KAS-III FREE FA SYNTHESIS
20180148746 ยท 2018-05-31
Inventors
Cpc classification
C12P7/6463
CHEMISTRY; METALLURGY
C12Y301/02014
CHEMISTRY; METALLURGY
C12Y402/01017
CHEMISTRY; METALLURGY
C12Y203/01041
CHEMISTRY; METALLURGY
C12Y103/01009
CHEMISTRY; METALLURGY
C12N9/1029
CHEMISTRY; METALLURGY
International classification
C12P7/64
CHEMISTRY; METALLURGY
Abstract
The present disclosure describes a genetically engineered a KASIII-independent fatty acid biosynthetic pathway that makes use of the promiscuous nature of the rest of the FAS enzymes (3-ketoacyl-ACP synthetase, 3-ketoacyl-ACP reductase, 3-hydroxyacyl ACP dehydrase, enoyl-ACP reductase) to bypass the KASIII step by providing a Co-A precursor of two or higher than two carbons (such as the four carbon butyryl-CoA) as the starting molecule. Since many CoA-based starter molecules can be supplied for the fatty acid synthesis, much more diversified products can be obtained with various carbon-chain lengths. As such, this disclosure will serve as a powerful and efficient platform to produce low to medium chain length products carrying many different functional groups.
Claims
1. A method of making functionalized fatty acids, comprising: a) growing a genetically engineered microbe in a medium for a time sufficient to allow production of a functionalized fatty acid, said microbe comprising: i) a -ketoacyl-acyl carrier protein synthase III (KASIII) independent fatty acid synthesis (FAS) pathway that makes a product from a functionalized primer (excluding acetyl-CoA or propionyl-coA) using FAS enzymes (except for KASIII); ii) said microbe having an overexpressed acyl ACP thioesterase (TE); iii) said microbe having an overexpressed 3-ketoacyl-ACP synthetase (EC 2.3.1.41), 3-ketoacyl-ACP reductase (EC 1.1.1.100), 3-hydroxyacyl ACP dehydrase (EC 4.2.1.17), enoyl-ACP reductase (EC 1.3.1.9), and Co-A transferase (EC 2.8.3.8); and, b) isolating said functionalized fatty acid, wherein said functionalized fatty acid is a branched fatty acid, a hydroxy fatty acid, a halogenated fatty acid, an unsaturated fatty acid, or an amino fatty acid.
2. The method of claim 1, wherein a functionalized primer or functionalized starter molecule for fatty acid synthesis is added to said medium.
3. The method of claim 1, wherein a functionalized starter molecule is added to said medium, and wherein said microbe comprises one or more overexpressed enzymes for activating said functionalized starter molecule with CoA to make a functionalized primer molecule.
4. The method of claim 1, wherein a functionalized primer is made by said microbe and said microbe also comprises one or more overexpressed enzymes for synthesizing said functionalized primer.
5. The method of claim 1, wherein said microbe comprises a reduced activity of KASIII (KASIII.sup.).
6. The method of claim 1, wherein said microbe comprises a null mutant of KASIII (KASIII).
7. The method of claim 1, the microbe comprising: a) overexpressed -ketothiolase, acetoacetyl-CoA reductase, trans-enoyl-coenzyme A reductase, and either 3-hydroxyacyl-ACP dehydrase or crotonase, or an expression construct(s) overexpressing -ketothiolase, acetoacetyl-CoA reductase, trans-enoyl-coenzyme A reductase, and either 3-hydroxyacyl-ACP dehydrase or crotonase; or b) overexpressed propionyl-CoA synthase or an expression construct overexpressing propionyl-CoA synthase.
8. The method of claim 7, said microbe further comprising reduced KASIII activity.
9. The method of claim 7, said microbe further comprising KASIII.
10. A genetically engineered microbe comprising: a) a -ketoacyl-acyl carrier protein synthase III (KASIII) independent fatty acid synthesis (FAS) pathway that makes a product from a primer excluding acetyl coA or propionyl-coA using FAS enzymes (except for KASIII); b) said microbe having an overexpressed acyl ACP thioesterase (TE); c) said microbe also having one or more expression vectors overexpressing enzymes selected from the group consisting of 3-ketoacyl-ACP synthetase, 3-ketoacyl-ACP reductase, 3-hydroxyacyl ACP dehydrase, enoyl-ACP reductase, and Co-A transferase.
11. The microbe of claim 10, further comprising KASIII.sup. or KASIII.
12. The microbe of claim 10, further comprising manipulating one or more of genes involved in (1) carbon uptake and glycolysis such as ptsG, (2) TCA cycle such as sucC, (3) various transcription factors regulating such as Crp-CAMP, Rpos, etc. (4) cofactor balance such as NAD/NADH, NADP/NADPH, and CoA/acetyl-CoA, and (5) fatty acid synthesis such as fabB, fabF, fabG, fabI and/or fabZ or their equivalents to improve product production.
13. A method of making a product, comprising: a) growing the microbe of claim 10 in a medium allowing cell growth; b) elongating a starter molecule or primer molecule having 2 or >2 carbons using the FAS enzymes (except for KASIII) to make a product; and, c) isolating said product.
14. The method of claim 13, comprising adding said starter molecule or primer molecule to said medium.
15. The method of claim 13, wherein said primer is produced in vivo by a native pathway or by a genetically engineered pathway.
16. The method of claim 13, wherein said primer or a starter molecule for said primer is supplied to said microbe in a medium for growing said microbe.
17. The method of claim 13, wherein said product is selected from the group consisting of C6-C16 hydroxy fatty acids, C6-C16 amino fatty acids, C6-C16 halogenated fatty acids, C6-C16 branched fatty acids, C6-C16 unsaturated fatty acids, C6-C16 -hydroxy fatty acids, C6-16 ,-dicarboxylic acids, C6-16 ,-diol fatty acids or derivatives thereof.
18. The method of claim 13, wherein said product is C6-C16 -hydroxy fatty acids or derivatives thereof.
19. The method of claim 18, wherein bifunctional ,-dicarboxylic acids are obtained by the oxidation of said -hydroxy fatty acids.
20. The method of claim 18, wherein bifunctional ,-diols are obtained by the reduction of said -hydroxy fatty acids.
21. A genetically engineered microbe having a KASIII-independent FAS pathway that makes a product from a primer using FAS enzymes (except for KASIII), said microbe having an expression vector(s) overexpressing a TE, a 3-ketoacyl-ACP synthetase, a 3-ketoacyl-ACP reductase, a 3-hydroxyacyl ACP dehydrase, an enoyl-ACP reductase, and a Co-A transferase with specificity for said primer, said microbe optionally having KASIII.sup. or KASIII.
22. A genetically engineered microbe having a -ketoacyl-acyl carrier protein synthase III (KASIII) independent fatty acid synthesis (FAS) pathway that makes a product from a starter molecule of >2 carbons or >3 carbons using FAS enzymes (except for KASIII).
23. The microbe of claim 22, having one or more overexpressed enzymes selected from the group consisting of 3-ketoacyl-ACP synthetase, 3-ketoacyl-ACP reductase, 3-hydroxyacyl ACP dehydrase, enoyl-ACP reductase, thioesterase or Co-A transferase.
24. The microbe of claim 22, wherein said starter molecule is produced in vivo by a native pathway or by a genetically engineered pathway.
25. The microbe of claim 22, further comprising reduced native acyl-carrier protein (ACP) dependent fatty acid biosynthesis, malonyl-CoA-ACP transacylase, acetyl-CoA carboxylase or KASIII.
26. A method of making a product; a) growing the microbe of claim 22 in a medium; b) elongating a coA-activated starter molecule having >2 carbons using the FAS enzymes to make a product; and, c) isolating said product.
27. The method of claim 26, further comprising adding said starter molecule to said medium.
28. A recombinant bacteria comprising KASIII.sup., TE.sup.+, PhaA.sup.+, PhaB.sup.+, TER.sup.+, and either FabZ.sup.+ or crt.sup.+.
29. The bacteria of claim 28, further comprising PrpE.sup.+.
30. A method of making a product, comprising: a) growing the microbe of claim 11 in a medium allowing cell growth; b) elongating a starter molecule or primer molecule having 2 or >2 carbons using the FAS enzymes (except for KASIII) to make a product; and, c) isolating said product.
31. A method of making a product, comprising: a) growing the microbe of claim 12 in a medium allowing cell growth; b) elongating a starter molecule or primer molecule having 2 or >2 carbons using the FAS enzymes (except for KASIII) to make a product; and, c) isolating said product.
32. The microbe of claim 23, wherein said starter molecule is produced in vivo by a native pathway or by a genetically engineered pathway.
33. The microbe of claim 23, further comprising reduced native acyl-carrier protein (ACP) dependent fatty acid biosynthesis, malonyl-CoA-ACP transacylase, acetyl-CoA carboxylase or KASIII.
34. The microbe of claim 24, further comprising reduced native acyl-carrier protein (ACP) dependent fatty acid biosynthesis, malonyl-CoA-ACP transacylase, acetyl-CoA carboxylase or KASIII.
35. A method of making a product; a) growing the microbe of claim 23 in a medium; b) elongating a coA-activated starter molecule having >2 carbons using the FAS enzymes to make a product; and, c) isolating said product.
