METHOD FOR SOLID-PHASE SYNTHESIS OF DNA ENCODED COMPOUND LIBRARY
20180155710 ยท 2018-06-07
Inventors
Cpc classification
C40B50/04
CHEMISTRY; METALLURGY
C12N15/1068
CHEMISTRY; METALLURGY
C40B70/00
CHEMISTRY; METALLURGY
C40B40/06
CHEMISTRY; METALLURGY
C12P19/34
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention provides a method of solid-phase synthesis of DNA-encoded compound library. The method includes following steps: a) reacting solid carrier G-1 with linker molecule L-1 to prepare L-G-1; b) reacting DNA with linker molecule L-0 to prepare L-2; c) reacting L-G-1 with L-2 to prepare L-G-2; d) removing protection group of the L-G-2 and obtaining L-G-2-1; e) reacting the L-G-2-1 with synthetic building block and performing DNA encoding; and f) removing the solid carrier and obtaining the DNA-encoded compound library. Compared with the prior art, the present invention can complete post-treatment purification of the reaction only by filtration and irrigation processes for several times. The present invention is simple to operate, can shorten the production cycle of DNA encoded compound library with more than 50%, significantly increases the production efficiency and the unicity as well as the purity of the final products.
Claims
1. A method for solid-phase synthesis of a DNA-encoded compound library, comprising: a. reacting a solid carrier G-1 with a linker molecule L-1, separating, purifying and obtaining L-G-1; b. reacting DNA with a linker molecule L-0, separating, purifying and obtaining L-2;
c. reacting the L-G-1 with the L-2, separating, purifying and obtaining L-G-2;
d. removing a protection group of the L-G-2 and obtaining L-G-2-1; and e. adopting method 1, method 2, method 3, method 4 or any combination thereof: method 1, comprising: reacting the L-G-2-1 with R.sup.1, separating, purifying and obtaining L-G-2-1-1; performing DNA encoding on the L-G-2-1-1 and obtaining L-G-3-I;
or method 2, comprising: i. reacting the L-G-2-1 with skeleton molecules, separating, purifying and obtaining L-G-2-2; and
ii. reacting the L-G-2-2 with R.sup.1 or reacting the R.sup.1 with the L-G-2-2 having protection group removed, separating, purifying and obtaining L-G-2-2-1; performing DNA encoding on the L-G-2-2-1 and obtaining L-G-3-1;
or method 3, comprising: i. reacting the L-G-2-1 with skeleton molecules, separating, purifying and obtaining L-G-2-2; ii. reacting the R.sup.1 with the L-G-2-2 or reacting the R.sup.1 with the L-G-2-2 having protection group removed, separating, purifying and obtaining L-G-2-2-1; performing DNA encoding on the L-G-2-2-1 and obtaining L-G-3-1; and iii. reacting a R.sup.2 with the L-G-3-1 or reacting the R.sup.2 with the L-G-3-1 having protection group removed, separating, purifying and obtaining L-G-3-1-1; performing DNA encoding on the L-G-3-1-1 and obtaining L-G-3-2;
or method 4, comprising: i. reacting L-G-2-1 with skeleton molecules, separating, purifying and obtaining L-G-2-2; performing DNA encoding on the L-G-2-2 and obtaining L-G-3-1; ii. reacting the R.sup.2 with the L-G-3-1 or reacting the R.sup.2 with the L-G-3-1 having protection group removed, separating, purifying and obtaining L-G-3-1-1; performing DNA encoding on the L-G-3-1-1 and obtaining L-G-3-2; wherein the R.sup.1 and R.sup.2 are synthetic building blocks; and f. removing the solid carrier from L-G-3-I, L-G-3-1 and/or L-G-3-2 and obtaining DNA-encoded compound library L-D-T.
2. The method according to claim 1, wherein in the step a, the described solid carrier is selected from any one or more of a PEG resin, a PEGA resin, an inorganic carrier and a PE thin plate.
3. The method according to claim 1, wherein in the step a, the described solid carrier is a solid carrier containing amino active functional group; and the solid carrier is ##STR00008##
4. The method according to claim 1, wherein in the step a, the described linker molecule L-1 is selected from a compound containing any one or more of functional groups consisting of ester group, sulfur-ester group, ortho-nitrobenzyl group, coumarin group, aromatic ketone groups, nitrine, hydroxyl group, sulfhydryl group, thioether group, carboxyl group, aldehyde group, amino groups, amide group, alkenyl group and alkynyl group; and the described linker molecule L-1 is ##STR00009##
