATGGCTAAGGGAGAGCCAG GCCGCGACTCTAGAGTCGGGGCGGCCGGCCGCTTCGAGCAGACATGATAAGATACATTGATGAGTTT GGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTT TATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCA GGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTAAAATCGAT AAGGATCCGTTTGCGTATTGGGCGCTCTTCCGCTGATCTGCGCAGCACCATGGCCTGAAATAACCTC TGAAAGAGGAACTTGGTTAGCTACCTTCTGAGGCGGAAAGAACCAGCTGTGGAATGTGTGTCAGTTA GGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAG CAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTA GTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCAT TCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCTGCCTCTGAGC TATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTCGATTCTTCTGA CACTAGCGCCACCATGAAGAAGCCCGAACTCACCGCTACCAGCGTTGAAAAATTTCTCATCGAGAAG TTCGACAGTGTGAGCGACCTGATGCAGTTGTCGGAGGGCGAAGAGAGCCGAGCCTTCAGCTTCGATG TCGGCGGACGCGGCTATGTACTGCGGGTGAATAGCTGCGCTGATGGCTTCTACAAAGACCGCTACGT GTACCGCCACTTCGCCAGCGCTGCACTACCCATCCCCGAAGTGTTGGACATCGGCGAGTTCAGCGAG AGCCTGACATACTGCATCAGTAGACGCGCCCAAGGCGTTACTCTCCAAGACCTCCCCGAAACAGAGC TGCCTGCTGTGTTACAGCCTGTCGCCGAAGCTATGGATGCTATTGCCGCCGCCGACCTCAGTCAAAC CAGCGGCTTCGGCCCATTCGGGCCCCAAGGCATCGGCCAGTACACAACCTGGCGGGATTTCATTTGC GCCATTGCTGATCCCCATGTCTACCACTGGCAGACCGTGATGGACGACACCGTGTCCGCCAGCGTAG CTCAAGCCCTGGACGAACTGATGCTGTGGGCCGAAGACTGTCCCGAGGTGCGCCACCTCGTCCATGC CGACTTCGGCAGCAACAACGTCCTGACCGACAACGGCCGCATCACCGCCGTAATCGACTGGTCCGAA GCTATGTTCGGGGACAGTCAGTACGAGGTGGCCAACATCTTCTTCTGGCGGCCCTGGCTGGCTTGCA TGGAGCAGCAGACTCGCTACTTCGAGCGCCGGCATCCCGAGCTGGCCGGCAGCCCTCGTCTGCGAGC CTACATGCTGCGCATCGGCCTGGATCAGCTCTACCAGAGCCTCGTGGACGGCAACTTCGACGATGCT GCCTGGGCTCAAGGCCGCTGCGATGCCATCGTCCGCAGCGGGGCCGGCACCGTCGGTCGCACACAAA TCGCTCGCCGGAGCGCAGCCGTATGGACCGACGGCTGCGTCGAGGTGCTGGCCGACAGCGGCAACCG CCGGCCCAGTACACGACCGCGCGCTAAGGAGGTAGGTCGAGTTTAAACTCTAGAACCGGTCATGGCC GCAATAAAATATCTTTATTTTCATTACATCTGTGTGTTGGTTTTTTGTGTGTTCGAACTAGATGCTG TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCATGACTATC GTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCCGGCAGCGCTCTTCC GCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAA AGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCA GCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGAC GAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGG CGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTC CGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTG TAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTAT CCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGG TAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTAC GGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAG TTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCA GATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAG TGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCC TTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGCGG CCGCAAATGCTAAACCACTGCAGTGGTTACCAGTGCTTGATCAGTGAGGCACCGATCTCAGCGATCT GCCTATTTCGTTCGTCCATAGTGGCCTGACTCCCCGTCGTGTAGATCACTACGATTCGTGAGGGCTT ACCATCAGGCCCCAGCGCAGCAATGATGCCGCGAGAGCCGCGTTCACCGGCCCCCGATTTGTCAGCA ATGAACCAGCCAGCAGGGAGGGCCGAGCGAAGAAGTGGTCCTGCTACTTTGTCCGCCTCCATCCAGT CTATGAGCTGCTGTCGTGATGCTAGAGTAAGAAGTTCGCCAGTGAGTAGTTTCCGAAGAGTTGTGGC CATTGCTACTGGCATCGTGGTATCACGCTCGTCGTTCGGTATGGCTTCGTTCAACTCTGGTTCCCAG CGGTCAAGCCGGGTCACATGATCACCCATATTATGAAGAAATGCAGTCAGCTCCTTAGGGCCTCCGA TCGTTGTCAGAAGTAAGTTGGCCGCGGTGTTGTCGCTCATGGTAATGGCAGCACTACACAATTCTCT TACCGTCATGCCATCCGTAAGATGCTTTTCCGTGACCGGCGAGTACTCAACCAAGTCGTTTTGTGAG TAGTGTATACGGCGACCAAGCTGCTCTTGCCCGGCGTCTATACGGGACAACACCGCGCCACATAGCA GTACTTTGAAAGTGCTCATCATCGGGAATCGTTCTTCGGGGCGGAAAGACTCAAGGATCTTGCCGCT ATTGAGATCCAGTTCGATATAGCCCACTCTTGCACCCAGTTGATCTTCAGCATCTTTTACTTTCACC AGCGTTTCGGGGTGTGCAAAAACAGGCAAGCAAAATGCCGCAAAGAAGGGAATGAGTGCGACACGAA AATGTTGGATGCTCATACTCGTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTACTAGTACGT CTCTCAAGGATAAGTAAGTAATATTAAGGTACGGGAGGTATTGGACAGGCCGCAATAAAATATCTTT ATTTTCATTACATCTGTGTGTTGGTTTTTTGTGTGAATCGATAGTACTAACATACGCTCTCCATCAA AACAAAACGAAACAAAACAAACTAGCAAAATAGGCTGTCCCCAGTGCAAGTGCAGGTGCCAGAACAT TTCTCT