36. A method of making a product; a) growing the microbe of claim 24 in a medium; b) elongating a coA-activated starter molecule having >2 carbons using the FAS enzymes to make a product; and, c) isolating said product.
37. A method of making a product; a) growing the microbe of claim 25 in a medium; b) elongating a coA-activated starter molecule having >2 carbons using the FAS enzymes to make a product; and, c) isolating said product.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
DETAILED DESCRIPTION
[0076] The invention provides a novel method of making fatty acids and various derivatives thereof that is KASIII-independent, thus avoiding the limiting substrate specificity of this initiating enzyme and allowing many more substrates to enter the FAS pathway and thus produced a wide variety of products.
[0077] The invention takes advantage of the remaining promiscuous enzymes of the fatty acid synthesis system (except for the initialization step involving the enzyme -ketoacyl-acyl carrier protein synthase III, or also known as -ketoacyl-ACP synthase III, 3-oxoacyl-ACP synthase III, KASIII, which is highly substrate specific). If desired, any of these genes can be overexpressed, but wild type levels may be sufficient for many purposes.
[0078] The enzymes involved in the fatty acid elongation cycle (3-ketoacyl-ACP synthetase, 3-ketoacyl-ACP reductase, 3-hydroxyacyl ACP dehydrase, enoyl-ACP reductase) have broad substrate specificity. The same set of enzymes can accept a wide range of carbon chain length as a substrate, making the system very versatile in making products of various chain lengths. The same set of enzymes can also accept a wide range of molecules that are derivatives of the usual substrates (such as with those with branched chain, containing additional other functional groups, for example hydroxy group, amine group, halogen, and the like) making the system very versatile in making a set of highly diversified products.
[0079] This invention thus allows us to bypass the gate-keeping step, a reaction catalyzed by the -ketoacyl-acyl carrier protein synthase III aka KASIII, by supplying the cells in vivo with a longer Co-A substrate (more than two carbon), such as butyryl-CoA, or a derivative of the usual substrate, such as an omega functionalized CoA primer, so that the cells can use the existing fatty acid synthesis system to make functionalized and other unusual fatty acids.
[0080] In addition, this invention of synthesizing fatty acids and fatty acid derivatives does not rely on, but can co-exist with, the ACP-based fatty acid elongation cycle. Alternatively, the native KASIII can be down regulated to reduce competition. Knock-out mutants can also be used. Although KASIII mutants grow slowly, they can be grown if supplemented. In fact, we have already created the mutant strain HWK201 (with a KASIII knockout) for use in the invention.
[0081] The 2 C, 3 C, 4 C etc. primer or starter molecule can be supplied to the cell, e.g., in the medium, or the cell can be provided with the enzymes needed to make this primer. An example of providing butyryl-CoA from acetyl-CoA is provided.
##STR00001##
[0082] Below is a table showing an example of steps and enzymes involved for the conversion of acetyl-CoA to butyryl-CoA.
TABLE-US-00003 Examples of typical enzymes for converting acetyl-CoA to various intermediates 1 EC 2.3.1.9, thiolase C. acetobutylicum thlA E. coli atoB R. eutropha phaA 2 EC 1.1.1.157 hydroxybutyryl-CoA dehydrogenase C. acetobutylicum hbd R. eutropha P06-PaaH1 R. eutropha phaB 3 EC 4.2.1.17 crotonase or enoyl-CoA hydratase C. acetobutylicum crt 4 EC 1.3.99.2 butyryl-CoA dehydrogenase C. acetobutylicum bcd & etfAB EC 1.3.1.44 T. denticola, C.a. ter Exmplified GenBank gene in this Accession Strain Gene patent or Gene ID Protein_ID R. eutropha phaA re_phaA 4249783 CAJ92573.1 T. eutropha phaB re phaB 4249784 CAJ92574.1 T. denticola ter td_ter 2741560 AAS11092.1 C. acetobutylicum crt ca_crt 1118895 AAA95967.1 E. coli atoB ec_atoB 946727 AAC75284.1 E. coli fabG ec_fabG 945645 AAC74177.1 E. coli fabI ec_fabI 945870 AAC74370.1 E. coli fabZ ec_fabZ 944888 AAC73291.1 E. coli fabD ec_fabD 945766 AAC74176.1 E. coli fabH ec_fabH 946003 AAC74175.1 E. coli fabA ec_fabA 945568 AAC74040.1 E. coli fabB ec_fabB 946799 AAC75383.1 E. coli acpP ec_acpP 944805 AAC74178.1 E. coli accA ec_accA 944895 AAC73296.1 S. enterica PrpE se_prpE 1251890 AFD57404.1 California Bay Tree UcfatB TE12 M94159.1 P. putida P1 alkJ AJ233397 CAB51051.1 P. putida P1 alkH AJ233397 CAB51050.1 The above genes are exemplary only, and many of the accession numbers are linked to homologs from other species that can be used herein. Further, the use of EC numbers will identify even more homologs.
[0083] Different carbon chain length fatty acids and fatty acid derivatives using the KASIII-independent FAS cycle can be produced by using various acyl-ACP thioesterases (TE) with appropriate substrate specificity, which are expressed in the cell or preferably overexpressed. Examples of the TE enzymes are: Umbellularia californica TE (GenBank #AAC49001), Cinnamomum camphora TE (GenBank #Q39473), Umbellularia californica TE (GenBank #Q41635), Myristica fragrans TE (GenBank #AAB71729), Myristica fragrans TE (GenBank #AAB71730), Elaeis guineensis TE (GenBank #ABD83939), Elaeis guineensis TE (GenBank #AAD42220), Populus tomentosa TE (GenBank #ABC47311), Arabidopsis thaliana TE (GenBank #NP-172327), Arabidopsis thaliana TE (GenBank #CAA85387), Arabidopsis thaliana TE (GenBank #CAA85388), Gossypium hirsutum TE (GenBank #Q9SQI3), Cuphea lanceolata TE (GenBank #CAA54060), Cuphea hookeriana TE (GenBank #AAC72882), Cuphea calophylla subsp. mesostemon TE (GenBank #ABB71581), Cuphea lanceolata TE (GenBank #CAC19933), Elaeis guineensis TE (GenBank #AAL15645), Cuphea hookeriana TE (GenBank #Q39513), Gossypium hirsutum TE (GenBank #AAD01982), Vitis vinifera TE (GenBank #CAN81819), Garcinia mangostana TE (GenBank #AAB51525), Brassica juncea TE (GenBank #ABI18986), Madhuca longifolia TE (GenBank #AAX51637), Brassica napus TE (GenBank #ABH11710), Oryza sativa (indica cultivar-group) TE (GenBank #EAY86877), Oryza sativa (japonica cultivar-group) TE (GenBank #NP-001068400), Oryza sativa (indica cultivar-group) TE (GenBank #EAY99617), and Cuphea hookeriana TE (GenBank #AAC49269), Escherichia coli TE II (ECK0446). Hundreds of TE genes have been clotted and characterized, and can be used herein. See e.g. Jing 2011.
[0084] By long chain acyl-ACP thioesterase, what is meant herein, is that the TE produces a preponderance of long chain (>C12) fatty acids. Preferably, such TE produces more than 50%, >60%, or >70% of a fatty acid >C12.
[0085] By short chain acyl-ACP thioesterase, what is meant herein, is that the TE produces a preponderance of short chain (C12) fatty acids. Preferably, such TE produces more than 50%, >60%, or >70% of a fatty acid C12.
[0086] The disclosed method is capable of producing C4-C20 or C6-C18 hydroxy fatty acids, amino fatty acids, halogenated fatty acids, branched fatty acids, unsaturated fatty acids, or a co-hydroxy fatty acids, bifunctional fatty acids, or derivatives thereof from the engineered pathway.
Vectors
[0087] Plasmid pHWABTC was designed, as an example, to overexpress four genes necessary for the conversion of acetyl-CoA to butyryl-CoA, thus bypassing the normal KASIII entry point. The enzymes exemplified herein are illustrative only, and any enzyme with the same CE number can be employed, and tested to confirm adequate activity.
[0088] A schematic diagram of pHWABTC is shown in
[0089] The schematic diagram of pHWABTZ is shown in
[0090] The PCR fragments were digested by restriction enzymes, BamHI and XbaI, and ligated to plasmid pHWABT, also digested with BamHI and XbaI, to make pHWABTZ. The newly constructed pHWABTZ expressed the -ketothiolase from Ralstonia eutropha H16, acetoacetyl-CoA reductase from Ralstonia eutropha H16, trans-enoyl-coenzyme A reductase from Treponema denticola, and 3-hydroxyacyl-ACP dehydrase from E. coli.
TABLE-US-00004 TABLE1 Theprimersusedinthisexperiment. Primers Sequences pHWABT-fabZ-F GCGCGggatccGAGGAGGACAGCTatgactactaa cactcatac pHWABT-fabZ-R gcgccTCTAGAtcaggcctcccggctacgag
[0091] The schematic diagram of pHWABIZ is shown in
TABLE-US-00005 TABLE2 Theprimersusedinthisexperiment. Primers Sequences pHWABIZ-P-R atggtctgtttcctgtgtgaaa pHWABIZ-P-F ggatccgaggaggacagctat pHWABIZ-I-F aatttcacacaggaaacagaccatgggttttctttcc ggtaa pHWABIZ-I-R atagctgtcctcctcggatccttatttcagttcgagt tcg
[0092] The schematic of pHWAGZI is shown in
[0093] The PCR fragments were digested by restriction enzymes, BamHI and XbaI, and ligated to plasmid pTrc-atoB-TUM3-mch, which was also digested with BamHI and XbaI to make pHWAGM. The fragments of pTrc-atoB-fabG were amplified from pHWAGM. The fabI gene encoding the enoyl-ACP reductase plus RBS and the fabZ gene encoding 3-hydroxyacyl-ACP dehydrase of E. coli plus RBS from E. coli were amplified from the genome of MG1655.
