Broad spectrum conjugate vaccine to prevent Klebsiella pneumoniae and Pseudomonas aeruginosa infections
09988426 ยท 2018-06-05
Assignee
Inventors
Cpc classification
A61K47/61
HUMAN NECESSITIES
A61K47/646
HUMAN NECESSITIES
International classification
Abstract
The present invention is drawn to conjugates and vaccine compositions comprising a Pseudomonas flagellin or an antigenic fragment or derivative thereof linked to one or more Klebsiella surface polysaccharide antigens, such as Klebsiella pneumoniae O polysaccharide from serovars O1, O2a, O2a,c, O3, O4, O5, O7, O8 and 012. The present invention also provides serovar reagent strains to produce the conjugates and vaccine compositions and methods of inducing an immune response with the conjugates and vaccine compositions.
Claims
1. An attenuated Klebsiella pneumoniae serovar strain, comprising an inactivating mutation in the guaBA locus and in the wza-wzc locus.
2. The strain of claim 1, wherein the serovar is selected from the group consisting of O1, O2a, O3, and O5.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) The skilled artisan will understand that the drawings, described below, are for illustration purposes only. The drawings are not intended to limit the scope of the present teachings in any way.
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
(32)
(33)
(34)
(35)
DETAILED DESCRIPTION OF THE INVENTION
(36) The present invention provides a conjugate vaccine for Klebsiella and Pseudomonas bacterial infections. These bacteria are known to cause a wide variety of infections in human subjects including but not limited to wound infections, burn infections, urinary tract infections, respiratory infections, central nervous system infections, abscess formations, cystic fibrosis, in-dwelling catheter infections, invasive bacteremia, and septic shock. There is a real need to develop vaccines which can protect against such bacterial infections. In some embodiments, the present invention relates to a vaccine product which encompasses a tetravalent formulation of four different OPS polysaccharide antigens from Klebsiella pneumoniae serovars conjugated with two different flagellin proteins from Pseudomonas aeruginosa. The vaccine can have efficacy for therapeutic use to mitigate against multiple drug resistant Pseudomonas and Klebsiella bacterial infections.
(37) At present, there is no simple and broadly effective vaccine which is effective against both Klebsiella and Pseudomonas. In some aspects, the invention described herein is a novel conjugate vaccine which comprises antigens from both bacterial types and can be manufactured in a large scalable fashion. Moreover, in some embodiments, the vaccine could also be used to generate therapeutic immunoglobulin (IVIG) preparations for passive protection against acute infections.
(38) Unless otherwise noted, technical terms are used according to conventional usage. Definitions of common terms in molecular biology may be found, for example, in Benjamin Lewin, Genes VII, published by Oxford University Press, 2000 (ISBN O19879276X); Kendrew et al. (eds.); The Encyclopedia of Molecular Biology, published by Blackwell Publishers, 1994 (ISBN 0632021829); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by Wiley, John & Sons, Inc., 1995 (ISBN 0471186341); and other similar technical references.
(39) For the purpose of interpreting this specification, the following definitions will apply and whenever appropriate, terms used in the singular will also include the plural and vice versa. In the event that any definition set forth below conflicts with the usage of that word in any other document, including any document incorporated herein by reference, the definition set forth below shall always control for purposes of interpreting this specification and its associated claims unless a contrary meaning is clearly intended (for example in the document where the term is originally used). The use of or means and/or unless stated otherwise. The use of a herein means one or more unless stated otherwise or where the use of one or more is clearly inappropriate. The use of comprise, comprises, comprising, include, includes, and including are interchangeable and not intended to be limiting. Furthermore, where the description of one or more embodiments uses the term comprising, those skilled in the art would understand that, in some specific instances, the embodiment or embodiments can be alternatively described using the language consisting essentially of and/or consisting of.
(40) Conjugate
(41) In one aspect, the present invention is directed to a conjugate comprising a Klebsiella surface polysaccharide antigen and a Pseudomonas flagellin protein or antigenic fragment or derivative thereof. In particular aspects of the invention, the surface polysaccharide antigen and the flagellin or antigenic fragment or derivative thereof are covalently linked optionally via a linker.
(42) The Klebsiella surface polysaccharide antigen can be any known Klebsiella surface polysaccharide antigen or a derivative or antigenic fragment thereof. In some embodiments, the surface polysaccharide is from one or more Klebsiella pneumoniae serovars. In some aspects of the invention, the Klebsiella surface polysaccharide antigen can be an O polysaccharide (OPS), a core oligosaccharide and an O polysaccharide (COPS), a capsule polysaccharide or combinations thereof.
(43) As used herein, OPS is a polysaccharide in which the lipid A moiety from lipopolysaccharide (LPS) and core oligosaccharide have been removed. In some embodiments of the invention, the surface polysaccharide antigen is an OPS. In some embodiments, the surface polysaccharide antigen is from epidemiologically relevant Klebsiella O serovars such as Klebsiella pneumoniae serovar O1, O2a, O3 and O5. In some embodiments, the surface polysaccharide antigen is an OPS derived from Klebsiella pneumoniae serovars O1, O2a, O2a,c, O3, O4, O5, O7, O8 and O12. In some embodiments, the surface polysaccharide antigen is an OPS derived from Klebsiella pneumoniae serovars O1, O2a, O3 and O5.
(44) The Pseudomonas flagellin can be any known Pseudomonas flagellin. As used herein, the term flagellin encompasses flagellin, fragments of flagellin and derivatives thereof. In particular aspects of the invention, the Pseudomonas flagellin is a Pseudomas aeruginosa (PA) flagellin. It is believed that all pathogenic Pseudomas aeruginosa express a single polar flagellum that extends from the cell surface to enable motility, that is comprised chiefly by polymers of either type A or B flagellin proteins. In some aspects of the invention, the Pseudomonas flagellin is a Pseudomas aeruginosa (PA) flagellin type A (FlaA) or an antigenic fragment or derivative thereof and/or a Pseudomas aeruginosa flagellin type B (FlaB) or an antigenic fragment or derivative thereof. In some embodiments, the Pseudomonas aeruginosa flagellin type A (FlaA) comprises SEQ ID NO:1 or an antigenic fragment or derivative thereof. In some embodiments, the Pseudomas aeruginosa flagellin type B (FlaB) comprises SEQ ID NO:2 or an antigenic fragment or derivative thereof. FliC and Fla (e.g., FlaA and FlaB) are used interchangeably throughout the specification but all refer to flagellin.
(45) In some embodiments, the conjugate comprises i) Pseudomonas aeruginosa flagellin type A (FlaA) or an antigenic fragment or derivative thereof and/or Pseudomas aeruginosa flagellin type B (FlaB) or an antigenic fragment or derivative thereof and ii) OPS from Klebsiella pneumoniae selected from Klebsiella pneumoniae serovars O1, O2a, O3, O5 or combinations thereof. In some embodiments, Pseudomonas flagellin or an antigenic fragment or derivative thereof can be covalently linked to one or more OPS from a single Klebsiella pneumoniae serovar type or may be linked to OPS from multiple Klebsiella pneumoniae serovar types.
(46) The ratio or stoichiometry of surface polysaccharide to flagellin is not limiting. In some embodiments, the Pseudomonas flagellin or an antigenic fragment or derivative thereof can be linked to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more surface polysaccharides, such as OPS, from the same Klebsiella or from mixtures of Klebsiella serovar types.
(47) In some embodiments, the Pseudomonas flagellin or an antigenic fragment or derivative thereof is linked to one to four OPS from the same serovar type. In another embodiment, the Pseudomonas flagellin or an antigenic fragment or derivative thereof is linked to one to four OPS from at least two different serovar types. In another embodiment, the flagellin or an antigenic fragment or derivative thereof is linked to one to four OPS, each from different serovar types. In some embodiments, the Klebsiella serovars comprise Klebsiella pneumoniae serovar O1, O2a, O3, and O5.
(48) In one embodiment, the conjugate comprises SEQ ID NO:1 or an antigenic fragment or derivative thereof and a surface polysaccharide from Klebsiella pneumoniae serovars O1, O2a, O3, O5 or combinations thereof. In some embodiments, the surface polysaccharide is OPS.
(49) In another embodiment, the conjugate comprises SEQ ID NO:2 or an antigenic fragment or derivative thereof and a surface polysaccharide from Klebsiella pneumoniae serovars O1, O2a, O3, O5 or combinations thereof. In some embodiments, the surface polysaccharide is OPS.
(50) Examples of fragments or derivatives of Pseudomonas flagellin can include fragments of the natural protein, including internal sequence fragments of the protein that retain their ability to elicit protective antibodies against a desired bacteria. The derivatives are also intended to include variants of the natural protein such as proteins having changes in amino acid sequence but that retain the ability to elicit an immunogenic, biological, or antigenic property as exhibited by the natural molecule.
(51) By derivative is further meant an amino acid sequence that is not identical to the wild type amino acid sequence, but rather contains at least one or more amino acid changes (deletion, substitutions, inversion, insertions, etc.) that do not essentially affect the immunogenicity or protective antibody responses induced by the modified protein as compared to a similar activity of the wild type amino acid sequence, when used for the desired purpose. In some embodiments, a derivative amino acid sequence contains at least 85-99% homology at the amino acid level to the specific amino acid sequence. In further embodiments, the derivative has at least 90% homology at the amino acid level. In other embodiments, the derivative has at least 95% homology.
(52) The flagellin of the invention may be a peptide encoding the native amino acid sequence or it may be a derivative or antigenic fragment of the native amino acid sequence.
(53) In some embodiments, the surface polysaccharide antigen of a Klebsiella is covalently linked to the Pseudomonas flagellin protein or an antigenic fragment or a derivative thereof either directly or with a linker. In some embodiments, the linker or linking chemical is selected from 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP), adipic acid dihydrazide, -aminohexanoic acid, chlorohexanol dimethyl acetal, D-glucuronolactone or p-nitrophenylethyl amine. In a particular embodiment, the linking chemical is CDAP.
(54) Compositions
(55) In some embodiments, the invention provides compositions comprising the conjugates of the invention. In some embodiments, the compositions are vaccine compositions which provide protective immunity against one or more Klebsiella and/or Pseudomonas pathogens and which comprise one or more of the above-mentioned conjugates. In some embodiments, effective amounts of one or more unconjugated Pseudomonas flagellin can be added to the compositions of the invention. In some embodiments, adding one or more unconjugated flagellin to compositions comprising one or more conjugates can enhance the immune response to the flagellin epitopes. In some embodiments, the one or more unconjugated Pseudomonas flagellin is selected from flagellin comprising SEQ ID NO:1, SEQ ID NO:2, antigenic fragments and derivatives thereof and combinations thereof.
(56) In some embodiments of the invention, the vaccine composition is a multivalent conjugate vaccine comprising one or more Pseudomonas flagellins linked to one or more Klebsiella surface polysaccharides, such as O polysaccharides (OPS). For example, the composition can be a multivalent conjugate vaccine comprising two different Pseudomonas flagellin proteins or antigenic fragments or derivatives thereof covalently linked to one or more Klebsiella O polysaccharides (OPS). In some embodiments, the multivalent conjugate vaccine comprises OPS antigens from one or more of Klebsiella pneumoniae serovars O1, O2a, O2a,c, O3, O4, O5, O7, O8 and O12. In some embodiments, the multivalent conjugate vaccine comprises four different OPS antigens from Klebsiella pneumoniae serovars O1, O2a, O3, and O5. In some embodiments, the Pseudomonas is Pseudomonas aeruginosa.
(57) In some embodiments, the composition comprises an effective amount of one or more conjugates comprising a Pseudomonas flagellin protein or an antigenic fragment or derivative thereof and a surface polysaccharide from Klebsiella. In one embodiment, the composition comprises a Pseudomas aeruginosa flagellin or an antigenic fragment or derivative thereof and an OPS from Klebsiella pneumoniae serovars O1, O2a, O3, O5 or combinations thereof.
(58) In some embodiments, the composition comprises a multivalent conjugate vaccine comprising one or more Pseudomas aeruginosa flagellin proteins selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2 and combinations thereof, or antigenic fragments or derivative thereof and one or more OPS from Klebsiella pneumoniae serovars O1, O2a, O3, O5 or combinations thereof.
(59) In some embodiments, the composition comprises: i) a conjugate comprising a Pseudomas aeruginosa flagellin protein according to SEQ ID NO:1 or an antigenic fragment or derivative thereof and one or more OPS from Klebsiella pneumoniae serovars O1, O2a, O3, O5 or combinations thereof; and ii) a conjugate comprising a Pseudomas aeruginosa flagellin protein according to SEQ ID NO:2 or an antigenic fragment or derivative thereof and one or more OPS from Klebsiella pneumoniae serovars O1, O2a, O3, O5 or combinations thereof.