5. The method according to claim 1, wherein in the step a, the described L-G-1 is ##STR00010##
6. The method according to claim 1, wherein in the step b, the described DNA is single-stranded DNA.
7. The method according to claim 1, wherein in the step b, the described linker molecule L-0 is selected from a compound containing any one or more of functional groups consisting of ester group, sulfur-ester group, ortho-nitrobenzyl group, coumarin group, aromatic ketone groups, nitrine, hydroxyl group, sulfhydryl group, thioether group, carboxyl group, aldehyde group, amino groups, amide group, alkenyl group and alkynyl group; and the described linker molecule is ##STR00011##
8. The method according to claim 1, wherein in the step b, the L-2 is
9. The method according to claim 1, wherein in the step c, the described L-G-2 is
10. The method according to claim 1, wherein in the step d, the described L-G-2-1 is
11. The method according to claim 1, wherein in the step e, the method of DNA encoding comprises: connecting marker sequence i with DNA of L-G-2-1-1, L-G-2-2-1, L-G-3-1-1 or L-G-2-2 in series and marking R.sup.i specifically with the marker sequence i; wherein R.sup.i is a synthetic building block, i=1 or 2; connecting the marker sequence i on DNA or marker sequence (i1) in series when a new R.sup.i is added each time during the synthesis; and connecting a terminal sequence on the marker sequence i after the synthesis is completed.
12. The method according to claim 1, wherein in the step e, the described R.sup.1 and R.sup.2 are respectively or simultaneously selected from polyfunctional group compounds, and the polyfunctional groups are independently selected from any two or more of groups consisting of amino, carboxyl, aldehyde group, alkenyl, alkynyl, halogen, azide group, hydroxyl group, sulfhydryl group and phenyl group; and the described R.sup.1 and R.sup.2 are respectively or simultaneously selected from amino acid, substituted or unsubstituted carboxylic acids, substituted or unsubstituted amines, substituted or unsubstituted olefins, substituted or unsubstituted alkenes, substituted or unsubstituted alkynes, substituted or unsubstituted aldehydes, isocyanate; and the described R.sup.1 and R.sup.2 are respectively or simultaneously selected from isocyanate, benzyl alcohol or benzoic acid.
13. The method according to claim 1, wherein in the step e, the described skeleton molecules contain any one or more of groups consisting of hydroxyl group, amino group, carboxyl group, cyanate group and aldehyde group.
14. The method according to claim 1, wherein in the step e, the described skeleton molecules are selected from any one or more of molecules consisting of 3-(4-hydroxyphenyl)propionic acid, 4-aminobenzoic acid, dl-4-hydroxyphenylglycine, FMOC-glycine, FMOC-1-phenylalanine, t-butylisocynide, cyclohexyl isocyanide, 3-methyl butyraldehyde, cyclopentyl aldehyde and ##STR00012##
15. The method according to claim 1, wherein in the step e, the described L-G-3-I is the described L-G-2-2 is
the described L-G-3-1 is:
wherein, R.sup.j is a group able to form isocyanate.
16. The method according to claim 1, wherein in the step f, the method of removing the solid carrier comprises: i. taking L-G-3-I, L-G-3-1 and/or L-G-3-2, adding an alkaline for reaction, separating and purifying; or; ii. taking L-G-3-I, L-G-3-1 and/or L-G-3-2, adding PBS buffer solution, performing decomposition reaction under light source, separating and purifying.
17. The method according to claim 1, wherein in the step f, the described L-D-T is wherein, R is a group able to form isocyanate; R.sub.1-a is CH.sub.2 or C.sub.6H.sub.5CH.sub.2CH; R.sub.1-b is n-butyl, isobutyl, tertiary butyl or cyclohexyl; R.sub.1-a is n-propyl, isopropyl or cyclopentyl; R.sup.k is a group produced by amino group reacting with any one of carboxylic acid, aldehyde and isocyanate.
18. A DNA encoded compound library, wherein the library has a general formula shown as formula I: wherein,
is a skeleton molecule of the compound library; R.sup.i is selected from hydrogen or synthetic building blocks; E is selected from amino group, alkenyl, alkynyl, amide, ester, thioether or azide; A is selected from a hydroxyl group or a sulfhydryl group; B is selected from ##STR00013## wherein R is hydrogen, C1C8 alkyl group, C1C8 alkenyl or a group forming a cycle with atoms in B.sub.1; B.sub.1 is selected from substituted or unsubstituted alkynyl, amino, carboxyl, aldehyde, azide or sulfhydryl; and
is DNA.
19. The DNA encoded compound library according to claim 18, wherein the described skeleton molecule contains any one or more of groups consisting of hydroxyl, amino, carboxyl, cyano group and aldehyde group.