[0094] The three fragments were assembled by the kit of GENEART Seamless Cloning and Assembly Kit to make pHWAGZI. The primers used in this experiment are listed in Table 3. The newly constructed pHWAGZI expressed the acetyl-CoA acetyltransferase, -ketoacyl-ACP reductase, 3-hydroxyacyl-ACP dehydrase, and enoyl-ACP reductase from E. coli.
TABLE-US-00006 TABLE3 Theprimersusedinthisexperiment. Primers Sequences pHWAGM-AtoB-F GCGCcGAGCTCatgaaaaattgtgtcatcgt pHWAGM-AtoB-R gcgccggatccaattcaaccgttcaatca pHWAGM-fabG-F GCGCGggatccGAGGAGGACAGCTatgaattttgaa ggaaaaatcgc pHWAGM-fabG-R gcgccTCTAGAtcagaccatgtacatcccgc pWHAG-F aagcttggctgttttggcggatga pWHAG-R tctagatcagaccatgtacatccc pWHAG-fabZ-F gcgggatgtacatggtctgatctagaagatctgtcg acactagtGAGGAGGACAGCTatgactactaacac tcatac pWHAG-fabZ-R GAATTCTCAGGCCTCCCGGCTACG pWHAG-fabI-F gaggcctgagaattcGAGGAGGACAGCTatgggttt tctttccggtaagc pWHAG-fabI-R atcttctctcatccgccaaaacagcc
[0095] The schematic diagram of pHWBT18Anti-acpP is shown in
[0096] The PCR fragments were digested by restriction enzymes, KpnI and XbaI, and ligated to plasmid pBAD33-SacI.sup., which was also digested with KpnI and XbaI. The plasmid was named pBAD33-SacI.sup.-T18.
[0097] Thirdly, the fragment consisting of terminator, Trc promoter and antisense RNA with paired-termini was amplified from pBSK-antisense. The PCR fragments were digested by restriction enzymes, SalI and SphI, and ligated to plasmid pBAD33-SacI.sup.-T18, also digested with SalI and SphI. The plasmid was named pHWBT18Anti.
[0098] Fourthly, the 127 bp reverse sequence of acpP of E. coli including RBS and some of its front part, from 43 to 84, was amplified from the genome of MG1655. The PCR fragments were digested by restriction enzymes, SacI and XhoI, and ligated to plasmid pHWBT18Anti, also digested with SacI and XhoI. The plasmid was named pHWBT18Anti-acpP. The primers used in this experiment are listed in Table 4.
TABLE-US-00007 TABLE4 Theprimersusedinthisexperiment. Primers Sequences pBAD-SacI-F ggctcggtacccggggatcctctagagtcgac pBAD-SacI-R cgctcggtaccgaattcgctagcccaaaaaaacg ggtat Trc-lacO-18-F GCGCGggtaccgcgcaacgcaattaatgtgagtt agcg Trc-lacO-18-R GCGGCtctagattaggcgctttcaaccggaatttg Antisense-F GCGCGgtcgacggctgttttggcggatgagagaag attttc Antisense-R tcgaggatatccccgcatgcaggaggaattaacca tgca Anti-acpP-F GCGCGgagctcaagaagcattgttggtaact Anti-acpP-R atcttctctcatccgccaaaacagcc
[0099] The schematic diagram of pHWBT18Anti-fabD is shown in
TABLE-US-00008 TABLE5 Theprimersusedinthisexperiment. Primers Sequences Anti-fabD-F GCGCGgagctccccacaggtcgtagcccagc Anti-fabD-R ccGgcctcgaggataaggattaaaacatgac
Fat Production
[0100] A single colony of strain HWK201(pWL4T), HWK201(pTrc99a, pWL4T) or HWK201(pHWABTZ, pWL4T) was inoculated into 5 ml of Luria-Bertani (LB) and incubated in an orbital shaker operated at 250 rpm at 37 C. overnight. The preculture was inoculated into a flask containing 50 mL of the culture medium with 1% (v/v) inoculum. The culture medium contained: tryptone 10 g/L, yeast extract 5 g/L, NaCl 5 g/L, glycerol 15 g/L, ampicillin 100 g/L, pH 7.5. Different concentrations of IPTG were investigated. Shake flask experiment was performed at 30 C. with shaking at 250 rpm for 72 h. The samples were extracted using the method developed in our lab (Zhang et al., 2011). The fatty acid concentration was quantified by a GC-FID system (Table 6). These conditions are generally employed throughout, with modification as noted.
TABLE-US-00009 TABLE 6 Concentration of fatty acid production of strains HWK201 (pWL4T), HWK201 (pTrc99a, pWL4T), and HWK201 (pHWABTZ, pWL4T) Concentration of Relevant IPTG total fatty acid (mg/L) Strain genotype (mM) 24 h 48 h 72 h HWK201 fadD, Not 52 61 (pWL4T) fabH, determined rc_TE.sup.+ HWK201 fadD, Not 48 60 (pTrc99a, fabH, determined pWL4T) rc_TE.sup.+ HWK201 fadD, 0.00 46.15 62 66 (pHWABTZ, fabH, 0.05 63.31 201 213 pWL4T) re_PhaA.sup.+, 0.10 35.67 127 125 re_PhaB.sup.+, 0.20 32.23 120 123 td_TER.sup.+, 0.50 31.08 125 122 ec_FabZ.sup.+, 1.00 20.25 106 116 rc_TE.sup.+ re_PhaA.sup.+: overexpression of -ketothiolase from Ralstonia eutropha H16 in pTrc99a re_PhaB.sup.+: overexpression of acetoacetyl-CoA reductase from Ralstonia eutropha H16 in pTrc99a td_TER.sup.+: overexpression of trans-enoyl-coenzyme A reductase from Treponema denticola in pTrc99a ec_FabZ.sup.+: overexpression of 3-hydroxyacyl-ACP dehydrase from E. coli in pTrc99a rc_TE.sup.+: overexpression of acyl-ACP thioesterase from Ricinus communis under the TUM3 promoter in pBAD33 fadD: deactivation of acyl-CoA synthetase fabH: deactivation of -ketoacyl-acyl carrier protein synthase III
[0101] The host strain HWK201 is an E. coli strain with a deactivated KASIIIwhich is the enzyme involved in the initialization step of the fatty acid synthesis cycle. The strains HWK201 (pWL4T) and HWK201 (pTrc99a, pWL4T) served as the control. Both strains lack the four genes re phaA, re phaB, td ter, ec fabZ that encode for enzymes to convert acetyl-CoA to butyryl-CoA, and which together function as the added primer synthesis pathway. Both strains produced about 60 mg/L of fatty acid at 72 hrs. This low level of fatty acid production is due to the deactivation of KASIII, which encodes the enzyme involved in the initialization step of the fatty acid synthesis cycle.
[0102] However, upon induction of the plasmid, pHWABTZ, carrying the genes re phaA, re phaB, td ter, ec fabZ, which encode for enzymes to convert acetyl-CoA to butyryl-CoA, fatty acid production is significantly increased (Table 6). These results support the claim that the FAS cycle can be activated in KASIII deficient strains if the cells are supplied with butyryl-CoA. Although this is not a functionalized primer molecule, this experiment proves that it is possible to bypass KASIII and make fats using the remaining enzymes.
[0103] A second experiment was performed to further confirm the functionality of the invention, but using a different enzyme set. A single colony of strain HWK201 (pHWABTC, pWL4T) was inoculated into 5 ml of LB and treated as above. The fatty acid concentration was quantified by a GC-FID system (Table 7).
[0104] In this study the 3-hydroxyacyl-ACP dehydrase from E. coli (ec FabZ) was substituted by a crotonase from Clostridium acetobutylicum (Ca CRT) in order to provide yet another example of making an initiating primer in the cell, thus bypassing the KASIII starting enzyme.
[0105] Similar to the above experiment, upon induction of the plasmid, pHWABTC, carrying the primer pathway genes re phaA, re phaB, td ter, ca crt, fatty acid production is significantly increased (Table 7). Again, the results support the claim that the FAS cycle can be activated in KASIII deficient strains if the cells are supplied with butyryl-CoA. That is, KASIII deficient strains cell can use butyryl-CoA as the priming molecule for the FAS cycle, bypassing KASIII.