(60) In some embodiments, the composition comprises: i) a conjugate comprising a Pseudomas aeruginosa flagellin protein according to SEQ ID NO:1 or an antigenic fragment or derivative thereof and one or more OPS from Klebsiella pneumoniae serovar O1; ii) a conjugate comprising a Pseudomas aeruginosa flagellin protein according to SEQ ID NO:1 or an antigenic fragment or derivative thereof and one or more OPS from Klebsiella pneumoniae serovar O2a; iii) a conjugate comprising a Pseudomas aeruginosa flagellin protein according to SEQ ID NO:2 or an antigenic fragment or derivative thereof and one or more OPS from Klebsiella pneumoniae serovar O3; and iv) a conjugate comprising a Pseudomas aeruginosa flagellin protein according to SEQ ID NO:2 or an antigenic fragment or derivative thereof and one or more OPS from Klebsiella pneumoniae serovar O5.
(61) In some embodiments, the composition comprises: i) a conjugate comprising a Pseudomas aeruginosa flagellin protein according to SEQ ID NO:1 or an antigenic fragment or derivative thereof and one or more OPS from Klebsiella pneumoniae serovar O1; ii) a conjugate comprising a Pseudomas aeruginosa flagellin protein according to SEQ ID NO:1 or an antigenic fragment or derivative thereof and one or more OPS from Klebsiella pneumoniae serovar O3; iii) a conjugate comprising a Pseudomas aeruginosa flagellin protein according to SEQ ID NO:2 or an antigenic fragment or derivative thereof and one or more OPS from Klebsiella pneumoniae serovar O2a; and iv) a conjugate comprising a Pseudomas aeruginosa flagellin protein according to SEQ ID NO:2 or an antigenic fragment or derivative thereof and one or more OPS from Klebsiella pneumoniae serovar O5.
(62) In some embodiments, the composition comprises: i) a conjugate comprising a Pseudomas aeruginosa flagellin protein according to SEQ ID NO:1 or an antigenic fragment or derivative thereof and one or more OPS from Klebsiella pneumoniae serovar O1; ii) a conjugate comprising a Pseudomas aeruginosa flagellin protein according to SEQ ID NO:1 or an antigenic fragment or derivative thereof and one or more OPS from Klebsiella pneumoniae serovar O5; iii) a conjugate comprising a Pseudomas aeruginosa flagellin protein according to SEQ ID NO:2 or an antigenic fragment or derivative thereof and one or more OPS from Klebsiella pneumoniae serovar O2a; and iv) a conjugate comprising a Pseudomas aeruginosa flagellin protein according to SEQ ID NO:2 or an antigenic fragment or derivative thereof and one or more OPS from Klebsiella pneumoniae serovar O3.
(63) In some embodiments, the composition comprises: i) a conjugate comprising a Pseudomas aeruginosa flagellin protein according to SEQ ID NO:1 or an antigenic fragment or derivative thereof and OPS from Klebsiella pneumoniae serovar O2a; ii) a conjugate comprising a Pseudomas aeruginosa flagellin protein according to SEQ ID NO:1 or an antigenic fragment or derivative thereof and OPS from Klebsiella pneumoniae serovar O5; iii) a conjugate comprising a Pseudomas aeruginosa flagellin protein according to SEQ ID NO:2 or an antigenic fragment or derivative thereof and OPS from Klebsiella pneumoniae serovar O1; and iv) a conjugate comprising a Pseudomas aeruginosa flagellin protein according to SEQ ID NO:2 or an antigenic fragment or derivative thereof and OPS from Klebsiella pneumoniae serovar O3.
(64) In some embodiments, the composition comprises: i) a conjugate comprising a Pseudomas aeruginosa flagellin protein according to SEQ ID NO:1 or an antigenic fragment or derivative thereof and OPS from Klebsiella pneumoniae serovar O3; ii) a conjugate comprising a Pseudomas aeruginosa flagellin protein according to SEQ ID NO:1 or an antigenic fragment or derivative thereof and OPS from Klebsiella pneumoniae serovar O5; iii) a conjugate comprising a Pseudomas aeruginosa flagellin protein according to SEQ ID NO:2 or an antigenic fragment or derivative thereof and OPS from Klebsiella pneumoniae serovar O1; and iv) a conjugate comprising a Pseudomas aeruginosa flagellin protein according to SEQ ID NO:2 or an antigenic fragment or derivative thereof and OPS from Klebsiella pneumoniae serovar O2a.
(65) In some embodiments, the composition comprises: i) a conjugate comprising a Pseudomas aeruginosa flagellin protein according to SEQ ID NO:1 or an antigenic fragment or derivative thereof and OPS from Klebsiella pneumoniae serovar O2a; ii) a conjugate comprising a Pseudomas aeruginosa flagellin protein according to SEQ ID NO:1 or an antigenic fragment or derivative thereof and OPS from Klebsiella pneumoniae serovar O3; iii) a conjugate comprising a Pseudomas aeruginosa flagellin protein according to SEQ ID NO:2 or an antigenic fragment or derivative thereof and OPS from Klebsiella pneumoniae serovar O1; and iv) a conjugate comprising a Pseudomas aeruginosa flagellin protein according to SEQ ID NO:2 or an antigenic fragment or derivative thereof and OPS from Klebsiella pneumoniae serovar O5.
(66) In some embodiments, the invention provides a composition comprising an effective amount of sera from a subject administered one or more conjugates of the invention. In some embodiments, the invention provides a composition comprising an effective amount of purified or enriched immunoglobulins from a subject administered one or more conjugates of the invention. In some embodiments, the composition comprising sera or the immunoglobulins can be administered to a subject in immunotherapy applications.
(67) In some embodiments, the compositions are pharmaceutical compositions comprising one or more conjugates of the invention and a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical composition can contain salts, buffers, adjuvants, or other substances which are desirable for improving the efficacy of the composition. Adjuvants are substances that can be used to specifically augment a specific immune response. Normally, the adjuvant and the composition are mixed prior to presentation to the immune system, or presented separately, but into the same site of the animal being immunized. Adjuvants can be loosely divided into several groups based upon their composition. These groups include oil adjuvants (for example, Freund's complete and incomplete), mineral salts (for example, AlK(SO.sub.4).sub.2, AlNa(SO.sub.4).sub.2, AlNH.sub.4 (SO.sub.4), silica, kaolin, and carbon), polynucleotides (for example, poly IC and poly AU acids), and certain natural substances (for example, wax D from Mycobacterium tuberculosis, as well as substances found in Corynebacterium parvum, or Bordetella pertussis, and members of the genus Brucella. Adjuvants are described by Warren et al. (Ann. Rev. Biochem., 4:369-388, 1986), the entire disclosure of which is hereby incorporated by reference. Further adjuvants suitable for use in the present invention include alum, a PRR ligand, TLR3 ligand, TLR4 ligand, TLR5 ligand, TLR6 ligand, TLR7/8 ligand, TLR9 ligand, NOD2 ligand, and lipid A and analogues thereof.
(68) In some embodiments of the invention the use of a flagellin protein or antigenic fragment or derivative thereof as a carrier for a conjugate provides an inherent adjuvant boost, and stimulates a robust immune response without the addition of further adjuvant. Thus, in some embodiments, the flagellin protein antigenic fragment or derivative thereof acts an adjuvant which stimulates innate immunity through TLR5 to improve the immunogenicity of surface polysaccharide antigen (e.g., OPS) within the composition. In some embodiments, the carrier is a mutant flagellin antigenic fragment or derivative thereof which has a diminished capability to stimulate innate immunity through TLR5. In some embodiments, an adjuvant is added to the compositions while in other embodiments, no adjuvant is added.
(69) In some embodiments, conventional adjuvants can be administered. Among those substances that can be included are the saponins such as, for example, Quil A. (Superfos A/S, Denmark). In some embodiments, immunogenicity of the conjugates in both mice and rabbits is enhanced by the use of monophosphoryl lipid A plus trehalose dimycolate (Ribi-700; Ribi Immunochemical Research, Hamilton, Mont.) as an adjuvant. Alum, a PRR ligand, TLR3 ligand, TLR 4 ligand, TLR5 ligand, TLR6 ligand, TLR7/8 ligand, TLR9 ligand, NOD2 ligand, and lipid A and analogues thereof may separately or in combination may also be used as adjuvants. Examples of materials suitable for use in vaccine compositions are provided in Remington's Pharmaceutical Sciences (Osol, A, Ed, Mack Publishing Co, Easton, Pa., pp. 1324-1341 (1980), which disclosure is incorporated herein by reference).
(70) In some embodiments, the vaccine composition can be formulated into liquid preparations for, e.g., nasal, rectal, buccal, vaginal, peroral, intragastric, mucosal, perlinqual, alveolar, gingival, olfactory, or respiratory mucosa administration. Suitable forms for such administration include solutions, suspensions, emulsions, syrups, and elixirs. The vaccine composition can also be formulated for parenteral, subcutaneous, intradermal, intramuscular, intraperitoneal or intravenous administration, injectable administration, sustained release from implants, or administration by eye drops. Suitable forms for such administration include sterile suspensions and emulsions. Such vaccine composition can be in admixture with a suitable carrier, diluent, or excipient such as sterile water, physiological saline, glucose, and the like. The vaccine composition can also be lyophilized The vaccine composition can contain auxiliary substances such as wetting or emulsifying agents, pH buffering agents, gelling or viscosity enhancing additives, preservatives, flavoring agents, colors, and the like, depending upon the route of administration and the preparation desired. Texts, such as Remington: The Science and Practice of Pharmacy, Lippincott Williams & Wilkins; 20th edition (Jun. 1, 2003) and Remington's Pharmaceutical Sciences, Mack Pub. Co.; 18.sup.th and 19.sup.th editions (December 1985, and June 1990, respectively), incorporated herein by reference in their entirety, can be consulted to prepare suitable preparations. Such preparations can include complexing agents, metal ions, polymeric compounds such as polyacetic acid, polyglycolic acid, hydrogels, dextran, and the like, liposomes, microemulsions, micelles, unilamellar or multilamellar vesicles, erythrocyte ghosts or spheroblasts. Suitable lipids for liposomal formulation include, without limitation, monoglycerides, diglycerides, sulfatides, lysolecithin, phospholipids, saponin, bile acids, and the like. The presence of such additional components can influence the physical state, solubility, stability, rate of in vivo release, and rate of in vivo clearance, and are thus chosen according to the intended application, such that the characteristics of the carrier are tailored to the selected route of administration.
(71) In some embodiments, the vaccine composition of the invention is administered parenterally. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. In some embodiments, the vaccine composition for parenteral administration may be in the form of a sterile injectable preparation, such as a sterile injectable aqueous or nonaqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Carriers or occlusive dressings can be used to increase skin permeability and enhance antigen absorption. Suspensions may be formulated according to methods well known in the art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be a sterile injectable solution or suspension in a parenterally acceptable diluent or solvent, such as a solution in 1,3-butanediol. Suitable diluents include, for example, water, Ringer's solution and isotonic sodium chloride solution. In addition, sterile fixed oils may be employed conventionally as a solvent or suspending medium. For this purpose, any bland fixed oil may be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid may likewise be used in the preparation of injectable preparations.
(72) Liquid dosage forms for oral administration may generally comprise a liposome solution containing the liquid dosage form. Suitable forms for suspending liposomes include emulsions, suspensions, solutions, syrups, and elixirs containing inert diluents commonly used in the art, such as purified water. Besides the inert diluents, such compositions can also include adjuvants, wetting agents, emulsifying and suspending agents, or sweetening, flavoring, or perfuming agents.
(73) In some embodiments, the vaccine composition is provided as a liquid suspension or as a freeze-dried product (or freeze-dried hyperimmune globulin for oral administration). Suitable liquid preparations include, e.g., isotonic aqueous solutions, suspensions, emulsions, or viscous compositions that are buffered to a selected pH. Transdermal preparations include lotions, gels, sprays, ointments or other suitable techniques. If nasal or respiratory (mucosal) administration is desired (e.g., aerosol inhalation or insufflation), compositions can be in a form and dispensed by a squeeze spray dispenser, pump dispenser or aerosol dispenser. Aerosols are usually under pressure by means of a hydrocarbon. Pump dispensers can preferably dispense a metered dose or a dose having a particular particle size, as discussed below.
(74) In some embodiments, when in the form of solutions, suspensions and gels, in some embodiments, the composition contains a major amount of water (preferably purified endotoxin-free water) in addition to the active ingredient. Minor amounts of other ingredients such as pH adjusters, emulsifiers, dispersing agents, buffering agents, preservatives, wetting agents, jelling agents, colors, and the like can also be present.
(75) In some embodiments, the compositions are preferably isotonic with the blood or other body fluid of the recipient. The isotonicity of the compositions can be attained using sodium tartrate, propylene glycol or other inorganic or organic solutes. Sodium chloride is particularly preferred. Buffering agents can be employed, such as acetic acid and salts, citric acid and salts, boric acid and salts, and phosphoric acid and salts. In some embodiments of the invention, phosphate buffered saline is used for suspension.
