Yeast strains engineered to produce ethanol from acetic acid and glycerol
09988649 ยท 2018-06-05
Assignee
Inventors
- Johannes Adrianus Maria De Bont (Echt, NL)
- Aloysius Wilhelmus Rudolphus Hubertus TEUNISSEN (Echt, NL)
- Paul Klaassen (Echt, NL)
- Wouter Willem Antonius Hartman (Echt, NL)
- Shimaira Van Beusekom (Echt, NL)
Cpc classification
Y02E50/10
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12P7/08
CHEMISTRY; METALLURGY
C12N1/22
CHEMISTRY; METALLURGY
C12N9/0008
CHEMISTRY; METALLURGY
International classification
C12N1/00
CHEMISTRY; METALLURGY
C12N1/22
CHEMISTRY; METALLURGY
C12P7/08
CHEMISTRY; METALLURGY
Abstract
The present invention relates to processes for producing ethanol from lignocellulosic hydrolysates comprising hexoses, pentoses and acetic acid, whereby genetically modified yeast cells are use that comprise an exogenous gene encoding an acetaldehyde dehydrogenase and a bacterial gene encoding an enzyme with NAD.sup.+-linked glycerol dehydrogenase activity. The process is further characterized in that glycerol is present in or fed into the culture medium, whereby the modified yeast cell ferments the hexoses, pentoses, acetic acid and glycerol to ethanol. The invention further relates to yeast cells for use in such processes. The yeast cells advantageously comprise genetic modifications that improve glycerol utilization such as modifications that increase one or more of dihydroxyacetone kinase activity and transport of glycerol into the cell. The yeast cell further preferably comprises a functional exogenous xylose isomerase gene and/or functional exogenous genes which confer to the cell the ability to convert L-arabinose into D-xylulose 5-phosphate and they may comprise a genetic modification that increase acetyl-CoA synthetase activity.
Claims
1. A Saccharomyces cell which has been genetically modified to comprise: (a) an exogenous gene encoding an enzyme with acetaldehyde dehydrogenase activity, that confers on the cell the ability to convert acetic acid into ethanol; and (b) a bacterial gene encoding an enzyme with NAD.sup.+-linked glycerol dehydrogenase activity (EC 1.1.1.6), wherein the Saccharomyces cell does not comprise a genetic modification that reduces specific NAD.sup.+-dependent formate dehydrogenase activity in the cell, wherein the exogenous gene encoding the enzyme with acetaldehyde dehydrogenase activity comprises a nucleotide sequence encoding the amino acid sequence of: (i) SEQ ID NO:1, and/or (ii) SEQ ID NO:3, and/or (iii) SEQ ID NO:5; and/or a variant thereof, wherein the variant of (i), (ii), and/or (iii) is an enzyme in Tables 1, 2, and 3, respectively is 85% identical to SEQ ID NO:1, and/or SEQ ID NO:2, and/or (iii) SEQ ID NO:5, and wherein the bacterial gene encoding the enzyme with NAD.sup.+-linked glycerol dehydrogenase activity comprises a nucleotide sequence encoding an amino acid sequence with at least 90% amino acid sequence identity to SEQ ID NO:7.
2. The Saccharomyces cell according to claim 1, wherein the cell further comprises a genetic modification that reduces specific NAD.sup.+-dependent glycerol 3-phosphate dehydrogenase activity in the cell.
3. The Saccharomyces cell according to claim 2, wherein the genetic modification that reduces specific NAD.sup.+-dependent glycerol 3-phosphate dehydrogenase activity in the cell is one or more genetic modifications that reduce the expression of an endogenous NAD.sub.+-dependent glycerol 3-phosphate dehydrogenase and/or inactivates a gene encoding an endogenous NAD.sub.+-dependent glycerol 3-phosphate dehydrogenase.
4. The Saccharomyces cell according to claim 3, wherein the NAD+-dependent glycerol 3-phosphate dehydrogenase is at least 90% identical to SEQ ID NO: 15 or 16.
5. A process for producing ethanol using the Saccharomyces cell of claim 1, comprising the step of fermenting a medium with a Saccharomyces cell, wherein the Saccharomyces cell has been genetically modified to comprise (a) an exogenous gene encoding an enzyme with acetaldehyde dehydrogenase activity, that confers on the cell the ability to convert acetic acid into ethanol, and (b) a bacterial gene encoding an enzyme with NAD.sup.+-linked glycerol dehydrogenase activity (EC 1.1.1.6), wherein the Saccharomyces cell does not comprise a genetic modification that reduces specific NAD.sup.+-dependent formate dehydrogenase activity in the cell, wherein the exogenous gene encoding the enzyme with acetaldehyde dehydrogenase activity comprises a nucleotide sequence encoding the amino acid sequence of: (i) SEQ ID NO:1, and/or (ii) SEQ ID NO:2, and/or (iii) SEQ ID NO:5; and/or a variant thereof, wherein the variant of (i), (ii), and/or (iii) is an enzyme in Tables 1, 2, and 3, respectively is 85% identical to SEQ ID NO:1, and/or SEQ ID NO:2, and/or (iii) SEQ ID NO:5, and wherein the bacterial gene encoding the enzyme with NAD+-linked glycerol dehydrogenase activity comprises a nucleotide sequence encoding an amino acid sequence with at least 90% amino acid sequence identity to SEQ ID NO:7; and (i) a source of at least one of hexose and a pentose; (ii) a source of acetic acid; and (iii) a source of glycerol, the Saccharomyces cell ferments acetic acid, glycerol and at least one of the hexose and the pentose to ethanol, and the process optionally comprises a step of recovering the ethanol.
6. The process according to claim 5, wherein the Saccharomyces cell further comprises a genetic modification that increases the specific activity of dihydroxyacetone kinase, wherein the modification is overexpression of a nucleotide sequence encoding a dihydroxyacetone kinase, wherein the nucleotide sequence encoding the dihydroxyacetone kinase comprises a nucleotide sequence encoding an amino acid sequence with at least 90% amino acid sequence identity to SEQ ID NO:8, or SEQ ID NO:9, or SEQ ID NO:25.
