In-Vitro Detection of Human Parvovirus 4
20180155798 ยท 2018-06-07
Inventors
Cpc classification
C12Q1/6806
CHEMISTRY; METALLURGY
International classification
C12Q1/6806
CHEMISTRY; METALLURGY
Abstract
Provided herein are primers and probes for in-vitro detection of human parvovirus 4, including primers and probes having the sequence of SEQ ID NO: 1 or a part of it or a nucleotide having minimum 90% sequence identity with SEQ ID NO: 1; SEQ ID NO: 2 or a part of it or a nucleotide having minimum 90% sequence identity with SEQ ID NO: 2; and/or SEQ ID NO: 3 or a part of it or a nucleotide having minimum 90% sequence identity with SEQ ID NO: 3. The nucleotide sequences enable high detection of all genotypes of human parvovirus 4.
Claims
1. A primer or probe for in-vitro detection of human parvovirus 4, wherein the primer or probe comprises the nucleotide sequences selected from the group consisting of: a) SEQ ID NO: 1 or a sequence having 90% sequence identity with SEQ ID NO: 1; b) SEQ ID NO: 2 or a sequence having 90% sequence identity with SEQ ID NO:2; and c) SEQ ID NO: 3 or a sequence having 90% sequence identity with SEQ ID NO: 3; wherein the nucleotide sequences enable high detection of all genotypes of human parvovirus 4.
2. The primer or probe as claimed in claim 1, wherein the nucleotide sequences enable detection of human parvovirus 4 virus present in low copy number up to ?100 copies/ml.
3. A reaction mixture for real time PCR comprising: nuclease free water present in an amount of 5.625 ?l; buffer present in an amount of 12.5 ?l; SEQ ID NO: 1 present in an amount of 0.35 ?l; SEQ ID NO: 2 present in an amount of 0.35 ?l; SEQ ID NO: 3 present in an amount of 0.175 ?l; enzyme present in an amount of 1.0 ?l; and template present in an amount of 5 ?l; wherein the reaction mixture enables equal intensity detection of all genotypes of human parvovirus 4.
4. The reaction mixture as claimed in claim 4, wherein SEQ ID NO: 3 further comprises FAM as a reporter and IABkFQ as a quencher at a 3end.
5. The primer or probe as claimed in claim 1, wherein SEQ ID NO: 1 and SEQ ID NO: 2 respectively represent forward and reverse primers to amplify human parvovirus 4.
6. The primer or probe as claimed in claim 1, wherein SEQ ID NO: 3 represents a probe for the detection of human parvovirus 4.
7. The primer or probe as claimed in claim 1, wherein the probe or primer for human parvovirus 4 virus is a primer or probe for the VP1 gene of human parvovirus 4.
8. The primer or probe as claimed in claim 1, wherein the primer or probe is sensitive to detect the sample with the viral load of ?100 copies/ml.
9. A test kit for in-vitro detection of human parvovirus 4, the kit comprises: a) a nucleic acid molecule having the sequence of SEQ ID NO: 1 or a sequence having 90% sequence identity with said SEQ ID NO: 1; b) a nucleic acid molecule having the sequence of SEQ ID NO: 2 or a sequence having 90% sequence identity with said SEQ ID NO:2; and/or c) a nucleic acid molecule having the sequence of SEQ ID NO: 3 or a sequence having 90% sequence identity with said SEQ ID NO:3; wherein the nucleotide sequence enables high detection of all genotypes of human parvovirus 4.
10. (canceled)
Description
BRIEF DESCRIPTION OF THE ACCOMPANYING DRAWINGS
[0027]
[0028]
[0029]
DETAILED DESCRIPTION OF THE INVENTION
[0030] The present invention provides a real-time polymerase chain reaction for detection of Human parvovirus 4 together with a new set of primers and probes with high sensitivity and specificity.
[0031] The invention further provides a test kit based on real time PCR for the detection of Human Parvovirus 4, said kit comprises nucleotide sequences selected from the group comprising of or any combinations thereof: [0032] a) a nucleic acid molecule that encodes a nucleotide sequence of SEQ ID NO:1 or a part of it or a nucleotide having at least 90% sequence identity with said SEQ ID NO:1; (Please check if 90% sequence identity is appropriate) [0033] b) a nucleic acid molecule that encodes a nucleotide sequence of SEQ ID NO:2 or a part of it or a nucleotide having at least 90% sequence identity with said SEQ ID NO:2; (Please check if 90% sequence identity is appropriate) [0034] c) a nucleic acid molecule that encodes a nucleotide sequence of SEQ ID NO:3 or a part of it or a nucleotide having at least 90% sequence identity with said SEQ ID NO:3; (Please check if 90% sequence identity is appropriate) [0035] wherein said nucleotide sequences enable high detection of all genotypes of human parvovirus 4. [0036] The nucleotide sequences enable detection of Human Parvovirus 4 present in low copy (number up to ?100 copies/ml.)
[0037] The invention also provides primers and probes for the detection of Human Parvovirus 4 virus in a sample comprising: [0038] a) a nucleic acid molecule that encodes a nucleotide sequence of SEQ ID NO:1 or a part of it or a nucleotide having at least 90% sequence identity with said SEQ ID NO:1, wherein said nucleotide sequence of SEQ ID NO: 1 represents forward primer to amplify Human Parvovirus 4; [0039] b) a nucleic acid molecule that encodes a nucleotide sequence of SEQ ID NO:2 or a part of it or a nucleotide having at least 90% sequence identity with said SEQ ID NO:2, wherein said nucleotide sequence of SEQ ID NO: 1 represents reverse primer to amplify Human Parvovirus 4; [0040] c) a nucleic acid molecule that encodes a nucleotide sequence of SEQ ID NO:3 or a part of it or a nucleotide having at least 90% sequence identity with said SEQ ID NO:3, wherein said nucleotide sequence of SEQ ID NO:3 represents probes to detect Human Parvovirus 4;
wherein said nucleotide sequences enable high detection of all genotypes of human parvovirus 4.