(76) In some embodiments, the viscosity of the compositions can be maintained at the selected level using a pharmaceutically acceptable thickening agent. In some embodiments, methylcellulose is used because it is readily and economically available and is easy to work with. Other suitable thickening agents include, for example, xanthan gum, carboxymethyl cellulose, hydroxypropyl cellulose, carbomer, and the like. The concentration of the thickener can depend upon the agent selected. In some embodiments, viscous compositions are prepared from solutions by the addition of such thickening agents.
(77) In some embodiments, a pharmaceutically acceptable preservative can be employed to increase the shelf life of the compositions. Benzyl alcohol can be suitable, although a variety of preservatives including, for example, parabens, thimerosal, chlorobutanol, or benzalkonium chloride can also be employed. A suitable concentration of the preservative can be from 0.02% to 2% based on the total weight although there can be appreciable variation depending upon the agent selected.
(78) In some embodiments, pulmonary delivery of the composition can also be employed. In some embodiments, the composition is delivered to the lungs of a mammal while inhaling and traverses across the lung epithelial lining to the blood stream. A wide range of mechanical devices designed for pulmonary delivery of therapeutic products can be employed, including but not limited to nebulizers, metered dose inhalers, and powder inhalers, all of which are familiar to those skilled in the art. These devices employ formulations suitable for the dispensing of the conjugate. Typically, each formulation is specific to the type of device employed and can involve the use of an appropriate propellant material, in addition to diluents, adjuvants and/or carriers useful in therapy.
(79) In embodiments where the compositions are prepared for pulmonary delivery in particulate form, it has an average particle size of from 0.1 m or less to 10 m or more. In some embodiments, it has an average particle size of from about 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, or 0.9 m to about 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, or 9.5 m for pulmonary delivery. Pharmaceutically acceptable carriers for pulmonary delivery of the insufflation include carbohydrates such as trehalose, mannitol, xylitol, sucrose, lactose, and sorbitol. Other ingredients for use in formulations can include DPPC, DOPE, DSPC and DOPC. Natural or synthetic surfactants can be used, including polyethylene glycol and dextrans, such as cyclodextran and other related enhancers, as well as cellulose and cellulose derivatives, and amino acids can also be used. Liposomes, microcapsules, microspheres, inclusion complexes, and other types of carriers can also be employed.
(80) Formulations suitable for use with a nebulizer, either jet or ultrasonic, typically comprise the composition dissolved or suspended in water at a concentration of about 0.01 or less to 100 mg or more of conjugate per mL of solution, preferably from about 0.1, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mg to about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, or 90 mg of conjugate per mL of solution. The formulation can also include a buffer and a simple sugar (e.g., for protein stabilization and regulation of osmotic pressure). The nebulizer formulation can also contain a surfactant, to reduce or prevent surface induced aggregation of the conjugate or composition caused by atomization of the solution in forming the aerosol.
(81) Formulations for use with a metered-dose inhaler device generally comprise a finely divided powder containing the vaccine composition suspended in a propellant with the aid of a surfactant. The propellant can include conventional propellants, such chlorofluorocarbon, a hydrochlorofluorocarbons, hydrofluorocarbons, and hydrocarbons, such as trichlorofluoromethane, dichlorodifluoromethane, dichlorotetrafluoroethanol, and 1,1,1,2-tetrafluoroethane, and combinations thereof. Suitable surfactants include sorbitan trioleate, soya lecithin, and oleic acid.
(82) Formulations for dispensing from a powder inhaler device typically comprise a finely divided dry powder containing the vaccine composition, optionally including a bulking agent, such as lactose, sorbitol, sucrose, mannitol, trehalose, or xylitol in an amount that facilitates dispersal of the powder from the device, typically from about 1 wt. % or less to 99 wt. % or more of the formulation, preferably from about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 wt. % to about 55, 60, 65, 70, 75, 80, 85, or 90 wt. % of the formulation.
(83) In some embodiments, the invention is directed to kits comprising one or more vaccine compositions of the invention. Such kits can be provided to an administering physician or other health care professional.
(84) In some embodiments, the kit is a package that houses one or more containers which comprises one or more vaccine compositions and instructions for administering the vaccine composition to a subject. In some embodiments, the kit can also comprise one or more other therapeutic agents. The kit can optionally contain one or more diagnostic tools and instructions for use.
(85) In some embodiments, the kit comprises an immunization schedule. In some embodiments, a vaccine cocktail containing two or more vaccine compositions can be included, or separate pharmaceutical compositions containing different vaccines or therapeutic agents. The kit can also contain separate doses of the vaccine composition for serial or sequential administration.
(86) In some embodiments, the kit further comprises suitable delivery devices, e.g., syringes, inhalation devices, and the like, along with instructions for administrating the therapeutic agents. The kit can optionally contain instructions for storage, reconstitution (if applicable), and administration of any or all therapeutic agents included. The kits can include a plurality of containers reflecting the number of administrations to be given to a subject. If the kit contains a first and second container, then a plurality of these can be present.
(87) Methods of Treatment
(88) Another aspect of the invention is directed to a method of inducing an immune response, comprising administering to a subject in need thereof an immunologically-effective amount of the above-mentioned conjugate or composition. In some embodiments, the surface polysaccharide antigen is an O polysaccharide (OPS), a core oligosaccharide and an O polysaccharide (COPS), a capsule polysaccharide, or combinations thereof. In some embodiments of the invention, the surface polysaccharide antigen is an O polysaccharide antigen (OPS). The surface polysaccharide antigen and the flagellin can be covalently linked.
(89) In some embodiments, methods of the claimed invention include administering multiple conjugates comprising one or more Pseudomonas flagellins or antigenic fragments or derivatives thereof covalently linked to one or more Klebsiella O polysaccharides (OPS) to induce an immune response. The multiple conjugates can comprise two different Pseudomonas flagellin covalently linked to one or more Klebsiella O polysaccharides (OPS). The two different Pseudomonas flagellins can be a Pseudomas aeruginosa flagellin type A (FlaA) and a Pseudomonas aeruginosa flagellin type B (FlaB).
(90) In further embodiments of the method, the multiple conjugates can comprise four different OPS antigens from Klebsiella pneumoniae. For example, the four different OPS can be derived from Klebsiella pneumoniae serovars O1, O2a, O3 and O5. Further, the two different Pseudomonas flagellins can be Pseudomonas aeruginosa flagellin type A (FlaA) and Pseudomas aeruginosa flagellin type B (FlaB) and/or the four Klebsiella OPS can be from Klebsiella pneumoniae serovars O1, O2a, O3 and O5. The Pseudomonas flagellin can be covalently linked to one or more OPS from a single Klebsiella pneumoniae serovar type or can be covalently linked to OPS from multiple Klebsiella pneumoniae serovar types. The Pseudomonas aeruginosa flagellin type A (FlaA) can comprise SEQ ID NO:1 and/or the Pseudomas aeruginosa flagellin type B (FlaB) can comprise SEQ ID NO:2.
(91) In some embodiments, the conjugate or composition is administered multiple times to the subject. The conjugate or composition may also be administered a single time to the subject. The term subject as used herein, refers to animals, such as mammals. For example, mammals contemplated include humans, primates, dogs, cats, sheep, cattle, goats, pigs, horses, chickens, mice, rats, rabbits, guinea pigs, and the like. The terms subject, patient, and host are used interchangeably.
(92) Human subjects are not limiting and can include deployed soldiers, hospital workers, patients and residents of chronic care facilities. In some embodiments, the patient is in a hospital or in a skilled nursing facility. In some embodiments, the subject is administered the conjugate or composition prior to, during, or after a surgery. The surgery is not limiting and can be, for example, colon surgery, hip arthroplasty, or small-bowel surgery. Further, the conjugate or composition can be administered prior to, during, or after a procedure selected from central venous catheterization, urinary tract catheterization, and intubation with a ventilator tube.
(93) As used herein, an immune response is the physiological response of the subject's immune system to an immunizing composition. An immune response may include an innate immune response, an adaptive immune response, or both. In some embodiments of the present invention, the immune response is a protective immune response. A protective immune response confers immunological cellular memory upon the subject, with the effect that a secondary exposure to the same or a similar antigen is characterized by one or more of the following characteristics: shorter lag phase than the lag phase resulting from exposure to the selected antigen in the absence of prior exposure to the immunizing composition; production of antibody which continues for a longer period than production of antibody resulting from exposure to the selected antigen in the absence of prior exposure to the immunizing composition; a change in the type and quality of antibody produced in comparison to the type and quality of antibody produced upon exposure to the selected antigen in the absence of prior exposure to the immunizing composition; a shift in class response, with IgG antibodies appearing in higher concentrations and with greater persistence than IgM, than occurs in response to exposure to the selected antigen in the absence of prior exposure to the immunizing composition; an increased average affinity (binding constant) of the antibodies for the antigen in comparison with the average affinity of antibodies for the antigen resulting from exposure to the selected antigen in the absence of prior exposure to the immunizing composition; and/or other characteristics known in the art to characterize a secondary immune response.
(94) In some embodiments, the immunogenicity of the conjugates and compositions of the invention are greater than the immunogenicity of at least one of the surface polysaccharide antigen or flagellin protein or an antigenic fragment or a derivative thereof alone. Methods of measuring immunogenicity are well known to those in the art and primarily include measurement of serum antibody including measurement of amount, avidity, and isotype distribution at various times after injection of the conjugate vaccine. Greater immunogenicity may be reflected by a higher titer and/or increased life span of the antibodies Immunogenicity may also be measured by the ability to induce protection to challenge with noxious substances or virulent organisms Immunogenicity may also be measured by the ability to immunize neonatal and/or immune deficient mice Immunogenicity may be measured in the patient population to be treated or in a population that mimics the immune response of the patient population.
(95) In some embodiments, the immune response that is generated by the conjugates and compositions of the invention is a protective immune response against infection by one or more Klebsiella and/or Pseudomonas serovars, including those serovars described herein.
(96) In some embodiments, the conjugates and compositions of the invention are administered alone in a single dose or administered in sequential doses. In other aspects of the invention, the conjugates and compositions of the invention are administered as a component of a homologous or heterologous prime/boost regimen in conjunction with one or more vaccines. In some embodiments of the invention, a single boost is used. In some embodiments of the invention, multiple boost immunizations are performed. In particular aspects of the invention drawn to a heterologous prime/boost, a mucosal bacterial prime/parenteral conjugate boost immunization strategy is used. In some embodiments, one or more (or all) of the live (or killed) attenuated Salmonella enterica serovars used as a reagent strain to express Pseudomonas flagellin as taught herein can be administered orally to a subject and the subject can be subsequently boosted parenterally with a conjugates and compositions of the invention as described herein. In some embodiments, one or more (or all) of the live (or killed) attenuated Klebsiella used as a reagent strain to isolate surface polysaccharide as taught herein can be administered orally to a subject and the subject can be subsequently boosted parenterally with a conjugates and compositions of the invention as described herein.
(97) In practicing immunization protocols for treatment and/or prevention, an immunologically-effective amount of conjugates and compositions of the invention are administered to a subject. As used herein, the term immunologically-effective amount means the total amount of therapeutic agent (e.g., conjugate or composition) or other active component that is sufficient to show an enhanced immune response in the subject. When immunologically-effective amount is applied to an individual therapeutic agent administered alone, the term refers to that therapeutic agent alone. When applied to a combination, the term refers to combined amounts of the ingredients that result in the therapeutic effect, whether administered in combination, serially or simultaneously, and regardless of order of administration.
(98) The particular dosage depends upon the age, weight, sex and medical condition of the subject to be treated, as well as on the method of administration. Suitable doses can be readily determined by those of skill in the art.
(99) The conjugates and compositions of the invention can be administered by either single or multiple dosages of an effective amount. In some embodiments, an effective amount of the compositions of the invention can vary from 0.01-5,000 g/ml per dose. In other embodiments, an effective amount of the conjugate or composition of the invention can vary from 0.1-500 g/ml per dose, and in other embodiments, it can vary from 10-300 g/ml per dose. In one embodiment, the dosage of the conjugate or composition administered will range from about 10g to about 1000 g. In another embodiment, the amount administered will be between about 20 g and about 500 g. In some embodiments, the amount administered will be between about 75 g and 250 g. Greater doses may be administered on the basis of body weight. The exact dosage can be determined by routine dose/response protocols known to one of ordinary skill in the art.
(100) In some embodiments, the amount of conjugates and compositions of the invention that provide an immunologically-effective amount for vaccination against Klebsiella and/or Pseudomonas infections is from about 1 g or less to about 100 g or more. In some embodiments, it is from about 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45 or 50 g to about 55, 60, 65, 70, 75, 80, 85, 90, or 95 g per kg body weight. In some embodiments, the immunologically-effective amount for vaccination against Klebsiella and/or Pseudomonas infection is from 0.01 g to 10 g.