7. The process according to claim 5, wherein the Saccharomyces cell further comprises a genetic modification that increases at least one of: (i) specific acetyl-CoA synthetase activity; and (ii) transport of glycerol into the cell.
8. The process according to claim 7, wherein (i) the nucleotide sequence encoding the acetyl-CoA synthetase encodes (A) an acetyl-CoA synthetase with a higher maximum rate than acetyl-CoA synthetase encoded by S. cerevisiae ACS1 gene, or (B) an acetyl-CoA synthetase with a higher affinity for acetate than the affinity of acetyl-CoA synthetase encoded by S. cerevisiae ACS2 gene, and (ii) the genetic modification that increases transport of glycerol into the cell's overexpression of a nucleotide sequence encoding (A) a glycerol uptake protein and/or (B) a glycerol channel.
9. The process according to claim 7, wherein the genetic modification that increases the specific acetyl-CoA synthetase activity does so under anaerobic conditions.
10. The process according to claim 5, wherein the Saccharomyces cell comprises at least one of: (i) a functional exogenous xylose isomerase gene, that confers on the cell the ability to isomerise xylose into xylulose; and (ii) functional exogenous genes encoding an
11. The process according to claim 5, wherein the Saccharomyces cell is a member of a species selected from the group consisting of S. cerevisiae, S. exiguus, and S. bayanus.
12. The process according to claim 5, wherein the medium contains or is fed with a lignocellulosic hydrolysate.
13. The process according to claim 5, wherein the Saccharomyces cell ferments under anaerobic conditions.
14. The process according to claim 7, wherein specific acetyl-CoA synthetase activity is modified by overexpression of a nucleotide sequence encoding an acetyl-CoA synthetase enzyme.
15. The process according to claim 8, wherein (A) the nucleotide sequence encoding the glycerol uptake protein comprises a nucleotide sequence encoding an amino acid sequence with at least 90% amino acid sequence identity to at least one of SEQ ID NO:10 and SEQ ID NO:11, and (B) the nucleotide sequence encoding the glycerol channel comprises a nucleotide sequence encoding an amino acid sequence with at least 90% amino acid sequence identity to the amino acid sequence between residues 250 and 530 of SEQ ID NO:12.
16. The process according to claim 10, wherein the Saccharomyces cell comprises at least one additional genetic modification that results in a characteristic selected from the group consisting of: (a) increased xylulose kinase specific activity; (b) increased flux of the pentose phosphate pathway; (c) reduced nonspecific aldose reductase specific activity; (d) increased transport of xylose and/or arabinose into the host cell; (e) decreased sensitivity to catabolite repression; (f) increased tolerance to ethanol, osmolarity or organic acids; and (g) reduced production of by-products.
Description
DESCRIPTION OF THE FIGURES
(1)
(2)
EXAMPLES
1. Enzyme Activity Assays
(3) Cell extracts for activity assays were prepared from exponentially growing aerobic or anaerobic batch cultures and analysed for protein content as described by Abbot et al., (2009, Appl. Environ. Microbiol. 75: 2320-2325).
(4) NAD.sup.+-dependent acetaldehyde dehydrogenase (EC 1.2.1.10) activity was measured at 30? C. by monitoring the oxidation of NADH at 340 mm. The reaction mixture (total volume 1 ml) contained 50 mM potassium phosphate buffer (pH 7.5), 0.15 mM NADH and cell extract. The reaction was started by addition of 0.5 mM acetyl-Coenzyme A.
(5) For glycerol 3-phosphate dehydrogenase (EC 1.1.1.8) activity determination, cell extracts were prepared as described above except that the phosphate buffer was replaced by triethanolamine buffer (10 mM, pH 5). Glycerol-3-phosphate dehydrogenase activities were assayed in cell extracts at 30? C. as described previously (Blomberg and Adler, 1989, J. Bacteriol. 171: 1087-1092.9). Reaction rates were proportional to the amounts of cell extract added.
(6) Acetyl-CoA synthase (EC 6.2.1.1) activity was measured as described by Frenkel and Kitchens (1977, J. Biol. Chem. 252: 504-507) which is a modification of the method of Webster (Webster, 1969, Methods Enzymol. 13: 375-381). NADH formation measured is spectrophotometrically when the acetyl-CoA produced is coupled with citrate synthase and malate dehydrogenase reactions. The assay system contained 100 mM Tris-Cl (pH 7.6), 10 mM MgCl.sub.2, 6 mM ATP, 5 mM malate, 1 mM NAD.sup.+, 0.1 mM NADH, 2.5 mM dithiothreitol or 2-mercaptoethanol, 0.2 mM coenzyme A, 25 ng citrate synthase (80 units/mg), 20 ng malate dehydrogenase (1000 units/mg), and 10 mM acetate and the reaction was measured rate was measured at 340 nm and calculated from the extinction coefficient of NADH (6.22?10.sup.6 cm.sup.2/mol).
(7) The activity of glycerol dehydrogenase and dihydroxyacetone kinase are measured at 30? C. in cell extracts, essentially as previously described (Gonzalez et al., 2008, Metab. Eng. 10, 234-245). Enzyme activities of glycerol dehydrogenase and dihydroxyacetone kinase are reported as ?moles of substrate/min/mg of cell protein.
2. Strain Construction
(8) All modifications start with the xylose and arabinose fermenting strain RN1008 his.sup.?. RN1008 his.sup.?, also referred to herein as RN1041, is a CEN.PK-based arabinose and xylose fermenting strain) with the genotype:
(9) Mat a, ura3-52, leu2-112, his3::loxP, gre3::loxP, loxP-Ptpi::TAL1, loxP-Ptpi::RKI1, loxP-Ptpi-TKL1, loxP-Ptpi-RPE1, delta::-LEU2, delta::Padh1XKS1Tcyc1-URA3-Ptpi-xylA-Tcyc1, delta::LEU2-AAAaraABD.