TABLE-US-00010 TABLE 7 Concentration of fatty acid production of strain HWK201 (pHWABTC, pWL4T) Concentration of Relevant IPTG total fatty acid (mg/L) Strain genotype (mM) 24 h 48 h 72 h HWK201 fadD, 0 41.43 41.26 45.53 (pHWABTC, fabH, 0.05 77.46 102.19 94.38 pWL4T) re_PhaA.sup.+, 0.1 77.19 100.06 100.31 re_PhaB.sup.+, 0.2 31.53 102.14 104.01 td_TER.sup.+, 0.5 13.48 55.99 62.74 ca_CRT.sup.+, 1 14.09 61.35 70.10 rc_TE.sup.+ re_PhaA.sup.+: overexpression of -ketothiolase from Ralstonia eutropha H16 in pTrc99a re_PhaB.sup.+: overexpression of acetoacetyl-CoA reductase from Ralstonia eutropha H16 in pTrc99a td_TER.sup.+: overexpression of trans-enoyl-coenzyme A reductase from Treponema denticola in pTrc99a ca_CRT.sup.+: overexpression of crotonase from Clostridium acetobutylicum in pTrc99a rc_TE.sup.+: overexpression of acyl-ACP thioesterase from Ricinus communis under the TUM3 promoter in pBAD33 fadD: deactivation of acyl-CoA synthetase fabH: deactivation of -ketoacyl-acyl carrier protein synthase III
fabD Antisense
[0106] In order to prove that the FAS pathway was truly KASIII independent, we turned off the fadD gene encoding malonyl-CoA-acyl carrier protein transacylase using antisense. This is expected to slow cell growth significantly. In the following experiment, the cells were then rescued by adding back in a primer pathway that bypasses the usual KASIII entry point.
[0107] The strain MG1655 (pHWBT18Anti-fadD), which carries the antisense-fabD gene under the control of an inducible trc promoter system, was chosen for this experiment. Two single colonies of the strain MG1655 (pHWBT18Anti-fabD) were selected from a plate containing freshly transformed cells. These selected colonies were streaked onto two M9 supplemented with glucose agar plates, one containing 1 mM IPTG and the other without. Both plates were incubated in a 37 C. incubator and the results are shown in
[0108] Malonyl-CoA-ACP transacylase (FabD) catalyzes the conversion of malonyl-CoA to malonyl-ACP, one of the early steps of fatty acid biosynthesis and is deemed to be essential for cell growth. The strain MG1655(pHWBT18Anti-fadD) carries the antisense-fabD gene under the control of an inducible trc promoter system showed normal growth on normal M9-glucose plate (top half,
[0109] This second experiment demonstrates fatty acid synthesis can be re-activated by providing butyryl-CoA, a four-carbon Co-A based substrate, independent of KASIII and/or malonyl ACP.
[0110] The strain MG1655 (pHWBT18Anti-fabD, pHWABTZ) carries an anti-sense fabD gene, plus four genes which encode the enzymes for the formation of butyryl-CoA from acetyl-CoA: -ketothiolase from Ralstonia eutropha H16, acetoacetyl-CoA reductase from Ralstonia eutropha H16, trans-enoyl-coenzyme A reductase from Treponema denticola, and 3-hydroxyacyl-ACP dehydrase from E. coli.
[0111] A single colony was selected from a plate containing freshly transformed cells. The selected colony was streaked onto two M9 supplemented with glucose agar plates, one containing 1 mM IPTG and the other without. Both plates were incubated in a 37 C. incubator and the results are shown in
[0112] The cells showed normal growth on normal M9-glucose plate (right bottom quadrant,
[0113] A similar experiment was performed with the strain MG1655 (pHWBT18Anti-fabD, pHW ABTC). This strain carries an anti-sense fabD gene, and four genes that encode the enzymes for the formation of butyryl-CoA from acetyl-CoA: -ketothiolase from Ralstonia eutropha H16, acetoacetyl-CoA reductase from Ralstonia eutropha H16, trans-enoyl-coenzyme A reductase from Treponema denticola, and crotonase from Clostridium acetobutylicum. Similar results were obtained with resumed cell growth when butyryl-CoA was being provided even where the expression of fabD was suppressed by the anti-sense (right top quadrant,
[0114] This third experiment demonstrates the functionality of the KASIII independent pathway with both KASIII and FabD eliminated. A single colony of strain HWK201 (pTrc99a, pHWBT18anti-fabD) or HWK201 (pHWABTZ, pHWBT18anti-fabD) was inoculated into 5 ml of LB and the experiments proceeded as described above.
[0115] The HWK201 (pHWABTZ, pHWBT18anti-fabD) strain produced more than twice fatty acids than that of the control strain HWK201 (pTrc99a, pHWBT18anti-fabD). These results further demonstrated that neither malonyl-ACP nor KASIII is essential for the KASIII independent fatty acid synthesis system, since the strain KASIII.sup. fabD.sup. strain produced higher levels of fatty acids with the four genes that encode the enzymes for the formation of butyryl-CoA from acetyl-CoA than that of the control strain that did not carry these four genes (Table 8).
TABLE-US-00011 TABLE 8 Concentration of fatty acid production of strains HWK201 (pTrc99a, pHWBT18anti-fabD) and HWK201 (pHWABTZ, pHWBT18anti-fabD) Concentration of Relevant IPTG total fatty acid (mg/L) Strain genotype (mM) 24 h 48 h 72 h HWK201 fadD, 0.050 102 303 333 (pHWABTZ, fabH, pWL4T) re_PhaA.sup.+, re_PhaB.sup.+, td_TER.sup.+, ec_FabZ.sup.+, rc_TE.sup.+ HWK201 fadD, 0.050 83 137 119 (pTrc99a, fabH, pHWBT18anti- Anti-fabD fabD) rc_TE.sup.+ HWK201 fadD, 0.050 117 265 274 (pHWABTZ, fabH, pHWBT18anti- re_PhaA.sup.+, fabD) re_PhaB.sup.+, td_TER.sup.+, ec_FabZ.sup.+, Anti-fabD rc_TE.sup.+ re_PhaA.sup.+: overexpression of -ketothiolase from Ralstonia eutropha H16 in pTrc99a re_PhaB.sup.+: overexpression of acetoacetyl-CoA reductase from Ralstonia eutropha H16 in pTrc99a td_TER.sup.+: overexpression of trans-enoyl-coenzyme A reductase from Treponema denticola in pTrc99a ec_FabZ.sup.+: overexpression of 3-hydroxyacyl-ACP dehydrase from E. coli in pTrc99a rc_TE.sup.+: overexpression of acyl-ACP thioesterase from Ricinus communis under the TUM3 promoter in pBAD33 fadD: deactivation of acyl-CoA synthetase fabH: deactivation of -ketoacyl-acyl carrier protein synthase III
AcpP Anti-Sense
[0116] This set of experiments knocks out acyl carrier protein (AcpP) functionality using antisense, thus further confirming that adding overexpressed enzymes can still allow FAS even without AcpP. This provides further options for running a KASIII independent FAS synthesis.
[0117] This first experiment demonstrated the proper functionality of the anti-sense construct, pHWBT18Anti-acpP. The strain MG1655 (pHWBT18Anti-acpP) carries the antisense-acpP gene under the control of an inducible trc promoter system and showed normal growth on normal M9-glucose plate (bottom half,
[0118] The second experiment demonstrates that the KASIII independent pathway will function even without the ACP carrier protein when the FAS enzymes are overexpressed, likely due to the high concentration of enzymes in the cell ensuring that the synthesis continue even without ACP carrier protein transferring the growing chain to the next enzyme. Two strains, MG1655 (pHWBT18Anti-acpP, pHWABTZ) and MG1655 (pHWBT18Anti-acpP, pHWABTC), were chosen for this experiment.
[0119] The strain MG1655 (pHWBT18Anti-acpP, pHWABTZ) carries an anti-sense acpP gene, and four genes which encode the enzymes for the formation of butyryl-CoA from acetyl-CoA: -ketothiolase from Ralstonia eutropha H16, acetoacetyl-CoA reductase from Ralstonia eutropha H16, trans-enoyl-coenzyme A reductase from Treponema denticola, and 3-hydroxyacyl-ACP dehydrase from E. coli.
[0120] The cells showed normal growth on normal M9-glucose plate (left top quadrant,
[0121] A similar experiment was performed with the strain MG1655 (pHWBT18Anti-acpP, pHWABTC). This strain carries an anti-sense acpP gene, and four genes that encode the enzymes for the formation of butyryl-CoA: acetyl-CoA--ketothiolase from Ralstonia eutropha H16, acetoacetyl-CoA reductase from Ralstonia eutropha H16, trans-enoyl-coenzyme A reductase from Treponema denticola, and crotonase from Clostridium acetobutylicum. Similar results were obtained, with resumed cell growth when butyryl-CoA was being provided, even where the expression of acpP was suppressed by the anti-sense (left bottom quadrant,
[0122] These results confirm that the cells were able to incorporate butyryl-CoA into the fatty acid biosynthesis pathway to form fatty acids (and hence resumed cell growth) and furthermore that this pathway can even run independently of ACP if the enzymes are overexpressed.
[0123] This next experiment combines the KASIII mutant with the AcpP antisense. A single colony of strain HWK201 (pTrc99a, pHWBT18anti-acpP) or HWK201 (pHWABTZ, pHWBT18anti-acpP) was inoculated into 5 ml of LB and treated as above. The fatty acid concentration was quantified by a GC-FID system (Table 9).
[0124] The HWK201 (pHWABTZ, pHWBT18anti-acpP) strain produced more than twice fatty acids than that of the control strain HWK201 (pTrc99a, pHWBT18anti-acpP). These results demonstrated that ACP carrier protein is not essential for the KASIII independent fatty acid synthesis system since the strain carries the anti-sense acpP produced higher levels of fatty acids in strains with the four genes that encode the enzymes for the formation of butyryl-CoA from acetyl-CoA than the control strain that did not carry these four genes (Table 9).