(101) The conjugates and compositions of the invention may confer resistance to Klebsiella and/or Pseudomonas infections by either passive immunization or active immunization. In one embodiment of passive immunization, the conjugate or composition is provided to a subject (i.e. a human or mammal), and the elicited antisera is recovered and directly provided to a recipient suspected of having an infection caused by Klebsiella and/or Pseudomonas.
(102) In some embodiments, the present invention provides a means for preventing or attenuating infection by Klebsiella and/or Pseudomonas or by organisms which have antigens that can be recognized and bound by antisera to the polysaccharide and/or protein of the conjugate or composition.
(103) The administration of the conjugate or composition (or the antisera which it elicits) may be for either a prophylactic or therapeutic purpose. When provided prophylactically, the conjugate or composition is provided in advance of any symptom of Klebsiella and/or Pseudomonas infection. The prophylactic administration of the conjugate or composition serves to prevent or attenuate any subsequent infection. When provided therapeutically, the conjugate or composition is provided upon the detection of a symptom of actual infection. The therapeutic administration of the conjugate or composition serves to attenuate any actual infection.
(104) The conjugate or composition of the invention may, thus, be provided either prior to the onset of infection (so as to prevent or attenuate an anticipated infection) or after the initiation of an actual infection.
(105) The conjugate or composition of the invention may be administered to warm-blooded mammals of any age. The conjugate or composition can be administered as a single dose or in a series including one or more boosters. In some embodiments, the immunization schedule would involve a primary series of three immunizations with a spacing of 1-2 months between the doses. In some settings a booster dose could be administered 6-12 months later. For example, an infant can receive three doses at 6, 10 and 14 weeks of age (schedule for infants in sub-Saharan Africa) or at 2, 4, and 6 months of life (schedule for U.S. infants). In some embodiments, U.S. infants might receive a booster at 12-18 months of age. Another target population would be U.S. elderly who would likely receive 2-3 doses spaced 1-2 months apart. A further target population would be patients upon admission to a hospital.
(106) Methods of Making the Conjugate
(107) The methods that can be used to make the conjugates of the invention are not limiting. Methods useful for producing conjugate vaccines have been previously described and disclosed in U.S. Pat. Nos. 4,673,574, 4,789,735, 4,619,828, 4,284,537, 5,370,872, 5,302,386, 5,576,002, and U.S. Patent Application Pub. No. 2011/0274714, all of which disclosures are incorporated herein by reference.
(108) In one embodiment, the invention is directed towards a method of making the conjugates described herein comprising binding a Klebsiella surface polysaccharide antigen and a Pseudomonas flagellin protein or an antigenic fragment or a derivative thereof. In some embodiments, the binding is covalent. In some embodiments, the surface polysaccharide antigen is an O polysaccharide (OPS). Further embodiments include covalently bonding Pseudomas aeruginosa flagellin type A (FlaA) and/or Pseudomas aeruginosa flagellin type B (FlaB) to at least one OPS from Klebsiella pneumoniae serovars O1, O2a, O3 and O5 to arrive at the conjugates described herein.
(109) In some embodiments, the surface polysaccharide antigen is isolated from a Klebsiella pneumoniae serovar having one or more mutations. For example, the Klebsiella pneumoniae may have an attenuating mutation in the guaBA locus and/or a mutation in the wza-wzc locus.
(110) In some embodiments, the Pseudomonas flagellin protein is isolated from a heterologous Gram-negative bacteria (GNB) expression system, including Salmonella and Escherichia coli. In some embodiments, the flagellin protein is isolated from a Salmonella enterica serovar strain engineered to express Pseudomonas aeruginosa flagellin protein. In some embodiments, the Salmonella enterica serovar is Enteritidis. In some embodiments, the Salmonella enterica serovar strain may have an attenuating mutation, for example, in the guaBA locus. In some embodiments, the flagellin is purified from the bacterial supernatant of the Salmonella enterica serovar reagent strains described herein by chromatographic methods.
(111) The Pseudomas aeruginosa flagellin can be purified and isolated using conventional techniques and methods. Such methods can include mechanical shearing, removal at low pH, heating or purification from bacterial supernatants. Methods of purification of a flagellin protein from whole flagella are known in the art or can be readily modified by one of ordinary skill in the art using methods known in the art. For example, by modifying the method of Ibrahim et al., purification of flagella is achieved; below pH 3.0, flagella dissociate into flagellin subunits (Ibrahim et al. J. Clin. Microbiol. 1985; 22:1040-4). Further methods for purification include adaptation of the mechanical shearing, and sequential centrifugation steps for purification of flagellin in flagella from bacterial cells.
(112) In some embodiments, COPS and OPS can be isolated by methods including, but not limited to mild acid hydrolysis removal of lipid A from LPS. Other embodiments may include use of hydrazine as an agent for COPS or OPS preparation. Preparation of LPS can be accomplished by known methods in the art. In some embodiments, LPS is prepared according to methods of Darveau et al. J. Bacteriol., 155(2):831-838 (1983), or Westphal et al. Methods in Carbohydrate Chemistry. 5:83-91 (1965) which are incorporated by reference herein.
(113) In some embodiments, the LPS is purified by a modification of the methods of Darveau et al., supra, followed by mild acid hydrolysis.
(114) The surface polysaccharide antigen and flagellin can be conjugated using known techniques and methods. For example, techniques to conjugate surface polysaccharide antigen and flagellin can include, in part, coupling through available functional groups (such as amino, carboxyl, thiol and aldehyde groups). See, e.g., Hermanson, Bioconjugate Techniques (Academic Press; 1992); Aslam and Dent, eds. Bioconjugation: Protein coupling Techniques for the Biomedical Sciences (MacMillan: 1998); S. S. Wong, Chemistry of Protein Conjugate and Crosslinking CRC Press (1991), and Brenkeley et al., Brief Survey of Methods for Preparing Protein Conjugates With Dyes, Haptens and Cross-Linking Agents, Bioconjugate Chemistry 3 #1 (Jan. 1992).
(115) In some embodiments of the present invention, the surface polysaccharide antigen and flagellin or fragments or derivatives thereof, can include functional groups or, alternatively, can be chemically manipulated to bear functional groups. In some embodiments, the presence of functional groups can facilitate covalent conjugation. Such functional groups can include amino groups, carboxyl groups, aldehydes, hydrazides, epoxides, and thiols, for example. Functional amino and sulfhydryl groups can be incorporated therein by conventional chemistry. Primary amino groups can be incorporated by reaction with ethylenediamine in the presence of sodium cyanoborohydride and sulfhydryls may be introduced by reaction of cysteamine dihydrochloride followed by reduction with a standard disulfide reducing agent.
(116) Flagellin may contain amino acid side chains such as amino, carbonyl, hydroxyl, or sulfhydryl groups or aromatic rings that can serve as sites for conjugation. Residues that have such functional groups can be added to either the surface polysaccharide antigen or flagellin. Such residues may be incorporated by solid phase synthesis techniques or recombinant techniques, for example.
(117) Surface polysaccharide antigen and flagellin can be chemically conjugated using conventional crosslinking agents such as carbodiimides. Examples of carbodiimides are 1-cyclohexyl-3-(2-morpholinyl-(4-ethyl) carbodiimide (CMC), 1-ethyl-3-(3-dimethyaminopropyl) carbodiimide (EDC), and 1-ethyl-3-(4-azonia-44-dimethylpentyl) carbodiimide.
(118) Examples of other crosslinking agents are cyanogen bromide, glutaraldehyde and succinic anhydride. In general, any of a number of homobifunctional agents including a homobifunctional aldehyde, a homobifunctional epoxide, a homobifunctional imidoester, a homobifunctional N-hydroxysuccinimide ester, a homobifunctional maleimide, a homobifunctional alkyl halide, a homobifunctional pyridyl disulfide, a homobifunctional aryl halide, a homobifunctional hydrazide, a homobifunctional diazonium derivative or a homobifunctional photoreactive compound can be used. Also included are heterobifunctional compounds, for example, compounds having an amine-reactive and a sulfhydryl-reactive group, compounds with an amine-reactive and a photoreactive group, and compounds with a carbonyl-reactive and a sulfhydryl-reactive group.
(119) Specific examples of homobifunctional crosslinking agents include the bifunctional N-hydroxysuccinimide esters dithiobis (succinimidylpropionate), disuccinimidyl suberate, and disuccinimidyl tartarate; the bifunctional imidoesters dimethyl adipimidate, dimethyl pimelimidate, and dimethyl suberimidate; the bifunctional sulfhydryl-reactive crosslinkers 1,4-di-[3-(2-pyridyldithio) propion-amido]butane, bismaleimidohexane, and bis-N-maleimido-1,8-octane; the bifunctional aryl halides 1,5-difluoro-2,4-dinitrobenzene and 4,4-difluoro-3,3-dinitrophenylsulfone; bifunctional photoreactive agents such as bis-[b-(4-azidosalicylamide)ethyl]disulfide; the bifunctional aldehydes formaldehyde, malondialdehyde, succinaldehyde, glutaraldehyde, and adiphaldehyde; a bifunctional epoxied such as 1,4-butaneodiol diglycidyl ether; the bifunctional hydrazides adipic acid dihydrazide, carbohydrazide, and succinic acid dihydrazide; the bifunctional diazoniums o-tolidine, diazotized and bis-diazotized benzidine; the bifunctional alkylhalides N1N-ethylene-bis(iodoacetamide), N1N-hexamethylene-bis(iodoacetamide), N1N-undecamethylene-bis(iodoacetamide), as well as benzylhalides and halomustards, such as a1a-diiodo-p-xylene sulfonic acid and tri(2-chloroethyl) amine, respectively.
(120) Examples of other common heterobifunctional crosslinking agents that may be used include, but are not limited to, SMCC (succinimidyl-4-(N-maleimidomethyl) cyclohexane-1-carboxylate), MBS (m-maleimidobenzoyl-N-hydroxysuccinimide ester), SIAB (N-succinimidyl(4-iodacteyl) aminobenzoate), SMPB (succinimidyl-4-(p-maleimidophenyl)butyrate), GMBS (N-(-maleimidobutyryloxy) succinimide ester), MPHB (4-(4-N-maleimidopohenyl) butyric acid hydrazide), M2C2H (4-(N-maleimidomethyl)cyclohexane-1-carboxyl-hydrazide), SMPT (succinimidyloxycarbonyl-a-methyl-a-(2-pyridyldithio)toluene), and SPDP (N-succinimidyl 3-(2-pyridyldithio) propionate). For example, crosslinking may be accomplished by coupling a carbonyl group to an amine group or to a hydrazide group by reductive amination.
(121) In another aspect of the invention, the surface polysaccharide antigen and flagellin can be conjugated through polymers, such as PEG, poly-D-lysine, polyvinyl alcohol, polyvinylpyrollidone, immunoglobulins, and copolymers of D-lysine and D-glutamic acid. Conjugation of the surface polysaccharide antigen and flagellin may be achieved in any number of ways, including involving one or more crosslinking agents and functional groups on the surface polysaccharide antigen and/or flagellin. The polymer can be derivatized to contain functional groups if it does not already possess appropriate functional groups.
(122) In some embodiments, 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) conjugation chemistry is used to achieve efficient synthesis of the surface polysaccharide antigen and flagellin conjugates. In some embodiments, 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) is used to conjugate OPS-FlaA conjugates and OPS-FlaB conjugates.
(123) In some embodiments, the surface polysaccharide antigen or flagellin is conjugated to a linker prior to conjugation. In some embodiments, the linker is adipic acid dihydrazide (ADH). The present invention contemplates the use of any linker capable of conjugating the surface polysaccharide antigen to flagellin. In some embodiments, the presence of a linker promotes optimum immunogenicity of the conjugate and composition and more efficient coupling. In some embodiments, the linkers separate the two or more antigenic components by chains whose length and flexibility can be adjusted as desired. Between the bifunctional sites, the chains can contain a variety of structural features, including heteroatoms and cleavage sites. In some embodiments, linkers also permit corresponding increases in translational and rotational characteristics of the antigens, increasing access of the binding sites to soluble antibodies. Besides ADH, suitable linkers include, for example, heterodifunctional linkers such as e-aminohexanoic acid, chlorohexanol dimethyl acetal, D-glucuronolactone and p-nitrophenyl amine. Coupling reagents contemplated for use in the present invention include hydroxysuccinimides and carbodiimides. Many other linkers and coupling reagents known to those of ordinary skill in the art are also suitable for use in the invention. Such compounds are discussed in detail by Dick et al., Conjugate Vaccines, J. M. Cruse and R. E. Lewis, Jr., eds., Karger, N.Y., pp. 48-114, hereby incorporated by reference.
(124) In some embodiments, ADH is used as the linker. In some embodiments, the molar ratio of ADH to surface polysaccharide antigen such as OPS in the reaction mixture is typically between about 10:1 and about 250:1. In some embodiments, a molar excess of ADH is used to ensure more efficient coupling and to limit OPS-OPS coupling. In some embodiments, the molar ratio is between about 50:1 and about 150:1. In other embodiments, the molar ratio is about 100:1. Similar ratios of AH-OPS to the flagellin in the reaction mixture are also contemplated. In some embodiments, one ADH per OPS is present in the AH-OPS conjugate.