(10) Mat a=mating type a ura3-52, leu2-112, his3::loxP mutations in the genes ura3, leu2 and his3, the ura3 is complemented by the xylA-XKS overexpression construct, leu2 is complemented by the AraABD overexpression construct. his3 could be used for selection of additional plasmids, RN1041 needs histidine in the medium for growth. gre3::loxP=deletion of the gre3 gene encoding xylose reductase, loxP site is left after marker removal. loxP-Ptpi . . . =overexpression of het pentose phosphate pathway, loxP site upstream of constitutive promoter is left after marker removal delta::=integration of the construct after recombination on the long terminal repeats of the Ty1 reterotransposon. AAAaraABD=codon optimized arthrobacter aurescens araA, araB and araD genes (see WO2009/011591)
Deletion Constructs for GPD1 and GPD2
(11) The deletion of GPD1 in RN1041 produces strain RN1197. The deletion of GPD2 in RN1041 produces strain RN1198. In this strain subsequently gpd1 is deleted to produce strain RN1199. In these strains plasmids were introduced for overexpression of the ACS genes (RN1200 to RN1207, Table 4) and further genes as indicated in Table 4.
(12) gpd1::hphMX
(13) Primers gpd1uf, gpd1ur, gpd1df and gpd1dr are used for amplification of genomic sequences fragments upstream and downstream of the GPD1 gene for its inactivation. Both the up- and downstream GPD1 fragments are cloned into a topo blunt vector (InVitrogen) to yield pGPD1up and pGPD1down, respectively.
(14) TABLE-US-00004 (SEQIDNO:41) gpd1uf:AAGCTTGGTACCCGCCTTGCTTCTCTCCCC (SEQIDNO:42) gpd1ur:TCTAGACCAGCATTCAAGTGGCCGGA (SEQIDNO:43) gpd1df:CGTACGAGTTGTTGAATGGCCAATCCGCT (SEQIDNO:44) gpd1dr:CCATGGTACCGAGTGGTGTTGTAACCACCCT (SEQIDNO:45) gpd1cf:ACCAATACGTAAACGGGGCG (SEQIDNO:46) gpd1cr:AATACACCCATACATACGGACGC
(15) Plasmid pRN593 (SEQ ID NO: 40) is constructed by ligation of the fragment cut with HindIII and XbaI from pGPD1up to the hphMX fragment cut with SpeI and BsrGI (plasmid collection C5YeastCompany) and the fragment cut with BsiWI and NcoI from pGPD1down into the HindIII and NcoI cut topo T/A vector (Invitrogen). Plasmid pRN593 is cut with KpnI to obtain deletion fragment for disrupting the genomic copy (SEQ ID NO: 17). The mixture of linear fragments is used for transformation of yeast. Transformants are selected for hygromycin resistance. Correct integration results in deletion of the GPD1 open reading frame. The integration is PCR verified with the primers gpd1cf and gpd1cr.
(16) gpd2::natMX
(17) Primers GPD2uf, GPD2ur, GPD2df and GPD2dr are used for amplification of genomic sequences fragments upstream and downstream of the GPD2 gene for its inactivation. A 407 bp upstream PCR fragment with an AflII site at the 3-end (derived from the GPD2 sequence) and a BglII site at the 5-end (for isolation of the deletion construct) is amplified using GPD2uf, GPD2ur and cloned in pCR2.1 (topo T/A, Invitrogen).
(18) TABLE-US-00005 (SEQIDNO:32) GPD2uf:GGTACCAGATCTTTTGCGGCGAGGTGCCG (SEQIDNO:33) GPD2ur:TCTAGACTTAAGGAATGTGTATCTTGTTAATCTTCTGACAGC
(19) A 417 bp downstream PCR fragment with a XhoI site at the 5-end and a BglII site at the 3-end is amplified using GPD2df and GPD2dr.
(20) TABLE-US-00006 (SEQIDNO:34) GPD2df:CTCGAGATAGTCTACAACAACGTCCGCA (SEQIDNO:35) GPD2dr:CCATGGAGATCTGCAGTGAAAAAGCTCGAAGAAACAGCT
(21) For the final construction the plasmid containing the upstream fragment is cut with AflII and Kpn, the downstream fragment is cut with XhoI en NcoI and the natMX marker (plasmid collection Royal Nedalco) is cut with AflII en XhoI and the fragments are ligated to produce plasmid pRN594 (SEQ ID NO: 36). pRN594 is cut with BglII prior to yeast transformation. Transformants are selected for nourseotricin resistance. Correct integration is verified by PCR.
(22) Cloning Method for Overexpression of the Saccharomyces cerevisiae ACS1 and ACS2 Genes
(23) The ACS1 open reading frame is PCR amplified with the primers acs1f and acs1r.
(24) TABLE-US-00007 acs1f: (SEQIDNO:47) TTAAGCTTAAAATGTCGCCCTCTGCCGT acs1r: (SEQIDNO:48) AAGCGCGCTACAACTTGACCGAATCAATTAGATGTCTAACAATGCCAGGG
(25) This PCR fragment is cut with the restriction enzymes HindIII and BssHII and ligated to the SalI and HindIII cut TEF1 promoter fragment (collection C5YeastCompany) and the BssHII and BsiWI cut ADH1 terminator fragment (collection C5YeastCompany). This combined fragment is PCRed with promoter and terminator specific primers and cloned into the topo Blunt vector (InVitrogen) to give pACS1.
(26) The ACS2 open reading frame is PCR amplified with the primers acs2f and acs2r.
(27) TABLE-US-00008 acs2f: (SEQIDNO:49) AACTGCAGAAAATGACAATCAAGGAACATAAAGTAGTTTATGAAGCTCA acs2r: (SEQIDNO:50) ACGTCGACTATTTCTTTTTTTGAGAGAAAAATTGGTTCTCTACAGCAGA
(28) This PCR fragment is cut with the restriction enzymes PstI and SalI and ligated to the SpeI and PstI cut PGK1 promoter fragment (collection C5YeastCompany) and the XhoI and BsiWI cut PGI1 terminator fragment (collection C5YeastCompany). This combined fragment is PCRed with promoter and terminator specific primers and cloned into the topo Blunt vector (InVitrogen) to give plasmid pACS2.