20. The DNA encoded compound library according to claim 19, wherein the described skeleton molecule is any one or more of following molecules consisting of 3-(4-hydroxyphenyl)propionic acid, 4-aminobenzoic acid, dl-4-hydroxyphenylglycine, FMOC-glycine, FMOC-1-phenylalanine, t-butylisocynide, cyclohexyl isocyanide, 3-methyl butyraldehyde, cyclopentyl aldehyde and ##STR00014##
21. The DNA encoded compound library according to claim 18, wherein the molecule A has 1050 atoms.
22. The DNA encoded compound library according to claim 18, wherein the library contains the following DNA encoded compound library: wherein, R.sup.j is a group able to form isocyanate; R.sub.1-a is CH.sub.2 or C.sub.6H.sub.5CH.sub.2CH; R.sub.1-b is n-butyl, isobutyl, tertiary butyl or cyclohexyl; R.sub.1-a is R.sub.1-a is n-propyl, isopropyl or cyclopentyl; R.sup.k is a group produced by amino group reacting with any one of carboxylic acid, aldehyde and isocyanate.
Description
DETAILED DESCRIPTION
[0120] The raw materials and equipments used in the present invention are known products and can be purchased in the market.
[0121] Some abbreviations are given:
[0122] Fmoc: fluorenylmethoxycarbonyl group;
[0123] DMF: N,N-dimethylformamide;
[0124] DMSO: dimethyl sulfoxide;
[0125] DMT-MM: 2-chloro-4,6-dimethoxy-1,3,5-triazine;
[0126] TEAA: triethylammonium acetate; and
[0127] DETA: ethyldiisopropylamine.
Embodiment 1
[0128] (1). The preparation of L-G-1
[0129] adding 3 mL of dichloromethane solution of compound L-1 (69 mg, 0.1 mmol, manufacturer: Aldrich) to G-1 (0.5 g, starting loading of CPG: 32 mol/g, derived from Shanghai Lingjiang Industrial Development Co., Ltd) and allowing reaction overnight under room temperature; removing the solvent by filtration after the reaction to obtain a solid; washing the solid respectively with DMF (2 mL3) and dichloromethane (2 mL3) to obtain L-G-1.
[0130] Taking L-G-1, removing Fmoc protection group with piperidine, and determining that the loading of L-G-1 is 14.5 mol/g by measuring UV absorption of the Fmoc-removed product, the productivity is 91%.
[0131] (2) The preparation of L-2
[0132] dissolving single strand DNA (32.0 nmol, molar weight is 7663.9) (sequence of the single strand DNA is GGAGCTTGTGAATTCTGGCACTCG) into 30 L NaHCO.sub.3 buffer solution, adding successively 20 mL DMSO solution of L-0 (1.0 mg, 3.0 mol, manufacturer: Aldrich) and 10 L water solution of DMT-MM solution (0.83 mg, 3.0 mol); allowing reaction overnight under room temperature; adjust pH to 45 with 3 mol/L HCl solution after the above mentioned reaction is finished; adding 240 L ethanol and precipitating at 20 C. for 2 hours, and centrifugating to obtain a solid; washing the solid with 85% ethanol to obtain L-2, and determining that the amount of substance of L-2 is 28.0 nmol using OD ultraviolet absorption, the productivity is 80%.
[0133] MS(ESI) m/z 7979.6 (M+1).sup.+.
[0134] (3) The preparation of L-G-2
[0135] adding 90 L aqueous solution of L-2 (28 nmol) and 10 L pyridine into L-G-1 (10 mg, 140 nmol), and allowing reaction with stirring for 21 hours at 40 C.; filtrating the solution after the above mentioned reaction, removing the solvent to obtain a solid; washing the solid respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times to obtain L-G-2.
[0136] (4) The preparation of L-G-2-1
[0137] Adding DMF (160 L) and pyridine (40 L) into L-G-2 (8.0 mg), and allowing react with stirring for 6 hours at 25 C.30 C.; filtrating the solution and removing the solvent to obtain a filtrated cake; washing the filtrated cake respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times to obtain L-G-2-1.
[0138] Taking part of L-G-2-1 (3.0 mg), adding 150 L of strong aqueous ammonia, and heating the solution to 55 C. and reacting for 1 hour to remove the solid carrier, removing the solvent by reducing the pressure after filtration process, washing the solid respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times, adding 250 L ethanol and 100 L acetic acid-sodium acetate buffer solution (pH=4.7, 0.5 mol/L) to the solid and precipitating at 20 C. to obtain the DNA in L-G-2-1, determining that the amount of substance of DNA in L-G-2-1 is 6.0 nmol by using OD ultraviolet absorption, the productivity is 65%.
[0139] MS(ESI) m/z 8251.0 (M+1).sup.+.
[0140] (5) the preparation of L-G-2-2.a
[0141] Adding molecule skeleton containing carboxylic acid, O-(7-azabenzotriazole-1-yl)-N, N,N,N-trtramethyluronium hexafluorophosphate, DIEA as well as DMF into L-G-2-1 and allowing react with stirring for 16 hours at 25 C.30 C.; filtrating the solution and removing the solvent to obtain a filtrated cake; washing the filtrated cake respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times to obtain L-G-2-2.a.