[0125] In addition, the HWK201 (pHWABTZ, pHWBT18anti-acpP) strain produces a similar level of fatty acids with another control strain HWK201 (pHWABTZ, pWL4T) strain, which does not carry the anti-sense-acpP. That is, the presence of anti-sense-acpP does not affect the fatty acid production of HWK201 (pHWABTZ, pHWBT18anti-acpP) strain, which carries genes that encode enzymes that convert acetyl-CoA to butyryl-CoA to activate the KASIII independent fatty acid system.
TABLE-US-00012 TABLE 9 Concentration of fatty acid production of strains HWK201 (pTrc99a, pHWBT18anti-acpP) and HWK201 (pHWABTZ, pHWBT18anti-acpP) Concentration of Relevant IPTG total fatty acid (mg/L) Strain genotype (mM) 24 h 48 h 72 h HWK201 fadD, 0.050 102 303 333 (pHWABTZ, fabH, pWL4T) re_PhaA.sup.+, re_PhaB.sup.+, td_TER.sup.+, ec_FabZ.sup.+, rc_TE.sup.+ HWK201 fadD, 0.050 108 156 151 (pTrc99a, fabH, pHWBT18anti- Anti- acpP acpP) rc_TE.sup.+ HWK201 fadD, 0.050 21 293 392 (pHWABTZ, fabH, pHWBT18anti- re_PhaA.sup.+, acpP) re_PhaB.sup.+, td_TER.sup.+, ec_FabZ.sup.+, Anti- acpP rc_TE.sup.+ re_PhaA.sup.+: overexpression of -ketothiolase from Ralstonia eutropha H16 in pTrc99a re_PhaB.sup.+: overexpression of acetoacetyl-CoA reductase from Ralstonia eutropha H16 in pTrc99a td_TER.sup.+: overexpression of trans-enoyl-coenzyme A reductase from Treponema denticola in pTrc99a ec_FabZ.sup.+: overexpression of 3-hydroxyacyl-ACP dehydrase from E. coli in pTrc99a rc_TE.sup.+: overexpression of acyl-ACP thioesterase from Ricinus communis under the TUM3 promoter in pBAD33 fadD: deactivation of acyl-CoA synthetase fabH: deactivation of -ketoacyl-acyl carrier protein synthase III
AccA Antisense
[0126] This first experiment demonstrated the proper functionality of the anti-sense construct for AccAacetyl-CoA carboxylasewhich catalyzes the irreversible carboxylation of acetyl-CoA to produce malonyl-CoA, thus providing further proof that the fatty acids produced herein truly are via a KASIII independent pathway.
[0127] The construct is pHWBT18Anti-accA (
[0128] These results indicate that the anti-accA antisense is functional and upon induction prevents or greatly reduces the formation of malonyl-CoA, hence limiting cell growth. The next experiment shows that the KASIII independent FAS can rescue the poor cell growth caused by lack of AccA.
[0129] A single colony of following eight strains: HWK201 (pTrc99a, pHWBT18anti-accA), HWK201 (pHWABTZ, pHWBT18anti-accA), HWK201 (pHWL4T), HWK201 (pHWBT18anti-accA), MG1655 (pHWBT18), MG1655 (pHWBT18anti-accA), MG1655 (pTrc99a, pHWBT18anti-accA), and MG1655 (pHWABTZ, pHWBT18anti-accA), were inoculated into 5 ml of LB and the experiment proceeded as above. The fatty acid concentration was quantified by a GC-FID system (Table 10).
[0130] For the HWK201 host strain, the presence of antisense-accA greatly reduces the production of fatty acids, from 61 to 10 mg/L. Inducing the plasmid pHWABTZ carrying the genes re phaA, re phaB, td ter, ec fabZ that encodes four enzymes to convert acetyl-CoA to butyryl-CoA, the fatty acid production by the strain HWK201 (pHWABTZ, pHWBT18anti-accA) is significantly increased to more 150 mg/L, even in the presence of the anti-sense accA (Table 10). Similar results were obtained with the MG1655 host strains. The strain MG1655 (pHWABTZ, pHWBT18anti-accA) produced 643 mg/L of fatty acid, which is very similar to that of the MG1655 (pHWBT18), which does not carry the anti-sense accA.
[0131] The results show that the presence of antisense-accA (resulting in reduced malonyl-CoA availability) does not shut down the fatty acid production by the strain HWK201 (pHWABTZ, pHWBT18anti-accA), which carries genes that encode enzymes to convert acetyl-CoA to butyryl-CoA and activates the KASIII independent fatty acid system. The results also suggest HWK201 (pHWABTZ, pHWBT18) can use both acetyl-CoA and malonyl-CoA for the chain length elongation of fatty acids.
TABLE-US-00013 TABLE 10 Concentration of fatty acid production of strains HWK201 (pTrc99a, pHWBT18anti-accA), HWK201 (pHWABTZ, pHWBT18anti-accA), HWK201 (pHWL4T), HWK201 (pHWBT18anti- accA), MG1655(pHWBT18), MG1655 (pHWBT18anti-accA), MG1655 (pTrc99a, pHWBT18anti-accA), MG1655 (pHWABTZ, pHWBT18anti-accA) Concentration of Relevant IPTG total fatty acid (mg/L) Strain genotype (mM) 24 h 48 h 72 h HWK201 fadD, 0.050 52 61 (pHWL4T) fabH, rc_TE.sup.+ HWK201 fadD, 0.050 <10 <10 <10 (pHWBT18anti- fabH, accA) Anti-accA rc_TE.sup.+ HWK201 fadD, 0.050 115 138 134 (pTrc99a, fabH, pHWBT18anti- Anti-accA accA) rc_TE.sup.+ HWK201 fadD, 0.050 154 191 192 (pHWABTZ, fabH, pHWBT18anti- re_PhaA.sup.+, accA) re_PhaB.sup.+, td_TER.sup.+, ec_FabZ.sup.+, Anti-accA rc_TE.sup.+ MG1655 rc_TE+ 0.050 778 960 976 (pHWBT18) MG1655 Anti-accA 0.050 325 392 380 (pHWBT18anti- rc_TE+ accA) MG1655 Anti-accA 0.050 162 (pTrc99a, rc_TE+ pHWBT18anti- accA) MG1655 re_PhaA+, 0.050 643 (pHWABTZ, re_PhaB+, pHWBT18anti- td_TER+, accA) ec_FabZ+, Anti-accA rc_TE+ re_PhaA.sup.+: overexpression of -ketothiolase from Ralstonia eutropha H16 in pTrc99a re_PhaB.sup.+: overexpression of acetoacetyl-CoA reductase from Ralstonia eutropha H16 in pTrc99a td_TER.sup.+: overexpression of trans-enoyl-coenzyme A reductase from Treponema denticola in pTrc99a ec_FabZ.sup.+: overexpression of 3-hydroxyacyl-ACP dehydrase from E. coli in pTrc99a rc_TE.sup.+: overexpression of acyl-ACP thioesterase from Ricinus communis under the TUM3 promoter in pBAD33 fadD: deactivation of acyl-CoA synthetase fabH: deactivation of -ketoacyl-acyl carrier protein synthase III
Fats not Made by Reversal Beta-Oxidation Cycle
[0132] We have shown above that fats made in our cells truly are KASIII independent using a KASIII mutant, as well as using antisense for AccP, AccA, and FabD in various combinations. However, since the pivotal work of Ramon Gonzalez at William Marsh Rice University, it remained formally possible that the fats were being produced by a reverse beta-oxidation cycle. This experiment was designed to eliminate that possibility.
[0133] The enzyme acyl-CoA dehydrogenase catalyzes a key reaction in the fatty acid beta-oxidation cycle. A fadE mutant was created to demonstrate the fatty acid production described in this invention is not by the reversal of beta-oxidation (R-BOX) cycle, but did in fact proceed by the KASIII independent pathway. A triple mutant strain, XZK108, was constructed which is a fadE, fadD (acyl-CoA synthetase) and fabH (beta-Ketoacyl-ACP synthase III aka KASIII) triple mutant.
[0134] The data in Table 11 proves that the fats are not being made using R-BOX, but made using the new KASIII-independent pathway. The XZK108 (pHWABTZ, pWL4T) strain with deactivation of acyl-CoA dehydrogenase enzyme (fadE) produced similar quantity of fatty acid as its parent strain (pHWABTZ, pWL4T). Since acyl-CoA dehydrogenase (fadE) is a key enzyme involved in the fatty acid beta-oxidation pathway, the results prove that the fat is made through the intended KASIII independent pathway.