(29) The ACS1 overexpression construct is cut from pACS1 with the restriction enzymes SalI and BsiWI, the ACS2 overexpression construct is cut from pACS2 with the restriction enzymes SpeI and BsiWI, the KanMX marker is cut with BspEI and XbaI (plasmid collection C5YeastCompany). These fragments are ligated to the plasmid pRS306+2mu ORI (plasmid collection C5Yeast company) cut with BspEI and XhoI to give the final plasmid pRN753 (SEQ ID NO: 51). This plasmid is used to transform yeast strains as indicated in Table 4 and transformants are selected on G418 resistance. Overexpression is verified by qPCR. An alternative plasmid that may be used for overexpression of ACS1 and ACS2 is pRN500 (SEQ ID NO: 20).
(30) Expression of E. coli adhE, E. histolytica ADH2 or E. coli mphF
(31) The PGK1 promoter (SpeI-PstI) and the ADH1 terminator sequence (AflII-NotI) are added to the codon optimized synthetic fragments and cloned into pRS303 with 2? ori cut with SpeI and NotI and the expression construct is cloned in this vector. Expression is qPRC verified. Codon optimized sequences for E. coli mphF (SEQ ID NO: 2), E. coli adhE (SEQ ID NO: 4) and E. histolytica ADH2 (SEQ ID NO: 6) are as indicated in the sequence listing.
(32) For expression of the E. coli mhpF gene, a yeast PGK1 promoter fragment (SpeI-PstI) and an ADH1 terminator fragment (AflII-NotI) (both from the Nedalco plasmid collection) were ligated onto the codon-optimized synthetic fragment encoding the E. coli mhpF (SEQ ID NO: 2). pRS 303 with 2? ori (=pRN347, Royal Nedalco plasmid collection) was cut with SpeI and NotI and the mhpF expression construct was cloned into this vector to produce pRN558 (SEQ ID NO: 29).
(33) For expression of the E. coli adhE gene, a codon optimized synthetic fragment encoding the E. coli adhE (SEQ ID NO: 4) is cut with XbaI and AflII and ligated into pRN558 cut with XbaI and AflII (replacing the E. coli mhpF gene in pRN558) to produce pRN595 (SEQ ID NO: 30).
(34) For expression of the Entamoebe histolytica adh2, a codon optimized synthetic fragment encoding the E. histolytica adh2 (SEQ ID NO: 6) is cut with XbaI and AflII and ligated into pRN558 cut with XbaI and AflII (replacing the E. coli mhpF gene in pRN558) to produce pRN596 (SEQ ID NO: 31). pRN595 is used for further construction of pRN957 and pRN977 (see below). It is clear that pRN558 and pRN596 can be used in the same way, thereby replacing expression of E. coli adhE with E. coli mhpF or E. histolytica adh2, respectively.
(35) Expression of E. coli gldA
(36) The construct for expression in yeast of the E. coli gldA was made by ligating a yeast ACT1 promoter fragment (cut with the restriction enzymes SpeI and PstI), a synthetic ORF (SEQ ID NO: 21), encoding the E. coli gldA, (cut with PstI en BssHII) and a yeast CYC1 terminator fragment (cut with BssHII and BsiWI) together into pCRII blunt (Invitrogen) to yield pRNgldA (SEQ ID NO: 28).
(37) DAK1 Overexpression
(38) PCR is performed on genomic DNA of S. cerevisiae with primers introducing a XbaI site 5 of the ATG and a SalI site 3 of the TAA to produce the fragment of SEQ ID NO: 22. A DNA fragment comprising the S. cerevisiae TPI1 promoter is ligated upstream of the DAK1 ORF and DNA fragment comprising the S. cerevisiae PGI1 terminator fragment is ligated downstream of the DAK1 ORF to produce pRNDAK (SEQ ID NO: 38).
(39) Expression of C. freundii dhaK
(40) The construct for expression in yeast of the Citrobacter freundii dhaK was made by ligating the yeast TPI1 promoter fragment (cut with the restriction enzymes XhoI and XbaI), a synthetic ORF (SEQ ID NO: 26), encoding the C. freundii dhaK, (cut with XbaI and SalI) and a yeast PGI1 terminator fragment (cut with XhoI and BsiWI) together into pCRII blunt (Invitrogen) to yield pRNdhaK (SEQ ID NO: 27).
(41) GUP1 Overexpression
(42) PCR is performed on genomic DNA of S. cerevisiae with primers introducing a HindIII site 5 of the ATG and a BamHI site 3 of the TAA to produce the fragment of SEQ ID NO: 23. A DNA fragment comprising the S. cerevisiae TDH3 promoter is ligated upstream of the GUP1 ORF and DNA fragment comprising the S. cerevisiae CYC1 terminator fragment is ligated downstream of the GUP1 ORF.
(43) FPS1 Overexpression
(44) PCR is performed on genomic DNA of S. cerevisiae with primers introducing a NsiI site 5 of the ATG and a BamHI site 3 of the TAA to produce the fragment of SEQ ID NO: 24. A DNA fragment comprising the S. cerevisiae ADH1 (medium) promoter is ligated upstream of the FSP1 ORF and DNA fragment comprising the S. cerevisiae CYC1 terminator fragment is ligated downstream of the FSP1 ORF.
(45) Construction of pRN347 and Yeast Strain RN1151
(46) pRN347 is constructed by cloning the 2? origin of replication (that was PCR-amplified from pYES2) in pRS303 (with HIS3 gene for complementation). RN1041 is transformed with the plasmid pRN347 to produce strain RN1151.
(47) Strains Expressing E. coli gldA and C. freundii dhaK or Overexpressing DAK1
(48) For construction of pRN957, the E. coli gldA expression construct is cut from plasmid pRNgldA with the restriction enzymes SpeI and BsiWI. The C. freundii dhaK expression construct is cut from plasmid pRNdhaK with the restriction enzymes BsiWI and XhoI. These fragments are ligated into plasmid pRN595 cut with the restriction enzymes SpeI and SalI to yield pRN957 (SEQ ID NO: 37).
(49) For construction of pRN977, the E. coli gldA expression construct is cut from plasmid pRNgldA with the restriction enzymes SpeI and BsiWI. The DAK1 expression construct is cut from the plasmid pRNDAK with the restriction enzymes BsiWI and XhoI. These fragments are ligated to plasmid pRN595 cut with the restriction enzymes SpeI and SalI to yield pRN977 (SEQ ID NO: 39).