[0142] More specifically,
[0143] Adding 4-Aminobenzoic Acid (4.15 mg, Manufacturer: Alfa), O-(7-Azabenzotriazole-1-yl)-N, N,N,N-trtramethyluronium hexafluorophosphate (6.9 mg manufacturer: Alfa), DIEA (20 L) as well as DMF (60 L) into L-G-2-1 (20 mg) and allowing reaction with stirring for 1216 hours at 25 C.30 C.; filtrating the solution and removing the solvent to obtain a filtrated cake; washing the filtrated cake respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times to obtain L-G-2-2.a.
[0144] Taking part of L-G-2-2.a (3.0 mg), adding 150 L of strong aqueous ammonia and heating the solution to 55 C. for 1 hour to remove the solid carrier, removing the solvent by reducing the pressure after filtration process, washing respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times. Adding 250 L ethanol and 100 L acetic acid-sodium acetate buffer solution (pH=4.7, 0.5 mol/L) to the solid and precipitating at 20 C. to obtain the DNA in L-G-2-2, determining that the amount of substance of DNA in L-G-2-1 is 4.5 nmol by using OD ultraviolet absorption, the productivity is 75%.
[0145] MS(ESI) m/z 8369.7 (M+1)+.
[0146] (6) The preparation of L-G-3-1.a
[0147] adding R.sup.j (R.sup.j is synthetic building block and selected from substituted isocyanate), DIEA and DMF into L-G-2-2.a; allowing reaction with stirring for 16 hours at 25 C.30 C.; filtrating the solution and removing the solvent to obtain a filtrated cake; washing the filtrated cake respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times to obtain L-G-2-2-1.a;
[0148] referencing to the DNA encoded method disclosed in the patent named Synthesis and Screening Method and Kit for Lead Compound (application number: CN201210555548.3), L-G-2-1-1.a is performed DNA encoding in solid-phase condition (single strand DNA sequence is GGAGCTTGTGAAATCTGGCACTCG) to obtain L-G-3-1.a;
[0149] after the encoding, washing the solid respectively with 0.1 mol/L TEAA buffer solution (4100 L) and distilled water (4100 L), finally washing with 100 L distilled water; taking a part of the solid washing, adding 50 L of strong aqueous ammonia, and allowing reaction for 1 hour at 55 C.; washing the solid with 0.1 mol/L TEAA buffer solution and distilled water for 3 times; precipitating the filtrated solution by ethanol, and freeze-drying for agarose electrophoresis test.
[0150] (7) The synthesis of compound library L-D-T-1
[0151] removing CPG from L-G-3-1.a by alkaline removal method or light removal method to obtain the DNA encoded compound library L-D-T-1.
Embodiment 2
[0152] (1) L-G-1 is obtained according to the preparation method for L-G-1 in embodiment 1;
[0153] (2) L-2 is obtained according to the preparation method for L-2 in embodiment 1;
[0154] (3) L-G-2 is obtained according to the preparation method for L-G-2 in embodiment 1;
[0155] (4) L-G-2-1 is obtained according to the preparation method for L-G-2-1 in embodiment 1; and
[0156] (5) the preparation of L-G-3-1.b
[0157] adding 2-ethylphenyl isocyanate (1.47 mg, manufacturer: Alfa), triethylamine (5 L) as well as DMF (15 L) into L-G-2-1 (5 mg) and reacting for 16 hours at 25 C.30 C.; filtrating the solution and removing the solvent to obtain a filtrated cake; washing the filtrated cake respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times to obtain L-G-2-1-1.b;
[0158] taking part of L-G-2-1-1.b (2.0 mg), adding 150 L of strong aqueous ammonia, and heating the solution to 55 C. for 1 hour to remove the solid carrier. Removing the solvent by reducing the pressure after filtration process, washing respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times. Adding 250 L ethanol and 100 L acetic acid-sodium acetate buffer solution (pH=4.7, 0.5 mol/L) to the solid, precipitating at 20 C. to obtain DNA in L-G-2-1-1.b. The amount of substance is 2.5 nmol by using OD ultraviolet absorption quantitation, the productivity is 63%.
[0159] MS(ESI) m/z 8395.4 (M+1).sup.+.
[0160] Referencing to the DNA encoded method disclosed in the patent named Synthesis and Screening Method and Kit for Lead Compound (application number: CN201210555548.3), L-G-2-1-1.b is performed DNA encoding in solid-phase condition (single strand DNA sequence is GGAGCTTGTGAAATCTGGCACTCG) to obtain L-G-3-1.b;
[0161] after the encoding, washing the solid respectively with 0.1 mol/L TEAA buffer solution (4100 L) and distilled water (4100 L), finally washing with 100 L distilled water; taking a part of solids after the irrigation, adding 50 L of strong aqueous ammonia, and reacting for 1 hour at 55 C.; washing the obtained solid with 0.1 mol/L TEAA buffer solution and distilled water for 3 times; precipitating the filtrated solution by ethanol, and freeze-drying for agarose electrophoresis test.