TABLE-US-00014 TABLE 11 Concentration of fatty acid production of strains HWK201 (pHWABTZ, pWL4T), XZK108 (pTrc99a, pWL4T) and XZK108 (pHWABTZ, pWL4T) Concentration of Relevant IPTG total fatty acid (mg/L) Strain genotype (mM) 24 h 48 h 72 h HWK201 fadD, 0.050 102 303 333 (pHWABTZ, fabH, pWL4T) re_PhaA.sup.+, re_PhaB.sup.+, td_TER.sup.+, ec_FabZ.sup.+, rc_TE.sup.+ XZK108 fadD, 0.050 65 58 56 (pTrc99a, fabH, pWL4T) fadE rc_TE.sup.+ XZK108 fadD, 0.050 249 313 320 (pHWABTZ, fabH, pWL4T) fadE, re_PhaA.sup.+, re_PhaB.sup.+, td_TER.sup.+, ec_FabZ.sup.+, rc_TE.sup.+ re_PhaA.sup.+: overexpression of -ketothiolase from Ralstonia eutropha H16 in pTrc99a re_PhaB.sup.+: overexpression of acetoacetyl-CoA reductase from Ralstonia eutropha H16 in pTrc99a td_TER.sup.+: overexpression of trans-enoyl-coenzyme A reductase from Treponema denticola in pTrc99a ec_FabZ.sup.+: overexpression of 3-hydroxyacyl-ACP dehydrase from E. coli in pTrc99a rc_TE.sup.+: overexpression of acyl-ACP thioesterase from Ricinus communis under the TUM3 promoter in pBAD33 fadD: deactivation of acyl-CoA synthetase fabH: deactivation of -ketoacyl-acyl carrier protein synthase III fadE: deactivation of acyl-CoA dehydrogenase enzyme
Hydroxy Fatty Acid Production
[0135] The biosynthesis of hydroxy fatty acid was used to demonstrate the ability to synthesize bi-functional molecules using the invention. The priming molecule (glycolyl CoA) is supplied by the activation of externally added glycolic acid using propionyl-CoA synthase (prpE) from Salmonella enterica, which activates the glycolic acid with coA. The hydroxy acetyl-CoA is then converted to hydroxy butyryl-CoA before entering into the KASIII independent fatty acid synthesis system (
[0136] The control strains carrying the plasmid only with the TE (pWL1T) or the plasmid with TE and the propionyl-CoA synthase (pDWPT) does not produce detectable quantities of omega-hydroxyhexadecanoic acid (or 16-hydroxyhexadecanoic acid) with or without addition of glycolic acid to the media. This indicates that the particular primer needs help entering the KASIII-independent pathway.
[0137] For the strain HWK201 (pHWABTC, pDWPT), which carries a plasmid with acyl-ACP thioesterase and the propionyl-CoA synthase (pDWPT) as well as another plasmid with -ketothiolase, acetoacetyl-CoA reductase, trans-enoyl-coenzyme A reductase, and 3-hydroxyacyl-ACP dehydrase (pHWABTC) produces significant quantity of omega-hydroxyhexadecanoic acid when the glycolic acid starter molecule was added to the media (Table 12). The same HWK201 (pHWABTC, pDWPT) strain does not produce detectable quantities of 16-hydroxyhexadecanoic acid when no glycolic acid was added (Table 12). The fragmentation spectra of derivatized 16-Hydroxyhexadecanoic acid of the sample show similar patterns to that from the NIST/EPA/NIH Spectral Library, proving the identity of the molecule (see
[0138] These results demonstrated that omega hydroxy fatty acid can be produced by KASIII deficient strain using the native fatty acid cycle if the primer pathway to convert the glycolic acid starter molecule to an appropriate primer is added. Furthermore, these results demonstrated that: (1) propionyl-CoA synthase (prpE) from Salmonella enterica can catalyze the reaction from glycolic acid to glycolyl-CoA; (2) -ketothiolase, acetoacetyl-CoA reductase, trans-enoyl-coenzyme A reductase, and 3-hydroxyacyl-ACP dehydrase can elongate glycolyl-CoA to hydroxy butyryl-CoA; and (3) the native fatty synthesis can use the resulting hydroxy butyryl-CoA as the initiating primer molecule leading to the production of 16-hydroxyhexadecanoic acid with 6 turns of the native FAS cycle.
TABLE-US-00015 TABLE 12 Concentration of hydroxy fatty acid production of strain HWK201 (pHWABTC, pDWPT), HWK201 (pXZ18), and HWK201 (pTrc99a, pDWPT) with and without glycolic acid addition Concentration of omega- IPTG hydroxy- (mM)/ glycolic hexadecanoic Relevant arabinose acid acid (mg/L) Strain genotype (mM) (g/L) 72 h HWK201 fadD, 0.05/10 0 Below (pHWABTC, fabH, detection pDWPT) re_PhaA.sup.+, limit re_PhaB.sup.+, td_TER.sup.+, ca_CRT.sup.+, se_PrpE.sup.+, rc_TE.sup.+ HWK201 fadD, 0.05/10 5 169.3 (pHWABTC, fabH, pDWPT) re_PhaA.sup.+, re_PhaB.sup.+, td_TER.sup.+, ca_CRT.sup.+, se_PrpE.sup.+, rc_TE.sup.+ HWK201 fadD, 0.05/0 0 Below (pXZ18) fabH, detection rc_TE+ limit HWK201 fadD, .sup.0/0 5 Below (pWL1T) fabH, detection rc_TE+ limit HWK201 fadD, 0.05/10 0 Below (pTrc99a, fabH, detection pDWPT) Se PrpE limit rc_TE+ HWK201 fadD, 0.05/10 5 Below (pTrc99a, fabH, detection pDWPT) Se PrpE limit rc_TE+ re_PhaA.sup.+: overexpression of -ketothiolase from Ralstonia eutropha H16 in pTrc99a re_PhaB.sup.+: overexpression of acetoacetyl-CoA reductase from Ralstonia eutropha H16 in pTrc99a td_TER.sup.+: overexpression of trans-enoyl-coenzyme A reductase from Treponema denticola in pTrc99a ca_CRT.sup.+: overexpression of crotonase from Clostridium acetobutylicum in pTrc99a rc_TE.sup.+: overexpression of acyl-ACP thioesterase from Ricinus communis under the TUM3 promoter in pBAD33 se_PrpE.sup.+: overexpression of propionyl-CoA synthase (prpE) from Salmonella enterica fadD: deactivation of acyl-CoA synthetase fabH: deactivation of -ketoacyl-acyl carrier protein synthase III
[0139] This second experiment demonstrates using a different primer pathway to illustrate the wide applicability of the KASIII independent FAS pathway. The starter molecule (glycolyl CoA) was supplied by the activation of externally added glycolic acid using propionyl-CoA synthase (prpE) from Salmonella enterica. However, the crotonase from Clostridium acetobutylicum (Ca CRT) substituted by the 3-hydroxyacyl-ACP dehydrase from E. coli (ec FabZ) herein. Plasmid pDWPT (
[0140] A single colony of strain HWK201 (pHWABTZ, pDWPT) or HWK201 (pWL1T) was inoculated into 5 ml of LB and the experiment proceeded as above. Similar to the prior experiment, the control strains carrying the plasmid only with the acyl-ACP thioesterase (pWL1T) or the plasmid with acyl-ACP thioesterase and the propionyl-CoA synthase (pDWPT) does not produce detectable quantities of omega-hydroxyhexadecanoic acid (or 16-hydroxyhexadecanoic acid) with or without addition of glycolic acid.
[0141] However, re-placing crotonase from C. acetobutylicum (Ca CRT) with the 3-hydroxyacyl-ACP dehydrase from E. coli (ec FabZ) yielded higher concentration of omega-hydroxyhexadecanoic acid when glycolic acid was added (Table 13a), possibly because the enzyme was more active with this particular substrate, producing more primer. The same HWK201 (pHWABTZ, pDWPT) strain does not produce detectable quantities of 16-hydroxyhexadecanoic acid when no glycolic acid was added (Table 13a).
[0142] Similar to the previous experiment, these results demonstrated that production of omega fatty acid by KASIII deficient strain using the native fatty acid cycle. In addition, these results further demonstrated that: (1) propionyl-CoA synthase (prpE) from Salmonella enterica can catalyze the reaction from glycolic acid to glycolyl-CoA; (2) -ketothiolase, acetoacetyl-CoA reductase, trans-enoyl-coenzyme A reductase, and 3-hydroxyacyl-ACP dehydrase can elongate glycolyl-CoA to hydroxy butyryl-CoA; and (3) the native fatty synthesis can use the hydroxy butyryl-CoA as the starting molecule leading to the production of 16-hydroxyhexadecanoic acid.
[0143] One of the advantages of the KASIII independent FAS cycle is demonstrated in Table 13b where the background of even chain length fatty acids is produced at very low levels. This is because the KASIII mutant strain can make normal fatty acid using acetyl-CoA as the primer molecule only at a very low level. Hence, the fatty acid elongation cycle is mainly used by the KASIII independent system to make functionalized fatty acids. This means that functionalized fatty acids made with the KASIII independent system will be more pure in the KASIII mutant background.