(50) Plasmids pRN957 and pRN977 are used to transform RN1041, RN1197, RN1198 and RN1199 to yield yeast strains as indicated in Table 4.
(51) TABLE-US-00009 TABLES 4A and B Overview of constructed strains Table 4A ACS1 ACS2 GPD1 GPD2 adhE DAK1 Cf dhaK Ec gldA Strain marker kanMX kanMX hphMX natMX HIS3 HIS3 HIS3 HIS3 HIS3 RN1041 wt wt wt wt absent wt absent absent del RN1151 wt wt wt wt absent wt absent absent wt RN1197 wt wt del wt absent wt absent absent wt RN1198 wt wt wt del absent wt absent absent wt RN1199 wt wt del del absent wt absent absent wt RN1200 up up wt wt expression up absent expression RN1201 up up wt wt expression wt expression expression RN1202 up up del wt expression up absent expression RN1203 up up del wt expression wt expression expression RN1204 up up wt del expression up absent expression RN1205 up up wt del expression wt expression expression RN1206 up up del del expression up absent expression RN1207 up up del del expression wt expression expression Table 4B ACS1/2 gpd1? gpd2? adhE, gldA, DAK1 adhE, gldA, dhaK HIS3 RN1041 RN1151 pRN347 RN1197 pRN593 pRN347 RN1198 pRN347 RN1199 pRN593 pRN594 pRN347 RN1200 pRN753 pRN957 RN1201 pRN753 pRN977 RN1202 pRN753 pRN593 pRN957 RN1203 pRN753 pRN593 pRN977 RN1204 pRN753 pRN594 pRN957 RN1205 pRN753 pRN594 pRN977 RN1206 pRN753 pRN593 pRN594 pRN957 RN1207 pRN753 pRN593 pRN594 pRN977
3. Anoxic Fermentations in Sterile Yeast Extract Peptone Medium with Constructed Strains in the Presence and Absence of Glycerol and or Acetic Acid
(52) The proof of principle of concomitant reduction of acetic acid and oxidation of glycerol was obtained by using a medium containing 1% yeast extract and 1% peptone. Experiments were run in chemostat culture (1 liter working volume) at D=0.05 h.sup.?1 and the pH was kept at 5.5 by automatic addition of either KOH or H.sub.2SO.sub.4. Glucose (50 g/l) and xylose (50 g/l) were added as carbon and energy source to the yeast extract peptone medium. For these experiments demonstrating the proof of principle, no arabinose was included. Where relevant, acetic acid was added to the yeast extract peptone medium at 4 g/l and glycerol at 10 g/l. The temperature was kept at 32? C.
(53) Precultures of strains are prepared by inoculating a frozen glycerol stock culture of the yeast in an YP (Yeast extract at 1% w/v and Peptone at 1% w/v) medium with addition of each of the sugars glucose and xylose (each at 1% w/v) at 32? C. and pH 5.5. After 24 h incubation under oxic conditions in shake flasks, 50 ml of this culture is used to inoculate the chemostat cultures.
(54) At steady state of the fermentations (5 volume changes), a sample was taken for analysis of sugar (glucose and xylose) consumption, consumption of acetic acid, and metabolite (ethanol and glycerol). Ethanol, glycerol and acetic acid concentrations are monitored by HPLC analysis. To determine the sugar consumption, glucose and xylose are determined by HPAEC (Dionex) analysis.
(55) Strain RN1151 is not able to reach a steady state situation in the medium containing 4 g/l acetic acid either in the presence or absence of glycerol. If no acetic acid is added to the medium, the organism at steady state consumed all glucose and xylose (less than 1 g/l remaining) No glycerol was consumed, but instead it was produced.
(56) Strains RN1200 and RN1201 are similarly tested on media with acetic acid and either with or without glycerol added. These strains perform distinctly different from strain RN1151. In the glycerol-containing medium the sugars glucose and xylose are consumed almost to completion (less than 1 g/l remaining) Acetic acid levels decreases to 0.5 g/l and the concentrations of glycerol at the end of the fermentation is 3 g/l in all three instances. The amounts of ethanol produced by strain RN1200 and RN1201 ranged between 43 and 47 g/l in various experiments. In the medium not containing glycerol, but containing 4 g/l acetic acid, no stable steady state was obtained. The strains cannot grow under these conditions. From these results we conclude that expression of the E. coli gldA and adhE genes in combination with upregulation of DAK1 or expression of C. freundii dhaK, has a profound effect on the performance of the strains. In the presence of glycerol, they are able to consume glycerol and acetic acid,
(57) Strains RN1202 to RN1207 are similar to strains RN1200 and RN1201 except for the fact that GPD1 and/or GPD2 genes have been deleted. In the medium containing 4 g/l acetic acid, the sugars glucose and xylose are consumed almost to completion (less than 1 g/l remaining) if glycerol is added to the medium as is the case for strains RN1200 and RN1201. If no glycerol is added, no steady state is obtained.
4. Anoxic Fermentations with the Constructed Strains in Acetic Acid Comprising Lignocellulosic Hydrolysates in the Presence or Absence of Glycerol
(58) The corn fiber hydrolysate contains: glucose (38 g/l), xylose (28 g/l), arabinose (12 g/l) and acetic acid (4 g/l). It had been prepared by treating corn fibers at 160 C and at pH 3.0 during 20 minutes, followed by enzymatic hydrolysis by cellulases and hemicellulases. Acetic acid was added to this hydrolysate resulting in a total concentration of acetic acid in the hydrolysate of 10 g/l. The pH of this hydrolysate enriched in acetic acid was restored to pH=4.5 by KOH addition. Yeast extract was added to this hydrolysate to reach a final concentration of 5 g/l. In all subsequent experiments, this enriched hydrolysate was employed. The pH during fermentations was kept at 6.5 by automatic addition of either KOH or H.sub.2SO.sub.4.