[0162] (6) L-D-T-2 is obtained according to the preparation method in embodiment 1.
Embodiment 3
[0163] (1) L-G-1 is obtained according to the preparation method for L-G-1 in embodiment 1;
[0164] (2) L-2 is obtained according to the preparation method for L-2 in embodiment 1;
[0165] (3) L-G-2 is obtained according to the preparation method for L-G-2 in embodiment 1;
[0166] (4) L-G-2-1 is obtained according to the preparation method for L-G-2-1 in embodiment 1; and
[0167] (5) the preparation of L-G-2-2.c
[0168] adding 4-aminobenzoic acid (4.15 mg, manufacturer: Alfa), O-(7-azabenzotriazole-1-yl)-N, N,N,N-trtramethyluronium hexafluorophosphate (6.9 mg, manufacturer: Alfa), DIEA (20 L) as well as DMF (60 L) into L-G-2-1 (20 mg), and reacting with stirring for 16 hours at 25 C.30 C.; filtrating the solution to remove the solvent and to obtain a filtrated cake; washing the filtrated cake respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times to obtain L-G-2-2. c;
[0169] taking part of L-G-2-2.c (2.0 mg), adding 150 L of strong aqueous ammonia, and heating the solution to 55 C. for 1 hour to remove the solid carrier. Removing the solvent by reducing the pressure after filtration, washing the solid respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times. Adding 250 L ethanol and 100 L acetic acid-sodium acetate buffer solution (pH=4.7, 0.5 mol/L) to the solid, precipitating at 20 C. to obtain DNA in L-G-2-2.c, the amount of substance of the obtained DNA in L-G-2-2.c is 3.0 nmol by using OD ultraviolet absorption quantification, the productivity is 75%.
[0170] MS (ESI) m/z 8369.7 (M+1).sup.+.
[0171] (6) The preparation of L-G-3-1.c
[0172] adding benzoic acid (2.0 mg), O-(7-azabenzotriazole-1-yl)-N, N,N,N-trtramethyluronium hexafluorophosphate (6.9 mg, manufacturer: Alfa), DIEA (20 L) as well as DMF (60 L) into L-G-2-1 (20 mg), and reacting with stirring for 16 hours at 25 C.30 C.; filtrating the solution to remove the solvent and obtaining a filtrated cake; washing the filtrated cake respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times to obtain L-G-2-2-1.c;
[0173] taking part of L-G-2-2-1.c (2.0 mg), adding 150 L of strong aqueous ammonia, and heating the solution to 55 C. for 1 hour to remove the solid carrier. Removing the solvent by reducing the pressure after filtration process, washing the solid respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times. Adding 250 L ethanol and 100 L acetic acid-sodium acetate buffer solution (pH=4.7, 0.5 mol/L) to the solid, precipitating at 20 C. to obtain DNA in L-G-2-2-1.c, the amount of substance of the obtained DNA in L-G-2-2-1.c is 1.5 nmol by using OD ultraviolet absorption quantification, the productivity is 38%.
[0174] MS(ESI) m/z 8473.1 (M+1).sup.+.
[0175] Referencing to the DNA encoded method disclosed in the patent named Synthesis and Screening Method and Kit for Lead Compound (application number: CN201210555548.3), L-G-2-2-1.c is performed DNA encoding in solid-phase condition (single strand DNA sequence is GGAGCTTGTGAAATCTGGCACTCG) to obtain L-G-3-1.c;
[0176] after encoding, washing the solid respectively with 0.1 mol/L TEAA buffer solution (4100 L) and distilled water (4100 L), finally washing the solid with 100 L distilled water; taking a part of solid the irrigation, adding 50 L of strong aqueous ammonia, and reacting for 1 hour at 55 C.; washing the obtained solid with 0.1 mol/L TEAA buffer solution and distilled water for 3 times; precipitating the filtrated solution by ethanol, and freeze-drying for agarose electrophoresis test.
[0177] (7) L-D-T-3 is obtained according to the preparation method of L-D-T-1 in embodiment 1.
Embodiment 4
[0178] (1) L-G-1 is obtained according to the preparation method for L-G-1 in embodiment 1;
[0179] (2) L-2 is obtained according to the preparation method for L-2 in embodiment 1;
[0180] (3) L-G-2 is obtained according to the preparation method for L-G-2 in embodiment 1;
[0181] (4) L-G-2-1 is obtained according to the preparation method for L-G-2-1 in embodiment 1; and
[0182] (5) the preparation of L-G-2-2.d
[0183] adding S-2 (17.4 mg, manufacturer: Alfa), O-(7-azabenzotriazole-1-yl)-N, N,N,N-trtramethyluronium hexafluorophosphate (6.9 mg, manufacturer: Alfa), DIEA (20 L) as well as DMF (60 L) into L-G-2-1 (20 mg) and reacting with stirring for 16 hours at 25 C.30 C.; filtrating the solution to remove the solvent and obtaining a filtrated cake; washing the filtrated cake respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times to obtain L-G-2-2.d;
[0184] taking part of L-G-2-2.d (2.0 mg), adding 150 L of strong aqueous ammonia, and heating the solution to 55 C. for 1 hour to remove the solid carrier. Removing the solvent by reducing the pressure after filtration process, washing the solid respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times. Adding 250 L ethanol and 100 L acetic acid-sodium acetate buffer solution (pH=4.7, 0.5 mol/L) to the solid, precipitating at 20 C. to obtain DNA in L-G-2-2.d, the amount of substance of the obtained DNA in L-G-2-2.d is 2.0 nmol by using OD ultraviolet absorption quantification, the productivity is 50%.