TABLE-US-00016 TABLE 13a Concentration of hydroxy fatty acid production of strains HWK201 (pHWABTZ, pDWPT), HWK201 (pWL1T), (pTrc99a, pDWPT) with and without glycolic acid Concentration of omega- IPTG hydroxy- (mM)/ glycolic hexadecanoic Relevant arabinose acid (mg/L) Strain genotype (mM) (g/L) 72 h HWK201 fadD, 0.05/10 0 ND (pHWABTZ, fabH, pDWPT) re_PhaA.sup.+, re_PhaB.sup.+, td_TER.sup.+, ec_FabZ.sup.+, se_PrpE.sup.+, rc_TE.sup.+ HWK201 fadD, 0.05/10 5 407.9 (pHWABTZ, fabH, pDWPT) re_PhaA.sup.+, re_PhaB.sup.+, td_TER.sup.+, ec_FabZ.sup.+, se_PrpE.sup.+, rc_TE.sup.+ HWK201 (pWL1T) fadD, .sup.0/0 0 ND fabH, rc_TE.sup.+ HWK201 (pWL1T) fadD, .sup.0/0 5 ND fabH, rc_TE.sup.+ HWK201 (pTrc99a, fadD, 0.05/10 0 ND pDWPT)* fabH, se_PrpE.sup.+, rc_TE+ HWK201 (pTrc99a, fadD, 0.05/10 5 ND pDWPT)* fabH, se_PrpE.sup.+, rc_TE+ re_PhaA.sup.+: overexpression of -ketothiolase from Ralstonia eutropha H16 in pTrc99a re_PhaB.sup.+: overexpression of acetoacetyl-CoA reductase from Ralstonia eutropha H16 in pTrc99a td_TER.sup.+: overexpression of trans-enoyl-coenzyme A reductase from Treponema denticola in pTrc99a ec_FabZ.sup.+: overexpression of 3-hydroxyacyl-ACP dehydrase from E. coli in pTrc99a rc_TE.sup.+: overexpression of acyl-ACP thioesterase from Ricinus communis under the TUM3 promoter in pBAD33 se_PrpE.sup.+: overexpression of propionyl-CoA synthase (prpE) from Salmonella enterica fadD: deactivation of acyl-CoA synthetase fabH: deactivation of -ketoacyl-acyl carrier protein synthase III *data from Table 12; NDnot detected - below detection limit
TABLE-US-00017 TABLE 13b Concentration of fatty acid production of strains HWK201 (pHWABTZ, pDWPT) and HWK201 (pWL1T) and HWK201 (pTrc99a, pDWPT) IPTG (mM)/ glycolic Relevant arabinose acid Concentration of fatty acid (mg/L) at 72 h Strain genotype (mM) (g/L) C14 C16 C16:1 HWK201 fadD, .sup.0/0 5 ND 21.9 8.1 (pWL1T)* fabH, rc_TE.sup.+ HWK201 fadD, 0.05/10 5 ND 20.2 15.1 (pTrc99a, fabH, pDWPT)* se_PrpE.sup.+ rc_TE+ HWK201 fadD, 0.05/10 5 ND 127.1 86.7 (pHWABTZ, fabH, pDWPT re_PhaA.sup.+, re_PhaB.sup.+, td_TER.sup.+, ec_FabZ.sup.+, se_PrpE.sup.+ rc_TE.sup.+ re_PhaA.sup.+: overexpression of -ketothiolase from Ralstonia eutropha H16 in pTrc99a re_PhaB.sup.+: overexpression of acetoacetyl-CoA reductase from Ralstonia eutropha H16 in pTrc99a td_TER.sup.+: overexpression of trans-enoyl-coenzyme A reductase from Treponema denticola in pTrc99a ec_FabZ.sup.+: overexpression of 3-hydroxyacyl-ACP dehydrase from E. coli in pTrc99a rc_TE.sup.+: overexpression of acyl-ACP thioesterase from Ricinus communis under the TUM3 promoter in pBAD33 se_PrpE.sup.+: overexpression of propionyl-CoA synthase (prpE) from Salmonella enterica fadD: deactivation of acyl-CoA synthetase fabH: deactivation of -ketoacyl-acyl carrier protein synthase III NDnot detected - below detection limit
Branched Fatty Acid Production
[0144] The versatility of the KASIII independent synthesis pathway was demonstrated by using a different substrate in order to produce branched chain fatty acids. In this study, the biosynthesis of omega methyl fatty acids was used to demonstrate the ability of synthesizing branched fatty acid cycle by supplying the substrate isobutyrate.
[0145] The priming molecule (isobutyryl CoA) in the following example was supplied by the activation of externally added isobutyrate using propionyl-CoA synthase (prpE) from Salmonella enterica. The isobutyryl CoA is then extended to longer chain branched fatty acids by the FAS cycle (similar to that shown in
[0146] A single colony of strain HWK201 (pDWPT) was inoculated into 5 mL of LB and the experiment proceeded as above, except the effect of addition of 2.64 g/L (30 mM) of isobutyrate was investigated. The fatty acid concentrations were quantified by a GC/FID and a GC/MS system, respectively.
TABLE-US-00018 TABLE 14 Concentration of branched chain fatty acid production of strains HWK201 (pWL1T), HWK201 (pDWPT) and HWK201 (pBAD33) Relevant Arabinose Isobutyrate Concentration of branched fatty acid (mg/L) at 72 h Strain genotype (mM) (g/L) C14 C16 C16:1 HWK201 fadD, 0 2.64 8 ND 20 (pWL1T) fabH, rc_TE.sup.+ HWK201 fadD, 10 2.64 21 111 25 (pDWPT) fabH, se_PrpE.sup.+ rc_TE+ HWK201 fadD, 10 2.64 <30 (pBAD33) fabH, se_PrpE.sup.+ rc_TE+ rc_TE.sup.+: overexpression of acyl-ACP thioesterase from Ricinus communis under the TUM3 promoter in pBAD33 se_PrpE.sup.+: overexpression of propionyl-CoA synthase (prpE) from Salmonella enterica fadD: deactivation of acyl-CoA synthetase fabH: deactivation of -ketoacyl-acyl carrier protein synthase III
Odd Chain Fatty Acid Production
[0147] The versatility of the KASIII independent synthesis pathway was demonstrated by using propionic acid to produce odd chain fatty acids. The priming molecule (propionyl CoA) in the following example was supplied by the activation of externally added starter molecule propionic acid, which was activated to the primer form using propionyl-CoA synthase (prpE) from Salmonella enterica. The propionyl CoA primer was then extended to longer chain fatty acids by FAS (similar to that shown in
[0148] The plasmid pHWABTZ carrying the genes re phaA, re phaB, td ter, ec fabZ which encode for enzymes to convert acetyl-CoA to butyryl-CoA and the plasmid pDWPT, which carries the acyl-ACP thioesterase from Ricinus communis and propionyl-CoA synthase (prpE) from Salmonella enterica, was used (similar to
[0149] A single colony of strain HWK201 (pHWABTZ, pDWPT), HWK201 (pHWABTC pDWPT), HWK201 (pW1T), or HWK201 (pDWPT) was inoculated into 5 ml of LB and the experiment proceeded as above, except the effect of addition of 0.89 g/L (12 mM) of propionic acid was investigated as a starter molecule. Fatty acid concentrations were quantified as above. Table 15 shows higher odd chain fats in those strains having the ability to use propionic acid as a starter. The third strain HWK201(pDWPT) produced lower levels of odd chain fatty acid implying the importance of the four genes (plasmid pHWABTZ) for better fatty acid production. Furthermore, the fourth strain HWK201(pDW1T) did not produce detectable quantity of odd chain fatty acid showing the importance of the four genes (plasmid pHWABTZ) as well as the prpE gene for better fatty acid production.
TABLE-US-00019 TABLE 15 Concentration of odd and even chain fatty acid production of strains HWK201 (pHWABTZ, pDWPT), HWK201 (pHWABTC pDWPT), HWK201 (pW1T) and HWK201 (pDWPT) IPTG (mM)/ Propionic Relevant Arabinose acid Concentration of odd and even fatty acid (mg/L) at 72 h Strain genotype (mM) (g/L) C15 C16 C16:1 HWK201 fadD, 0.05/10 0.89 158 127 18 (pHWABTZ fabH, pDWPT) re_PhaA.sup.+, re_PhaB.sup.+, td_TER.sup.+, ec_FabZ.sup.+, se PrpE.sup.+ rc_TE.sup.+ HWK201 fadD, 0.05/10 0.89 25 40 0 (pHWABTC fabH, pDWPT) re_PhaA.sup.+, re_PhaB.sup.+, td_TER.sup.+, ca_CRT.sup.+, se_PrpE.sup.+, rc_TE.sup.+ HWK201 fadD, 0/10 0.89 46 161 22 (pDWPT) fabH, se_PrpE.sup.+ rc_TE+ HWK201 fadD, .sup.0/0 0.89 ND 29 41 (pW1T) fabH, rc_TE+ re_PhaA.sup.+: overexpression of -ketothiolase from Ralstonia eutropha H16 in pTrc99a re_PhaB.sup.+: overexpression of acetoacelyl-CoA reductase from Ralstonia eutropha H16 in pTrc99a td_TER.sup.+: overexpression of trans-enoyl-coenzyme A reductase from Treponema denticola in pTrc99a ec_FabZ.sup.+: overexpression of 3-hydroxyacyl-ACP dehydrase from E. coli in pTrc99a rc_TE.sup.+: overexpression of acyl-ACP thioesterase from Ricinus communis under the TUM3 promoter in pBAD33 se_PrpE.sup.+: overexpression of propionyl-CoA synthase (prpE) from Salmonella enterica fadD: deactivation of acyl-CoA synthetase fabH: deactivation of -ketoacyl-acyl carrier protein synthase III
Prophetic: Omega Amino Fatty Acid Production
[0150] The versatility of the KASIII independent synthesis pathway can be demonstrated by using a different substrate to produce omega amino fatty acids. The ability to synthesize omega-functionalized fatty acid is demonstrated by supplying the substrate beta-alanine. The CoA activated primer molecule can either be provided by the native or engineered in vivo pathways or from externally added molecules, but in this case the priming molecule (beta-alanyl CoA) is supplied by the activation of externally added beta-alanine using propionyl-CoA synthase (prpE) from Salmonella enterica.