(125) Other linkers are available and can be used to link two aldehyde moieties, two carboxylic acid moieties, or mixtures thereof. Such linkers include (C.sub.1-C.sub.6) alkylene dihydrazides, (C.sub.1-C.sub.6) alkylene or arylene diamines, -aminoalkanoic acids, alkylene diols or oxyalkene diols or dithiols, cyclic amides and anhydrides and the like. For examples, see U.S. Pat. No. 5,739,313, incorporated herein in its entirety.
(126) In some embodiments, conjugation is conducted at a temperature of from about 0 C. to about 5 C. for about 36 to about 48 hours. In one embodiment, conjugation is conducted at about 4 C. for about 36 hours, followed by about an additional 18 to 24 hours at a temperature of from about 20 C. to about 25 C. In another embodiment, conjugation is conducted for about 18 hours at about 20 to 24 C., such that the residual cyanate groups react with water and decompose. Longer or shorter conjugation times and/or higher or lower conjugation temperatures can be employed, as desired. In some embodiments, it is desirable, however, to conduct the conjugation reaction, at least initially, at low temperatures, for example, from about 0 C. to about 5 C., such as about 4 C., so as to reduce the degree of precipitation of the conjugate.
(127) In some embodiments of the invention, conjugation of the surface polysaccharide antigen and flagellin protein is on the terminal amino group of lysine residues. In some embodiments of the invention, conjugation is to cysteine groups. In some embodiments of the invention, conjugation of the surface polysaccharide antigen is to N-terminal serine groups. In some embodiments of the invention, conjugation of the surface polysaccharide antigen to the flagellin is directed towards the C-terminal carboxylic acid group. In some embodiments of the invention, conjugation is to naturally occurring amino acid groups. In other embodiments of the invention, conjugation is to engineered amino acid sequences and residues within the flagellin protein.
(128) In some embodiments of the invention, conjugation of the surface polysaccharide antigen and flagellin is on random free hydroxyl groups on the OPS polysaccharide chain. In some embodiments of the invention, conjugation of the flagellin to the surface polysaccharide antigen and is at the terminal end of the polysaccharide chain.
(129) In some embodiments of the invention, the surface polysaccharide antigen and flagellin reactants contain multiple reactive groups per molecule. In some embodiments, an activated surface polysaccharide antigen molecule can react with and form more than one linkage to more than one flagellin. Likewise, an activated flagellin can react with and form more than one linkage to more than one activated surface polysaccharide antigen. Therefore, in some embodiments, the conjugate product is a mixture of various cross-linked matrix-type lattice structures. For example, a single linkage can be present, or 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 or more linkages can be present. The average number of linkages between a surface polysaccharide and flagellin antigen can be adjusted, as desired. In some embodiments, the average number of linkages can depend upon the type of OPS polysaccharide, the type of flagellin protein, the conjugation method, the reaction conditions, and the like.
(130) In some embodiments, purification processes such as column chromatography and/or ammonium sulfate precipitation of the conjugate from unconjugated polysaccharide may not be necessary. However, in certain embodiments it can be desirable to conduct one or more purification steps. In some embodiments, after conjugation, the conjugate can be purified by any suitable method. Purification can be employed to remove unreacted polysaccharide, protein, or small molecule reaction byproducts. Purification methods include ultrafiltration, size exclusion chromatography, density gradient centrifugation, hydrophobic interaction chromatography, ammonium sulfate fractionation, ion exchange chromatography, ligand exchange chromatography, immuno-affinity chromatography, polymyxin-b chromatography, and the like, as are known in the art. In some embodiments, the conjugation reactions proceed with higher yield, and generate fewer undesirable small molecule reaction byproducts. Accordingly, in some embodiments no purification may be necessary, or only a minor degree of purification can be desirable. The conjugate or composition of the invention can be concentrated or diluted, or processed into any suitable form for use in pharmaceutical compositions, as desired.
(131) Genetically Engineered Strains
(132) In another embodiment, the invention provides a modified Klebsiella that is useful for isolating the surface polysaccharide antigen for use in making the conjugates of the invention. In some embodiments, the modified Klebsiella is a modified Klebsiella pneumonia. In some embodiments, the modified Klebsiella comprises one or more attenuating mutations. In some embodiments, the modified Klebsiella has an attenuating mutation in the guaBA locus. In some embodiments, the Klebsiella comprises one or more mutations in the wza-wzc locus. In some embodiments, the Klebsiella pneumoniae serovar can be O1, O2a, O3, and/or O5. In some embodiments, the Klebsiella is Klebsiella pneumoniae serovar O1, O2a, O3, or O5 having an attenuating mutation in the guaBA locus and a mutation in the wza-wzc locus.
(133) In some embodiments the guaA gene (NCBI-ProteinID: ABR78243 NCBI-GI: 152971364 NCBI-GeneID: 5339904 UniProt: A6TCC2) of Klebsiella pneumoniae comprises SEQ ID NO:5, and encodes guanosine monophosphate synthase.
(134) In some embodiments the guaB gene (NCBI-ProteinlD: ABR78244 NCBI-GI: 152971365 NCBI-GeneID: 5339905 UniProt: A6TCC3) of Klebsiella pneumoniae comprises SEQ ID NO:6, and encodes inosine 5-monophosphate dehydrogenase.
(135) In some embodiments the wza gene (NCBI-ProteinID: ABR77930 NCBI-GI: 152971051 NCBI-GeneID: 5340218 UniProt: A6TBF9) of Klebsiella pneumoniae comprises SEQ ID NO:7, and encodes capsule export-outer membrane protein.
(136) In some embodiments the wzb gene (NCBI-ProteinID: ABR77929 NCBI-GI: 152971050 NCBI-GeneID: 5340217 UniProt: A6TBF8) of Klebsiella pneumoniae comprises SEQ ID NO:8, and encodes protein tyrosine phosphatase.
(137) In some embodiments the K2-wzc gene (NCBI-ProteinID: ABR77928 NCBI-GI: 152971049 NCBI-GeneID: 5340932 UniProt: A6TBF7) of Klebsiella pneumoniae comprises SEQ ID NO:9, and encodes tyrosine autokinase.
(138) In another embodiment, the invention provides a modified Gram-negative bacteria (GNB) engineered to express Pseudomonas flagellin which can be isolated for use in preparation of the conjugates of the invention. In some embodiments, the Gram-negative bacteria is Escherichia coli . In some embodiments, the Gram-negative bacteria is a Salmonella such as a Salmonella enterica serovar strain. In some embodiments, the Salmonella enterica serovar is selected from Enteritidis, Typhimurium, and Paratyphi A. In some embodiments, the Salmonella enterica serovar is Enteritidis.
(139) In some embodiments, the Gram-negative bacteria expressing Pseudomonas flagellin has one or more mutations. In some embodiments, the Gram-negative bacteria has one or more mutations in the guaBA locus, the guaB gene, the guaA gene, the clpP gene, the clpX gene and/or the clpPX locus. In some embodiments, the Gram-negative bacteria expressing Pseudomonas flagellin has one or more codon optimized Pseudomonas fliC genes. In some embodiments, the Gram-negative bacteria expressing Pseudomonas flagellin encodes a excretion signal for flagellin.
(140) In some embodiments, the Gram-negative bacteria, such as Salmonella enterica, has at least one attenuating mutation in the guaBA locus and/or the clpPX locus. In some embodiments, one or more of guaBA, clpPX and fliD are mutated to create highly attenuated strains that hyper-secrete flagellin monomers into the supernatant. A guaBA mutation (involved in guanosine nucleotide synthesis (Samant S et al., PLoS Pathog. 2008; 4(2):e37)) is highly attenuating in several Gram negative pathogens (e.g., Shigella (Kotloff K L et al., Hum Vaccin. 2007; 3(6):268-275), Salmonella (Tennant S M et al., Infect Immun. 2011; 79(10):4175-4185; Gat O et al., PLoS Negl Trop Dis. 2011; 5(11):e1373), Francisella (Santiago A E et al., Vaccine. 2009; 27(18):2426-2436)). When either clpP or clpX (that form the ClpPX protease) is deleted, the master flagella regulator complex FlhD/F1hC is not degraded and large amounts of flagella are produced. Deletion of clpPX is also independently attenuating (Tennant S M et al., Infect Immun. 2011; 79(10):4175-4185; Tomoyasu T et al., J Bacteriol. 2002; 184(3):645-653). Deletion of the gene for the flagella capping protein FliD causes flagellin monomers to be exported into the supernatant, and engineered Salmonella mutants deficient in clpPX and fliD produce and export large amounts of flagellin into the culture supernatant. These recombinant strains are considered as safe from an occupational health and safety perspective and enable conjugate vaccine carrier proteins to be expressed at high levels, thus lowering the overall cost of manufacture.
(141) Growth conditions in fully chemically defined minimal media for attenuated S. Enteritidis and S. Typhimurium strains have been established, whereby an optical density at 600 nm (OD.sub.600) of 15-18 is consistently attained at 20 L fermentation scale. Prototype attenuated S. Enteritidis reagent strain CVD 1943 guaBA clpP fliD was constructed from wild-type strain S. Enteritidis R11 (a Malian clinical isolate) (Richmond P, J Infect Dis. 2000; 181(2):761-764).
(142) In some embodiments, the Gram negative bacteria has an inactivating mutation in fliC such as a deletion in fliC. Such strain may further have an inserted (either in the chromosome or on a plasmid) heterologous fliC such as fliC from Pseudomas aeruginosa or a bacteria producing flagellin with cross-reactivity to fliC from Pseudomonas aeruginosa.
(143) In some embodiments, the Gram negative bacteria is Salmonella enterica having a mutation in fliC and having a plasmid encoding Pseudomonas aeruginosa Type A flagellin (FlaA) and/or Pseudomas aeruginosa Type B flagellin (FlaB). In some embodiments, the amino acid sequence of FlaA comprises SEQ ID NO:1 and the nucleotide sequence of FlaA comprises SEQ ID NO:3. In some embodiments, the amino acid sequence of FlaB comprises SEQ ID NO:2 and the nucleotide sequence comprises SEQ ID NO:4. In some embodiments, the Salmonella enterica expressing Pseudomonas flagellin has one or more codon optimized Pseudomonas fliC genes. In some embodiments, the Salmonella enterica expressing Pseudomonas flagellin encodes a Salmonella enterica Enteritidis fliC excretion signal.
(144) In some embodiments, the Gram negative bacteria hyper-secretes Pseudomonas flagellin. In some embodiments, the Gram negative bacteria comprises a clpP or clpX (that form the ClpPX protease) mutation causing the master flagella regulator complex FlhD/FlhC to not be degraded, thereby causing the production of large amounts of flagella.
(145) In some embodiments, using modified strains with attenuating mutations can simplify purification. Attenuated Salmonella strains are considered as safe from an occupational health and safety perspective. As used herein, attenuated strains are those that have a reduced, decreased, or suppressed ability to cause disease in a subject, or those completely lacking in the ability to cause disease in a subject. Attenuated strains may exhibit reduced or no expression of one or more genes, may express one or more proteins with reduced or no activity, may exhibit a reduced ability to grow and divide, or a combination of two or more of these characteristics.
(146) In some embodiments, the attenuated strains producing Pseudomonas flagellin of the invention have a mutation in one or more of the guaBA locus, the guaB gene, the guaA gene, the clpP gene, the clpX gene and the clpPX locus. For example, the attenuated strains can have a mutation (i) in the guaB gene and the clpP gene, (ii) in the guaA gene and the clpP gene, (iii) in the guaBA locus, and the clpP gene, (iv) in the guaB gene and the clpX gene, (v) in the guaA gene and the clpX gene, (vi) in the guaBA locus, and the clpX gene, (vii) in the guaB gene and the clpPX locus, (viii) in the guaA gene and the clpPX locus, or (ix) in both the guaBA locus and the clpPX locus.
(147) In some embodiments, attenuated strains are prepared having inactivating mutations (such as chromosomal deletions) in both the guaBA locus (encoding enzymes involved in guanine nucleotide biosynthesis) and the clpPX locus (encoding an important metabolic ATPase) genes. In some embodiments, one or more of the attenuated strains also have fliD and fliC mutations.
(148) The mutations of the loci and genes described herein can be any mutation, such as one or more nucleic acid deletions, insertions or substitutions. The mutations can be any deletion, insertion or substitution of the loci or genes that results in a reduction or absence of expression from the loci or genes, or a reduction or absence of activity of a polypeptide encoded by the loci or genes. The mutations may be in the coding or non-coding regions of the loci or genes.