[0185] MS(ESI) m/z 8698.0 (M+1).sup.+.
[0186] (6) The preparation of L-G-3-1.d
[0187] adding piperidine (5 L) into L-G-2-2.d (15 mg) and reacting with stirring for 6 hours at 25 C.30 C.; filtrating the solution to remove the solvent and obtaining a filtrated cake; washing the filtrated cake respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times to obtain a solid; adding R.sup.j (R.sup.j is selected from isocyanate substituted by R.sup.j, 1.5 mg), triethylamine (10 L) as well as DMF (100 L) into the solid; reacting with stirring for 16 hours at 25 C.30 C.; filtrating the solution to remove the solvent and obtaining a filtrated cake; washing the filtrated cake respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times to obtain L-G-2-2-1.d;
[0188] referencing to the DNA encoded method disclosed in the patent named Synthesis and Screening Method and Kit for Lead Compound (application number: CN201210555548.3), L-G-2-2-1.d is performed DNA encoding in solid-phase condition (single strand DNA sequence is GGAGCTTGTGAAATCTGGCACTCG) to obtain L-G-3-1.d;
[0189] after encoding, washing the solid respectively with 0.1 mol/L TEAA buffer solution (4*100 L) and distilled water (4*100 L), finally washing with 100 L distilled water; taking a part of the solid after the irrigation, adding 50 L of strong aqueous ammonia, and reacting for 1 hour at 55 C.; washing the obtained solid with 0.1 mol/L TEAA buffer solution and distilled water for 3 times; precipitating the filtrated solution by ethanol, and freeze-drying for agarose electrophoresis test.
[0190] (7) Synthesis of L-D-T-4 compound library
[0191] taking part of L-G-3-1.d (3.0 mg), adding 150 L of strong aqueous ammonia, and heating the solution to 55 C. for 1 hour to remove the solid carrier. Removing the solvent by reducing the pressure after filtration process, washing the solid respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times. Adding 250 L ethanol and 100 L acetic acid-sodium acetate buffer solution (pH=4.7, 0.5 mol/L) to the solid, and precipitating at 20 C. to obtain L-D-T-4.
Embodiment 5
[0192] (1) L-G-1 is obtained according to the preparation method for L-G-1 in embodiment 1;
[0193] (2) L-2 is obtained according to the preparation method for L-2 in embodiment 1;
[0194] (3) L-G-2 is obtained according to the preparation method for L-G-2 in embodiment 1;
[0195] (4) L-G-2-1 is obtained according to the preparation method for L-G-2-1 in embodiment 1; and
[0196] (5) the preparation of L-G-2-2.e
[0197] adding S-1, S-2 and S-3 as well as DMF into L-G-2-1 and reacting with stirring for 16 hours at 25 C.30 C.; filtrating the solution to remove the solvent and obtaining a filtrated cake; washing the filtrated cake respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times to obtain L-G-2-2.e.
[0198] Specifically,
[0199] adding S-1 (FMOC-glycine, manufacturer: Alfa, 14.8 mg), S-2 (t-butylisocynide, manufacturer: Alfa, 4.2 mg) and S-3 (isovaleraldehyde, manufacturer: Alfa, 4.3 mg) as well as DMF (100 L) into L-G-2-1 and reacting with stirring for 16 hours at 25 C.30 C.; filtrating the solution to remove the solvent and obtaining a filtrated cake; washing the filtrated cake respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times to obtain L-G-2-2. e;
[0200] taking part of L-G-2-2-1.e (2.0 mg), adding 150 L of strong aqueous ammonia to, and heating the solution to 55 C. for 1 hour to remove the solid carrier. Removing the solvent by reducing the pressure after filtration process, finally washing the solid respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times. Adding 250 L ethanol and 100 L acetic acid-sodium acetate buffer solution (pH=4.7, 0.5 mol/L) to the solid, precipitating at 20 C. to obtain DNA in L-G-2-2.e, the amount of substance of DNA in L-G-2-2.e is 38 nmol by using OD ultraviolet absorption quantitation, the productivity is 76%.
[0201] MS(ESI) m/z 9111.4 (M+1).sup.+.