[0041] The nucleotide sequences enable detection of Human Parvovirus 4 present in low copy (number up to ?100 copies/ml.)
[0042] The invention further provides a reaction mixture for real time PCR for the detection of Human Parvovirus 4 virus comprising: [0043] a) Nuclease free water present in an amount of 5.625 ?l. [0044] b) Buffer present in an amount of 12.5 ?l. [0045] c) Human parvovirus 4 Primer Forward (10 pm) present in an amount of 0.35 ?l. [0046] d) Human parvovirus 4 Primer Reverse (10 pm) present in an amount of 0.35 ?l. [0047] e) Human parvovirus 4 Probe (10 pm) present in an amount of 0.175 ?l. [0048] f) Enzyme present in an amount of 1.0 ?l. [0049] g) Template present in an amount of 5 ?l.
[0050] The reaction mixture advantageously enables equal intensity detection of all genotypes of Human Parvovirus 4 virus.
[0051] The reaction mixture further advantageously enables detection of human parvovirus 4 with high sensitivity and also of all the genotypes of Human Parvovirus 4.
[0052] Designing the Primers and Probes for Human Parvovirus 4
[0053] Sequences representing all three Human parvovirus 4 genotypes (1-3) accession no. (genotype 1: EU546204.1, genotype 2: EU175855.1, genotype 3: JN183925.1) and many other sequences representing Human parvovirus 4 were downloaded from the GenBank nucleotide database and aligned using the program Mega5.1. A highly conserved region of the VP1 gene is selected for the design of real-time PCR primers and probe. All three Human parvovirus 4 genotypes which we studied are presented in
TABLE-US-00001 TABLE1 Sequence Oligo- Product ID Polarity nucleotidesequence5-3 Length size 1.HPV4 Forward GAGTCCACCTTGTTAGTGACAG 22 126bp Fwd 2.HPV4 Reverse GAGGATTACCAGGACCAACATAA 23 Rvs 3.HPV4 /5FAM/TTGTTGAACCAGACCTTG 24 Probe AGCGGC/3IABkFQ/
[0054] Although the inventions herein are described with various specific embodiments, it will be obvious for a person skilled in the art to practice the embodiments herein with modifications. However, all such modifications are deemed to be within the scope of the claims. It is also to be understood that the following claims are intended to cover all of the generic and specific features of the embodiments described herein and all the statements of the scope of the embodiments which as a matter of language might be said to fall there between.
[0055] Testing the Sensitivity & Specificity of Probes and Primers
[0056] A known Human parvovirus 4 sample was amplified with the aforesaid primers and cloned in pTZ57R/T cloning vector using commercial kit then the cloned plasmid was amplified using M13/pUC sequencing primers (Fwd & Rvs), then the amplified product was sequenced using capillary sequencer to get exact cloned sequence. Further the sequenced segment was checked for the sequence similarity using NCBI Blast program and it was confirmed that the cloned sequence belonged to Human parvovirus 4.
[0057] A batch of 80 samples was prepared by mixing different viruses in different combinations including Human parvovirus 4 as well as HBV, HCV, Human Parvovirus B19, Adenovirus, Dengue, Japanese encephalitis, HSV-1, HSV-2, Varicella zoster virus and was tested for Human parvovirus 4 by currently designed primer and probes. Results showed that there is no cross reactivity of the designed primers and probes with the above mentioned viruses.
[0058] The sensitivity of this Real Time based assay was estimated based on a cloned and standardized parvovirus 4 DNA with known copy number. Detection of positive samples containing 500 copies/ml, 200 copies/ml & 100 copies/ml of the parvovirus 4 standard in the assay was 100% (10 of 10 tests) respectively, while samples with ?10 copies/ml were tested positive 9 out of 10 times. These results show that the assay has a very high sensitivity and specificity required for detecting human parvovirus 4.
[0059] Clinical Specimen Testing
[0060] To determine the assay specificity of the primers and probe for detecting Human parvovirus 4 DNA, Real Time-based assay was performed (using amplification oligomers of SEQ ID Nos. 1, 2 and 3) on clinical available serum/plasma samples. The assay was performed on 95 samples from five different subgroups of patients samples stored at virology section, dept. of Microbiology, King George's Medical University, Lucknow, U.P., India. Of total clinical samples tested 33 were positive for the parvovirus 4. All positive samples provided positive results when they were retested three times using the same assay (
[0061] Validation of the Sequence Amplified Using Newly Designed Primers
[0062] Few positive samples for human parvovirus 4 were cloned sequenced using ABI 3130 sequencer using M13/pUC sequencing primers. Sequencing results showed all the amplified sequences belonged to human parvovirus 4 (
[0063] In the present embodiment, the invention has been described with reference to detection of Human parvovirus 4 from human plasma, serum, CSF, nasal and throat swab samples, however such description should not be considered as restricting the scope of the present invention. Further it would be possible for a person skilled in the art to practice the present invention considering other sample for the detection of Human parvovirus 4 without departing from the scope of the present invention.