(149) In some embodiments, the chromosomal genome of the Gram negative bacteria or Klebsiella is modified by removing or otherwise modifying the guaBA locus, and thus blocking the de novo biosynthesis of guanine nucleotides. In some embodiments, a mutation in the guaBA locus inactivates the purine metabolic pathway enzymes IMP dehydrogenase (encoded by guaB) and GMP synthetase (encoded by guaA). In some embodiments, the strains are unable to de novo synthesize GMP, and consequently GDP and GTP nucleotides, which severely limits bacterial growth in mammalian tissues. The guaBA mutants of the present invention are unable to grow in minimal medium unless supplemented with guanine.
(150) In some embodiments, the guaA gene of S. Enteritidis, which encodes GMP synthetase, is 1578 bp in size (GenBank Accession Number NC_011294.1 (2623838-2625415) (SEQ ID NO:10). In some embodiments, the guaA gene of S. Typhimurium, is 1578 bp in size (GenBank Accession Number NC_003197.1 (2622805.2624382, complement) (SEQ ID NO:11). In some embodiments, the guaA gene of S. Typhi, is 1578 bp in size (GenBank Accession Number NC_004631.1 (415601.417178) (SEQ ID NO:12). In some embodiments, the guaA gene of S. Paratyphi A, is 1578 bp in size (GenBank Accession Number NC_006511.1 (421828.423405) (SEQ ID NO:13). In some embodiments, the guaA gene of S. Paratyphi B is 1578 bp in size (GenBank Accession Number NC_010102.1 (418694.420271) (SEQ ID NO:14).
(151) Deletion mutants can be produced by eliminating portions of the coding region of the guaA gene so that proper folding or activity of GuaA is prevented. For example, about 25 to about 1500 bp, about 75 to about 1400 bp, about 100 to about 1300 bp, or all of the coding region can be deleted. Alternatively, the deletion mutants can be produced by eliminating, for example, a 1 to 100 bp fragment of the guaA gene so that the proper reading frame of the gene is shifted. In the latter instance, a nonsense polypeptide may be produced or polypeptide synthesis may be aborted due to a frame-shift-induced stop codon. The preferred size of the deletion removes both guaB and guaA, from the ATG start codon of guaB to the stop codon of guaA.
(152) In some embodiments, the guaB gene of S. Enteritidis which encodes IMP dehydrogenase, is 1467 bp in size (GenBank Accession Number NC.sub.O11294.1 (2625485-2626951, complement) (SEQ ID NO:15). In some embodiments, the guaB gene of S. Typhimurium is 1467 bp in size (GenBank Accession Number NC_003197.1 (2624452.2625918, complement) (SEQ ID NO:16). In some embodiments, the guaB gene of S. Paratyphi A is 1467 bp in size (GenBank Accession Number NC_006511.1 (420292.421758) (SEQ ID NO:17). Deletion mutants can be produced by eliminating portions of the coding region of the guaB gene so that proper folding or activity of GuaB is prevented. For example, about 25 to about 1400 bp, about 75 to about 1300 bp, about 100 to about 1200 bp, or all of the coding region can be deleted. Alternatively, the deletion mutants can be produced by eliminating, for example, a 1 to 100 bp fragment of the guaB gene so that the proper reading frame of the gene is shifted. In the latter instance, a nonsense polypeptide may be produced or polypeptide synthesis may be aborted due to a frame-shift-induced stop codon. The preferred size of the deletion removes both guaB and guaA, from the ATG start codon of guaB to the stop codon of guaA.
(153) In some embodiments, the clpP gene of S. Enteritidis, which encodes a serine-protease, is 624 bp in size (GenBank Accession Number NC_011294.1 (482580-483203) (SEQ ID NO:18). In some embodiments, the clpP gene of S. Typhimurium is 624 bp in size (GenBank Accession Number NC_003197.1 (503210.503833) (SEQ ID NO:19). In some embodiments, the clpP gene of S. Paratyphi A is 624 bp in size (GenBank Accession Number NC_006511.1 (2369275.2369898, complement) (SEQ ID NO:20).
(154) Deletion mutants can be produced by eliminating portions of the coding region of the clpP gene so that proper folding or activity of ClpP is prevented. For example, about 25 to about 600 bp, about 75 to about 500 bp, about 100 to about 400 bp, or all of the coding region can be deleted. Alternatively, the deletion mutants can be produced by eliminating, for example, a 1 to 100 bp fragment of the clpP gene so that the proper reading frame of the gene is shifted. In the latter instance, a nonsense polypeptide may be produced or polypeptide synthesis may be aborted due to a frame-shift-induced stop codon. clpP forms an operon with clpX; the preferred size of the deletion encompasses only the downstream clpX gene and extends from the ATG start codon to the stop codon, inclusive.
(155) In some embodiments, the clpX gene of S. Enteritidis, which encodes a chaperone ATPase, is 1272 bp in size (GenBank Accession Number NC_011294.1 (483455-484726) (SEQ ID NO:21). In some embodiments, the clpX gene of S. Typhimurium is 1272 bp in size (GenBank Accession Number NC_003197.1 (504085.505356) (SEQ ID NO:22). In some embodiments, the clpX gene of S. Paratyphi A is 1272 bp in size (GenBank Accession Number NC_006511.1 (2367752.2369023, complement) (SEQ ID NO:23).
(156) Deletion mutants can be produced by eliminating portions of the coding region of the clpX gene so that proper folding or activity of ClpX is prevented. For example, about 25 to about 1200 bp, about 75 to about 1100 bp, about 100 to about 1000 bp, or all of the coding region can be deleted. Alternatively, the deletion mutants can be produced by eliminating, for example, a 1 to 100 bp fragment of the clpX gene so that the proper reading frame of the gene is shifted. In the latter instance, a nonsense polypeptide may be produced or polypeptide synthesis may be aborted due to a frame-shift-induced stop codon. clpP forms an operon with clpX; the preferred size of the deletion encompasses only the downstream clpX gene and extends from the ATG start codon to the stop codon, inclusive.
(157) The fliC gene can be mutated using conventional techniques known in the art. The fliC gene encodes a flagellin protein. In some embodiments, the fliC gene from S. Enteritidis is 1518 bp in size (GenBank Accession Number NC_011294.1 (1146600.1148117) (SEQ ID NO:24). In some embodiments, the fliC gene of S. Typhimurium is 1488 bp in size (GenBank Accession Number NC_003197.1 (2047658.2049145, complement) (SEQ ID NO:25). In some embodiments, the fliC gene of S. Paratyphi A, is 1488 bp in size (GenBank Accession Number NC_006511.1 (989787.991274) (SEQ ID NO:26).
(158) In some embodiments, deletions can be made in any of the loci or genes included herein by using convenient restriction sites located within the loci or genes, or by site-directed mutagenesis with oligonucleotides (Sambrook et al., Molecular Cloning, A Laboratory Manual, Eds., Cold Spring Harbor Publications (1989)).
(159) In some embodiments, inactivation of the loci or genes can also be carried out by an insertion of foreign DNA using any convenient restriction site, or by site-directed mutagenesis with oligonucleotides (Sambrook et al., supra) so as to interrupt the correct transcription of the loci or genes. The typical size of an insertion that can inactivate the loci or genes is from 1 base pair to 100 kbp, although insertions smaller than 100 kbp are preferable. In some embodiments, the insertion can be made anywhere inside the loci or gene coding regions or between the coding regions and the promoters. In some embodiments, the bacterial loci and genes are mutated using Lambda Red-mediated mutagenesis (see, e.g., Datsenko and Wanner, PNAS USA 97:6640-6645 (2000)).
(160) While the invention has been described with reference to certain particular examples and embodiments herein, those skilled in the art will appreciate that various examples and embodiments can be combined for the purpose of complying with all relevant patent laws (e.g., methods described in specific examples can be used to describe particular aspects of the invention and its operation even though such are not explicitly set forth in reference thereto).
EXAMPLES
Example 1
Preparation and Testing of Conjugates Comprising Surface Polysaccharides and Flagellin Proteins
(161) Reagent strain to purify heterologous flagellinsWe have created a recombinant reagent strain that can be used to purify large amounts of heterologous flagellin by deleting fliC from the S. Enteritidis reagent strain CVD 1943. The new reagent strain S. Enteritidis R11 guaBA clpP fliD fliC is designated CVD 1947. Heterologous fliC genes can subsequently be cloned into pGEN206 (Stokes M G et al., Infection and Immunity, 2007; 75(4):1827-1834), a low copy number highly stable plasmid and introduced into CVD 1947. Development of scalable upstream and downstream bioprocesses for obtaining purified flagellins and OPSRobust, scalable, high yield and generalized purification methods have been developed to purify OPS and flagellins. We have developed and confirmed broadly applicable and scalable downstream manufacturing processes to purify secreted flagellins from culture supernatants, and OPS from bacterial cells using common bioprocess methods and equipment. We have also confirmed performance at 20 L scale for two different Salmonella serovar (Typhimurium and Enteritidis) where we can reliably purify to near homogeneity >150 mg of flagellin/L of supernatant, and 3 mg of COPS/g wet cell paste. By using fully chemically defined medium that does not contain any exogenous biological material (e.g., peptides, proteins), all biological components originate from the bacterial strain, thus further simplifying flagellin purification. Notably, we have found that secreted flagellin represents the major (>90%) detectable protein species in fermentation culture supernatant (
(162) TABLE-US-00001 TABLE 1 Immunogenicity of COPS:FliC conjugate vaccines in CD-1 mice and protective efficacy against lethal challenge with wild-type S. Enteritidis R11.sup.a Anti-FliC Anti-LPS GMT Anti-FliC GMT Anti-LPS Mortality.sup.c Vaccine Vaccine (EU.sup.d/ml) Seropositive.sup.b (EU/ml) Seropositive.sup.b (dead/total) Efficacy PBS 101 0 82 0 12/13 COPS:FliC 8,735,020 100% 223 39% .sup.3/13.sup.d 75.0% CDAP COPS:FliC 9,548,869 100% 392 40% .sup.2/13.sup.d 83.3% Oxime .sup.aIP LD.sub.5 10.sup.5 CFU. .sup.bDefined as 4-fold the GMT in mice immunized with PBS .sup.cMice challenged i.p. with 1 10.sup.6 CFU .sup.dp < 0.001 vs. PBS control animals by Fisher's exact test. .sup.dELISA Units
(163) We also examined the effect of different COPS:FliC conjugate vaccine doses on immunogenicity and efficacy (Chu C Y, Infect Immun. 1991; 59(12):4450-4458). Maximal levels of anti-flagellin IgG and 100% seroconversion (4-fold vs. PBS geometric mean titers [GMT]) were achieved at doses 0.25 g of COPS:FliC. Mice immunized at the lowest dose of 0.025 g COPS:FliC also displayed a significantly higher GMT of anti-FliC IgG compared to mice receiving PBS, but with sub-maximal levels and several animals failing to produce detectable anti-FliC IgG (75% seropositive). We further observed that anti-flagellin IgG end-point titers were significantly higher than anti-LPS IgG levels in COPS:FliC immunized mice at all doses tested. Immunization with COPS:FliC doses of 10 g and 2.5 g elicited GMT's of 885 EU/ml and 308 EU/ml respectively, whereas immunization with doses of 0.25 g and 0.025 g resulted in GMT's of <80 EU/ml. Notably, whereas infection with 110.sup.6 CFU of S. Enteritidis caused 100% mortality in the PBS control group, mice immunized with 0.025 g, 0.25 g, 2.5 g or 10 g of COPS:FliC were all significantly protected (90% vaccine efficacy). We also found that conjugation can reliably reduce TLRS stimulatory capacity, and that TLRS activity was dispensable for immunogenicity. Our findings are in agreement with those reported for flagellin immunization experiments in TLRS-deficient mice, where anti-flagellin titers obtained were comparable to wild-type mice (Sanders C J et al., Eur J Immunol. 2009; 39(2):359-371). Vaxinnate Corporation has reported measurable rates of adverse events at low dosage levels for their TLRS stimulatory flagellin-based fusion proteins with influenza antigens (Turley C B et al., Vaccine. 2011; 29(32):5145-5152). Hence, we will aim to abolish TLR5 activity in our conjugates, as we have successfully done previously (Simon R, Infect Immun. 2011; 79(10):4240-4249). Functional Activity of Vaccine Induced Antibodies
(164) I. Opsonophagocytosis. Pooled sera from mice immunized with COPS:FliC were able to cause uptake of wild-type and invA (invasion)-deficient S. Enteritidis R11 into J774 cultured mouse macrophage cells. Uptake was reduced in the absence of bacterial expression of either flagellin (fliC) or long-chain OPS (rfaL) components present in the vaccine (
(165) II. Passive transfer. Passive immunization of naive mice with sera from mice immunized with 10 g of COPS:FliC produced >80% protection against lethal S. Enteritidis challenge, whereas mice receiving normal sera or PBS succumbed to infection, demonstrating that protection can be mediated in vivo by vaccine induced antibodies (TABLE 2).