[0202] (6) The preparation of L-G-3-1.e
[0203] referencing to the DNA encoded method disclosed in the patent named Synthesis and Screening Method and Kit for Lead Compound (application number: CN201210555548.3), L-G-2-2-1.e is performed DNA encoding in solid-phase condition (single strand DNA sequence is GGAGCTTGTGAAATCTGGCACTCG) to obtain L-G-3-1.e;
[0204] after encoding, washing the solid respectively with 0.1 mol/L TEAA buffer solution (4100 L) and distilled water (4100 L), finally washing with 100 L distilled water; taking a part of the solid after the irrigation, adding 50 L of strong aqueous ammonia, and reacting for 1 hour at 55 C.; washing the obtained solid with 0.1 mol/L TEAA buffer solution and distilled water for 3 times; precipitating the filtrated solution by ethanol, freeze-drying for agarose electrophoresis test;
[0205] adding piperidine (40 L) into L-G-2-2-1.e (10 mg) and reacting with stirring for 6 hours at 25 C.30 C.; filtrating the solution to remove the solvent and obtaining a filtrated cake; washing the filtrated cake respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times to obtain a solid; adding R.sup.k (R.sup.k is selected from synthetic building block containing carboxylic acids, aldehydes or isocyanates), O-(7-azbenzotriazole-1-yl)-N, N,N,N-tetramethyluronium hexafluorophosphate (6.1 mg, manufacturer: Alfa), DIEA (20 L) as well as DMF (60 L) into the solid; reacting with stirring for 16 hours at 25 C.30 C.; filtrating the solution to remove the solvent and obtaining a filtrated cake; washing the filtrated cake respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times to obtain L-G-3-1-1.e;
[0206] referencing to the DNA encoded method disclosed in the patent named Synthesis and Screening Method and Kit for Lead Compound (application number: CN201210555548.3), L-G-3-1-1.e is performed DNA encoding in solid-phase condition (single strand DNA sequence is GGAGCTTGTGAAATCTGGCACTCG) to obtain L-G-3-1.e; after encoding, washing the solid respectively with 0.1 mol/L TEAA buffer solution (4100 L) and distilled water (4100 L), finally washing with 100 L distilled water; taking a part of the solid after the irrigation, adding 50 L of strong aqueous ammonia, and reacting for 1 hour at 55 C.; washing the obtained solid with 0.1 mol/L TEAA buffer solution and distilled water for 3 times; precipitating the filtrated solution by ethanol, and freeze-drying for agarose electrophoresis test; and
[0207] (7) synthesis of L-D-T-5 compound library
[0208] taking part of L-G-3-1.e (2.0 mg), adding 40 L of aqueous ammonia, and heating the solution to 55 C. for 1 hour to remove the solid carrier. Washing the solid respectively with distilled water and 0.1 mol/L TEAA buffer solution for several times to obtain filtrated solution; concentrating the filtrated solution, and adding appropriate ethanol, precipitating at 20 C. and centrifugating to obtain a solid; washing the solid with 85% ethanol to obtain DNA encode compound library L-D-T-5 is finally.
Embodiment 6
[0209] (1) L-G-1 is obtained according to the preparation method for L-G-1 in embodiment 1;
[0210] (2) L-2 is obtained according to the preparation method for L-2 in embodiment 1;
[0211] (3) L-G-2 is obtained according to the preparation method for L-G-2 in embodiment 1;
[0212] (4) L-G-2-1 is obtained according to the preparation method for L-G-2-1 in embodiment 1; and
[0213] (5) the preparation of L-G-2-2.f
[0214] adding S-1, S-2 and S-3 as well as DMF into L-G-2-1, and reacting with stirring for 16 hours at 25 C.30 C.; filtrating the solution to remove the solvent and obtaining a filtrated cake; washing the filtrated cake respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times to obtain L-G-2-2.f.
[0215] Specifically,
[0216] adding S-1 (FMOC-L-phenylalanine, manufacturer: Alfa, 15.1 mg), S-2 (cyclohexylisocynide, manufacturer: Alfa, 4.8 mg) and S-3 (cyclopentylaldehyde, manufacturer: Alfa, 4.1 mg) as well as DMF (100 L) into L-G-2-1 (20 mg), and reacting with stirring for 16 hours at 25 C.30 C.; filtrating the solution to remove the solvent and obtaining the filtrated cake; washing the filtrated cake respectively with distilled water and 0.1M TEAA buffer solution for 3 times to obtain L-G-2-2.f;
[0217] taking part of L-G-2-2-1.d (2.0 mg), adding 150 L of strong aqueous ammonia, and heating the solution to 55 C. for 1 hour to remove the solid carrier. Removing the solvent by reducing the pressure after filtration process, washing the solid respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times. Adding 250 L ethanol and 100 L acetic acid-sodium acetate buffer solution (pH=4.7, 0.5 mol/L) to the solid, precipitating at 20 C. to obtain DNA in L-G-2-2.f, the amount of substance of DNA in L-G-2-2.f is 35 nmol by using OD ultraviolet absorption quantitation, the productivity is 70%.