[0151] The beta-alanyl CoA was then extended to longer chain fatty acid with an omega amino group by the FAS cycle (similar to that shown in
[0152] A single colony of strain HWK201 (pHWABTZ, pDWPT), HWK201 (pTrc99a, pDWPT), HWK201 (pDWPT) is inoculated into 5 ml of LB and the experiment proceeds as described above.
Prophetic: Changing Chain Length
[0153] The versatility of the KASIII independent synthesis pathway to produce fatty acid with various carbon chain lengths can be demonstrated by using different acyl-ACP thioesterases with various substrate specificity. In this experiment, the biosynthesis of fatty acids with a TE specific to shorter carbon chain length, dodecanoic acid (C12), is used. The acyl-ACP thioesterase from Ricinus communis under the TUM3 promoter in pBAD33 (plasmid pWL4T) is replaced with the California Bay Tree (M94159.1) TE. The plasmid constructs are named pWL4T-CB12 and pWL4T-BS12.
[0154] A single colony of strain HWK201 (pHWABTZ, pWL4T-CB12) or HWK201 (pHWABTZ, pWL4T-BS12) is inoculated into 5 ml of LB and the experiment proceeds as described above. Although data is not yet available herein, our lab has already demonstrated the ability to control fatty acid length by judicious selection of the TE. Thus, proof of concept is already available.
Prophetic: Hydroxyfatty Acids
[0155] The biosynthesis of hydroxy fatty acid can be used to demonstrate the ability of synthesizing hydroxy fatty acids with the KASIII-independent fatty acid synthesis system with various TEs with differing substrate specificity. In addition, a priming molecule (glycolyl CoA) is supplied by the activation of externally added glycolic acid using propionyl-CoA synthase (prpE) from Salmonella enterica. In this experiment, we will use the 3-hydroxyacyl-ACP dehydrase from E. coli (ec FabZ) instead of crotonase. Plasmid pDWPT-CB12 is constructed by replacing the acyl-ACP thioesterase from Ricinus communis with that from the California Bay Tree and propionyl-CoA synthase (prpE) from Salmonella enterica.
[0156] A single colony of strain HWK201 (pHWABTZ, pDWPT-CB12) or HWK201 (pWL1T) is inoculated into 5 ml of LB and the experiments proceed as described. Data is not shown, but preliminary results indicate likely success.
Prophetic: Halogenated Fatty Acids
[0157] The versatility of the KASIII independent synthesis pathway can also be demonstrated by using a different substrate to produce halogenated fatty acids. The priming molecule chloroacetic acid or chloropropionic acid is supplied by the activation of externally added chloroacetic/chloropropionic acid using propionyl-CoA synthase (prpE) from Salmonella enterica. The chloroacyl-CoA is then extended to longer chain fatty acid with an omega chloro-group by the FAS cycle (similar to that shown in
[0158] A single colony of strain HWK201 (pHWABTZ, pDWPT) or HWK201 (pDWPT) is inoculated into 5 ml of Luria-Bertani (LB) and the experiment proceeds as above. Since the FAS enzymes are very forgiving of substrate specificity, this is predicted to be successful.
Prophetic: Omega Unsaturated Fats
[0159] In this experiment, the biosynthesis of omega unsaturated acids is used to demonstrate the ability of synthesizing omega functionalized fatty acid by supplying a proper primer substrate. Propenoyl-CoA is supplied by the activation of externally added acrylic acid using propionyl-CoA synthase (prpE) from Salmonella enterica. The propenoyl-CoA is then extended to longer chain fatty acid with omega unsaturated group by the FAS cycle (similar to that shown in
[0160] A single colony of strain HWK201 (pHWABTZ, pDWPT) or HWK201 (pDWPT) is inoculated into 5 ml of LB and the experiment proceeds as described above.
Prophetic: Using Different Genes to Initiate the FAS
[0161]
Prophetic: A,-Dicarboxylic Acids
[0162] The -hydroxy fatty acids produced above can be further converted to ,-dicarboxylic acids by converting the hydroxyl group to the carboxylic group using AlkH and AlkJ from Pseudomonas putida P1. At least three configurations can be envisioned. First, the genes expressing AlkH and AlkJ from Pseudomonas putida P1 can be also included in the engineered cells described above. Thus, the -hydroxy fatty acids produced will be converted to ,-dicarboxylic acids within the same cell. In the second configuration, co-culturing of the engineered cells described above together with cells carrying the genes expressing AlkH and AlkJ from Pseudomonas putida P1 will allow the same reactions on fats that are released from the first cells and taken up by the second. In the third two-step configuration, the -hydroxy fatty acids produced by the engineered cells described in above will be disrupted to release the -hydroxy fatty acids before feeding into a culture of cells carrying the genes expressing AlkH and AlkJ from Pseudomonas putida P1.
[0163] Although this experiment has not yet been completed, proof of concept has been demonstrated by the successful use of the AlkH and AlkJ genes to convert fats made by the regular FAS cycle or the reverse beta-oxidation cycle.
Prophetic: Bacillus
[0164] The above experiments are repeated in Bacillus subtilis. The same genes can be used, especially since Bacillus has no significant codon bias. A protease-deficient strain like WB800N is preferably used for greater stability of heterologous protein. The E. coli-B. subtilis shuttle vector pMTLBS72 exhibiting full structural stability can be used to move the genes easily to a more suitable vector for Bacillus. Alternatively, two vectors pHT01 and pHT43 allow high-level expression of recombinant proteins within the cytoplasm. As yet another alternative, plasmids using the theta-mode of replication such as those derived from the natural plasmids pAM1 and pBS72 can be used. Several other suitable expression systems are available. Since the FAS genes are ubiquitous, the invention is predicted to function in Bacillus, as well as other bacteria having Type II FAS enzymes.
Prophetic: Yeast
[0165] Standard cloning/metabolic engineering approaches can be used to implement the KASIII-independent approach in yeast. In fact, transplanting the whole native E. coli FAS system to yeast has recently been reported, indicating proof of concept for using the bacterial FAS cycle in yeast.
[0166] There are many shuttle vectors for moving genes into yeast. Indeed, almost all commonly used S. cerevisiae vectors are shuttle vectors. Yeast shuttle vectors have components that allow for replication and selection in both E. coli cells and yeast cells. For example, the pAUR vector series by ClonTech includes six E. coli-yeast shuttle vectors, each constructed for a particular application in either Saccharomyces cerevisiae, Schizosaccharomyces, Saccharomyces pombe or Aspergillus nidulans. The vectors include a novel drug-resistance selective marker that confers Aureobasidin A resistance in transformed yeast or filamentous fungal species.
[0167] Fine-tuning of the KASIII-independent approach system, such as codon optimization, promoter strength manipulation through RBS design, and protein engineering can be adapted to improve the system performance to increase the product titer and yield. Since various TE and FAS enzymes have already been successfully transformed into yeast, success is predicted.
[0168] The following references are incorporated by reference in their entirety for all purposes: [0169] Zhang X., Li M., Agrawal A., San K. Efficient free fatty acid production in Escherichia coli using plant acyl-ACP thioesterases. Metab. Eng. 2011, 13: 713-722. [0170] Nathan L. Alderson, et al., The Human FA2H Gene Encodes a Fatty Acid 2-Hydroxylase. J. Biol. Chem. 2004, 279: 48562-48568. [0171] N. Nakashima & T. Tamura. Gene silencing in Escherichia coli using antisense RNAs expressed from doxycycline-inducible vectors. Letters in Applied Microbiology. 2013, 56: 436-442. [0172] Jaoon Y. H. Kim & Hyung Joon Cha. Down-regulation of acetate pathway through antisense strategy in Escherichia coli: improved foreign protein production. Biotechnol Bioeng, 2003, 83(7): 841-853. [0173] Srivastava A., et al, 14-Aminotetradecanoic acid exhibits antioxidant activity and ameliorates xenobiotics-induced cytotoxicity. Mol. Cell. Biochem. 2012, 364: 1-9. [0174] Jing, et al., Phylogenetic and experimental characterization of an acyl-ACP thioesterase family reveals significant diversity in enzymatic specificity and activity, BMC Biochemistry 2011, 12:44.
[0175] U.S. Pat. No. 8,906,667 Increasing NADPH-dependent products
[0176] US20140273114 bacteria and method for synthesizing fatty acids
[0177] U.S. Pat. No. 8,795,991 Increasing bacterial succinate productivity
[0178] US20140212935 Short chain fatty acids from bacteria
[0179] US20140193867 Microbial odd chain fatty acids
[0180] U.S. Pat. No. 8,709,753 Native NAD-dependent GAPDH replaced with NADP-dependent GAPDH plus NADK
[0181] US20140093921 Bacteria and method for synthesizing fatty acids
[0182] U.S. Pat. No. 8,486,686 Large scale microbial culture method
[0183] U.S. Pat. No. 8,236,525 Reduced phosphotransferase system activity in bacteria
[0184] U.S. Pat. No. 7,901,924 Increased bacterial CoA and acetyl-CoA pools
[0185] U.S. Pat. No. 7,709,261 Recycling system for manipulation of intracellular NADH availability