(166) TABLE-US-00002 TABLE 2 Efficacy of passive transfer into nive mice of sera from mice immunized with COPS:FliC. Protection of mice from lethal challenge with wild-type S. Enteritidis R11.sup.a Mortality Treatment (dead/total) PBS 5/6 Normal serum 7/7 COPS:FliC serum 1/7.sup.b .sup.aMice challenged IP with 5 10.sup.5 CFU .sup.bp = 0.005 compared to normal serum by 2-tailed Fisher's exact test. Development of opsonophagocytic antibody (OPA) assaysWe have developed and validated a high-throughput flow cytometry based OPA uptake assay using GFP-expressing PA (
polysaccharide vaccines (Romero-Steiner S et al., Clin Diagn Lab Immunol. 1997; 4(4):415-422) to measure functional antibodies elicited by S. Typhimurium vaccines. This assay uses baby rabbit complement as a complement source and HL-60 cells as phagocytes. The OPA titer is defined as the titer of sera that results in greater than 50% killing of bacteria following opsonophagocytosis. As shown in
(167) Research Design for KP and PA strainsGenetically engineered Klebsiella pneumoniae reagent strains are created to improve occupational safety for large scale fermentation, and simplify and enhance OPS purification and yields. GuaBA from K pneumoniae O1, O2, O3 and O5 strains is deleted using lambda red recombination (Datsenko K A, Wanner B L., Proc Natl Acad Sci USA. Jun. 6 2000; 97(12):6640-6645). Capsule synthesis (cps) gene cluster is deleted from the four guaBA mutants. CPS mutation serves two purposes: 1) It is a secondary independently attenuating mutation that safeguards against the possibility of reversion to virulence; and 2) purification of core-O polysaccharide will be simpler as there will be no contaminating capsular polysaccharide.
(168) The genes encoding PA flagellins FlaA and FlaB are cloned into pSEC10, a highly stable low copy number plasmid, and then transform the plasmids into our S. Enteritidis reagent strain CVD 1947. The reagent strains grow in chemically defined minimal media and secrete large amounts of PA flagellin is confirmed by performing SDS-PAGE and western blots of culture supernatant.
(169) Reagents strains are grown in 5 L fermentation culture, as optimization at this scale is generally translatable to larger volumes (e.g., 50 L-1,000 L). KP reagent strain fermentation is optimzed with rich media to supply an optimal environment for growth, making use of animal product free formulation to comply with FDA regulations for biologics. PA-Fla CVD 1947 expression vectors is grown in fully chemically defined minimal media to reduce the contaminant background, as the PA-Fla product will be in the supernatant. KP OPS and PA-Fla purification is conducted with previously optimized biochemical purification protocols that we developed for Salmonella COPS and FliC. Products are tracked through the process using standardized assays, and are verified to meet the following release parameters (TABLE 3):
(170) TABLE-US-00003 TABLE 3 Lot release parameters for purified KP COPS and PA flagellins COPS Flagellin Parameter limit (assay) limit (assay) Residual <1% (BCA) <1% (HPLC-SEC host cell protein with UV, SDS-PAGE) Residual nucleic acid <1% (A260 nm) <1% (Quant-IT) Residual endotoxin <150 EU/g (LAL) <150 EU/g (LAL) Identity Conform to standards Expected size by (HPAEC-PAD, Western blot ELISA) Size/Weight HPLC-SEC HPLC-SEC with UV, with RI SDS-PAGE Construction of K. pneumoniae reagent strainsWe genetically engineered Klebsiella pneumoniae reagent strains to improve occupational safety for large scale fermentation, and simplify and enhance COPS purification and yields. We deleted guaBA from K. pneumoniae O1, O2, O3 and O5 strains using lambda red recombination. We also deleted the capsule synthesis (cps) gene cluster from the four guaBA mutants. CPS mutation will serve two purposes: 1) It is a secondary independently attenuating mutation that safeguards against the possibility of reversion to virulence; and 2) purification of core-O polysaccharide will be simpler as there will be no contaminating capsular polysaccharide.
(171) We used lambda red recombination to delete guaBA (for attenuation) and the capsule (cps) gene cluster from the following KP strains: B5055 (O1:K2), 7380 (O2ab:K-), 390 (O3:K11) and 4425/51 (O5:K7). We have genetically engineered the B5055 (O1) and 7380 (O2ab) Klebsiella strains and have deleted guaBA and cps genes, as necessary. We have also created the 390 (O3) guaBA mutant. See Table 4.
(172) TABLE-US-00004 TABLE 4 CVD genetically engineered KP reagent strains Strain Parent O K designation strain type type guaBA CPS Notes CVD 3000 B5055 1 2 + Completed CVD 3001 B5055 1 2 Completed CVD 3010 7380 2 Naturally Completed Deficient CVD 3020 4425 5 57 In progress CVD 3030 390 3 11 In progress
(173) The primers used for the genetic engineering are shown in Table 5:
(174) TABLE-US-00005 Name Target Purpose Primersequences(5->3) guaBA_676_F B5055 guaBA GGGTAGATGATCACCGGCAG (SEQIDNO:27) guaBA_688_R B5055 guaBA TGATTGGTCTGACTGGACGC (SEQIDNO:28) guaBA_155_R B5055 guaBA GGAAGCCAGTGGGATCTGAC (SEQIDNO:29) guaBA_256_F B5055 guaBA CTGATCCAAACCTGGCCCAT (SEQIDNO:30) guamut_F B5055 guaBA GGTCGACGGATCCCCGGAAT GGAGTAATCCCCGGCGTTAG (SEQIDNO:31) guamut_R B5055 guaBA GAAGCAGCTCCAGCCTACAC GGGCAATATCTCGACCAGGG (SEQIDNO:32) guaA_R2 390- guaBA CATACACCACGCGGGAGATA 4425/51- (SEQIDNO:33) 7380 guaA_mut_F2 390- guaBA GGTCGACGGATCCCCGGAATGC 4425/51- TAGCCGCGTTTTCGTGGAAGTG 7380 (SEQIDNO:34) guaB_F2 390- guaBA GTCCTCCTCGTTCCCGCT 4425/51- (SEQIDNO:35) 7380 guaB_mut_R2 390- guaBA GAAGCAGCTCCAGCCTACACGAA 4425/51- TTCCATCTTTACAGGCGTTCGGT 7380 (SEQIDNO:36) wza_F B5055 wzabc GAGCCGACTCTAGGGTGGC 4425/51 (SEQIDNO:37) wza wza_R B5055 wzabc GAAGCAGCTCCAGCCTACAC 4425/51 TAATGTCACATCATCAGTAA wza ATCAAAATTTG (SEQIDNO:38) K2_wzc_F B5055 wzabc GAAGCAGCTCCAGCCTACAC wzc GTAATAGATATGTTATAGAG TTTGGAGGGGAG SEQIDNO:39) K2_wzc_R B5055 wzabc TATTTAATTTCCCTCTTTCAT wzc CCTGTAATGTT (SEQIDNO:40) K11_wzc_F 390 wzabc GGTCGACGGATCCCCGGAAT wzc TGTTTCAAGATTATATATTT CGATGCCTAATG (SEQIDNO:41) K11_wzc_R 390 wzabc TCCTTAGTATAAAGTTGAGA wzc GATTTCTGATTC (SEQIDNO:42) K57_wzc_F 4425/51 wzabc GGTCGACGGATCCCCGGAAT wzc GAATCGGATGATATCGATTT AGGTAAAATTGT (SEQIDNO:43) K57_wzc_R 4425/51 wzabc GCTAATAGCTTTCAAACGAC wzc TTATATAGGTTA (SEQIDNO:44) P1 pKD13- Kan- GTGTAGGCTGGAGCTGCTTC kan cassette (SEQIDNO:45) P4 pKD13- Kan- ATTCCGGGGATCCGTCGACC kan cassette (SEQIDNO:46) Deletion of guaBA from K. pneumoniae B5055DNA was first purified from B5055 with the Qiagen DNEasy Blood and Tissue kit according to the manufacturer's protocol. DNA upstream of guaA was amplified using the following primers that produce a 688 bp DNA fragment (KP_guamut_F: 5-GGTCGACGGATCCCCGGAATGGAGTAATCCCCGGCGTTAG-3 (SEQ ID NO:31); KP guaBA_688_R: 5-TGATTGGTCTGACTGGACGC-3 (SEQ ID NO:28)). DNA downstream of guaB was amplified using primers that produce a 676 bp DNA fragment (KP guaBA_676_F: 5-GGGTAGATGATCACCGGCAG-3 (SEQ ID NO:27); KP_guamut_R: 5-GAAGCAGCTCCAGCCTACACGGGCAATATCTCGACCAGGG-3 (SEQ ID NO:32)). PCR amplification of the guaA/guaB flanking regions was conducted using Vent polymerase. PCR products were electrophoresed on a 1% agarose gel and extracted and purified with a Qiagen Gel extraction kit according to the manufacturer's protocol. The PCR products were combined in an overlapping PCR reaction using a Kan cassette amplified from pKD13 as described by Datsenko and Wanner. The PCR product of 2.4 kb was gel extracted and amplified with guaBA_676_F/guaBA_688_R before transformation. Electrocompetent B5055 cells were transformed by electroporation with pKD46. Electrocompetent cells of K. pneumoniae B5055 expressing lambda red recombinase were prepared and electroporated with the 2.4 kb PCR product. Kanamycin resistant colonies were selected and screened for integration of the Kanamycin resistance cassette. The Kanamycin resistance cassette was subsequently deleted using pCP20 that removes the cassette via the FRT sites present in the sequence. To remove pCP20, cells were grown at 42 C. and tested after each passage for loss of Carbenicillin or Chloramphenicol resistance. Deletion of capsule genes from K. pneumoniae B5055The genes encoding capsule synthesis in K. pneumoniae B5055 were also deleted using lambda red recombination. DNA downstream of wza was amplified using the following primers that produce a 600 bp DNA fragment (wza_F: 5-GAGCCGACTCTAGGGTGGC-3 (SEQ ID NO:37); wza_R: 5-GAAGCAGCTCCAGCCTACACTAATGTCACATCATCAGTAAAT CAAAATTTG-3 (SEQ ID NO:38)). Primers for the other flank amplify a region inside wzc itself since it is specific for the capsule type while the surrounding regions are highly variable between different capsule types. The primers (K2_wzc_F: 5-GGTCGA CGGA TCCCCGGAA TGTAATAGATATGTTATAGAGTTTGGAGGGGAG-3 (SEQ ID NO:39); K2_wzc_R: 5-TATTTAATTTCCCTCTTTCATCCTGTAATGTT-3 (SEQ ID NO:40)) produced a 600 bp fragment. The same procedure as used for the guaBA mutagenesis were used.
(175) Schematic diagrams of the guaBA and wzabc genetic regions of K. pneumoniae are shown in
(176) The capsule deletion was assessed by India Ink staining and microscopic observation of the parental and mutant strain. The K. pneumoniae B5055 guaBA wzabc strain showed no evidence of capsule whereas the wild-type strain was capsule positive.
(177) We have confirmed the guanine auxotrophy phenotype by growing the recombinant strains on minimal media containing or lacking guanine (
(178) TABLE-US-00006 TABLE 6 Verification of attenuation of KP reagent strain in vivo. Strain 50% lethal dose Wild-type B5055 5.34 10.sup.3 CFU B5055 guaBA wzabc (CVD 3001) >10.sup.8 CFU Construction of recombinant S. Enteritidis that express Type A and B flagella from P. aeruginosaWe cloned flaA from P. aeruginosa PAK which encodes Type A flagella (40 kDa) into pSEC10, a low copy number highly stable plasmid. We also cloned flaB from P. aeruginosa PAO1 which encodes Type B flagella (52 kDa) into pSEC10. The recombinant plasmids were transformed separately into CVD 1947 (S. Enteritidis R11 guaBA clpP fliD fliC) to create reagent strains capable of expressing large amounts of Type A or B flagellin. Mutagenesis was verified by PCR and sequencing upstream and downstream of the deletion. Secretion of Type A or B flagella was verified by SDS-PAGE.