(59) Precultures of strains are prepared by inoculating a frozen glycerol stock culture of the yeast in an YP (Yeast extract at 1% w/v and Peptone at 1% w/v) medium with addition of each of the sugars glucose, xylose and arabinose (each at 1% w/v) at 32? C. and pH 5.5. After 24 h incubation under oxic conditions in shake flasks, 50 ml of this culture is used to inoculate the fermenter cultures. Fermentations are performed in a fed-batch fermentation setup. Hydrolysate (either with or without glycerol added at 50 g/l) is pumped into the fermenter. If no glycerol was added, then 40 ml of water was added. During the first 6 hours, the flow rate for hydrolysate is set at a rate of 5 ml per hour. During the next 6 hours, the flow rate is set at 10 ml per hour. Subsequently, for another 43 hours, the flow rate is set at 20 ml per hour. The total volume at the end of the fermentation reaches 1000 ml. These anoxic fed-batch fermentations are performed at about pH=4.5 with gentle stirring at 100 rpm. The temperature during the fermentations is set at 32? C. To minimize infection, the hydrolysates are heated for 10 min at 105? C. prior to fermentations and the antibiotic kanamycine with at final concentration of 50 ?g/ml is added.
(60) At the end of the fermentations after 55 h, a sample was taken for analysis of sugar (glucose, xylose and arabinose) consumption, consumption of acetic acid, and metabolite (ethanol and glycerol). Ethanol, glycerol and acetic acid concentrations over time are monitored by HPLC analysis. To determine the sugar consumption, glucose, xylose, and arabinose are determined by HPAEC (Dionex) analysis.
(61) Strain RN1151 (=RN1041 complemented with HIS3) is tested on hydrolysate either with or without glycerol added. In both instances, the concentration of glucose at the end of the fermentation run (55 h) is 35 g/l whereas xylose and arabinose remain at their initial concentrations of 28 and 12 g/l, respectively. The amounts of ethanol produced are 2 g/l and acetic acid is present at 9.5 g/l. No glycerol consumption is detected in the glycerol-containing hydrolysate. The fermentation of the sugars halts during the course of the fed-batch operation because of increasing levels of acetic acid. Initially, no acetic acid is present in the fermenter, but while pumping the hydrolysate that contained toxic levels of acetic acid, the concentration quickly reaches toxic levels.
(62) Strains RN1200 and RN1201 are similarly tested on hydrolysate either with or without glycerol added. These strains perform distinctly different from strain RN1151. In the glycerol-containing hydrolysate, the sugars glucose, xylose and arabinose are consumed to completion. Acetic acid levels decreases to 2 g/l and the concentrations of glycerol at the end of the fermentation is 29.5 g/l in all three instances. The amounts of ethanol produced by strains RN1200 and RN1201 are 51.7, and 52.2 g/l, respectively. In the hydrolysate that did not contain glycerol, considerably less sugar is consumed. Xylose and arabinose levels are unchanged at 28 and 12 g/l, respectively. Glucose is consumed but to a limited extent only. At the end of the fermentation, the remaining concentration is 32 g/l in all three instances with ethanol reaching a concentration of 3 g/l. The concentration of acetic acid drops to 9.1 g/l at the end of the fermentation whereas some glycerol is produced (less than 0.5 g/l). From these results we conclude that expression of the E. coli gldA and adhE genes in combination with upregulation of DAK1 or expression of C. freundii dhaK, has a profound effect on the performance of the strains. In the presence of glycerol, they are able to consume glycerol and acetic acid, and produce additional ethanol (as compared to strain RN1151). In the absence of glycerol, the strains consume some acetic acid. But during the fermentation, the acetic acid level rises to toxic levels.
(63) Strains RN1202 to RN1207 are similar to strains RN1200 and RN1201 except for the fact that GPD1 and/or GPD2 genes have been deleted. In the glycerol-containing hydrolysate, the sugars glucose, xylose and arabinose are consumed to completion as was the case for strain RN1200. Acetic acid levels similarly decrease to approximately 2 g/l and the concentrations of glycerol at the end of the fermentation is 28 g/l in these three instances. The amounts of ethanol produced for strains RN1202, RN1203, RN1204, RN1205, RN1206 and RN1207 are 51.6, 52.9, 52.1, 52.5, 53.1 and 52.3 g/l, respectively. In the hydrolysate that not containing glycerol, considerably less sugar is consumed. Xylose and arabinose levels are unchanged at 28 and 12 g/l, respectively. Glucose is consumed but to a limited extent only. At the end of the fermentation, the remaining concentration in the non-glycerol hydrolysate for glucose is 31 g/l in all three instances with ethanol reaching a concentration of 3 g/l. The concentration of acetic acid drops to 9.1 g/l at the end of the fermentation whereas some glycerol is produced (less than 0.5 g/l). From these results we conclude that deleting GPD1 and/or GPD2 genes along with the other modifications in RN1202, RN1203, RN1204, RN1205, RN1206 and RN1207 result in strains that can perform the desired reactions.
(64) Materials and Methods for Examples 5-8
(65) General Molecular Biology Techniques
(66) Unless indicated otherwise, the methods used are standard biochemical techniques. Examples of suitable general methodology textbooks include Sambrook et al., Molecular Cloning, a Laboratory Manual (1989) and Ausubel et al., Current Protocols in Molecular Biology (1995), John Wiley & Sons, Inc.
(67) Media
(68) The media used in the experiments was either YEP-medium (10 g/l yeast extract, 20 g/l peptone) or solid YNB-medium (6.7 g/l yeast nitrogen base, 15 g/l agar), supplemented with sugars as indicated in the examples. For solid YEP medium, 15 g/l agar was added to the liquid medium prior to sterilization.
(69) In the AFM experiments, Mineral Medium was used. The composition of Mineral Medium has been described by Verduyn et al. (Yeast (1992), Volume 8, 501-517) and was supplemented with 2,325 g/l urea and sugars as indicated in the examples.
(70) Transformation of Yeast Cells
(71) Yeast transformation was done according to the method described by Schiestl and Gietz (Current Genetics (1989), Volume 16, 339-346).
(72) Colony PCR
(73) Genomic DNA was extracted from single yeast colonies for PCR according to the method described by L?oke et al. (BioTechniques (2011), Volume 50, 325-328).