[0218] MS(ESI) m/z 9241.9 (M+1).sup.+.
[0219] (6) The preparation of L-G-3-1.f
[0220] referencing to the DNA encoded method disclosed in the patent named Synthesis and Screening Method and Kit for Lead Compound (application number: CN201210555548.3), L-G-2-2.f is performed DNA encoding in solid-phase condition (single strand DNA sequence is GGAGCTTGTGAAATCTGGCACTCG) to obtain L-G-2-2-1.f; after encoding, washing the solid respectively with 0.1 mol/L TEAA buffer solution (4100 L) and distilled water (4100 L), finally washing with 100 L distilled water; taking part of the solid after washing, adding 50 L of strong aqueous ammonia, and reacting for 1 hour at 55 C.; washing the obtained solid with 0.1 mol/L TEAA buffer solution and distilled water for 3 times; precipitating the filtrated solution by ethanol, and freeze-drying for agarose electrophoresis test;
[0221] taking part of L-G-2-2-1.f (10 mg), adding piperidine (40 L), and reacting with stirring for 6 hours at 25 C.30 C.; filtrating the solution to remove the solvent and obtaining a filtrated cake; washing the filtrated cake respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times to obtain the solid; add R.sup.k (R.sup.k is selected from synthetic building block containing carboxylic acids, aldehydes or isocyanates), O-(7-azbenzotriazole-1-yl)-N, N,N,N-tetramethyluronium hexafluorophosphate (6.1 mg, manufacturer: Alfa), DIEA (20 L) as well as DMF (60 L) into the solid; reacting with stirring for 16 hours at 25 C.30 C.; filtrating the solution to remove the solvent and obtaining a filtrated cake; washing the filtrated cake respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times to obtain L-G-3-1-1.f;
[0222] referencing to the DNA encoded method disclosed in the patent named Synthesis and Screening Method and Kit for Lead Compound (application number: CN201210555548.3), L-G-3-1-1.f is performed DNA encoding in solid-phase condition (single strand DNA sequence is GGAGCTTGTGAAATCTGGCACTCG) to obtain L-G-3-1.f; after encoding, washing the solid respectively with 0.1 mol/L TEAA buffer solution (4100 L) and distilled water (4100 L), finally washing with 100 L distilled water; taking part of the solid after washing, adding 50 L of strong aqueous ammonia, and reacting for 1 hour at 55 C.; washing the obtained solid with 0.1 mol/L TEAA buffer solution and distilled water for 3 times; precipitating the filtrated solution by ethanol, freeze-drying for agarose electrophoresis test; and
[0223] (7) synthesis of L-D-T-6 compound library
[0224] taking part of L-G-3-1.f (2.0 mg), adding 40 L of aqueous ammonia, and heating the solution to 55 C. for 1 hour to remove the solid carrier. Washing the solid respectively with distilled water and 0.1 mol/L TEAA buffer solution for several times to obtain a filtrated solution; concentrating the filtrated solution, and adding appropriate amount of ethanol, precipitating at 20 C. and centrifugating to obtain a solid; washing the solid with 85% ethanol to obtain DNA encode compound library L-D-T-6.
[0225] The present invention can realize synthesis of DNA coding compound in organic solvent system. It can make the unrealized or relatively low synthesis of chemical reaction in the DNA coding compound library in the traditional liquid phase condition successfully reacted, and further enlarge reaction types of coding compound library and the space of diversity of the encoded compound library. The enlarged reaction types include organic catalyzed aldol reactions, alkenes metathesis reactions etc. In the traditional liquid phase DNA encoded compound library the efficiencies are rather low, while the present invention significantly increase the synthesis efficiencies of these reactions.
[0226] Compared with the existed method for liquid phase synthesis of DNA encoded compound library, the synthesis technology with CPG carrying DNA encoded compound in the present invention, performs the after-reaction purification process through several simple filtration and washing procedures. It simplifies the after-process of chemical synthesis and of DNA encode reactions, and simplifies the processes of separation and purification. It also shortens the cycle of synthesis of compound library at more than 50% and saves the cost enormously. Moreover, it significantly enhances the purified quality, that is, enhances the purity of final products and enhance the DNA encoding efficiency as well as unicity.
[0227] The method for synthesis of DNA encoded compound library in the present invention, is able to remove the excessive DNA, decreases the interference which excessive DNA would make on the following screening process during the DNA encoded compound library synthesis and also significantly increases the targeting ability and the accuracy on the screening of new pharmaceuticals.
[0228] The linker molecules in the present invention, connect the CPG, DNA and small molecules at a suitable distance. Thus the forces between molecules can be formed and also be broken under moderate condition, which makes a variety of reactions happens with the co-existence of DNA and CPG.