(179) The fliC gene was amplified from P. aeruginosa PAK using primers PAK_fliC_F and PAK_fliC_R and cloned into pSEC10 so that it is expressed using the PompC promoter. Likewise, the fliC gene was amplified from P. aeruginosa PAO1 using primers PAO1_fliC_F and PAO1_fliC_R and cloned into pSEC10 so that it is expressed using the PompC promoter. Primers used for cloning are shown in Table 4. Schematic diagrams of the resultant plasmids pSEC10-flaA and pSEC10-flaB are shown in
(180) TABLE-US-00007 TABLE7 PrimersusedforcloningofP.aeruginosafliCgenesinpSEC10. Name Strain Restrictionsite Sequence(5-3) PAK_fliC_F PAK BamHI TATCTAGGATCCATGGCCT TGACCGTCAACAC (SEQIDNO:47) PAK_fliC_R PAK NheI CTAAGTGCTAGCAAGCTT AGCGCAGCAGGCT (SEQIDNO:48) PAO1_fliC_F PAO1 BamHI ACTTGCGGATCCATGGCC CTTACAGTCAAACG (SEQIDNO:49) PAO1_fliC_R PAO1 NheI ATTAGCGCTAGCCGTGAG TGACCGTTCCCG (SEQIDNO:50) Construction of the reagent strain S. Enteritidis CVD1947We previously used Salmonella Enteritidis CVD 1943 (R11 guaBA clpP fliD) to express large amounts of flagellin into the supernatant. We genetically engineered this strain so that it no longer expresses native fliC. The objective is to use this strain to express exogenous fliC from a plasmid and which is secreted into the supernatant. We used lambda red recombination to delete the fliC gene. To ensure transcription of downstream genes after deletion of fliC in CVD 1943, the kanamycin cassette from pKD4 was used since it allows conservation of multiple promoter sites in the scar region after removing the kanamycin cassette from the genome. The primers shown in Table 5 were used to create a construct by overlapping PCR containing the Kanamycin cassette flanked by DNA upstream and downstream of fliC. Primers R11_fliC_up_F3 and R11_all_up_R3 amplify a 259 bp fragment upstream of fliC. R11_fliC_dwn_F3 and R11_fliC_dwn_R3 amplify a 301 bp fragment downstream of fliC. The fliC gene was subsequently deleted using lambda red recombination.
(181) TABLE-US-00008 TABLE8 PrimersusedformutagenesisofSalmonellaEnteritidisCVD1947. Name Target Sequence(5-3) P1 pKD4 GTGTAGGCTGGAGCTGCTTC (SEQIDNO:51) P2 pKD4 CATATGAATATCCTCCTTA (SEQIDNO:52) R11_filC_up_F3 R11 CCATGCCATCTTCCTTTCG (SEQIDNO:53) R11_all_up_F3 R11(P1 GAAGCAGCTCCAGCCTACACG cpt) ATCTTTTCCTTATCAATTACAA CTTG(SEQIDNO:54) R11_filC_down_F3 R11(P2 TAAGGAGGATATTCATATGATC cpt) CGGCGATTGATTCAC (SEQIDNO:55) R11_filC_down_R3 R11 TGGTAATTTAATCTCCCCCCA (SEQIDNO:56)
(182) We verified the deletion of fliC in CVD 1947 by sequencing the deletion. The entire fliC gene was deleted (
(183) The pSEC10-flaA and pSEC10-flaB plasmids were transformed into S. Enteritidis CVD 1947. We confirmed that CVD1947 (pSEC10-flaA) and CVD 1947 (pSEC10-flaB) can express FlaA and FlaB in the supernatant where they demonstrated the approximate predicted molecular weight of 45 kDa and 50 kDa respectively by SDS-PAGE and coomassie analysis (
(184) The identity of the final purified O1 OPS was accomplished by depolymerization with 2M Trifluoroacetic acid and analysis of the monosaccharide constituents by high-performance anion-exchange chromatography with pulsed amperometric detection (HPAEC-PAD) (
(185) Dot blot analysis of the conjugate and unconjugated polysaccharide confirmed reactivity of the conjugate with sera from mice administered CVD 3001 (KP O1 reagent strain deleted for guaBA and capsule synthesis genes). A robust signal was seen for the conjugate, whereas the polysaccharide did not bind the membrane as no protein component was present that is required for binding, thus confirming that conjugated saccharide was reactive with the anti-O1 antibodies (
(186) Flagellins have been found as effective carrier proteins, however, the majority of licensed conjugate vaccines use established vaccine proteins as carriers (e.g., TT, diphtheria toxoid)(Knuf M, Vaccine. 2011; 29(31):4881-4890), that are already administered separately as vaccine antigens, and for which immunity from the carrier protein is not a basis for licensure (Knuf M, Vaccine. 2011; 29(31):4881-4890). The exception is the GlaxoSmithKline 10-valent pneumococcal conjugate vaccine Synflorix that uses Haemophilus influenzae protein D as a carrier protein to extend protection against non-typeable H. influenzae acute otitis media (Forsgren A et al., Clin Infect Dis. 2008; 46(5):726-731; Prymula R, Schuerman L, Expert Rev Vaccines. 2009; 8(11):1479-1500). Two major challenges are thus addressed by our development approach. First, we will confirm induction of functional immunity by both the polysaccharide hapten and protein carrier Immunogenicity and functional efficacy for OPS and Fla induced antibodies will likely be influenced by physicochemical conjugate structure. The size, structure, and level of solvent accessible protein and polysaccharide residues have been documented to influence coupling site preference in glycoconjugates (Bardotti A et al., Vaccine. 2008; 26(18):2284-2296); this could affect functional immunogenicity if important protective epitopes are the preferential sites of linkage. A minimal level of vicinial polysaccharide epitopes is necessary to cross-link B-cell receptors (BCR). We have found that conjugation of equal weights of COPS and flagellin produces linkage ratios that are immunogenic (Simon R, Infect Immun. 2011; 79(10):4240-4249; Raphael Simon J Y W et al., PLOS ONE. 2013; 8(5): e64680). Lattice type conjugates provide larger surfaces for BCR cross-linking, however, CDAP activation also alters polysaccharide linkage point epitopes. End-linkage with oxime chemistry does not alter PS epitopes, but forms smaller conjugates. By screening COPS conjugates made with different chemistries and PA Fla types, we expect to identify optimal monovalent conjugate formulations. Secondly, possible interference between individual components is a recognized pitfall of multivalent vaccine formulations. Thus, it will be confirmed that the immunogenicity and efficacy of individual component OPS and flagellin antigens are preserved when combined into a quadrivalent formulation. By identifying in animals optimally immunogenic and protective monovalent conjugate architectures and confirming immunogenicity when co-formulated, effective quadrivalent formulations will be produced.
(187) Prior to undertaking a quadrivalent conjugate screen, proof-of-concept will first be established for a single candidate monovalent antigen KP-OPS:PA-Fla conjugate type synthesized with material purified from shake flask cultures. Accordingly, we will construct candidate conjugates of KP O1 OPS with type A PA flagellin, as both of these types have been reported extensively as protective vaccine antigens using well characterized challenge strains and infection models. We will generate a sun-type KP-O1-OPS:PA-FlaA conjugate using oxime chemistry as well as a lattice type conjugate using CDAP, and immunize mice (n=30/group) 3 times at 28 day intervals with PBS, KP-O1-OPS:PA-FlaA conjugates, or O1 OPS alone or admixed with FlaA. We will assess the kinetics and induction of anti-LPS and anti-Fla antibody responses by measuring the level of vaccine induced IgG antibodies in sera before immunization and 21 days after each vaccine dose by ELISA with purified antigens, and by measuring functional activity using motility inhibition and OPA assays. We will determine whether KP-O1-OPS:PA-FlaA conjugates are protective against infection, by challenging IP with KP (n=15/group) or in burn wound infections with PA (n=15/group), as protection mediated by these KP and PA antigens is best established with these challenge routes. For challenge studies, we will use PA PAK that is a type A flagellin-expressing isolate or KP B5055 that is an encapsulated O1:K2 isolate, as both have been used extensively as challenge strains for vaccine studies in mice (
(188) The conjugate type demonstrating the best immunogenicity and protection in will be assessed for protection against Klebsiella pneumoniae (KP) B5055 or Pseudomas aeruginosa (PA) PAK administered by several routes of infection (burn, myositis, punch wound, or IP septicemia). Mice (n=120/group) will be immunized 3 times at 28 day intervals with PBS or KP-O1-OPS and PA FlaA conjugated or admixed. Preimmune sera and sera obtained 21 days after the final vaccination will be assessed for functional and binding antibodies with homologous antigens and strains. Mice (n=15/group) will be infected (wound and IP) with PA or KP (
(189) We will generate 16 different candidate conjugates by linking the individual KP OPS serotypes using CDAP or oxime chemistry to FlaA or FlaB, using material obtained from fermentation cultures. The two monovalent KP-O1-OPS:PA-FlaA CDAP and oxime conjugate types created above will be included for confirmation of previous results. This conjugate panel will be tested individually in mice by immunizing with 3 doses spaced 28 days apart (n=30/group). Pre-immune sera and sera taken 21 days after the final dose will be assessed for homologous anti-LPS and anti-flagellin IgG levels by ELISA and functional antibodies by OPA or motility inhibition assays. We will screen for functional efficacy of vaccine-elicited antibodies in vivo by measuring protection against IP infection with the homologous KP O type expressing strain (O1: B5055; O2, O3 and O5: recombinant mouse virulent strains that we will generate; n=15/group), and burn wounds with the homologous flagellin expressing PA strain (n=15/group)(
(190) A single monovalent conjugate from each OPS type will subsequently be selected for inclusion in a quadrivalent formulation based on the following ranked criteria: 1) anti-LPS IgG levels and KP OPA antibody titers, 2) anti-flagellin IgG and functional anti-PA antibody titers, 3) protective efficacy, 4) regulatory and manufacturing considerations (yield, ease of synthesis, epitope preservation, and regulatory precedent). We place anti-OPS responses as more critical than anti-flagellin responses in our go/no-go decision tree, as moderate anti-flagellin immune responses could be compensated for in a final formulation by the inclusion of multiple conjugates that utilize the same flagellin protein carrier. The final quadrivalent conjugate formulation will include minimally at least one conjugate made with each flagellin type, and would be anticipated to impart high IgG antibody levels to both flagellin types. We recognize as well that mouse protection studies may not always fully recapitulate the true pathogenicity of a given bacterial strain in humans, nor fully approximate the mechanisms of protective immunity. This is particularly true for KP, as numerous examples exist of human clinical isolates that demonstrate poor pathogenicity in mice (Struve C, Krogfelt K A, Environ Microbiol. 2004; 6(6):584-590; Simoons-Smit A M, J Med Microbiol. 1984; 17(1):67-77; Yu V L, Emerg Infect Dis. 2007; 13(7):986-993). Hence, while protection is one important measure of down-selection and is expected to approximate vaccine performance in humans, we place greater credence on the capacity to induce robust seroconversion levels and high titers in our chosen functional antibody assays, as these are the anticipated correlates and mechanisms of protection for humans.
(191) To confirm that the specific immune responses to FlaA and FlaB are maintained when co-formulated, mice will be immunized 3 times at 28 day intervals with monovalent (n=15/group) and bivalent (n=30/group) flagellin preparations. Levels of IgG and functional titers for the homologous Ha types will be determined in pre-immune sera and sera taken 21 days after the final dose. Protection will be assessed against burn infection with homologous Fla expressing PA strains (n=15/group)(
(192) An assay will be conducted to confirm that the humoral responses and protective efficacy of the 4 down-selected monovalent COPS and flagellin conjugate vaccine components are maintained when administered as a multivalent vaccine formulation. Mice (n=240/group) will be immunized 3 times at 28 day intervals with PBS or the quadrivalent formulation, or 2 individual monovalent conjugates (n=120/group)(
(193) We will assess the utility of the quadrivalent conjugate formulation to generate antibody preparations that can be used therapeutically as IVIG. For this, rabbits will be hyper-immunized with quadrivalent vaccine and pooled sera will be prepared for use in passive transfer studies in mice. The level of anti-LPS and anti-flagellin IgG in rabbit sera will be determined by ELISA, as well as functional antibody titers by OPA and motility inhibition assays. Dosage levels will be approximated to the antibody titer induced by active immunization in mice. Naive mice (n=30/group) will be intravenously administered immune sera, normal (unimmunized) rabbit sera (N.S.), or PBS, followed by IP or burn infection 2-4 hours later with KP B5055 or PA PAK, respectively (
(194) The 50% effective dose (ED.sub.50) for various doses of KP B5055 O1:1(2 and PA PAK are determined by infecting at various doses at multiple wound sites in naive pigs. Once a reliable infectious dose is determined, 4 pigs 3 times are immunized with PBS or quadrivalent conjugate containing 25 g of total polysaccharide, as this approximate COPS dose was used successfully in human clinical trials for Shigella (Passwell J H, Infect Immun. 2001; 69(3):1351-1357; Cohen D, Infect Immun. 1996; 64(10):4074-4077), S. Paratyphi A (Konadu E Y, Infect Immun. 2000; 68(3):1529-1534), and E. coli (Ahmed A et al., J Infect Dis. 2006; 193(4):515-521) COPS conjugates. As controls, 2 pigs are mock immunized with PBS alone. Twenty-one days after the final dose, immunized (2 /individual pathogen) or control pigs (1/individual pathogen) are infected at multiple sites with moderate or high levels of KP B5055 of PA PAK (
(195) While there have been shown and described what are presently believed to be the preferred embodiments of the present invention, those skilled in the art will realize that other and further embodiments can be made without departing from the spirit and scope of the invention described in this application, and this application includes all such modifications that are within the intended scope of the claims set forth herein. All patents and publications mentioned and/or cited herein are incorporated by reference to the same extent as if each individual publication was specifically and individually indicated as having been incorporated by reference in its entirety.