(74) AFM Procedure
(75) The Alcohol Fermentation Monitor (AFM; Halotec, Veenendaal, the Netherlands) is a robust and user-friendly laboratory parallel bioreactor that allows for accurate comparisons of carbon conversion rates and yields for six simultaneous anaerobic fermentations.
(76) The starting culture of the AFM experiment contained 50 mg of yeast (dry weight). To determine this, a calibration curve was made of the RN1041 strain of biomass vs. OD700. This calibration curve was used in the experiment to determine the volume of cell culture needed for 50 mg of yeast (dry weight).
(77) Prior to the start of the AFM experiment, precultures were grown as indicated in the examples. For each strain the OD.sub.700 was measured and 50 mg of yeast (dry weight) was inoculated in 400 ml Mineral Medium (Verduyn et al. (Yeast (1992), Volume 8, 501-517), supplemented with 2,325 g/l urea and sugars as indicated in the examples.
(78) Glyceroldehydrogenase Activity Assay
(79) The method for the determination of the glyceroldehydrogenase activity assay was adopted from Lin and Magasanik (1960) J Biol Chem. 235:1820-1823.
(80) TABLE-US-00010 TABLE 5 Assay conditions 1.0M Carbonate/bicarbonate buffer pH 10 800 ?l 1.0M ammoniumsulfate 33 ?l 0.1M NAD+ 33 ?l Cell Free Extract 5 ?l
(81) Cell free extract was prepared by harvesting cells by centrifugation. Cells were harvested in the exponential phase. The cell pellet was washed once with 1 M carbonate/bicarbonate buffer (pH10) and a cell free extract was prepared in the same by the addition of glass beads and vortexing at maximum speed for 1 minute intervals until the cells were disrupted. The latter was checked microscopically.
(82) Shake Flask Experiments
(83) Anaerobic shake flask experiments were performed as indicated in the examples. Typical experiments use 100 ml Erlenmeyer flasks with 25 ml of medium. In order to ensure anaerobic conditions, the flask was closed with a waterlock.
(84) For each time point, a separate shake flask was inoculated, thereby omitting aeration during sampling.
(85) Strains
(86) The parent strain used in the experiments described in examples 5 through 8 is RN1041.
(87) RN1041 has been described in WO 2012067510. This strain has the following genotype:
(88) MAT a, ura3-52, leu2-112, his3::loxP, gre3::loxP, loxP-pTPI1::TAL1, loxP-pTPI1::RKI1, loxP-pTPI1-TKL1, loxP-pTPI1-RPE1, delta::pADH1-XKS1-tCYC1-LEU2, delta::URA3-pTPI1-xylA-tCYC1
(89) MAT a=mating type a
(90) ura3-52, leu2-112, HIS3::loxP mutations in the URA3, LEU2 and HIS3 genes respectively. The ura3-52 mutation is complemented by the URA3 gene on the xylA overexpression construct; the leu2-112 mutation is complemented by the LEU2 gene on the XKS1 overexpression construct. The deletion of the HIS3-gene causes a histidine auxotrophy. For this reason, RN1041 needs histidine in the medium for growth.
(91) gre3::loxP is a deletion of the GRE3 gene, encoding aldose reductase. The loxP site is left behind in the genome after marker removal.
(92) loxP-pTPI1 designates the overexpression of genes of, in the experiments described herein, the non-oxidative pentose phosphate pathway by replacement of the native promoter by the promoter of the TPI1 gene. The loxP site upstream of the strong, constitutive TPI1 promoter remains in the genome after marker removal (Kuyper et al, FEMS Yeast Research 5 (2005) 925-934).
(93) delta:: means chromosomal integration of the construct after recombination on the long terminal repeats of the Ty1 retrotransposon.
Example 5
Construction of Strains
(94) The following strains were constructed:
(95) TABLE-US-00011 TABLE 6 strains constructed RN1041 Parent strain (see above) RN1067 RN1041 gpd1::hphMX RN1068 RN1041 gpd2::natMX RN1069 RN1041 gpd1::hphMX gpd2::natMX RN1186 RN1041 + pRN977 RN1187 RN1067 + pRN977 RN1188 RN1068 + pRN977 RN1189 RN1069 + pRN977
(96) The deletion of the GPD1-gene (gpd1) and/or the GPD2-gene (gpd2) was brought about as described in Example 2.
(97) Strains RN1041, RN1067, RN1068 and RN1069 were transformed with plasmid pRN977. This plasmid contains the following features: the HIS3-gene for selection of transformants, the 2? origin of replication, the ampicillin resistance marker for selection in E. coli, the adhE-gene from E. coli under control of the PGK1-promoter and the ADH1-terminator, the DAK1-gene from S. cerevisiae under control of the TPI1-promoter and the PGI1-terminator and the E. coli gldA-gene, under control of the ACT1-promoter and CYC1-terminator. All promoters and terminators are from S. cerevisiae. The sequence of plasmid pRN977 is set out in SEQ ID NO: 39.
(98) After transformation of strains RN1041, RN1067, RN1068 and RN1069, single colony isolates were subjected to colony PCR analysis, in order to check the presence of plasmid pRN977. A representative colony of each transformation was selected for further experimentation. These selected strains are designated RN1186, RN1187, RN1188 and RN1189.
(99) Similarly, transformants were generated with the following specifications:
(100) TABLE-US-00012 TABLE 7 transformants RN1190 RN1041 + pRN957 RN1191 RN1067 + pRN957 RN1192 RN1068 + pRN957 RN1193 RN1069 + pRN957
(101) Plasmid pRN957 is similar to pRN977; however, the DAK1-gene from S. cerevisiae has been replaced by the dhaK-gene from Citrobacter freundii. The sequence of this plasmid, pRN957, is set out in SEQ ID NO: 37.
(102) As a control strain, strain RN1041 was transformed with plasmid pRN595 (RN1041+pRN595). This plasmid, pRN595, is similar to pRN977; however, it lacks the gldA and DAK1 genes. The sequence of plasmid pRN595 is set out in SEQ ID NO: 30.
Example 6
Shake Flask Experiments
(103) The performance of the constructed strains was tested in an anaerobic shake flask experiment. To this end, cells were pregrown in Mineral Medium (Verduyn) supplemented with glucose as carbon source. The cultures were incubated overnight in a rotary shaker at 280 rpm and 30? C.
(104) An aliquot of the cells was taken from the overnight cultures for inoculation of the anaerobic cultures. The amount of cells was such, that the anaerobic culture had an initial optical density at 600 nm of approximately 0.1.
(105) The carbon composition of the Mineral Medium: 2.5% glucose, 2.5% xylose, 1% glycerol and 2 g/l HAc. The pH was adjusted to pH 4.5. The shake flasks were closed with a waterlock in order to ensure anaerobic conditions. For each time point, a separate flask was inoculated.
(106) The results of net glycerol increase or decrease, after 94 hours of fermentation, and the HAc consumption, are indicated in the table below.
(107) TABLE-US-00013 TABLE 8 Glycerol and HAc consumption, and ethanol production values per strain Net Glycerol Increase (+) or HAc Decrease (?) consumption Ethanol titer Strain (in grams/liter) (in grams/liter) (in grams per liter) RN1041 +1.47 0.24 23.28 RN1186 ?1.20 0.99 25.32 RN1187 ?1.52 0.99 23.76 RN1188 ?0.80 0.97 25.01 RN1189 ?0.86 0.89 24.85 RN1190 ?0.47 0.71 24.38 RN1191 ?0.80 0.93 24.77 RN1192 +0.93 0.29 23.60 RN1193 ?0.84 0.92 24.93
(108) The strain indicated in table 8 as RN1041 was transformed with plasmid pRS323, a standard cloning vector containing the HIS3-gene and a 2? origin of replication, thereby complementing the histidine auxotrophy.
(109) The results show: RN1041 produces glycerol, which makes sense since both GPD1- and GPD2-genes are active and gldA and DAK1 are not overexpressed. Since adhE is not expressed in this strain, HAc consumption is low. Strains RN1186 through RN1189 show glycerol and HAc consumption, resulting in an increased ethanol titer as compared to RN1041. The experiments with the transformants RN1190, RN1191 and RN1193 show the same results, i.e. consumption of glycerol and acetate, however to a slightly lesser extent. Also here, the ethanol titer is higher as compared to RN1041. The result of strain RN1192 is an artefact, as later characterization showed that this strain had lost its plasmid pRN957.
(110) Overexpression of either a homologous or heterologous dihydroxyacetone kinase, in combination with overexpression of gldA and adhE, results in a simultaneous consumption of acetate and glycerol under anaerobic conditions.
Example 7
AFM Experiments
(111) The experiment described in Example 6 was repeated in a slightly different set-up, i.e. the AFM (Alcoholic Fermentation Monitor), which allows on-line carbondioxide determination, during the experiment.
(112) The strains tested were RN1041, RN1041+pRN595, RN1186, RN1187, RN1188 and RN1189. The strain RN1041 was transformed with plasmid pRS323, a standard cloning vector containing the HIS3-gene and a 2? origin of replication, thereby complementing the histidine auxotrophy.
(113) The strains were pre-cultured overnight in Mineral Medium with 2% glucose as carbon source, in a rotary shaker at 280 rpm and 30? C.
(114) The cells were harvested and an AFM experiment was started as described above.
(115) Samples were taken at regular intervals and sugars, ethanol, glycerol and HAc were determined by HPLC.
(116) Results are shown in the Table below.
(117) TABLE-US-00014 TABLE 9 Glycerol and HAc consumption and ethanol production values per strain at time = 112 hours. Net glycerol increase (?) or HAc decrease (+) (grams consumption Ethanol production Strain per litre) (grams per litre) (grams per litre) RN1041 +1.4 0.1 24.0 RN1041+ +1.1 0.4 24.1 pRN595 RN1186 ?0.3 0.7 25.5 RN1187 ?1.2 1.0 25.5 RN1188 ?0.3 0.7 25.2 RN1189 ?1.1 1.0 25.6
(118) The evolution of the glycerol and HAc levels in time are shown in
(119) Strains RN1041 and RN1041+pRN595 are showing a net glycerol production. Strains RN1186 and RN1188 are initially showing glycerol production; however, after approximately 24 to 32 hours, glycerol consumption commenced and continued until in the end a net glycerol consumption was observed.
(120) Strains RN1187 and RN1189 do not exhibit the initial glycerol production, as seen with RN1186 and RN1188. After 24 hours, glycerol consumption commences. The glycerol consumption is significantly higher in these strains as compared to RN1186 and RN1188. These results indicate that deletion of the GPD1-gene results in higher glycerol consumption than the deletion of the GPD2-gene.
(121) Strain RN1041+pRN595 is showing a higher HAc consumption than the reference strain RN1041. RN1186 and RN1188 are exhibiting a higher HAc consumption than RN1041+pRN595. This result indicated that glycerol consumption enhanced HAc consumption. This effect is even stronger in strains RN1187 and RN1189.
Example 8
Glycerol Dehydrogenase Activity Assay
(122) Cell free extracts (CFE) of strain RN1041 and RN1190 were prepared as described above. The glycerol dehydrogenase activity assay, adopted from the protocol of Lin and Magasanik (1960) J Biol Chem. 235:1820-1823, was performed. The results are shown in the Table below.
(123) TABLE-US-00015 TABLE 10 glycerol dehydrogenase activity assay Sample Cofactor Increase in A340/min RN1041 NAD+ 0.00 5 ?l CFE RN1190 NAD+ 0.02 5 ?l CFE RN1041 NAD+ 0.00 20 ?l CFE RN1190 NAD+ 0.09 20 ?l CFE RN1041 NADP+ 0.00 5 ?l CFE RN1190 NADP+ 0.00 5 ?l CFE RN1041 NADP+ 0.00 20 ?l CFE RN1190 NADP+ 0.00 20 ?l CFE
(124) The strain indicated in table 10 as RN1041 was transformed with plasmid pRS323, a standard cloning vector containing the HIS3-gene and a 2? origin of replication, thereby complementing the histidine auxotrophy.
(125) These results indicate that: a) E. coli gldA, expressed in RN1190, is NAD+-dependent, and b) that increase in the amount of CFE resulted in a proportional increase of the conversion rate of NAD+, and hence of glycerol into dihydroxyacetone.